USP5 Regulates Ferroptosis in Colorectal Cancer by Targeting the YBX3/SLC7A11 Axis Through Lysosomal Degradation

preprint OA: closed
Full text JSON View at publisher
Full text 163,899 characters · extracted from preprint-html · click to expand
USP5 Regulates Ferroptosis in Colorectal Cancer by Targeting the YBX3/SLC7A11 Axis Through Lysosomal Degradation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article USP5 Regulates Ferroptosis in Colorectal Cancer by Targeting the YBX3/SLC7A11 Axis Through Lysosomal Degradation Guoqing Li, Haowen Qiu, Yi Liu, Haimeng Zhou, Lingjuan Hu, Wei Qi, and 11 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6569374/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 10 Nov, 2025 Read the published version in Cell Death & Disease → Version 1 posted 9 You are reading this latest preprint version Abstract Colorectal cancer(CRC)is the third most common malignant tumor globally and has become a major public health issue, posing a severe threat to human health. Ferroptosis, an iron-dependent form of regulated cell death, has emerged as a promising therapeutic target in CRC treatment. Despite its significant clinical potential, the precise regulatory mechanisms underlying ferroptosis, particularly its role in ferroptosis within CRC, remain to be fully elucidated. Previous studies, including our own work, have revealed that various deubiquitinases (DUBs) are involved in regulating cellular processes; however, the specific mechanisms by which these enzymes contribute to ferroptosis in CRC remain unclear. In this study, we identify USP5 as a key regulator of ferroptosis in CRC. Traditionally recognized as a deubiquitinase, USP5 modulates cellular physiological activities through deubiquitination. However, our findings show that USP5, distinct from its conventional deubiquitination function, suppresses ferroptosis by promoting the lysosomal degradation of YBX3 (Y-box binding protein 3). Under normal conditions, YBX3 facilitates the degradation of SLC7A11 (solute carrier family 7 member 11), whereas USP5 mediates YBX3 degradation, thereby stabilizing SLC7A11, enhancing CRC cell survival, and promoting tumor progression. In patient-derived organoid and xenograft models, USP5 knockout significantly increased the sensitivity of cancer cells to ferroptosis and inhibited tumor growth. Moreover, additional knockout of YBX3 restored the stability of SLC7A11, highlighting the complex regulatory network between USP5, YBX3, and SLC7A11. Systematic functional assays and mechanistic studies further confirmed that the USP5/YBX3/SLC7A11 axis is a central pathway for ferroptosis resistance in CRC. These findings offer new insights into therapeutic strategies for CRC, particularly in the context of ferroptosis-targeting therapies. Biological sciences/Cancer/Oncogenes Biological sciences/Cell biology/Cell death USP5 YBX3 ferroptosis lysosome degradation colorectal cancer Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Colorectal cancer (CRC) is a commonly diagnosed malignancy worldwide and ranks as the second leading cause of cancer-related deaths globally, and poses a major public health threat[1-3]. According to the latest statistics from 2024, China reports around 510,000 new CRC cases and approximately 240,000 deaths each year[4]. In the United States, there are an estimated 152,810 new CRC cases in 2024, resulting in about 53,010 deaths[1]. Current treatment options for CRC include chemotherapy, radiotherapy, immunotherapy, and surgery[5-7]. However, these treatments face significant challenges such as recurrence, drug resistance, and adverse effects, highlighting the urgent need for more effective therapeutic strategies[8, 9]. Ferroptosis is a distinct form of regulated cell death characterized by iron-dependent lipid peroxidation and resultant oxidative damage to cellular membranes[10]. This process is initiated through intracellular iron-catalyzed lipid peroxidation and is morphologically defined by mitochondrial shrinkage and the reduction or loss of cristae structure[11-14]. Unlike apoptosis and necrosis, ferroptosis is orchestrated by cellular metabolic activity, redox equilibrium, and iron homeostasis[15, 16]. Central regulators of this pathway include glutathione peroxidase 4 (GPX4) and the cystine/glutamate antiporter system Xc⁻, particularly its subunit SLC7A11[17, 18]. The role of ferroptosis in cancer biology extends beyond its intrinsic cytotoxicity toward malignant cells[19, 20]. While the induction of ferroptosis may suppress tumor progression, paradoxically, it may also facilitate cancer development under specific microenvironmental conditions [21, 22]. For instance, DHPO, an allosteric covalent inhibitor of USP7, has been shown to inhibit gastric cancer proliferation and metastasis both in vitro and in vivo by downregulating stearoyl-CoA desaturase (SCD) and promoting ferroptosis[23]. Conversely, circPIAS1 has been found to suppress ferroptosis by competitively binding to miR-455-3p, thereby upregulating Nuclear Protein 1 (NUPR1), which facilitates the growth and metastatic potential of hepatocellular carcinoma (HCC)[24]. Emerging evidence suggests that CRC cells often exhibit elevated intracellular iron levels and dysregulated lipid metabolism, rendering them particularly susceptible to ferroptosis induction[25, 26]. This unique vulnerability highlights ferroptosis as a promising therapeutic target, especially in the context of drug-resistant CRC[27, 28]. Ubiquitination is a critical post-translational modification that regulates numerous cellular functions, particularly protein degradation and stabilization[13, 29]. Ubiquitin-specific peptidase 5 (USP5), a member of the deubiquitinating enzyme (DUB) family, primarily functions to deubiquitinate substrate proteins, thereby modulating essential biological processes such as proteostasis[30-33]. Recent studies have demonstrated that USP5 expression is significantly upregulated in breast cancer cells, where it promotes cell proliferation and migration, potentially through the stabilization of HIF-2α[34]. In non-small cell lung cancer, USP5 has been implicated in enhancing cellular proliferation and resistance to apoptosis by stabilizing PD-L1[35]. Similarly, in bladder cancer, elevated USP5 expression facilitates tumor progression via stabilization of c-Jun[36]. Beyond its canonical role in ubiquitin processing, USP5 is also involved in cellular stress responses independent of its deubiquitinase activity[30, 37, 38]. Moreover, it plays a pivotal role in DNA damage repair and the maintenance of genomic stability, indirectly contributing to tumor cell survival and chemoresistance[39-41]. In CRC, iron metabolism is frequently dysregulated[42]. Inducing ferroptosis can enhance cancer cell death, whereas inhibiting ferroptosis contributes to resistance against chemotherapeutic agents[43, 44]. Investigating the interplay between deubiquitinating enzymes (DUBs) and ferroptosis in CRC may offer valuable insights into cancer progression and therapeutic vulnerabilities[45, 46]. The role of USP5 in regulating protein turnover and stability is crucial for cellular homeostasis, influencing multiple cellular processes[33]. Our findings confirm that USP5 does not carry out its traditional function as a deubiquitinating enzyme in the regulation of CRC initiation and progression. Instead, it facilitates the lysosomal degradation of YBX3 (Y-box binding protein 3), and through the USP5/YBX3/SLC7A11 axis, it modulates CRC progression by coordinating autophagy and ferroptosis. Result USP5 knockout sensitizes CRC cells to ferroptosis To investigate the role of deubiquitination in the regulation of ferroptosis in CRC we systematically screened 108 deubiquitinases (DUBs) to identify key regulatory factors and elucidate their underlying mechanisms. Two pairs of sgRNAs were designed for each DUB, and corresponding CRISPR-Cas9 vectors were constructed to establish a comprehensive knockout library. These vectors were transfected into CRC cell lines, generating 108 individual knockout lines that collectively constituted a complete DUB knockout panel.Both control and DUB-deficient cell lines were treated with the ferroptosis inducer erastin, and cell viability was assessed to identify candidates whose deletion significantly impaired cell survival (Fig. 1 A). This screen identified USP5 as a potential negative regulator of ferroptosis. Western blot analysis revealed that USP5 expression was markedly upregulated in most CRC cell lines compared to the normal colorectal epithelial cell line NCM460 (Fig. 1 B). To further investigate its role, we established USP5-overexpressing and USP5-knockout models in HCT116 and HCT15 cells (Fig. 1 C). Functional assays demonstrated that USP5 knockout sensitized CRC cells to ferroptosis, as indicated by a significant reduction in cell viability after 72 hours of erastin treatment, confirmed by both microscopy and CCK-8 assays (Fig. 1 D-G, Supplementary Fig. S1 A-D). In contrast, USP5 overexpression conferred resistance to ferroptosis. Mechanistically, flow cytometric analysis showed that USP5 deficiency led to increased lipid peroxidation and accumulation of intracellular lipid reactive oxygen species (ROS) following erastin treatment (Fig. 1 H, I). Conversely, USP5 overexpression reduced these effects by lowering lipid ROS levels (Fig. 1 J, K). Transmission electron microscopy revealed classical ferroptotic ultrastructural changes in USP5-knockout cells, including rupture of the outer mitochondrial membrane, reduced mitochondrial volume, and loss or disorganization of cristae (Fig. 1 L). Moreover, FerroOrange staining confirmed marked ferrous iron (Fe²⁺) accumulation in USP5-deficient cells, further exacerbating ferroptotic cell death (Fig. 1 M). Collectively, these findings identify USP5 as a critical negative regulator of ferroptosis in CRC. Its loss promotes ferroptotic sensitivity through enhanced lipid peroxidation, mitochondrial damage, and iron overload. USP5 promotes the development and progression of CRC To elucidate the role of USP5 in CRC, we conducted comprehensive bioinformatics analyses to examine its expression profile. Data from The Cancer Genome Atlas (TCGA) revealed that USP5 is broadly overexpressed across various cancer types, including CRC, with elevated levels observed in both tumor tissues and adjacent non-tumor tissues (Fig. 2 A-C). Analysis of 12 paired CRC tumor and adjacent normal tissues further confirmed significantly higher USP5 expression in most tumor samples (Fig. 2 D, E). Immunohistochemistry (IHC) analysis demonstrated markedly increased USP5 expression in tumor tissues compared to adjacent normal tissues. Notably, Ki-67, a marker of cellular proliferation, was also elevated in tumor sections (Fig. 2 F). Histopathological assessment using hematoxylin and eosin (H&E) staining revealed malignant features in tumor tissues, including disorganized architecture and increased cellularity (Fig. 2 G). Functional assays provided further evidence for the oncogenic role of USP5. Transwell migration assays showed that USP5 overexpression significantly promoted cell migration (Fig. 2 H, I). Cell proliferation, measured using the CCK-8 assay, indicated that elevated USP5 expression significantly enhanced CRC cell growth (Supplementary Fig. S2 A, B). Similarly, colony formation assays confirmed that USP5 overexpression markedly increased the proliferative capacity of CRC cells, underscoring its tumor-promoting function in colorectal carcinogenesis (Fig. 2 J, K). Notably, treatment of USP5-knockout cell lines with the ferroptosis inhibitor ferrostatin-1 (fer-1) partially restored their growth, suggesting that USP5 may regulate CRC cell proliferation, at least in part, by modulating ferroptosis-related pathways (Supplementary Fig. S2 C). These findings highlight the critical role of USP5 in promoting CRC cell proliferation, migration, and overall tumor progression. USP5 regulates ferroptosis by stabilizing SLC7A11 To delineate the mechanism by which USP5 regulates ferroptosis, we examined key components of the ferroptotic pathway in both USP5-knockout and USP5-overexpressing cells. The expression of SLC7A11, a core subunit of the cystine/glutamate antiporter system Xc⁻, was significantly modulated following USP5 alteration, a trend consistently observed across multiple cell lines (Fig. 3 A, B). In 293T cells, dose-dependent transfection with Flag-tagged USP5 resulted in a progressive increase in SLC7A11 protein levels, indicating that USP5 promotes SLC7A11 accumulation (Fig. 3 C). In patient-derived CRC samples, tumors with high USP5 expression displayed significantly elevated SLC7A11 levels (Fig. 3 D). TCGA analysis further confirmed that SLC7A11 is upregulated in both colon and rectal cancers and revealed a strong positive correlation between USP5 and SLC7A11 expression (Fig. 3 F). Cycloheximide (CHX) chase assays demonstrated that USP5 overexpression delayed CHX-induced degradation of SLC7A11, suggesting that USP5 stabilizes the SLC7A11 protein (Fig. 3 G). To assess functional relevance, we reintroduced SLC7A11 into USP5-deficient cells. Western blot analysis confirmed partial restoration of SLC7A11 expression (Fig. 3 H). Upon treatment with erastin and the ferroptosis inhibitor fer-1, SLC7A11 overexpression significantly attenuated USP5-mediated lipid ROS accumulation and ferroptotic cell death, as determined by flow cytometry and CCK-8 assays (Fig. 3 I, J). These findings identify USP5 as a negative regulator of ferroptosis through stabilization of SLC7A11, thereby supporting CRC cell survival and tumor progression. USP5 promotes lysosomal degradation of YBX3 To elucidate the mechanism by which USP5 regulates ferroptosis, we first identified SLC7A11 as a potential downstream target through preliminary experimental screening. However, co-immunoprecipitation (Co-IP) analysis revealed that USP5 does not directly interact with SLC7A11 (Supplementary Fig. S3 A). To further explore the regulatory network, we performed silver staining followed by mass spectrometry, which identified YBX3 as a novel interacting protein of USP5 (Fig. 4 A). The interaction between USP5 and YBX3 was validated through exogenous co-expression of Flag- and HA-tagged constructs, as well as endogenous Co-IP assays in HCT116 cells, confirming a robust and specific association (Fig. 4 B, C). Domain-mapping experiments indicated that all functional domains of USP5 are capable of binding to YBX3 (Supplementary Fig. S3 B). To investigate the regulatory impact of USP5 on YBX3 expression, dose-dependent co-transfection experiments in 293T cells demonstrated that increasing USP5 expression resulted in a progressive reduction in YBX3 protein levels, suggesting that USP5 promotes YBX3 degradation (Fig. 4 D). Consistently, endogenous USP5 knockout led to a marked upregulation of YBX3, whereas overexpression suppressed its levels, further supporting a negative regulatory role of USP5 on YBX3 (Fig. 4 E, F). Cycloheximide (CHX) chase assays revealed that USP5 shortens the half-life of YBX3 and accelerates its degradation (Fig. 4 G, Supplementary Fig. S3 C). Notably, both wild-type USP5 and its catalytically inactive mutant (C335A, in which the catalytic cysteine at position 335 is substituted with alanine) promoted YBX3 degradation, indicating that this regulatory effect is independent of USP5's canonical deubiquitinase activity (Fig. 4 G, H). Co-IP assays confirmed that both wild-type and mutant USP5 retain their ability to interact with YBX3, further demonstrating that enzymatic activity is not required for this interaction (Fig. 4 I). Additionally, ubiquitin immunoprecipitation (IP) assays showed no significant differences in YBX3 ubiquitination levels between cells expressing wild-type and mutant USP5, suggesting that USP5 does not modulate YBX3 degradation through a ubiquitin-dependent mechanism (Fig. 4 J). To define the degradation pathway, cells were treated with the proteasome inhibitor MG132 or the lysosome inhibitor chloroquine (CQ). Only CQ treatment restored YBX3 protein levels, indicating that USP5 mediates YBX3 degradation via the lysosomal pathway (Fig. 4 K). Furthermore, knockdown of ATG5, a core autophagy-related gene, rescued YBX3 levels in USP5-overexpressing cells (Fig. 4 L). Immunofluorescence analysis further revealed that USP5 promotes the co-localization of YBX3 with lysosomes, reinforcing the conclusion that YBX3 is degraded through the lysosomal pathway in a USP5-dependent manner (Fig. 4 M). These findings identify YBX3 as a novel downstream effector of USP5 and reveal a non-canonical, lysosome-mediated mechanism by which USP5 regulates ferroptosis. YBX3 regulates the stability of SLC7A11 and modulates ferroptosis sensitivity in a USP5-dependent manner. Building upon previous findings, this study further investigated the relationship between YBX3 and SLC7A11 to elucidate the role of YBX3 in ferroptosis regulation. Co-immunoprecipitation (Co-IP) assays using ectopically expressed HA-YBX3 and Myc-SLC7A11 revealed a physical interaction between the two proteins (Fig. 5 A). High-content immunofluorescence imaging in HCT116 cells further demonstrated their co-localization, supporting the existence of an intracellular interaction (Fig. 5 B). To explore the regulatory impact of YBX3 on SLC7A11 expression, we performed dose-dependent co-transfection assays. Increasing amounts of HA-YBX3 plasmid led to a progressive reduction in Myc-SLC7A11 protein levels, indicating that YBX3 promotes SLC7A11 degradation (Fig. 5 C). Cycloheximide (CHX) chase assays further confirmed that overexpression of YBX3 significantly accelerated SLC7A11 degradation (Fig. 5 D). To dissect the degradation pathway involved, HCT116 cells overexpressing HA-YBX3 were treated with either the proteasome inhibitor MG132 or the lysosomal inhibitor chloroquine (CQ). Notably, CQ treatment—but not MG132—restored SLC7A11 protein levels, suggesting that YBX3 facilitates lysosome-dependent degradation of SLC7A11 (Fig. 5 E). The biological relevance of this regulatory axis was examined in USP5 knockout cells. Knockdown of YBX3 (shYBX3) in this context markedly restored SLC7A11 protein levels compared to USP5 knockout alone (Fig. 5 F). In HCT116 cells overexpressing USP5, transient expression of HA-YBX3 reversed the USP5-mediated stabilization of SLC7A11, further confirming the antagonistic role of YBX3 (Fig. 5 G). Functional assays revealed that YBX3 knockdown significantly rescued the ferroptosis sensitivity of USP5-deficient cells, as demonstrated by improved cell viability upon Erastin treatment (Fig. 5 H). Consistently, BODIPY-C11 staining coupled with flow cytometry showed reduced lipid ROS accumulation in the double-knockdown group, highlighting YBX3’s role in promoting ferroptosis (Fig. 5 I). Conversely, in USP5-overexpressing cells, reintroduction of YBX3 impaired the protective effect of USP5, as indicated by reduced cell viability (Fig. 5 J) and enhanced lipid peroxidation upon Erastin exposure (Fig. 5 K). Collectively, these findings demonstrate that YBX3 negatively regulates SLC7A11 through lysosome-mediated degradation, and highlight the critical role of the USP5–YBX3–SLC7A11 axis in orchestrating ferroptosis by modulating SLC7A11 stability, cell viability, and lipid ROS accumulation. Organoid and Xenograft models confirm USP5's role in regulating ferroptosis and CRC progression To explore the role of USP5 in patient-derived CRC tissues and its influence on ferroptosis in a clinically relevant context, we established CRC organoids from primary tumor samples of a CRC patient. These organoids, which retain the genetic, molecular, and phenotypic features of the original tumor, provide a robust ex vivo platform to assess the functional impact of USP5 depletion on ferroptosis susceptibility and tumor growth dynamics. Using CRISPR/Cas9 gene-editing technology, we generated USP5-knockout (sgUSP5) organoids, with successful depletion of USP5 confirmed by Western blot analysis (Fig. 6 A). Growth assays revealed that loss of USP5 markedly impaired organoid proliferation relative to control organoids (sgCtrl) (Fig. 6 B). Erastin sensitivity was assessed by determining the half-maximal inhibitory concentration (IC₅₀), followed by treatment with 15 µM erastin for 72 hours. sgUSP5 organoids displayed significantly decreased Calcein-AM staining (viable cell marker), increased propidium iodide (PI) staining (cell death marker), and markedly reduced ATP levels compared to controls, indicating enhanced ferroptotic cell death (Fig. 6 C-E). To evaluate the physiological relevance of USP5-mediated ferroptosis regulation in vivo, we employed a xenograft tumor model. Nude mice were subcutaneously injected with sgCtrl HCT116, sgUSP5 HCT116, and sgUSP5 HCT116 cells with stable knockdown of YBX3 (shYBX3). Each group was further subdivided for treatment with vehicle control (DMSO) or fer-1 (0.5 mg/mL, administered biweekly for 3 weeks post-tumor establishment) (Fig. 6 F). Tumor volumes were monitored throughout the experiment, and excised tumors were weighed at the endpoint (Fig. 6 G-I). Notably, fer-1 treatment significantly restored tumor volume and mass in the sgUSP5 group, suggesting that ferroptosis inhibition rescued the growth-suppressive effects induced by USP5 deletion. Correspondingly, Western blot analysis revealed reactivation of SLC7A11 expression in tumors from the Fer-1-treated sgUSP5 group (Fig. 6 J). Collectively, these findings demonstrate that USP5 depletion sensitizes CRC cells to ferroptosis and suppresses tumor progression in both patient-derived organoid and in vivo xenograft models, highlighting the USP5/YBX3-ferroptosis axis as a potential therapeutic target in CRC. Discussion Ferroptosis is a new breakthrough in cancer therapy, and its occurrence significantly affects the physiological activity of cancer cells. Previous studies have shown that USP5 can target LSH to resist ferroptosis in liver cancer cells and promote the malignant transformation of tumors[ 44 ]. This study systematically investigates the role of USP5 in the progression of CRC and suggests that USP5 regulates ferroptosis resistance in CRC by lysosome-dependent degradation of YBX3, which in turn stabilizes the expression of SLC7A11. Although USP5 is widely recognized as a typical oncogene, its function and significance in CRC are yet to be clarified. In this study, we systematically screened 108 deubiquitinases (DUBs) and identified USP5 as a key regulatory factor of ferroptosis in CRC cells. Our research positions USP5 as a molecular regulator that balances cell survival and ferroptosis in CRC cells. Previous studies have indicated that USP5 plays an important role in cancer progression. For example, in breast cancer, USP5 promotes tumor progression by stabilizing HIF-2α, while in non-small cell lung cancer, USP5 enhances immune escape through PD-L1, promoting cancer development[ 34 , 35 ]. Furthermore, unlike other DUBs[ 23 , 47 ], the deletion of USP5 significantly increased lipid peroxidation, mitochondrial membrane rupture, and Fe²⁺ accumulation when treated with erastin, suggesting that USP5 regulates ferroptosis through a specific mechanism in CRC cells. The high expression of USP5 in CRC tissues and its role in promoting cell proliferation and migration indicate its multifunctional oncogenic properties. Notably, the ferroptosis inhibitor fer-1 partially restores cell growth in USP5 knockout cells, suggesting that USP5 not only acts through classical oncogenic pathways but also regulates the balance between tumor cell survival and death by modulating ferroptosis [ 34 , 36 ]. Traditionally, DUBs stabilize substrate proteins through deubiquitination[ 48 ]. For example, MSK1 increases Snail protein stability through USP5-mediated deubiquitination of Snail, promoting CRC metastasis[ 49 ]. Studies have also shown that USP5 can promote the K48-linked polyubiquitination of NLRP3 via recruitment of the E3 ligase MARCHF7 and mediate its degradation in autophagy, inhibiting the inflammasome signaling pathway[ 50 ]. This study further confirms the regulatory role of USP5 in autophagy. It is worth noting that the functional studies of USP5 are rapidly expanding, with its regulatory network involving DNA repair, inflammation, tumorigenesis, neurodegenerative diseases, and other areas[ 35 ]. By dynamically balancing the stability and degradation of substrate proteins, USP5 reveals its multifunctional regulatory hub role in complex pathological networks such as cancer and inflammation, providing new perspectives for disease-targeted therapy. YBX3 is involved in cellular stress responses and gene regulation, playing a crucial role in modulating key signaling pathways and stress-related mechanisms[ 51 , 52 ]. In hepatocellular carcinoma (HCC), YBX3 promotes tumor growth by enhancing cell survival under stress conditions through the regulation of oxidative stress responses and metabolic reprogramming.[ 53 , 54 ]. Closely associated with cell death mechanisms like autophagy, YBX3 also influences chemoresistance in breast cancer by affecting autophagy-related pathways. [ 55 , 56 ]. SLC7A11, as the core subunit of the system Xc⁻, plays a pivotal role in determining a cell's sensitivity to ferroptosis[ 17 ]. It is noteworthy that ferroptosis has a dual role in various cancer types: it can inhibit tumor growth through its cytotoxic effects or promote tumor survival through adaptive responses[ 16 , 19 , 57 – 59 ]. Dysregulation of iron metabolism is common in CRC, making cancer cells more sensitive to ferroptosis[ 60 – 62 ]. This study found that USP5 stabilizes SLC7A11 and enhances its protein levels. Importantly, USP5’s regulation of SLC7A11 does not depend on direct interaction, but rather occurs indirectly through the downstream effector molecule YBX3. In contrast, in liver cancer, USP5 stabilizes SLC7A11 through deubiquitination[ 44 ]. This study reveals a mechanism by which USP5 regulates SLC7A11 independently of the ubiquitin system, expanding the regulatory network of SLC7A11 and further highlighting the heterogeneity of DUB functions in different cancers. Moreover, the positive correlation between USP5 and SLC7A11 provides theoretical support for clinical combination therapies (erastin and USP5 inhibitors). The interaction and co-localization of YBX3 and SLC7A11 establish the link between YBX3 and the regulation of ferroptosis. Unlike the mechanism in liver cancer where circPIAS1 inhibits ferroptosis through the miR-455-3p/NUPR1 axis, YBX3 directly targets SLC7A11 and destabilizes it through lysosomal degradation[ 24 ]. In the context of USP5 knockout, silencing YBX3 restores SLC7A11 levels and rescues ferroptosis resistance, suggesting a strict hierarchical regulatory relationship within the USP5/YBX3/SLC7A11 axis. Patient-derived organoids and xenograft models confirmed that USP5 knockout significantly inhibits tumor growth and enhances ferroptosis sensitivity, with fer-1 partially reversing this effect. These results resemble the efficacy of ferroptosis therapies targeting LSH in liver cancer and GPX4 inhibitors in glioma, yet the regulatory mechanism of the USP5/YBX3 axis is more specific[ 19 , 44 ]. Furthermore, the downregulation of SLC7A11 caused by USP5 loss suggests its potential as a biomarker for predicting the efficacy of ferroptosis inducers. Compared to traditional chemotherapy, inhibitors targeting the USP5/YBX3 interaction or the lysosomal pathway may reduce systemic toxicity, providing a new approach for the precision treatment of CRC. In conclusion, this study reveals the unique mechanism of the USP5/YBX3/SLC7A11 axis in regulating ferroptosis in CRC through multidimensional comparisons: USP5 stabilizes SLC7A11 by degrading YBX3 via the lysosomal pathway, balancing autophagy and ferroptosis(Figure 7 ). Compared to other cancers, USP5’s function shifts from relying on ubiquitination to utilizing the lysosomal pathway, and YBX3 transitions from a pro-survival factor to a ferroptosis-sensitive factor. These findings not only expand our understanding of the functional diversity of DUBs but also lay the theoretical foundation for the development of novel therapies targeting the lysosomal-ferroptosis axis. Future research should further explore whether YBX3 is influenced by other molecular chaperones or regulatory factors, and investigate the structural basis of the USP5/YBX3 interaction and its dynamic regulation in the tumor microenvironment to promote clinical translation. Materials and Methods Reverse transcription Total RNA was isolated from cells using Trizol reagent (Invitrogen, #15596-018CN) according to the manufacturer’s instructions. RNA was reverse transcribed into cDNA using the 1st Strand cDNA Synthesis Kit with gDNA wiper (Vazyme, #R312-01). Primers in PCR All oligonucleotides, including PCR primers and shRNAs, were chemically synthesized by Tsingke Biotechnology (Beijing, China) using solid-phase phosphoramidite chemistry with HPLC purification (purity > 98%). USP5 sgRNA1 Forward: caccgTGTCAGTATTACCGACGATC USP5 sgRNA1 Reverse: aaacGATCGTCGGTAATACTGACAc USP5 sgRNA2 Forward: caccgTGGGCTTACCGGCGTGTCGA USP5 sgRNA2 Reverse: aaacTCGACACGCCGGTAAGCCCAc ATG5 sgRNA1 Forward: aaacTCAATCGGAAACTCATGGAAc ATG5 sgRNA1 Reverse: caccgTTCCATGAGTTTCCGATTGA ATG5 sgRNA2 Forward: caccgCCCTTTAGAATATATCAGGT ATG5 sgRNA2 Reverse: aaacACCTGATATATTCTAAAGGGc USP5 Forward: cgACGCGTATGGCGGAGCTGAGT USP5 Reverse: ccgCTCGAGGCTGGCCACTCT USP5- C335A Forward: CTGGGTAACAGCgcCTACCTCAACTCTGT USP5- C335A Reverse: AGAGTTGAGGTAGgcGCTGTTACCCAGGT USP5 C-ZnF Reverse: ccgctcgagTGCCTGCACCTCCTG USP5 ZnF Forward: cgACGCGTATGTGGGATGGGGAAGTA USP5 ZnF Reverse: ccgctcgagTGTCTTCTGCATCTT USP5 C Box Forward: cgACGCGTATGGACAAGACGATGACT USP5 C Box Reverse: ccgctcgagCGGAGTGACCAGGGG USP5 U BA1 Forward: cgACGCGTATGGATGAGCCCAAAGGT USP5 U BA1 Reverse: cgACGCGTATGGATGAGCCCAAAGGT USP5 H Box Forward: cgACGCGTATGGACATCTCAGAGGGC YBX3 shRNA1 Forward: CCGGCGGTTCATCGAAATCCAACTTCTCGAGAAGTTGGATTTCGATGAACCGTTTTT YBX3 shRNA1 Reverse: AATTCAAAAACGGTTCATCGAAATCCAACTTCTCGAGAAGTTGGATTTCGATGAACCG YBX3 shRNA2 Forward: CCGGCCGTCTGTTCGCCGTGGATATCTCGAGATATCCACGGCGAACAGACGGTTTTTG YBX3 shRNA2 Reverse: AATTCAAAAACCGTCTGTTCGCCGTGGATATCTCGAGATATCCACGGCGAACAGACGG Plasmisd Plasmids encoding HA-tagged SLC7A11 (HA-SLC7A11) and HA-tagged YBX3 (HA-YBX3) were purchased from Miaoling Bioscience. Full-length, truncated, and deletion mutants of Flag-tagged USP5, as well as MYC-tagged SLC7A11 (MYC-SLC7A11), were constructed using standard molecular biology techniques. Chemicals and reagents Erastin (Selleck, S7242), Ferrostatin-1 (MedChemExpress, S7243), CHX (MedChemExpress, HY-12320), CQ (MedChemExpress, HY-17589A), FerroOrange (Cell Signaling Technology 36104S), LysoTracker™ Probe (Maokangbio Company, MX4319-50UL), MG132 (Selleck, S2619), Protein A/G Beads 4FF (Smart-Lifesciences, SA032025). Co-immunoprecipitation and western blot analyses Cells were harvested in NP40 lysis buffer containing 150 mM NaCl, 50 mM Tris-HCl pH 8.0, 1% NP40 supplemented with protease inhibitors (10 µg/mL aprotinin, 10 µg/mL leupeptin, and 1 mM phenylmethylsulfonyl fluoride), and the lysates were centrifuged at high speed to remove insoluble debris. Then, the proteins were incubated with indicated antibodies together with Protein A/G beads (Roche) for overnight at 4°C. And the beads were washed with IP wash buffer (200 mM NaCl, 50 mM Tris-HCl pH 8.0, 0.1% NP40) for three time and boiled with 1× SDS loading buffer. The interacted proteins were detected using indicated primary antibodies. The primary antibodies used for western blot analysis are as follows: anti-USP5 (Proteintech, 10473-1-AP;1;3000), anti-YBX3 (Bethyl, A303-070A-T;1:2000), anti-SLC7A11 (Cell Signaling Technology, 98051;1:3000), anti-β-tubulin (Cell Signaling Technology, 2146;1:5000), anti-Flag (Smart-Lifesciences, SLAB0102;1: 5000), anti-HA (Smart-Lifesciences, SLAB0202;1:5000), anti-Myc (Abclonal, AE010;1:5000), anti-ATG5(Cell Signaling Technology, 12994;1:3000) Cell culture and transfection The RKO, LoVo, HCT116, NCM460, HCT15, SW48, DLD1, SW480, HT29, and HEK293T cell lines were obtained from the China Center for Type Culture Collection (CCTCC). Cells were maintained under the culture conditions recommended by the supplier, which included appropriate growth media and incubation parameters. All cells were cultured at 37°C in Dulbecco’s Modified Eagle Medium (DMEM) with 10% fetal bovine serum (FBS) and 1% antibiotic (penicillin-streptomycin). FreeStyle™ Max DNA in vitro transfection reagent (Signagen) was used for transfection. The FreeStyle™ Max reagent and DNA (1:2 ratio) were mixed and diluted in serum free DMEM for 10 ~ 15 min at room temperature. The FreeStyle™ Max-DNA mixture was then added to the subconfluent cell culture for cell transfection. Mice For xenograft tumor growth assays, female BALB/c nude mice aged 5–6 weeks were utilized. All procedures involving animals adhered to the guidelines outlined in the Guide for the Care and Use of Laboratory Animals and were approved by the Institutional Animal Care and Use Committee of University of south China. Cell viability and colony formation assay For the CCK-8 assay, cells were plated in 96-well plates at an initial density of 1 × 10³ cells per well. On days 1–6, CCK-8 solution (Dojindo Laboratories, Kumamoto, Japan) was added to each well and incubated at 37°C for 1 hour. Cell viability was subsequently quantified by measuring absorbance at 450 nm using a spectrophotometer (ELx800, BioTek, USA). For the colony formation assay, cells were seeded in six-well plates at a density of 500 cells per well and cultured for 14 days or at 250 cells per well for 7 days. Colonies were then stained using crystal violet, followed by imaging for analysis. Xenograft tumor growth model A total of 5 × 10 6 HCT116 cells suspended in 200 µL of saline were subcutaneously injected into the dorsal flanks of mice. Tumor growth was monitored starting on day 5 post-inoculation, with measurements taken every two days along two perpendicular axes using a vernier caliper. Two weeks after inoculation, tumors were excised, weighed, and recorded following the euthanasia of the animals. For the drug administration study in vivo, mice were divided into two treatment groups: DMSO, fer-1. In the DMSO group, DMSO was diluted with 90% PBS; in the fer-1 group, 540 µL of fer-1 stock solution was taken, and 21,600 µL of PEG300, 2,700 µL of Tween 80, and 29160 µL of saline were added to dilute it to 0.5 mg/mL. All solutions were administered via intraperitoneal injection twice a week at the specified concentration. After three weeks of treatment, the mice were sacrificed, and subcutaneous tumors were isolated for further analysis. All solutions were administered via intraperitoneal injection at the specified concentrations twice a week. After three weeks of treatment, the mice were sacrificed, and the subcutaneous tumors were isolated for subsequent analyses. Lipid Reactive Oxygen Species assay C11-BODIPY 581/591 (Thermo Fisher, D3861) was used to detect lipid peroxide levels. Cells were resuspended in PBS and incubated with the above probes at 37°C for 30 minutes, followed by analysis using flow cytometry (BeamCyte, FL-1026). Data analysis was performed with FlowJo software. Ferrous iron detection FerroOrange (Dojindo, F374) was used to assess intracellular Fe 2+ levels. Cells were cultured in a 96-well plate. After drug treatment, the supernatant was discarded. A working solution of FerroOrange at a concentration of 1 µmol/L was added, and the cells were incubated for 15 minutes in a 37°C incubator. Images were captured using the automated cell imaging system (ImageXpress Pico). Transmission electron microscopy HCT116 sgCtrl or HCT116 sgUSP5 cells (1 × 10 6 ) were plated in 10 cm dishes. After 72 hours of treatment with DMSO or erastin, the cells were fixed using 3 mL of 2.5% glutaraldehyde at room temperature for 1 h. The cells were then centrifuged sequentially at 1000g, 3000g, 6000g, and 12000g for 5 minutes each and collected. Next, osmium tetroxide staining was performed on ice for 1 h in the dark. Following staining, cells were washed with uranyl acetate and incubated overnight at room temperature in darkness. After rinsing with ddH2O, ethanol gradient dehydration was applied. The dehydrated samples were then incubated in propylene oxide and resin mixtures at 1:1 and 1:2 ratios, followed by immersion in 100% resin for 4 h. The samples were subsequently placed in plastic molds and allowed to cure at 37°C overnight. At last, the samples were placed in a 65°C oven for 48 h. Ultrathin sections were prepared, and the samples were subsequently examined using electron microscopy. Immunofluorescence After transfection with Flag-USP5 and HA-YBX3 for 48 hours, the cells were stained with LysoTracker TM DeepRed (70 nM) at 37°C for 1 hour. After washing three times with PBS, the cells were fixed with 4% paraformaldehyde for 15 minutes and permeabilized with 0.5% Triton X-100 for 10 minutes. Subsequently, the cells were blocked at room temperature for 1 hour using blocking solution (0.3 g BSA + 10 mL PBS + 1 mL 0.5% Triton X-100) and incubated with primary antibodies (Flag, HA) overnight. The next day, the cells were incubated with secondary antibodies and stained with DAPI. After mounting, images were captured using a laser confocal microscope (Zeiss, LSM980). IP Mass Spectrometry Experiment The IP-MS procedure was performed as follows: Cell lysates were prepared using lysis buffer supplemented with protease inhibitors, followed by sonication to enhance cell disruption. Protein concentration was quantified using either BCA or Bradford assay to ensure sufficient USP5 protein amounts. For proteolytic digestion, quantified USP5 samples were incubated with digestion buffer and trypsin at 37°C for 4h to overnight, with the reaction terminated by adding equal volume of acidic solution (e.g., TFA). Sample purification was conducted using C18 solid-phase extraction columns according to the manufacturer's protocol, including washing and elution steps, with subsequent solvent removal using nitrogen drying or lyophilization to obtain dried peptide samples. For MS analysis, dried peptides were reconstituted in MS-compatible solvent (0.1% FA in water/acetonitrile) and loaded via syringe injection. Mass spectrometer parameters (voltage, gas flow, temperature) were optimized for sample characteristics before data acquisition. Finally, raw data were processed using specialized software (MaxQuant/Mascot/Proteome Discoverer) for peptide identification, USP5 quantification, and subsequent bioinformatic analysis. Ferrous iron detection FerroOrange (Dojindo, #F374) was used to assess intracellular Fe2 + levels. Cells were cultured in a 96-well plate. After drug treatment, the supernatant was discarded. A working solution of FerroOrange at a concentration of 1 µmol/L was added, and the cells were incubated for 15 min in a 37°C incubator. Images were captured using the automated cell imaging system (ImageXpress Pico). Culture of CRC organoids Colorectal tumor tissues were obtained postoperatively and processed in the laboratory. The specimens were initially washed with PBS and then mechanically dissociated into small fragments. These fragments were subsequently digested using Collagenase IV at 37°C for 1 h. The resulting cell suspension was passed through a 40 µm cell strainer to isolate single cells. The isolated cells were resuspended in Matrigel and seeded into 48-well plates. Organoids derived from patient colorectal tumors were cultured in Advanced DMEM/F12 medium (Gibco) supplemented with Primocin (InvivoGen), GlutaMax (Gibco), HEPES (Gibco), B27 (Gibco), N2 supplement (Gibco), SB202190 (MedChemExpress), Y27632 (MedChemExpress), Blebbistatin (MedChemExpress), CHIR99021 (MedChemExpress), A83-01 (Tocris Bioscience), and recombinant human R-Spondin-1 (rhR-Spondin-1; R&D Systems). The cultures were maintained at 37°C in a 5% CO2 atmosphere. Calcein/PI Viability Assay for CRC Organoids CRC organoids were seeded in 96-well plates and treated with DMSO or Erastin for 48 h prior to analysis. Following treatment, a working solution of Calcein AM/Propidium Iodide (PI) was prepared (Beyotime, #C2015M). After discarding the supernatant, 100 µL of the working solution was added to each well, and the plate was incubated at 37°C in the dark for 30 min. After incubation, fluorescence was observed using a fluorescence microscope (Calcein AM: green fluorescence, Ex/Em = 494/517 nm; PI: red fluorescence, Ex/Em = 535/617 nm). ATP Viability Assay for CRC Organoids CRC organoids were seeded in 96-well plates and treated with either DMSO or Erastin for 72 h. After treatment, cell viability was assessed using the Organoid Viability ATP Assay Kit (BioGenous, #E238003). The plate was removed from the incubator and equilibrated to room temperature for 10 min. An equal volume of detection reagent was added to each well (1:1 ratio). The plate was subjected to linear shaking at 1000 rpm for 5 min, followed by incubation at room temperature for 20 min. Chemiluminescence was measured at 560 nm using a microplate reader. Declarations Author contributions Guoqing Li and Xiaodong Zhang are responsible for the conceptualization and funding acquisition; Haowen Qiu is responsible for the Investigation, Methodology, Supervision, Visualization, Writing – original draft; Yi Liu and Haimemg Zhou are responsible for the Writing – review & editing; Lingjuan Hu, Wei Qi, Honglu Ma, Yaoyi Liu and Le Li contributed to project administration; Nanyang Yang, Meiqin Huang and Runlei Du are responsible for the validation; Lijuan Meng, Feng Shi and Baiqi Wang are responsible for the visualization. Funding This work was supported by the National Natural Science Foundation of China (No. 32370777 to Runlei Du), the Natural Science Foundation of Guangxi Province (No. 2024GXNSFAA999020 to Xiaodong Zhang), the Natural Science Foundation of Hunan Province (No. 2021JJ40480 to Guoqing Li, No. 2025JJ50541 to Guoqing Li, No. 2023JJ60049 to Baiqi Wang, No. 2024JJ6379 to Yi Liu), Scientific Research Project of the Hunan Education Department of China (No. 21A0268 to Guoqing Li), and the Fund Project of University of South China (No. 221RGC003 to Xiaodong Zhang). Competing interests The authors declare no competing interests. References Siegel RL, Giaquinto AN, Jemal A. Cancer statistics, 2024. CA Cancer J Clin 2024, 74 (1) : 12-49. Kocarnik JM, Compton K, Dean FE, Fu W, Gaw BL, Harvey JD , et al. Cancer Incidence, Mortality, Years of Life Lost, Years Lived With Disability, and Disability-Adjusted Life Years for 29 Cancer Groups From 2010 to 2019: A Systematic Analysis for the Global Burden of Disease Study 2019. JAMA Oncol 2022, 8 (3) : 420-444. Patel SG, Karlitz JJ, Yen T, Lieu CH, Boland CR. The rising tide of early-onset colorectal cancer: a comprehensive review of epidemiology, clinical features, biology, risk factors, prevention, and early detection. Lancet Gastroenterol Hepatol 2022, 7 (3) : 262-274. Zheng RS, Chen R, Han BF, Wang SM, Li L, Sun KX , et al. [Cancer incidence and mortality in China, 2022]. Zhonghua Zhong Liu Za Zhi 2024, 46 (3) : 221-231. Shin AE, Giancotti FG, Rustgi AK. Metastatic colorectal cancer: mechanisms and emerging therapeutics. Trends Pharmacol Sci 2023, 44 (4) : 222-236. Pomeroy AE, Schmidt EV, Sorger PK, Palmer AC. Drug independence and the curability of cancer by combination chemotherapy. Trends Cancer 2022, 8 (11) : 915-929. Vasan N, Baselga J, Hyman DM. A view on drug resistance in cancer. Nature 2019, 575 (7782) : 299-309. Luo M, Yang X, Chen HN, Nice EC, Huang C. Drug resistance in colorectal cancer: An epigenetic overview. Biochim Biophys Acta Rev Cancer 2021, 1876 (2) : 188623. Oyelere AM, Kok DE, Bos D, Gunter MJ, Ferrari P, Keski-Rahkonen P , et al. Coffee consumption is associated with a reduced risk of colorectal cancer recurrence and all-cause mortality. Int J Cancer 2024, 154 (12) : 2054-2063. Stockwell BR, Friedmann Angeli JP, Bayir H, Bush AI, Conrad M, Dixon SJ , et al. Ferroptosis: A Regulated Cell Death Nexus Linking Metabolism, Redox Biology, and Disease. Cell 2017, 171 (2) : 273-285. Dixon SJ, Lemberg KM, Lamprecht MR, Skouta R, Zaitsev EM, Gleason CE , et al. Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell 2012, 149 (5) : 1060-1072. Yu Y, Yan Y, Niu F, Wang Y, Chen X, Su G , et al. Ferroptosis: a cell death connecting oxidative stress, inflammation and cardiovascular diseases. Cell Death Discov 2021, 7 (1) : 193. Liu Y, Lu S, Wu LL, Yang L, Yang L, Wang J. The diversified role of mitochondria in ferroptosis in cancer. Cell Death Dis 2023, 14 (8) : 519. Hassannia B, Vandenabeele P, Vanden Berghe T. Targeting Ferroptosis to Iron Out Cancer. Cancer Cell 2019, 35 (6) : 830-849. Zheng J, Conrad M. The Metabolic Underpinnings of Ferroptosis. Cell Metab 2020, 32 (6) : 920-937. Jiang X, Stockwell BR, Conrad M. Ferroptosis: mechanisms, biology and role in disease. Nat Rev Mol Cell Biol 2021, 22 (4) : 266-282. Xie Y, Hou W, Song X, Yu Y, Huang J, Sun X , et al. Ferroptosis: process and function. Cell Death Differ 2016, 23 (3) : 369-379. Chen Q, Zheng W, Guan J, Liu H, Dan Y, Zhu L , et al. SOCS2-enhanced ubiquitination of SLC7A11 promotes ferroptosis and radiosensitization in hepatocellular carcinoma. Cell Death Differ 2023, 30 (1) : 137-151. Chen X, Kang R, Kroemer G, Tang D. Broadening horizons: the role of ferroptosis in cancer. Nat Rev Clin Oncol 2021, 18 (5) : 280-296. Zhou X, An B, Lin Y, Ni Y, Zhao X, Liang X. Molecular mechanisms of ROS-modulated cancer chemoresistance and therapeutic strategies. Biomed Pharmacother 2023, 165: 115036. Chen X, Li J, Kang R, Klionsky DJ, Tang D. Ferroptosis: machinery and regulation. Autophagy 2021, 17 (9) : 2054-2081. Ren Y, Mao X, Xu H, Dang Q, Weng S, Zhang Y , et al. Ferroptosis and EMT: key targets for combating cancer progression and therapy resistance. Cell Mol Life Sci 2023, 80 (9) : 263. Guan X, Wang Y, Yu W, Wei Y, Lu Y, Dai E , et al. Blocking Ubiquitin-Specific Protease 7 Induces Ferroptosis in Gastric Cancer via Targeting Stearoyl-CoA Desaturase. Adv Sci (Weinh) 2024, 11 (18) : e2307899. Zhang XY, Li SS, Gu YR, Xiao LX, Ma XY, Chen XR , et al. CircPIAS1 promotes hepatocellular carcinoma progression by inhibiting ferroptosis via the miR-455-3p/NUPR1/FTH1 axis. Mol Cancer 2024, 23 (1) : 113. Wang Y, Zhang Z, Sun W, Zhang J, Xu Q, Zhou X , et al. Ferroptosis in colorectal cancer: Potential mechanisms and effective therapeutic targets. Biomed Pharmacother 2022, 153: 113524. Hua Y, Yang S, Zhang Y, Li J, Wang M, Yeerkenbieke P , et al. Modulating ferroptosis sensitivity: environmental and cellular targets within the tumor microenvironment. J Exp Clin Cancer Res 2024, 43 (1) : 19. Zhang Y, Shi J, Liu X, Feng L, Gong Z, Koppula P , et al. BAP1 links metabolic regulation of ferroptosis to tumour suppression. Nat Cell Biol 2018, 20 (10) : 1181-1192. Friedmann Angeli JP, Krysko DV, Conrad M. Ferroptosis at the crossroads of cancer-acquired drug resistance and immune evasion. Nat Rev Cancer 2019, 19 (7) : 405-414. Sun T, Liu Z, Yang Q. The role of ubiquitination and deubiquitination in cancer metabolism. Mol Cancer 2020, 19 (1) : 146. Ning F, Xin H, Liu J, Lv C, Xu X, Wang M , et al. Structure and function of USP5: Insight into physiological and pathophysiological roles. Pharmacol Res 2020, 157: 104557. Gu J, Chen C, He P, Du Y, Zhu B. Unraveling the Immune Regulatory Functions of USP5: Implications for Disease Therapy. Biomolecules 2024, 14 (6). Hill J, Nyathi Y. USP5 enhances SGTA mediated protein quality control. PLoS One 2022, 17 (7) : e0257786. Chen Y, Xue H, Jin J. Applications of protein ubiquitylation and deubiquitylation in drug discovery. J Biol Chem 2024, 300 (5) : 107264. Huang W, Liu X, Zhang Y, Deng M, Li G, Chen G , et al. USP5 promotes breast cancer cell proliferation and metastasis by stabilizing HIF2α. J Cell Physiol 2022, 237 (4) : 2211-2219. Pan J, Qiao Y, Chen C, Zang H, Zhang X, Qi F , et al. USP5 facilitates non-small cell lung cancer progression through stabilization of PD-L1. Cell Death Dis 2021, 12 (11) : 1051. Zhang HH, Zhang AQ, Peng P, Huang L, Liu CY, Nie XR , et al. USP5 facilitates bladder cancer progression by stabilizing the c-Jun protein. Cancer Cell Int 2024, 24 (1) : 32. Xie X, Matsumoto S, Endo A, Fukushima T, Kawahara H, Saeki Y , et al. Deubiquitylases USP5 and USP13 are recruited to and regulate heat-induced stress granules through their deubiquitylating activities. J Cell Sci 2018, 131 (8). Shi S, Pan X, Chen M, Zhang L, Zhang S, Wang X , et al. USP5 promotes lipopolysaccharide-induced apoptosis and inflammatory response by stabilizing the TXNIP protein. Hepatol Commun 2023, 7 (8). Liu Y, Wang WM, Lu YF, Feng L, Li L, Pan MZ , et al. Usp5 functions as an oncogene for stimulating tumorigenesis in hepatocellular carcinoma. Oncotarget 2017, 8 (31) : 50655-50664. Zheng Y, Wang L, Niu X, Guo Y, Zhao J, Li L , et al. EOAI, a ubiquitin-specific peptidase 5 inhibitor, prevents non-small cell lung cancer progression by inducing DNA damage. BMC Cancer 2023, 23 (1) : 28. Nakajima S, Lan L, Wei L, Hsieh CL, Rapić-Otrin V, Yasui A , et al. Ubiquitin-specific protease 5 is required for the efficient repair of DNA double-strand breaks. PLoS One 2014, 9 (1) : e84899. Hwang J, Park A, Kim C, Kim CG, Kwak J, Kim B , et al. Inhibition of IRP2-dependent reprogramming of iron metabolism suppresses tumor growth in colorectal cancer. Cell Commun Signal 2024, 22 (1) : 412. Zhang Z, Ji Y, Hu N, Yu Q, Zhang X, Li J , et al. Ferroptosis-induced anticancer effect of resveratrol with a biomimetic nano-delivery system in colorectal cancer treatment. Asian J Pharm Sci 2022, 17 (5) : 751-766. Yan B, Guo J, Wang Z, Ning J, Wang H, Shu L , et al. The ubiquitin-specific protease 5 mediated deubiquitination of LSH links metabolic regulation of ferroptosis to hepatocellular carcinoma progression. MedComm (2020) 2023, 4 (4) : e337. Lu L, Jifu C, Xia J, Wang J. E3 ligases and DUBs target ferroptosis: A potential therapeutic strategy for neurodegenerative diseases. Biomed Pharmacother 2024, 175: 116753. D'Arcy P, Wang X, Linder S. Deubiquitinase inhibition as a cancer therapeutic strategy. Pharmacol Ther 2015, 147: 32-54. Han S, Yu C, Qiu M, Xiong X, Peng H, Song X , et al. USP13 regulates ferroptosis in chicken follicle granulosa cells by deubiquitinating ATG7. Poult Sci 2024, 103 (11) : 104209. Chen H, Ferguson CJ, Mitchell DC, Risch I, Titus A, Paulo JA , et al. The Hao-Fountain syndrome protein USP7 regulates neuronal connectivity in the brain via a novel p53-independent ubiquitin signaling pathway. Cell Rep 2025, 44 (2) : 115231. Hong KS, Ryu KJ, Kim H, Kim M, Park SH, Kim T , et al. MSK1 promotes colorectal cancer metastasis by increasing Snail protein stability through USP5-mediated Snail deubiquitination. Exp Mol Med 2025. Cai B, Zhao J, Zhang Y, Liu Y, Ma C, Yi F , et al. USP5 attenuates NLRP3 inflammasome activation by promoting autophagic degradation of NLRP3. Autophagy 2022, 18 (5) : 990-1004. Petruzzelli R, Gaudino S, Amendola G, Sessa R, Puzone S, Di Concilio R , et al. Role of the cold shock domain protein A in the transcriptional regulation of HBG expression. Br J Haematol 2010, 150 (6) : 689-699. Liu RT, Wang GR, Liu C, Qiu J, Yan LK, Li XJ , et al. RNAi-mediated downregulation of DNA binding protein A inhibits tumorigenesis in colorectal cancer. Int J Mol Med 2016, 38 (3) : 703-712. Yasen M, Obulhasim G, Kajino K, Mogushi K, Mizushima H, Tanaka S , et al. DNA binding protein A expression and methylation status in hepatocellular carcinoma and the adjacent tissue. Int J Oncol 2012, 40 (3) : 789-797. Pan W, Wang L, Zhang XF, Zhang H, Zhang J, Wang G , et al. Hypoxia-induced microRNA-191 contributes to hepatic ischemia/reperfusion injury through the ZONAB/Cyclin D1 axis. Cell Death Differ 2019, 26 (2) : 291-305. Luciani A, Festa BP, Chen Z, Devuyst O. Defective autophagy degradation and abnormal tight junction-associated signaling drive epithelial dysfunction in cystinosis. Autophagy 2018, 14 (7) : 1157-1159. Qin HL, Wang XJ, Yang BX, Du B, Yun XL. Notoginsenoside R1 attenuates breast cancer progression by targeting CCND2 and YBX3. Chin Med J (Engl) 2021, 134 (5) : 546-554. Jiang L, Kon N, Li T, Wang SJ, Su T, Hibshoosh H , et al. Ferroptosis as a p53-mediated activity during tumour suppression. Nature 2015, 520 (7545) : 57-62. Zhou Q, Meng Y, Li D, Yao L, Le J, Liu Y , et al. Ferroptosis in cancer: From molecular mechanisms to therapeutic strategies. Signal Transduct Target Ther 2024, 9 (1) : 55. Zhao L, Zhou X, Xie F, Zhang L, Yan H, Huang J , et al. Ferroptosis in cancer and cancer immunotherapy. Cancer Commun (Lond) 2022, 42 (2) : 88-116. Chen P, Li X, Zhang R, Liu S, Xiang Y, Zhang M , et al. Combinative treatment of β-elemene and cetuximab is sensitive to KRAS mutant colorectal cancer cells by inducing ferroptosis and inhibiting epithelial-mesenchymal transformation. Theranostics 2020, 10 (11) : 5107-5119. Zhang C, Liu X, Jin S, Chen Y, Guo R. Ferroptosis in cancer therapy: a novel approach to reversing drug resistance. Mol Cancer 2022, 21 (1) : 47. Yan H, Talty R, Aladelokun O, Bosenberg M, Johnson CH. Ferroptosis in colorectal cancer: a future target? Br J Cancer 2023, 128 (8) : 1439-1451. Additional Declarations (Not answered) Supplementary Files supplementalmaterial.docx Supplemental figures 1-3 Westernblotdata1.xlsx Western blot data-1 Westernblotdata2.xlsx Western blot data-3 Westernblotdata3.xlsx Western blot data-2 Cite Share Download PDF Status: Published Journal Publication published 10 Nov, 2025 Read the published version in Cell Death & Disease → Version 1 posted Editorial decision: revise 02 Jun, 2025 Review # 1 received at journal 30 May, 2025 Review # 2 received at journal 27 May, 2025 Reviewer # 2 agreed at journal 21 May, 2025 Reviewer # 1 agreed at journal 20 May, 2025 Reviewers invited by journal 20 May, 2025 Submission checks completed at journal 01 May, 2025 First submitted to journal 01 May, 2025 Editor assigned by journal 01 May, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6569374","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":459442347,"identity":"c983abe3-e2d4-47a8-821d-d54e5b5526a5","order_by":0,"name":"Guoqing Li","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3ElEQVRIiWNgGAWjYLCCBAYGGTb2BjCbsYFYLTxsPAdI0QIEPAwSCURqkY9IPnjj4Y5aHj7JN8YffjDYyG44wPzsAT4thjfSki0SzxznYZPOMZPsYUgz3nCAzdwAr5YZOWYSiW3HwFqYGRgOJ244wMMmQZwWyTPGnxkY/hPWIi8B1lIDVMZjIM3AcICwFgOeZ0C/tAGV8aSVSfYYJBvPPMxmht+W9uSDN3+21cnJtx/e/OFHhZ1s3/HmZ/htOcDAAFRwGMYFYmZ86kG2NIC11BFQNgpGwSgYBSMaAABTEkM6SG+EEAAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0001-8169-0434","institution":"University of South China","correspondingAuthor":true,"prefix":"","firstName":"Guoqing","middleName":"","lastName":"Li","suffix":""},{"id":459442348,"identity":"27e01580-6d11-4fe9-b858-c94ce6c09b22","order_by":1,"name":"Haowen Qiu","email":"","orcid":"","institution":"University of South China","correspondingAuthor":false,"prefix":"","firstName":"Haowen","middleName":"","lastName":"Qiu","suffix":""},{"id":459442349,"identity":"45962778-2423-4c23-b12b-dc32847ab3de","order_by":2,"name":"Yi Liu","email":"","orcid":"","institution":"University of South China","correspondingAuthor":false,"prefix":"","firstName":"Yi","middleName":"","lastName":"Liu","suffix":""},{"id":459442350,"identity":"8ee4000c-8794-42cb-b613-180a02ea0526","order_by":3,"name":"Haimeng Zhou","email":"","orcid":"https://orcid.org/0009-0004-9243-2675","institution":"Wuhan University","correspondingAuthor":false,"prefix":"","firstName":"Haimeng","middleName":"","lastName":"Zhou","suffix":""},{"id":459442351,"identity":"9df7ec22-d5b8-4ba7-8654-982f1aa3c5eb","order_by":4,"name":"Lingjuan Hu","email":"","orcid":"","institution":"University of South China","correspondingAuthor":false,"prefix":"","firstName":"Lingjuan","middleName":"","lastName":"Hu","suffix":""},{"id":459442352,"identity":"2b680a83-1c4e-4d3a-80ca-53b163b3ccd7","order_by":5,"name":"Wei Qi","email":"","orcid":"","institution":"University of South China","correspondingAuthor":false,"prefix":"","firstName":"Wei","middleName":"","lastName":"Qi","suffix":""},{"id":459442353,"identity":"e9d5bac9-63b8-48f4-abd6-ecf374c21013","order_by":6,"name":"Honglu Ma","email":"","orcid":"","institution":"University of South China","correspondingAuthor":false,"prefix":"","firstName":"Honglu","middleName":"","lastName":"Ma","suffix":""},{"id":459442354,"identity":"94a9090f-42ed-4966-9bf2-1f350eeceae4","order_by":7,"name":"Yaoyi Liu","email":"","orcid":"","institution":"University of South China","correspondingAuthor":false,"prefix":"","firstName":"Yaoyi","middleName":"","lastName":"Liu","suffix":""},{"id":459442355,"identity":"2e132df2-9629-4844-b4b2-00657e2abb65","order_by":8,"name":"Le Li","email":"","orcid":"","institution":"University of South China","correspondingAuthor":false,"prefix":"","firstName":"Le","middleName":"","lastName":"Li","suffix":""},{"id":459442356,"identity":"90cb42c4-b0c5-43bf-a3cc-aaec714aa219","order_by":9,"name":"Nanyang Yang","email":"","orcid":"","institution":"University of South China","correspondingAuthor":false,"prefix":"","firstName":"Nanyang","middleName":"","lastName":"Yang","suffix":""},{"id":459442357,"identity":"54592575-5b79-468f-a382-93efaea3fde8","order_by":10,"name":"Meiqin Huang","email":"","orcid":"","institution":"University of South China","correspondingAuthor":false,"prefix":"","firstName":"Meiqin","middleName":"","lastName":"Huang","suffix":""},{"id":459442358,"identity":"251caf94-130e-47df-9235-51d12ec08433","order_by":11,"name":"Run-Lei Du","email":"","orcid":"https://orcid.org/0000-0001-7890-9781","institution":"Wuhan University","correspondingAuthor":false,"prefix":"","firstName":"Run-Lei","middleName":"","lastName":"Du","suffix":""},{"id":459442359,"identity":"908ec3ba-c9d6-4096-bd16-71b47e0d3b25","order_by":12,"name":"Lijuan Meng","email":"","orcid":"","institution":"University of South China","correspondingAuthor":false,"prefix":"","firstName":"Lijuan","middleName":"","lastName":"Meng","suffix":""},{"id":459442360,"identity":"f7d4570f-2216-4dea-b02d-c02234a51154","order_by":13,"name":"Feng Shi","email":"","orcid":"","institution":"University of South China","correspondingAuthor":false,"prefix":"","firstName":"Feng","middleName":"","lastName":"Shi","suffix":""},{"id":459442361,"identity":"101b0509-3b25-4a76-9860-0558a9ffce8d","order_by":14,"name":"Bai-Qi Wang","email":"","orcid":"","institution":"The Second Affiliated Hospital University of South China Clinical Research Center","correspondingAuthor":false,"prefix":"","firstName":"Bai-Qi","middleName":"","lastName":"Wang","suffix":""},{"id":459442362,"identity":"943a0886-68f7-4d44-a747-77dd9c457fb7","order_by":15,"name":"Li Yu","email":"","orcid":"","institution":"University of South China","correspondingAuthor":false,"prefix":"","firstName":"Li","middleName":"","lastName":"Yu","suffix":""},{"id":459442363,"identity":"69a62d6a-5b73-43fa-83fe-5da6110c73b2","order_by":16,"name":"Xiaodong Zhang","email":"","orcid":"https://orcid.org/0000-0002-5137-7145","institution":"University of South China","correspondingAuthor":false,"prefix":"","firstName":"Xiaodong","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2025-05-01 05:35:22","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6569374/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6569374/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41419-025-08146-2","type":"published","date":"2025-11-10T05:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":83327554,"identity":"1a596a40-d0e2-46c4-bd9a-6c8706540664","added_by":"auto","created_at":"2025-05-23 06:59:49","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":3551781,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eUSP5 knockout sensitizes CRC cells to ferroptosis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eA\u003c/strong\u003e) Constructed a deubiquitinating enzyme knockout gene library in colorectal cancer cells, treated with erastin (15µM) for 4 days (72h), and measured cell viability using the CCK-8 assay. (\u003cstrong\u003eB\u003c/strong\u003e)Compared USP5 protein levels in the normal human colon epithelial cell line (NCM460) and eight CRC cell lines. (\u003cstrong\u003eC\u003c/strong\u003e) Assessed USP5 knockout and overexpression efficiency in HCT116 and HCT15 cells using western blot. (\u003cstrong\u003eD-G\u003c/strong\u003e) In HCT116 and HCT15 cell lines, USP5 knockout cells were treated with erastin (15 µM) for 72 hours, while USP5 overexpressing cells received erastin (20 µM) under the same conditions. Cell viability was subsequently assessed using the CCK-8 assay. (\u003cstrong\u003eH, I\u003c/strong\u003e) Lipid-ROS levels in USP5 knockout cell lines were analyzed via flow cytometry following erastin (15 µM) \u0026nbsp;\u0026nbsp;treatment and fer-1 (10 µM) rescue, with corresponding quantitative analysis of Lipid-ROS levels. (\u003cstrong\u003eJ, K\u003c/strong\u003e) Flow cytometry was employed to assess Lipid-ROS levels in USP5 overexpressing cell lines after erastin (20 µM) treatment and fer-1(10 µM) rescue, followed by quantitative analysis of Lipid-ROS levels. (\u003cstrong\u003eL\u003c/strong\u003e) Representative TEM micrographs of sgCtrl and sgUSP5 HCT116 cells before and after treatment with erastin.\u003cstrong\u003e \u003c/strong\u003e(\u003cstrong\u003eM\u003c/strong\u003e) Intracellular Fe\u003csup\u003e2+\u003c/sup\u003e levels were determined using ferroOrnge in USP5 knockout or overexpression cells, with quantitative analysis presented. Data are shown as means ± SDs. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, unpaired Student’ s \u003cem\u003et\u003c/em\u003e test or two-way ANOVA.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-6569374/v1/9a8997319c5003f8cb43d41e.png"},{"id":83327541,"identity":"596a6015-8fd7-4951-b2ca-f285b22c4ae2","added_by":"auto","created_at":"2025-05-23 06:59:49","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":5919012,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eUSP5 promotes the development and progression of colorectal cancer\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003eA-C\u003c/strong\u003e) Analyzed and compared USP5 expression levels across different cancers using databases such as TCGA, including comparisons between tumor and adjacent normal tissues. \u003cstrong\u003e(D\u003c/strong\u003e, \u003cstrong\u003eE\u003c/strong\u003e) Measured and visualized USP5 expression levels in tumor and adjacent normal tissues from 12 patient pairs. \u003cstrong\u003e(F) \u003c/strong\u003eRepresentative images of immunohistochemical (IHC) staining for USP5 and Ki-67 in normal and tumor colorectal tissues (left), with corresponding quantification (right). \u003cstrong\u003e(G)\u003c/strong\u003e Representative hematoxylin and eosin (H\u0026amp;E) staining images of normal and tumor colorectal tissues. (\u003cstrong\u003eH, I\u003c/strong\u003e) Conducted transwell chamber assays for USP5 knockout and overexpression groups with corresponding data analysis. (\u003cstrong\u003eJ, K\u003c/strong\u003e) Performed colony formation assays for USP5 knockout and overexpression groups, with statistical analysis of the results. Data are shown as means ± SDs. *\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001, unpaired Student’ s \u003cem\u003et\u003c/em\u003etest or two-way ANOVA.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-6569374/v1/86327d4ab34c5a329b3e2e21.png"},{"id":83329048,"identity":"e68e1a98-f0bb-4168-a20b-cb29b625fd88","added_by":"auto","created_at":"2025-05-23 07:15:49","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":3190304,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eUSP5 regulates ferroptosis by stabilizing SLC7A11\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A) \u003c/strong\u003eWestern blot analysis of ferroptosis-related protein expression following USP5 knockout or overexpression. \u003cstrong\u003e(B)\u003c/strong\u003e Confirmation of SLC7A11 expression changes in sgCtrl/sgUSP5 and EV/ Flag-USP5 HCT116 or HCT15 cell lines.\u003cstrong\u003e (C)\u003c/strong\u003e Transient transfection of 0-1 μg USP5 plasmid and 0.25 μg HA-SLC7A11 plasmid into HEK-293T cells, followed by protein expression analysis 48 hours later. \u003cstrong\u003e(D)\u003c/strong\u003e Western blot analysis of SLC7A11 expression in cancer and adjacent normal tissues from 12 patient samples, focusing on cases with high USP5 expression, with corresponding data analysis.\u003cstrong\u003e (E) \u003c/strong\u003eBox plots showing SLC7A11 mRNA expression levels in colorectal adenocarcinoma (COAD) and rectal adenocarcinoma (READ) based on TCGA datasets, comparing tumor and normal samples.\u003cstrong\u003e (F)\u003c/strong\u003eAnalysis of the correlation between USP5 and SLC7A11 using TCGA database.\u003cstrong\u003e(G)\u003c/strong\u003e Transfect HEK-293T cells with Flag-USP5. After 24 hours of transfection, treat the cells with CHX (100 μg/mL) for the specified time points. Analyze SLC7A11 protein levels using western blot. \u003cstrong\u003e(H)\u003c/strong\u003e In USP5 knockout cell lines, transiently transfect HA-SLC7A11 and assess its expression using western blot analysis. \u003cstrong\u003e(I)\u003c/strong\u003e Cell viability assay in HCT116 cells under indicated sgRNA and treatment conditions (DMSO, erastin(15 µM), erastin and ferrostatin-1(10 µM)). \u003cstrong\u003e(J) \u003c/strong\u003eFlow cytometric analysis of lipid ROS levels using BODIPY-C11 staining under indicated conditions. Data are presented as mean ± SD. Statistical analyses were performed using unpaired two-tailed Student’s t-test or two-way ANOVA. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-6569374/v1/069b4e72041678f316384b3f.png"},{"id":83328088,"identity":"dfbbf733-499b-485a-8bb8-e484fc590919","added_by":"auto","created_at":"2025-05-23 07:07:49","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":4691534,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eUSP5 promotes lysosomal degradation of YBX3\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Silver staining and mass spectrometry analysis of proteins co-immunoprecipitated with USP5. HCT116 cell lysates were immunoprecipitated using anti-USP5 antibody. Highlighted regions indicate USP5 and YBX3. Right panel: Volcano plot showing proteins enriched in USP5 immunoprecipitates.\u003cstrong\u003e (B) \u003c/strong\u003eCo-immunoprecipitation of HA-YBX3 and Flag-USP5 in HEK-293T cells. Left: Flag immunoprecipitation; Right: HA immunoprecipitation. \u003cstrong\u003e(C) \u003c/strong\u003eEndogenous interaction between USP5 and YBX3 validated by co-immunoprecipitation in HCT116 cells.\u003cstrong\u003e (D)\u003c/strong\u003e\u0026nbsp;Transiently transfect 0-2 μg Flag-USP5 plasmid and 0.5 μg HA-YBX3 plasmid into HEK-293T cells, collect cells 48 hours later for protein expression analysis. \u003cstrong\u003e(E, F)\u003c/strong\u003e\u0026nbsp;Western blot to analyze YBX3 expression in HCT116 and HCT5 cells following USP5 knockout and overexpression. \u003cstrong\u003e(G)\u003c/strong\u003e\u0026nbsp;Western blotting analysis exhibiting YBX3 remaining level at indicated time in HCT16 with USP5 knockout and treatment with CHX (100 μg/mL), a protein synthesis inhibitor.\u003cstrong\u003e (H)\u003c/strong\u003e\u0026nbsp;Co-transfect HA-YBX3 with Flag-USP5 and Flag-C335A (enzyme activity mutant) into HEK293T cells for 48 hours, then detect HA-YBX3 expression.\u003cstrong\u003e (I)\u003c/strong\u003e\u0026nbsp;Transfect Flag-USP5 and Flag-C335A into 293T cells, collect cells 48 hours later for Co-IP. \u003cstrong\u003e(J)\u003c/strong\u003e\u0026nbsp;Transfect three plasmid groups into 293T cells, treat with MG132 for 12 hours after 36 hours of transfection, and perform denaturing Co-IP.\u003cstrong\u003e (K)\u003c/strong\u003e\u0026nbsp;Transfect Flag-USP5 and HA-YBX3 into 293T cells, add MG132 or CQ to co-transfected groups, and perform western blot to analyze protein expression.\u003cstrong\u003e (L)\u003c/strong\u003e\u0026nbsp;Transfect Flag-USP5, Flag-C335A, and Lenti-sgATG into 293T cells, and use western blot to analyze YBX3 protein levels.\u003cstrong\u003e (M)\u003c/strong\u003e Set up two experimental groups: one group will be transfected with Flag-USP5 and HA-YBX3, while the other group will not be transfected with Flag-USP5. After 48 hours of culture, label the samples with the indicated antibodies and stain the lysosomes using the LysoTracker\u003csup\u003eTM\u003c/sup\u003e probe. Finally, analyze the samples via confocal microscopy. Statistical analyses were performed using unpaired two-tailed Student’s t-test or two-way ANOVA. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-6569374/v1/4f5bc1335d9b687936ddeebb.png"},{"id":83329738,"identity":"12dfa60b-5a23-459f-8e65-992afc651a07","added_by":"auto","created_at":"2025-05-23 07:23:49","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2411692,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eYBX3 regulates the stability of SLC7A11 and modulates ferroptosis sensitivity in a USP5-dependent manner\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003eCo-immunoprecipitation assays showing interaction between HA-YBX3 and Myc-SLC7A11 in HEK-293T cells. Cell lysates were immunoprecipitated with anti-HA or anti-Myc antibodies and analyzed by western blotting using indicated antibodies.\u003cstrong\u003e (B)\u003c/strong\u003e Confocal microscopy showing subcellular co-localization of HA-YBX3 and Myc-SLC7A11 in HEK-293T cells. Nuclei were stained with DAPI. Scale bar, 14 μm. \u003cstrong\u003e(C) \u003c/strong\u003eWestern blot analysis of Myc-SLC7A11 levels in HEK-293T cells co-expressing increasing amounts of HA-YBX3. β-Tubulin served as a loading control. \u003cstrong\u003e(D) \u003c/strong\u003eCHX (cycloheximide) chase assay assessing Myc-SLC7A11 protein stability in the presence or absence of HA-YBX3 overexpression in HEK-293T cells. Protein levels were measured at indicated time points and quantified (right panel).\u003cstrong\u003e (E) \u003c/strong\u003eHEK-293T cells transfected with HA-YBX3 were treated with proteasome inhibitor MG132 or lysosomal inhibitor chloroquine (CQ), followed by western blot analysis of SLC7A11 expression. \u003cstrong\u003e(F) \u003c/strong\u003eWestern blot analysis of SLC7A11 and YBX3 levels in HCT116 cells with stable USP5 knockout and shYBX3.\u003cstrong\u003e (G)\u003c/strong\u003eImmunoblotting of HA-YBX3 and SLC7A11 in HCT116 cells co-transfected with HA-YBX3 and either empty vector, Flag-USP5, or catalytically inactive mutant Flag-USP5 (C335A). \u003cstrong\u003e(H)\u003c/strong\u003e Cell viability measured by CCK-8 assay in shYBX3 and sgUSP5 HCT116 cells, treated with DMSO, erastin (15 μM), or erastin plus fer-1 (10 μM) for 48 h. \u003cstrong\u003e(I)\u003c/strong\u003e Using BODIPY-C11 staining and flow cytometry to assess lipid peroxidation (lipid ROS) levels in three treatment groups; right panel shows quantification of mean fluorescence intensity. \u003cstrong\u003e(J)\u003c/strong\u003e CCK-8 cell viability assay in HCT116 cells transfected with HA-YBX3 , EV HCT116 and Flag-USP5 HCT116 cells. Cells were treated with DMSO, erastin, or erastin plus Fer-1. \u003cstrong\u003e(K)\u003c/strong\u003eUsing BODIPY-C11 staining and flow cytometry to assess lipid peroxidation (lipid ROS) levels in three treatment groups; right panel shows quantification of mean fluorescence intensity. Data represent mean ± SD of at least three independent experiments. Statistical significance was determined by unpaired two-tailed Student’s t-test or two-way ANOVA. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.01, ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-6569374/v1/2b60c376bc1ba628d3803c4f.png"},{"id":83327546,"identity":"01d23326-8231-491d-b3c9-27d40fc32f2d","added_by":"auto","created_at":"2025-05-23 06:59:49","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1579849,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eOrganoid and Xenograft models confirm USP5's role in regulating ferroptosis and CRC progression\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003eKnockout efficiency of USP5 in colorectal organoids was confirmed by western blot assays.\u003cstrong\u003e \u003c/strong\u003e(\u003cstrong\u003eB\u003c/strong\u003e) sgCtrl and sgUSP5 colorectal organoids were visualized by microscope at 5-day intervals.\u003cstrong\u003e (C)\u003c/strong\u003e Determination of IC\u003csub\u003e50\u003c/sub\u003e in normal human colorectal cancer organoids.\u003cstrong\u003e (D)\u003c/strong\u003e sgCtrl and sgUSP5 colorectal organoids were treated with DMSO or erastin (15 μM) for 72 hours. Organoids were stained using the Calcein/PI Cell Viability Kit and visualized by fluorescence microscope. \u003cstrong\u003e(E)\u003c/strong\u003e Organoid viability was quantitatively assessed using the ATP Assay Kit. \u003cstrong\u003e(F-H) \u003c/strong\u003eTherapy of fer-1 promotes xenograft tumor growth in USP5 knockout cells and recovery tumor growth and weight by fer-1(0.5 mg/mL), tumor volume, and tumor weight in mice (n=5).\u003cstrong\u003e (I)\u003c/strong\u003e\u0026nbsp;Expression of SLC7A11 in xenograft tumor by western blot assays. Data are shown as means ± SDs. ****\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001, unpaired Student’ s \u003cem\u003et\u003c/em\u003e test or two-way ANOVA.\u0026nbsp;\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-6569374/v1/95c6b10b44e1d7cfdd5747ca.png"},{"id":83328084,"identity":"23dee4c0-6bb3-4afe-bca4-4e60ad73a695","added_by":"auto","created_at":"2025-05-23 07:07:49","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":2094407,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSchematic model of the role of USP5 in regulating the YBX3/SLC7A11 to inhibit ferroptosis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn the presence of USP5, USP5 colocalizes with YBX3 in the lysosome. Through the lysosomal degradation pathway, USP5 mediates the degradation of YBX3, thereby preventing the degradation of SLC7A11 and consequently inhibiting ferroptosis in colorectal cancer (CRC).\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-6569374/v1/7221bd0a24c284122b86f031.png"},{"id":95612242,"identity":"98ce7220-b2b2-4ccc-adf8-ce099ef344eb","added_by":"auto","created_at":"2025-11-11 08:11:56","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":25425671,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6569374/v1/d8234b4c-47fe-4dea-a7b1-21fb2be1ab9d.pdf"},{"id":83327542,"identity":"4c32056c-d0db-4212-92ad-8ddf67a34d01","added_by":"auto","created_at":"2025-05-23 06:59:49","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":859703,"visible":true,"origin":"","legend":"Supplemental figures 1-3","description":"","filename":"supplementalmaterial.docx","url":"https://assets-eu.researchsquare.com/files/rs-6569374/v1/28c9fde795df8b0c6399cc47.docx"},{"id":83327593,"identity":"b323e318-bda9-40bc-b20e-f1611afbd4d1","added_by":"auto","created_at":"2025-05-23 06:59:50","extension":"xlsx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":126330729,"visible":true,"origin":"","legend":"\u003cp\u003eWestern blot data-1\u003c/p\u003e","description":"","filename":"Westernblotdata1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-6569374/v1/414d80e04c660ef1074fb40b.xlsx"},{"id":83327595,"identity":"e17c26e6-5bbb-487c-8635-0d1237c8af39","added_by":"auto","created_at":"2025-05-23 06:59:52","extension":"xlsx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":229349893,"visible":true,"origin":"","legend":"Western blot data-3","description":"","filename":"Westernblotdata2.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-6569374/v1/698f2b1357050b96e161744c.xlsx"},{"id":83328107,"identity":"258cf03c-0351-421a-9458-e17f46595706","added_by":"auto","created_at":"2025-05-23 07:07:50","extension":"xlsx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":141505200,"visible":true,"origin":"","legend":"Western blot data-2","description":"","filename":"Westernblotdata3.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-6569374/v1/7082d5839f049a3e56b70816.xlsx"}],"financialInterests":"(Not answered)","formattedTitle":"USP5 Regulates Ferroptosis in Colorectal Cancer by Targeting the YBX3/SLC7A11 Axis Through Lysosomal Degradation","fulltext":[{"header":"Introduction","content":"\u003cp\u003eColorectal cancer (CRC) is a commonly diagnosed malignancy worldwide and ranks as the second leading cause of cancer-related deaths globally, and poses a major public health threat[1-3]. According to the latest statistics from 2024, China reports around 510,000 new CRC cases and approximately 240,000 deaths each year[4]. In the United States, there are an estimated 152,810 new CRC cases in 2024, resulting in about 53,010 deaths[1]. Current treatment options for CRC include chemotherapy, radiotherapy, immunotherapy, and surgery[5-7]. However, these treatments face significant challenges such as recurrence, drug resistance, and adverse effects, highlighting the urgent need for more effective therapeutic strategies[8, 9].\u003c/p\u003e\n\u003cp\u003eFerroptosis is a distinct form of regulated cell death characterized by iron-dependent lipid peroxidation and resultant oxidative damage to cellular membranes[10]. This process is initiated through intracellular iron-catalyzed lipid peroxidation and is morphologically defined by mitochondrial shrinkage and the reduction or loss of cristae structure[11-14]. Unlike apoptosis and necrosis, ferroptosis is orchestrated by cellular metabolic activity, redox equilibrium, and iron homeostasis[15, 16]. Central regulators of this pathway include glutathione peroxidase 4 (GPX4) and the cystine/glutamate antiporter system Xc⁻, particularly its subunit SLC7A11[17, 18]. The role of ferroptosis in cancer biology extends beyond its intrinsic cytotoxicity toward malignant cells[19, 20]. While the induction of ferroptosis may suppress tumor progression, paradoxically, it may also facilitate cancer development under specific microenvironmental conditions [21, 22]. For instance, DHPO, an allosteric covalent inhibitor of USP7, has been shown to inhibit gastric cancer proliferation and metastasis both in vitro and in vivo by downregulating stearoyl-CoA desaturase (SCD) and promoting ferroptosis[23]. Conversely, circPIAS1 has been found to suppress ferroptosis by competitively binding to miR-455-3p, thereby upregulating Nuclear Protein 1 (NUPR1), which facilitates the growth and metastatic potential of hepatocellular carcinoma (HCC)[24]. Emerging evidence suggests that CRC cells often exhibit elevated intracellular iron levels and dysregulated lipid metabolism, rendering them particularly susceptible to ferroptosis induction[25, 26]. This unique vulnerability highlights ferroptosis as a promising therapeutic target, especially in the context of drug-resistant CRC[27, 28]. \u003c/p\u003e\n\u003cp\u003eUbiquitination is a critical post-translational modification that regulates numerous cellular functions, particularly protein degradation and stabilization[13, 29]. Ubiquitin-specific peptidase 5 (USP5), a member of the deubiquitinating enzyme (DUB) family, primarily functions to deubiquitinate substrate proteins, thereby modulating essential biological processes such as proteostasis[30-33]. Recent studies have demonstrated that USP5 expression is significantly upregulated in breast cancer cells, where it promotes cell proliferation and migration, potentially through the stabilization of HIF-2\u0026alpha;[34]. In non-small cell lung cancer, USP5 has been implicated in enhancing cellular proliferation and resistance to apoptosis by stabilizing PD-L1[35]. Similarly, in bladder cancer, elevated USP5 expression facilitates tumor progression via stabilization of c-Jun[36]. Beyond its canonical role in ubiquitin processing, USP5 is also involved in cellular stress responses independent of its deubiquitinase activity[30, 37, 38]. Moreover, it plays a pivotal role in DNA damage repair and the maintenance of genomic stability, indirectly contributing to tumor cell survival and chemoresistance[39-41].\u003c/p\u003e\n\u003cp\u003eIn CRC, iron metabolism is frequently dysregulated[42]. Inducing ferroptosis can enhance cancer cell death, whereas inhibiting ferroptosis contributes to resistance against chemotherapeutic agents[43, 44]. Investigating the interplay between deubiquitinating enzymes (DUBs) and ferroptosis in CRC may offer valuable insights into cancer progression and therapeutic vulnerabilities[45, 46]. The role of USP5 in regulating protein turnover and stability is crucial for cellular homeostasis, influencing multiple cellular processes[33].\u003c/p\u003e\n\u003cp\u003eOur findings confirm that USP5 does not carry out its traditional function as a deubiquitinating enzyme in the regulation of CRC initiation and progression. Instead, it facilitates the lysosomal degradation of YBX3 (Y-box binding protein 3), and through the USP5/YBX3/SLC7A11 axis, it modulates CRC progression by coordinating autophagy and ferroptosis.\u003c/p\u003e"},{"header":"Result","content":"\u003cdiv id=\"Sec2\" class=\"Section2\"\u003e \u003ch2\u003eUSP5 knockout sensitizes CRC cells to ferroptosis\u003c/h2\u003e \u003cp\u003eTo investigate the role of deubiquitination in the regulation of ferroptosis in CRC we systematically screened 108 deubiquitinases (DUBs) to identify key regulatory factors and elucidate their underlying mechanisms. Two pairs of sgRNAs were designed for each DUB, and corresponding CRISPR-Cas9 vectors were constructed to establish a comprehensive knockout library. These vectors were transfected into CRC cell lines, generating 108 individual knockout lines that collectively constituted a complete DUB knockout panel.Both control and DUB-deficient cell lines were treated with the ferroptosis inducer erastin, and cell viability was assessed to identify candidates whose deletion significantly impaired cell survival (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). This screen identified USP5 as a potential negative regulator of ferroptosis. Western blot analysis revealed that USP5 expression was markedly upregulated in most CRC cell lines compared to the normal colorectal epithelial cell line NCM460 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). To further investigate its role, we established USP5-overexpressing and USP5-knockout models in HCT116 and HCT15 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFunctional assays demonstrated that USP5 knockout sensitized CRC cells to ferroptosis, as indicated by a significant reduction in cell viability after 72 hours of erastin treatment, confirmed by both microscopy and CCK-8 assays (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD-G, Supplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA-D). In contrast, USP5 overexpression conferred resistance to ferroptosis. Mechanistically, flow cytometric analysis showed that USP5 deficiency led to increased lipid peroxidation and accumulation of intracellular lipid reactive oxygen species (ROS) following erastin treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eH, I). Conversely, USP5 overexpression reduced these effects by lowering lipid ROS levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eJ, K). Transmission electron microscopy revealed classical ferroptotic ultrastructural changes in USP5-knockout cells, including rupture of the outer mitochondrial membrane, reduced mitochondrial volume, and loss or disorganization of cristae (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eL). Moreover, FerroOrange staining confirmed marked ferrous iron (Fe\u0026sup2;⁺) accumulation in USP5-deficient cells, further exacerbating ferroptotic cell death (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eM).\u003c/p\u003e \u003cp\u003eCollectively, these findings identify \u003cb\u003eUSP5\u003c/b\u003e as a critical negative regulator of ferroptosis in CRC. Its loss promotes ferroptotic sensitivity through enhanced lipid peroxidation, mitochondrial damage, and iron overload.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eUSP5 promotes the development and progression of CRC\u003c/h2\u003e \u003cp\u003eTo elucidate the role of USP5 in CRC, we conducted comprehensive bioinformatics analyses to examine its expression profile. Data from The Cancer Genome Atlas (TCGA) revealed that USP5 is broadly overexpressed across various cancer types, including CRC, with elevated levels observed in both tumor tissues and adjacent non-tumor tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-C). Analysis of 12 paired CRC tumor and adjacent normal tissues further confirmed significantly higher USP5 expression in most tumor samples (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD, E). Immunohistochemistry (IHC) analysis demonstrated markedly increased USP5 expression in tumor tissues compared to adjacent normal tissues. Notably, Ki-67, a marker of cellular proliferation, was also elevated in tumor sections (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). Histopathological assessment using hematoxylin and eosin (H\u0026amp;E) staining revealed malignant features in tumor tissues, including disorganized architecture and increased cellularity (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG). Functional assays provided further evidence for the oncogenic role of USP5. Transwell migration assays showed that USP5 overexpression significantly promoted cell migration (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH, I). Cell proliferation, measured using the CCK-8 assay, indicated that elevated USP5 expression significantly enhanced CRC cell growth (Supplementary Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eA, B). Similarly, colony formation assays confirmed that USP5 overexpression markedly increased the proliferative capacity of CRC cells, underscoring its tumor-promoting function in colorectal carcinogenesis (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eJ, K). Notably, treatment of USP5-knockout cell lines with the ferroptosis inhibitor ferrostatin-1 (fer-1) partially restored their growth, suggesting that USP5 may regulate CRC cell proliferation, at least in part, by modulating ferroptosis-related pathways (Supplementary Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThese findings highlight the critical role of USP5 in promoting CRC cell proliferation, migration, and overall tumor progression.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eUSP5 regulates ferroptosis by stabilizing SLC7A11\u003c/h3\u003e\n\u003cp\u003eTo delineate the mechanism by which USP5 regulates ferroptosis, we examined key components of the ferroptotic pathway in both USP5-knockout and USP5-overexpressing cells. The expression of SLC7A11, a core subunit of the cystine/glutamate antiporter system Xc⁻, was significantly modulated following USP5 alteration, a trend consistently observed across multiple cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, B). In 293T cells, dose-dependent transfection with Flag-tagged USP5 resulted in a progressive increase in SLC7A11 protein levels, indicating that USP5 promotes SLC7A11 accumulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). In patient-derived CRC samples, tumors with high USP5 expression displayed significantly elevated SLC7A11 levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). TCGA analysis further confirmed that SLC7A11 is upregulated in both colon and rectal cancers and revealed a strong positive correlation between USP5 and SLC7A11 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). Cycloheximide (CHX) chase assays demonstrated that USP5 overexpression delayed CHX-induced degradation of SLC7A11, suggesting that USP5 stabilizes the SLC7A11 protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG). To assess functional relevance, we reintroduced SLC7A11 into USP5-deficient cells. Western blot analysis confirmed partial restoration of SLC7A11 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH). Upon treatment with erastin and the ferroptosis inhibitor fer-1, SLC7A11 overexpression significantly attenuated USP5-mediated lipid ROS accumulation and ferroptotic cell death, as determined by flow cytometry and CCK-8 assays (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eI, J).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThese findings identify USP5 as a negative regulator of ferroptosis through stabilization of SLC7A11, thereby supporting CRC cell survival and tumor progression.\u003c/p\u003e\n\u003ch3\u003eUSP5 promotes lysosomal degradation of YBX3\u003c/h3\u003e\n\u003cp\u003eTo elucidate the mechanism by which USP5 regulates ferroptosis, we first identified SLC7A11 as a potential downstream target through preliminary experimental screening. However, co-immunoprecipitation (Co-IP) analysis revealed that USP5 does not directly interact with SLC7A11 (Supplementary Fig. \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003eA). To further explore the regulatory network, we performed silver staining followed by mass spectrometry, which identified YBX3 as a novel interacting protein of USP5 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). The interaction between USP5 and YBX3 was validated through exogenous co-expression of Flag- and HA-tagged constructs, as well as endogenous Co-IP assays in HCT116 cells, confirming a robust and specific association (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB, C). Domain-mapping experiments indicated that all functional domains of USP5 are capable of binding to YBX3 (Supplementary Fig. \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo investigate the regulatory impact of USP5 on YBX3 expression, dose-dependent co-transfection experiments in 293T cells demonstrated that increasing USP5 expression resulted in a progressive reduction in YBX3 protein levels, suggesting that USP5 promotes YBX3 degradation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). Consistently, endogenous USP5 knockout led to a marked upregulation of YBX3, whereas overexpression suppressed its levels, further supporting a negative regulatory role of USP5 on YBX3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE, F). Cycloheximide (CHX) chase assays revealed that USP5 shortens the half-life of YBX3 and accelerates its degradation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG, Supplementary Fig. \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003eC). Notably, both wild-type USP5 and its catalytically inactive mutant (C335A, in which the catalytic cysteine at position 335 is substituted with alanine) promoted YBX3 degradation, indicating that this regulatory effect is independent of USP5's canonical deubiquitinase activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG, H). Co-IP assays confirmed that both wild-type and mutant USP5 retain their ability to interact with YBX3, further demonstrating that enzymatic activity is not required for this interaction (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eI). Additionally, ubiquitin immunoprecipitation (IP) assays showed no significant differences in YBX3 ubiquitination levels between cells expressing wild-type and mutant USP5, suggesting that USP5 does not modulate YBX3 degradation through a ubiquitin-dependent mechanism (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eJ).\u003c/p\u003e \u003cp\u003eTo define the degradation pathway, cells were treated with the proteasome inhibitor MG132 or the lysosome inhibitor chloroquine (CQ). Only CQ treatment restored YBX3 protein levels, indicating that USP5 mediates YBX3 degradation via the lysosomal pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eK). Furthermore, knockdown of ATG5, a core autophagy-related gene, rescued YBX3 levels in USP5-overexpressing cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eL). Immunofluorescence analysis further revealed that USP5 promotes the co-localization of YBX3 with lysosomes, reinforcing the conclusion that YBX3 is degraded through the lysosomal pathway in a USP5-dependent manner (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eM).\u003c/p\u003e \u003cp\u003eThese findings identify YBX3 as a novel downstream effector of USP5 and reveal a non-canonical, lysosome-mediated mechanism by which USP5 regulates ferroptosis.\u003c/p\u003e \u003cp\u003e \u003cb\u003eYBX3 regulates the stability of SLC7A11 and modulates ferroptosis sensitivity in a USP5-dependent manner.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eBuilding upon previous findings, this study further investigated the relationship between YBX3 and SLC7A11 to elucidate the role of YBX3 in ferroptosis regulation. Co-immunoprecipitation (Co-IP) assays using ectopically expressed HA-YBX3 and Myc-SLC7A11 revealed a physical interaction between the two proteins (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). High-content immunofluorescence imaging in HCT116 cells further demonstrated their co-localization, supporting the existence of an intracellular interaction (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). To explore the regulatory impact of YBX3 on SLC7A11 expression, we performed dose-dependent co-transfection assays. Increasing amounts of HA-YBX3 plasmid led to a progressive reduction in Myc-SLC7A11 protein levels, indicating that YBX3 promotes SLC7A11 degradation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). Cycloheximide (CHX) chase assays further confirmed that overexpression of YBX3 significantly accelerated SLC7A11 degradation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). To dissect the degradation pathway involved, HCT116 cells overexpressing HA-YBX3 were treated with either the proteasome inhibitor MG132 or the lysosomal inhibitor chloroquine (CQ). Notably, CQ treatment\u0026mdash;but not MG132\u0026mdash;restored SLC7A11 protein levels, suggesting that YBX3 facilitates lysosome-dependent degradation of SLC7A11 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe biological relevance of this regulatory axis was examined in USP5 knockout cells. Knockdown of YBX3 (shYBX3) in this context markedly restored SLC7A11 protein levels compared to USP5 knockout alone (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF). In HCT116 cells overexpressing USP5, transient expression of HA-YBX3 reversed the USP5-mediated stabilization of SLC7A11, further confirming the antagonistic role of YBX3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG). Functional assays revealed that YBX3 knockdown significantly rescued the ferroptosis sensitivity of USP5-deficient cells, as demonstrated by improved cell viability upon Erastin treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eH). Consistently, BODIPY-C11 staining coupled with flow cytometry showed reduced lipid ROS accumulation in the double-knockdown group, highlighting YBX3\u0026rsquo;s role in promoting ferroptosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eI). Conversely, in USP5-overexpressing cells, reintroduction of YBX3 impaired the protective effect of USP5, as indicated by reduced cell viability (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eJ) and enhanced lipid peroxidation upon Erastin exposure (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eK).\u003c/p\u003e \u003cp\u003eCollectively, these findings demonstrate that YBX3 negatively regulates SLC7A11 through lysosome-mediated degradation, and highlight the critical role of the USP5\u0026ndash;YBX3\u0026ndash;SLC7A11 axis in orchestrating ferroptosis by modulating SLC7A11 stability, cell viability, and lipid ROS accumulation.\u003c/p\u003e\n\u003ch3\u003eOrganoid and Xenograft models confirm USP5's role in regulating ferroptosis and CRC progression\u003c/h3\u003e\n\u003cp\u003eTo explore the role of USP5 in patient-derived CRC tissues and its influence on ferroptosis in a clinically relevant context, we established CRC organoids from primary tumor samples of a CRC patient. These organoids, which retain the genetic, molecular, and phenotypic features of the original tumor, provide a robust ex vivo platform to assess the functional impact of USP5 depletion on ferroptosis susceptibility and tumor growth dynamics.\u003c/p\u003e \u003cp\u003eUsing CRISPR/Cas9 gene-editing technology, we generated USP5-knockout (sgUSP5) organoids, with successful depletion of USP5 confirmed by Western blot analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). Growth assays revealed that loss of USP5 markedly impaired organoid proliferation relative to control organoids (sgCtrl) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). Erastin sensitivity was assessed by determining the half-maximal inhibitory concentration (IC₅₀), followed by treatment with 15 \u0026micro;M erastin for 72 hours. sgUSP5 organoids displayed significantly decreased Calcein-AM staining (viable cell marker), increased propidium iodide (PI) staining (cell death marker), and markedly reduced ATP levels compared to controls, indicating enhanced ferroptotic cell death (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC-E).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo evaluate the physiological relevance of USP5-mediated ferroptosis regulation in vivo, we employed a xenograft tumor model. Nude mice were subcutaneously injected with sgCtrl HCT116, sgUSP5 HCT116, and sgUSP5 HCT116 cells with stable knockdown of YBX3 (shYBX3). Each group was further subdivided for treatment with vehicle control (DMSO) or fer-1 (0.5 mg/mL, administered biweekly for 3 weeks post-tumor establishment) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF). Tumor volumes were monitored throughout the experiment, and excised tumors were weighed at the endpoint (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG-I). Notably, fer-1 treatment significantly restored tumor volume and mass in the sgUSP5 group, suggesting that ferroptosis inhibition rescued the growth-suppressive effects induced by USP5 deletion. Correspondingly, Western blot analysis revealed reactivation of SLC7A11 expression in tumors from the Fer-1-treated sgUSP5 group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eJ).\u003c/p\u003e \u003cp\u003eCollectively, these findings demonstrate that USP5 depletion sensitizes CRC cells to ferroptosis and suppresses tumor progression in both patient-derived organoid and in vivo xenograft models, highlighting the USP5/YBX3-ferroptosis axis as a potential therapeutic target in CRC.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eFerroptosis is a new breakthrough in cancer therapy, and its occurrence significantly affects the physiological activity of cancer cells. Previous studies have shown that USP5 can target LSH to resist ferroptosis in liver cancer cells and promote the malignant transformation of tumors[\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. This study systematically investigates the role of USP5 in the progression of CRC and suggests that USP5 regulates ferroptosis resistance in CRC by lysosome-dependent degradation of YBX3, which in turn stabilizes the expression of SLC7A11. Although USP5 is widely recognized as a typical oncogene, its function and significance in CRC are yet to be clarified.\u003c/p\u003e \u003cp\u003eIn this study, we systematically screened 108 deubiquitinases (DUBs) and identified USP5 as a key regulatory factor of ferroptosis in CRC cells. Our research positions USP5 as a molecular regulator that balances cell survival and ferroptosis in CRC cells. Previous studies have indicated that USP5 plays an important role in cancer progression. For example, in breast cancer, USP5 promotes tumor progression by stabilizing HIF-2α, while in non-small cell lung cancer, USP5 enhances immune escape through PD-L1, promoting cancer development[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Furthermore, unlike other DUBs[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e], the deletion of USP5 significantly increased lipid peroxidation, mitochondrial membrane rupture, and Fe\u0026sup2;⁺ accumulation when treated with erastin, suggesting that USP5 regulates ferroptosis through a specific mechanism in CRC cells.\u003c/p\u003e \u003cp\u003eThe high expression of USP5 in CRC tissues and its role in promoting cell proliferation and migration indicate its multifunctional oncogenic properties. Notably, the ferroptosis inhibitor fer-1 partially restores cell growth in USP5 knockout cells, suggesting that USP5 not only acts through classical oncogenic pathways but also regulates the balance between tumor cell survival and death by modulating ferroptosis [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTraditionally, DUBs stabilize substrate proteins through deubiquitination[\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. For example, MSK1 increases Snail protein stability through USP5-mediated deubiquitination of Snail, promoting CRC metastasis[\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Studies have also shown that USP5 can promote the K48-linked polyubiquitination of NLRP3 via recruitment of the E3 ligase MARCHF7 and mediate its degradation in autophagy, inhibiting the inflammasome signaling pathway[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. This study further confirms the regulatory role of USP5 in autophagy. It is worth noting that the functional studies of USP5 are rapidly expanding, with its regulatory network involving DNA repair, inflammation, tumorigenesis, neurodegenerative diseases, and other areas[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. By dynamically balancing the stability and degradation of substrate proteins, USP5 reveals its multifunctional regulatory hub role in complex pathological networks such as cancer and inflammation, providing new perspectives for disease-targeted therapy.\u003c/p\u003e \u003cp\u003eYBX3 is involved in cellular stress responses and gene regulation, playing a crucial role in modulating key signaling pathways and stress-related mechanisms[\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. In hepatocellular carcinoma (HCC), YBX3 promotes tumor growth by enhancing cell survival under stress conditions through the regulation of oxidative stress responses and metabolic reprogramming.[\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. Closely associated with cell death mechanisms like autophagy, YBX3 also influences chemoresistance in breast cancer by affecting autophagy-related pathways. [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e, \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eSLC7A11, as the core subunit of the system Xc⁻, plays a pivotal role in determining a cell's sensitivity to ferroptosis[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. It is noteworthy that ferroptosis has a dual role in various cancer types: it can inhibit tumor growth through its cytotoxic effects or promote tumor survival through adaptive responses[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan additionalcitationids=\"CR58\" citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]. Dysregulation of iron metabolism is common in CRC, making cancer cells more sensitive to ferroptosis[\u003cspan additionalcitationids=\"CR61\" citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e]. This study found that USP5 stabilizes SLC7A11 and enhances its protein levels. Importantly, USP5\u0026rsquo;s regulation of SLC7A11 does not depend on direct interaction, but rather occurs indirectly through the downstream effector molecule YBX3. In contrast, in liver cancer, USP5 stabilizes SLC7A11 through deubiquitination[\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. This study reveals a mechanism by which USP5 regulates SLC7A11 independently of the ubiquitin system, expanding the regulatory network of SLC7A11 and further highlighting the heterogeneity of DUB functions in different cancers. Moreover, the positive correlation between USP5 and SLC7A11 provides theoretical support for clinical combination therapies (erastin and USP5 inhibitors).\u003c/p\u003e \u003cp\u003eThe interaction and co-localization of YBX3 and SLC7A11 establish the link between YBX3 and the regulation of ferroptosis. Unlike the mechanism in liver cancer where circPIAS1 inhibits ferroptosis through the miR-455-3p/NUPR1 axis, YBX3 directly targets SLC7A11 and destabilizes it through lysosomal degradation[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. In the context of USP5 knockout, silencing YBX3 restores SLC7A11 levels and rescues ferroptosis resistance, suggesting a strict hierarchical regulatory relationship within the USP5/YBX3/SLC7A11 axis.\u003c/p\u003e \u003cp\u003ePatient-derived organoids and xenograft models confirmed that USP5 knockout significantly inhibits tumor growth and enhances ferroptosis sensitivity, with fer-1 partially reversing this effect. These results resemble the efficacy of ferroptosis therapies targeting LSH in liver cancer and GPX4 inhibitors in glioma, yet the regulatory mechanism of the USP5/YBX3 axis is more specific[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Furthermore, the downregulation of SLC7A11 caused by USP5 loss suggests its potential as a biomarker for predicting the efficacy of ferroptosis inducers. Compared to traditional chemotherapy, inhibitors targeting the USP5/YBX3 interaction or the lysosomal pathway may reduce systemic toxicity, providing a new approach for the precision treatment of CRC.\u003c/p\u003e \u003cp\u003eIn conclusion, this study reveals the unique mechanism of the USP5/YBX3/SLC7A11 axis in regulating ferroptosis in CRC through multidimensional comparisons: USP5 stabilizes SLC7A11 by degrading YBX3 via the lysosomal pathway, balancing autophagy and ferroptosis(Figure \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). Compared to other cancers, USP5\u0026rsquo;s function shifts from relying on ubiquitination to utilizing the lysosomal pathway, and YBX3 transitions from a pro-survival factor to a ferroptosis-sensitive factor. These findings not only expand our understanding of the functional diversity of DUBs but also lay the theoretical foundation for the development of novel therapies targeting the lysosomal-ferroptosis axis. Future research should further explore whether YBX3 is influenced by other molecular chaperones or regulatory factors, and investigate the structural basis of the USP5/YBX3 interaction and its dynamic regulation in the tumor microenvironment to promote clinical translation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eReverse transcription\u003c/h2\u003e \u003cp\u003eTotal RNA was isolated from cells using Trizol reagent (Invitrogen, #15596-018CN) according to the manufacturer\u0026rsquo;s instructions. RNA was reverse transcribed into cDNA using the 1st Strand cDNA Synthesis Kit with gDNA wiper (Vazyme, #R312-01).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003ePrimers in PCR\u003c/h3\u003e\n\u003cp\u003eAll oligonucleotides, including PCR primers and shRNAs, were chemically synthesized by Tsingke Biotechnology (Beijing, China) using solid-phase phosphoramidite chemistry with HPLC purification (purity\u0026thinsp;\u0026gt;\u0026thinsp;98%).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eUSP5\u003c/em\u003e sgRNA1 Forward:\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecaccgTGTCAGTATTACCGACGATC\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eUSP5\u003c/em\u003e sgRNA1 Reverse:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eaaacGATCGTCGGTAATACTGACAc\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eUSP5\u003c/em\u003e sgRNA2 Forward:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecaccgTGGGCTTACCGGCGTGTCGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eUSP5\u003c/em\u003e sgRNA2 Reverse:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eaaacTCGACACGCCGGTAAGCCCAc\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eATG5\u003c/em\u003e sgRNA1 Forward:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eaaacTCAATCGGAAACTCATGGAAc\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eATG5\u003c/em\u003e sgRNA1 Reverse:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecaccgTTCCATGAGTTTCCGATTGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eATG5\u003c/em\u003e sgRNA2 Forward:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecaccgCCCTTTAGAATATATCAGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eATG5\u003c/em\u003e sgRNA2 Reverse:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eaaacACCTGATATATTCTAAAGGGc\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eUSP5\u003c/em\u003e Forward:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecgACGCGTATGGCGGAGCTGAGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eUSP5\u003c/em\u003e Reverse:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eccgCTCGAGGCTGGCCACTCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eUSP5-\u003c/em\u003eC335A Forward:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGGGTAACAGCgcCTACCTCAACTCTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eUSP5-\u003c/em\u003eC335A Reverse:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGAGTTGAGGTAGgcGCTGTTACCCAGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eUSP5 C-ZnF Reverse:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eccgctcgagTGCCTGCACCTCCTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eUSP5 ZnF Forward:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecgACGCGTATGTGGGATGGGGAAGTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eUSP5 ZnF Reverse:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eccgctcgagTGTCTTCTGCATCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eUSP5 C Box Forward:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecgACGCGTATGGACAAGACGATGACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eUSP5 C Box Reverse:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eccgctcgagCGGAGTGACCAGGGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eUSP5 U BA1 Forward:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecgACGCGTATGGATGAGCCCAAAGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eUSP5 U BA1 Reverse:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecgACGCGTATGGATGAGCCCAAAGGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eUSP5 H Box Forward:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecgACGCGTATGGACATCTCAGAGGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eYBX3\u003c/em\u003e shRNA1 Forward:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCGGCGGTTCATCGAAATCCAACTTCTCGAGAAGTTGGATTTCGATGAACCGTTTTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eYBX3\u003c/em\u003e shRNA1 Reverse:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAATTCAAAAACGGTTCATCGAAATCCAACTTCTCGAGAAGTTGGATTTCGATGAACCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eYBX3\u003c/em\u003e shRNA2 Forward:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCGGCCGTCTGTTCGCCGTGGATATCTCGAGATATCCACGGCGAACAGACGGTTTTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eYBX3\u003c/em\u003e shRNA2 Reverse:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAATTCAAAAACCGTCTGTTCGCCGTGGATATCTCGAGATATCCACGGCGAACAGACGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003ePlasmisd\u003c/h2\u003e \u003cp\u003ePlasmids encoding HA-tagged SLC7A11 (HA-SLC7A11) and HA-tagged YBX3 (HA-YBX3) were purchased from Miaoling Bioscience. Full-length, truncated, and deletion mutants of Flag-tagged USP5, as well as MYC-tagged SLC7A11 (MYC-SLC7A11), were constructed using standard molecular biology techniques.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eChemicals and reagents\u003c/h2\u003e \u003cp\u003eErastin (Selleck, S7242), Ferrostatin-1 (MedChemExpress, S7243), CHX (MedChemExpress, HY-12320), CQ (MedChemExpress, HY-17589A), FerroOrange (Cell Signaling Technology 36104S), LysoTracker\u0026trade; Probe (Maokangbio Company, MX4319-50UL), MG132 (Selleck, S2619), Protein A/G Beads 4FF (Smart-Lifesciences, SA032025).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eCo-immunoprecipitation and western blot analyses\u003c/h2\u003e \u003cp\u003eCells were harvested in NP40 lysis buffer containing 150 mM NaCl, 50 mM Tris-HCl pH 8.0, 1% NP40 supplemented with protease inhibitors (10 \u0026micro;g/mL aprotinin, 10 \u0026micro;g/mL leupeptin, and 1 mM phenylmethylsulfonyl fluoride), and the lysates were centrifuged at high speed to remove insoluble debris. Then, the proteins were incubated with indicated antibodies together with Protein A/G beads (Roche) for overnight at 4\u0026deg;C. And the beads were washed with IP wash buffer (200 mM NaCl, 50 mM Tris-HCl pH 8.0, 0.1% NP40) for three time and boiled with 1\u0026times; SDS loading buffer. The interacted proteins were detected using indicated primary antibodies. The primary antibodies used for western blot analysis are as follows: anti-USP5 (Proteintech, 10473-1-AP;1;3000), anti-YBX3 (Bethyl, A303-070A-T;1:2000), anti-SLC7A11 (Cell Signaling Technology, 98051;1:3000), anti-β-tubulin (Cell Signaling Technology, 2146;1:5000), anti-Flag (Smart-Lifesciences, SLAB0102;1: 5000), anti-HA (Smart-Lifesciences, SLAB0202;1:5000), anti-Myc (Abclonal, AE010;1:5000), anti-ATG5(Cell Signaling Technology, 12994;1:3000)\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eCell culture and transfection\u003c/h2\u003e \u003cp\u003eThe RKO, LoVo, HCT116, NCM460, HCT15, SW48, DLD1, SW480, HT29, and HEK293T cell lines were obtained from the China Center for Type Culture Collection (CCTCC). Cells were maintained under the culture conditions recommended by the supplier, which included appropriate growth media and incubation parameters. All cells were cultured at 37\u0026deg;C in Dulbecco\u0026rsquo;s Modified Eagle Medium (DMEM) with 10% fetal bovine serum (FBS) and 1% antibiotic (penicillin-streptomycin). FreeStyle\u0026trade; Max DNA in vitro transfection reagent (Signagen) was used for transfection. The FreeStyle\u0026trade; Max reagent and DNA (1:2 ratio) were mixed and diluted in serum free DMEM for 10\u0026thinsp;~\u0026thinsp;15 min at room temperature. The FreeStyle\u0026trade; Max-DNA mixture was then added to the subconfluent cell culture for cell transfection.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eMice\u003c/h2\u003e \u003cp\u003eFor xenograft tumor growth assays, female BALB/c nude mice aged 5\u0026ndash;6 weeks were utilized. All procedures involving animals adhered to the guidelines outlined in the Guide for the Care and Use of Laboratory Animals and were approved by the Institutional Animal Care and Use Committee of University of south China.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eCell viability and colony formation assay\u003c/h2\u003e \u003cp\u003eFor the CCK-8 assay, cells were plated in 96-well plates at an initial density of 1 \u0026times; 10\u0026sup3; cells per well. On days 1\u0026ndash;6, CCK-8 solution (Dojindo Laboratories, Kumamoto, Japan) was added to each well and incubated at 37\u0026deg;C for 1 hour. Cell viability was subsequently quantified by measuring absorbance at 450 nm using a spectrophotometer (ELx800, BioTek, USA). For the colony formation assay, cells were seeded in six-well plates at a density of 500 cells per well and cultured for 14 days or at 250 cells per well for 7 days. Colonies were then stained using crystal violet, followed by imaging for analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eXenograft tumor growth model\u003c/h2\u003e \u003cp\u003eA total of 5 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e HCT116 cells suspended in 200 \u0026micro;L of saline were subcutaneously injected into the dorsal flanks of mice. Tumor growth was monitored starting on day 5 post-inoculation, with measurements taken every two days along two perpendicular axes using a vernier caliper. Two weeks after inoculation, tumors were excised, weighed, and recorded following the euthanasia of the animals. For the drug administration study in vivo, mice were divided into two treatment groups: DMSO, fer-1. In the DMSO group, DMSO was diluted with 90% PBS; in the fer-1 group, 540 \u0026micro;L of fer-1 stock solution was taken, and 21,600 \u0026micro;L of PEG300, 2,700 \u0026micro;L of Tween 80, and 29160 \u0026micro;L of saline were added to dilute it to 0.5 mg/mL. All solutions were administered via intraperitoneal injection twice a week at the specified concentration. After three weeks of treatment, the mice were sacrificed, and subcutaneous tumors were isolated for further analysis. All solutions were administered via intraperitoneal injection at the specified concentrations twice a week. After three weeks of treatment, the mice were sacrificed, and the subcutaneous tumors were isolated for subsequent analyses.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eLipid Reactive Oxygen Species assay\u003c/h2\u003e \u003cp\u003eC11-BODIPY 581/591 (Thermo Fisher, D3861) was used to detect lipid peroxide levels. Cells were resuspended in PBS and incubated with the above probes at 37\u0026deg;C for 30 minutes, followed by analysis using flow cytometry (BeamCyte, FL-1026). Data analysis was performed with FlowJo software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eFerrous iron detection\u003c/h2\u003e \u003cp\u003eFerroOrange (Dojindo, F374) was used to assess intracellular Fe\u003csup\u003e2+\u003c/sup\u003e levels. Cells were cultured in a 96-well plate. After drug treatment, the supernatant was discarded. A working solution of FerroOrange at a concentration of 1 \u0026micro;mol/L was added, and the cells were incubated for 15 minutes in a 37\u0026deg;C incubator. Images were captured using the automated cell imaging system (ImageXpress Pico).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eTransmission electron microscopy\u003c/h2\u003e \u003cp\u003eHCT116 sgCtrl or HCT116 sgUSP5 cells (1 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e) were plated in 10 cm dishes. After 72 hours of treatment with DMSO or erastin, the cells were fixed using 3 mL of 2.5% glutaraldehyde at room temperature for 1 h. The cells were then centrifuged sequentially at 1000g, 3000g, 6000g, and 12000g for 5 minutes each and collected. Next, osmium tetroxide staining was performed on ice for 1 h in the dark. Following staining, cells were washed with uranyl acetate and incubated overnight at room temperature in darkness. After rinsing with ddH2O, ethanol gradient dehydration was applied. The dehydrated samples were then incubated in propylene oxide and resin mixtures at 1:1 and 1:2 ratios, followed by immersion in 100% resin for 4 h. The samples were subsequently placed in plastic molds and allowed to cure at 37\u0026deg;C overnight. At last, the samples were placed in a 65\u0026deg;C oven for 48 h. Ultrathin sections were prepared, and the samples were subsequently examined using electron microscopy.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence\u003c/h2\u003e \u003cp\u003eAfter transfection with Flag-USP5 and HA-YBX3 for 48 hours, the cells were stained with LysoTracker\u003csup\u003eTM\u003c/sup\u003eDeepRed (70 nM) at 37\u0026deg;C for 1 hour. After washing three times with PBS, the cells were fixed with 4% paraformaldehyde for 15 minutes and permeabilized with 0.5% Triton X-100 for 10 minutes. Subsequently, the cells were blocked at room temperature for 1 hour using blocking solution (0.3 g BSA\u0026thinsp;+\u0026thinsp;10 mL PBS\u0026thinsp;+\u0026thinsp;1 mL 0.5% Triton X-100) and incubated with primary antibodies (Flag, HA) overnight. The next day, the cells were incubated with secondary antibodies and stained with DAPI. After mounting, images were captured using a laser confocal microscope (Zeiss, LSM980).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eIP Mass Spectrometry Experiment\u003c/h2\u003e \u003cp\u003eThe IP-MS procedure was performed as follows: Cell lysates were prepared using lysis buffer supplemented with protease inhibitors, followed by sonication to enhance cell disruption. Protein concentration was quantified using either BCA or Bradford assay to ensure sufficient USP5 protein amounts. For proteolytic digestion, quantified USP5 samples were incubated with digestion buffer and trypsin at 37\u0026deg;C for 4h to overnight, with the reaction terminated by adding equal volume of acidic solution (e.g., TFA). Sample purification was conducted using C18 solid-phase extraction columns according to the manufacturer's protocol, including washing and elution steps, with subsequent solvent removal using nitrogen drying or lyophilization to obtain dried peptide samples. For MS analysis, dried peptides were reconstituted in MS-compatible solvent (0.1% FA in water/acetonitrile) and loaded via syringe injection. Mass spectrometer parameters (voltage, gas flow, temperature) were optimized for sample characteristics before data acquisition. Finally, raw data were processed using specialized software (MaxQuant/Mascot/Proteome Discoverer) for peptide identification, USP5 quantification, and subsequent bioinformatic analysis.\u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eFerrous iron detection\u003c/h2\u003e \u003cp\u003eFerroOrange (Dojindo, #F374) was used to assess intracellular Fe2\u0026thinsp;+\u0026thinsp;levels. Cells were cultured in a 96-well plate. After drug treatment, the supernatant was discarded. A working solution of FerroOrange at a concentration of 1 \u0026micro;mol/L was added, and the cells were incubated for 15 min in a 37\u0026deg;C incubator. Images were captured using the automated cell imaging system (ImageXpress Pico).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eCulture of CRC organoids\u003c/h2\u003e \u003cp\u003eColorectal tumor tissues were obtained postoperatively and processed in the laboratory. The specimens were initially washed with PBS and then mechanically dissociated into small fragments. These fragments were subsequently digested using Collagenase IV at 37\u0026deg;C for 1 h. The resulting cell suspension was passed through a 40 \u0026micro;m cell strainer to isolate single cells. The isolated cells were resuspended in Matrigel and seeded into 48-well plates. Organoids derived from patient colorectal tumors were cultured in Advanced DMEM/F12 medium (Gibco) supplemented with Primocin (InvivoGen), GlutaMax (Gibco), HEPES (Gibco), B27 (Gibco), N2 supplement (Gibco), SB202190 (MedChemExpress), Y27632 (MedChemExpress), Blebbistatin (MedChemExpress), CHIR99021 (MedChemExpress), A83-01 (Tocris Bioscience), and recombinant human R-Spondin-1 (rhR-Spondin-1; R\u0026amp;D Systems). The cultures were maintained at 37\u0026deg;C in a 5% CO2 atmosphere.\u003c/p\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003eCalcein/PI Viability Assay for CRC Organoids\u003c/h2\u003e \u003cp\u003eCRC organoids were seeded in 96-well plates and treated with DMSO or Erastin for 48 h prior to analysis. Following treatment, a working solution of Calcein AM/Propidium Iodide (PI) was prepared (Beyotime, #C2015M). After discarding the supernatant, 100 \u0026micro;L of the working solution was added to each well, and the plate was incubated at 37\u0026deg;C in the dark for 30 min. After incubation, fluorescence was observed using a fluorescence microscope (Calcein AM: green fluorescence, Ex/Em\u0026thinsp;=\u0026thinsp;494/517 nm; PI: red fluorescence, Ex/Em\u0026thinsp;=\u0026thinsp;535/617 nm).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section3\"\u003e \u003ch2\u003eATP Viability Assay for CRC Organoids\u003c/h2\u003e \u003cp\u003eCRC organoids were seeded in 96-well plates and treated with either DMSO or Erastin for 72 h. After treatment, cell viability was assessed using the Organoid Viability ATP Assay Kit (BioGenous, #E238003). The plate was removed from the incubator and equilibrated to room temperature for 10 min. An equal volume of detection reagent was added to each well (1:1 ratio). The plate was subjected to linear shaking at 1000 rpm for 5 min, followed by incubation at room temperature for 20 min. Chemiluminescence was measured at 560 nm using a microplate reader.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGuoqing Li and Xiaodong Zhang are responsible for the\u0026nbsp;conceptualization and funding acquisition; Haowen Qiu is responsible for the Investigation, Methodology, Supervision, Visualization, Writing \u0026ndash; original draft;\u0026nbsp;Yi Liu and Haimemg Zhou are\u0026nbsp;responsible for the Writing \u0026ndash; review \u0026amp; editing; Lingjuan Hu, Wei Qi, Honglu Ma, Yaoyi Liu and Le Li contributed to project administration; Nanyang Yang, Meiqin Huang and Runlei Du are responsible for the validation; Lijuan Meng, Feng Shi and Baiqi Wang are responsible for the visualization.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Natural Science Foundation of China (No. 32370777 to Runlei Du), the Natural Science Foundation of Guangxi Province (No. 2024GXNSFAA999020 to Xiaodong Zhang), the Natural Science Foundation of Hunan Province (No. 2021JJ40480 to Guoqing Li, No.\u0026nbsp;2025JJ50541\u0026nbsp;to Guoqing Li,\u0026nbsp;No. 2023JJ60049 to Baiqi Wang, No. 2024JJ6379 to Yi Liu), Scientific Research Project of the Hunan Education Department of China (No. 21A0268 to Guoqing Li), and the Fund Project of University of South China (No. 221RGC003 to Xiaodong Zhang).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eSiegel RL, Giaquinto AN, Jemal A. Cancer statistics, 2024. \u003cem\u003eCA Cancer J Clin\u003c/em\u003e 2024, \u003cstrong\u003e74\u003c/strong\u003e(1)\u003cstrong\u003e:\u003c/strong\u003e 12-49.\u003c/li\u003e\n\u003cli\u003eKocarnik JM, Compton K, Dean FE, Fu W, Gaw BL, Harvey JD\u003cem\u003e, et al.\u003c/em\u003e Cancer Incidence, Mortality, Years of Life Lost, Years Lived With Disability, and Disability-Adjusted Life Years for 29 Cancer Groups From 2010 to 2019: A Systematic Analysis for the Global Burden of Disease Study 2019. \u003cem\u003eJAMA Oncol\u003c/em\u003e 2022, \u003cstrong\u003e8\u003c/strong\u003e(3)\u003cstrong\u003e:\u003c/strong\u003e 420-444.\u003c/li\u003e\n\u003cli\u003ePatel SG, Karlitz JJ, Yen T, Lieu CH, Boland CR. The rising tide of early-onset colorectal cancer: a comprehensive review of epidemiology, clinical features, biology, risk factors, prevention, and early detection. \u003cem\u003eLancet Gastroenterol Hepatol\u003c/em\u003e 2022, \u003cstrong\u003e7\u003c/strong\u003e(3)\u003cstrong\u003e:\u003c/strong\u003e 262-274.\u003c/li\u003e\n\u003cli\u003eZheng RS, Chen R, Han BF, Wang SM, Li L, Sun KX\u003cem\u003e, et al.\u003c/em\u003e [Cancer incidence and mortality in China, 2022]. \u003cem\u003eZhonghua Zhong Liu Za Zhi\u003c/em\u003e 2024, \u003cstrong\u003e46\u003c/strong\u003e(3)\u003cstrong\u003e:\u003c/strong\u003e 221-231.\u003c/li\u003e\n\u003cli\u003eShin AE, Giancotti FG, Rustgi AK. Metastatic colorectal cancer: mechanisms and emerging therapeutics. \u003cem\u003eTrends Pharmacol Sci\u003c/em\u003e 2023, \u003cstrong\u003e44\u003c/strong\u003e(4)\u003cstrong\u003e:\u003c/strong\u003e 222-236.\u003c/li\u003e\n\u003cli\u003ePomeroy AE, Schmidt EV, Sorger PK, Palmer AC. Drug independence and the curability of cancer by combination chemotherapy. \u003cem\u003eTrends Cancer\u003c/em\u003e 2022, \u003cstrong\u003e8\u003c/strong\u003e(11)\u003cstrong\u003e:\u003c/strong\u003e 915-929.\u003c/li\u003e\n\u003cli\u003eVasan N, Baselga J, Hyman DM. A view on drug resistance in cancer. \u003cem\u003eNature\u003c/em\u003e 2019, \u003cstrong\u003e575\u003c/strong\u003e(7782)\u003cstrong\u003e:\u003c/strong\u003e 299-309.\u003c/li\u003e\n\u003cli\u003eLuo M, Yang X, Chen HN, Nice EC, Huang C. Drug resistance in colorectal cancer: An epigenetic overview. \u003cem\u003eBiochim Biophys Acta Rev Cancer\u003c/em\u003e 2021, \u003cstrong\u003e1876\u003c/strong\u003e(2)\u003cstrong\u003e:\u003c/strong\u003e 188623.\u003c/li\u003e\n\u003cli\u003eOyelere AM, Kok DE, Bos D, Gunter MJ, Ferrari P, Keski-Rahkonen P\u003cem\u003e, et al.\u003c/em\u003e Coffee consumption is associated with a reduced risk of colorectal cancer recurrence and all-cause mortality. \u003cem\u003eInt J Cancer\u003c/em\u003e 2024, \u003cstrong\u003e154\u003c/strong\u003e(12)\u003cstrong\u003e:\u003c/strong\u003e 2054-2063.\u003c/li\u003e\n\u003cli\u003eStockwell BR, Friedmann Angeli JP, Bayir H, Bush AI, Conrad M, Dixon SJ\u003cem\u003e, et al.\u003c/em\u003e Ferroptosis: A Regulated Cell Death Nexus Linking Metabolism, Redox Biology, and Disease. \u003cem\u003eCell\u003c/em\u003e 2017, \u003cstrong\u003e171\u003c/strong\u003e(2)\u003cstrong\u003e:\u003c/strong\u003e 273-285.\u003c/li\u003e\n\u003cli\u003eDixon SJ, Lemberg KM, Lamprecht MR, Skouta R, Zaitsev EM, Gleason CE\u003cem\u003e, et al.\u003c/em\u003e Ferroptosis: an iron-dependent form of nonapoptotic cell death. \u003cem\u003eCell\u003c/em\u003e 2012, \u003cstrong\u003e149\u003c/strong\u003e(5)\u003cstrong\u003e:\u003c/strong\u003e 1060-1072.\u003c/li\u003e\n\u003cli\u003eYu Y, Yan Y, Niu F, Wang Y, Chen X, Su G\u003cem\u003e, et al.\u003c/em\u003e Ferroptosis: a cell death connecting oxidative stress, inflammation and cardiovascular diseases. \u003cem\u003eCell Death Discov\u003c/em\u003e 2021, \u003cstrong\u003e7\u003c/strong\u003e(1)\u003cstrong\u003e:\u003c/strong\u003e 193.\u003c/li\u003e\n\u003cli\u003eLiu Y, Lu S, Wu LL, Yang L, Yang L, Wang J. The diversified role of mitochondria in ferroptosis in cancer. \u003cem\u003eCell Death Dis\u003c/em\u003e 2023, \u003cstrong\u003e14\u003c/strong\u003e(8)\u003cstrong\u003e:\u003c/strong\u003e 519.\u003c/li\u003e\n\u003cli\u003eHassannia B, Vandenabeele P, Vanden Berghe T. Targeting Ferroptosis to Iron Out Cancer. \u003cem\u003eCancer Cell\u003c/em\u003e 2019, \u003cstrong\u003e35\u003c/strong\u003e(6)\u003cstrong\u003e:\u003c/strong\u003e 830-849.\u003c/li\u003e\n\u003cli\u003eZheng J, Conrad M. The Metabolic Underpinnings of Ferroptosis. \u003cem\u003eCell Metab\u003c/em\u003e 2020, \u003cstrong\u003e32\u003c/strong\u003e(6)\u003cstrong\u003e:\u003c/strong\u003e 920-937.\u003c/li\u003e\n\u003cli\u003eJiang X, Stockwell BR, Conrad M. Ferroptosis: mechanisms, biology and role in disease. \u003cem\u003eNat Rev Mol Cell Biol\u003c/em\u003e 2021, \u003cstrong\u003e22\u003c/strong\u003e(4)\u003cstrong\u003e:\u003c/strong\u003e 266-282.\u003c/li\u003e\n\u003cli\u003eXie Y, Hou W, Song X, Yu Y, Huang J, Sun X\u003cem\u003e, et al.\u003c/em\u003e Ferroptosis: process and function. \u003cem\u003eCell Death Differ\u003c/em\u003e 2016, \u003cstrong\u003e23\u003c/strong\u003e(3)\u003cstrong\u003e:\u003c/strong\u003e 369-379.\u003c/li\u003e\n\u003cli\u003eChen Q, Zheng W, Guan J, Liu H, Dan Y, Zhu L\u003cem\u003e, et al.\u003c/em\u003e SOCS2-enhanced ubiquitination of SLC7A11 promotes ferroptosis and radiosensitization in hepatocellular carcinoma. \u003cem\u003eCell Death Differ\u003c/em\u003e 2023, \u003cstrong\u003e30\u003c/strong\u003e(1)\u003cstrong\u003e:\u003c/strong\u003e 137-151.\u003c/li\u003e\n\u003cli\u003eChen X, Kang R, Kroemer G, Tang D. Broadening horizons: the role of ferroptosis in cancer. \u003cem\u003eNat Rev Clin Oncol\u003c/em\u003e 2021, \u003cstrong\u003e18\u003c/strong\u003e(5)\u003cstrong\u003e:\u003c/strong\u003e 280-296.\u003c/li\u003e\n\u003cli\u003eZhou X, An B, Lin Y, Ni Y, Zhao X, Liang X. Molecular mechanisms of ROS-modulated cancer chemoresistance and therapeutic strategies. \u003cem\u003eBiomed Pharmacother\u003c/em\u003e 2023, \u003cstrong\u003e165:\u003c/strong\u003e 115036.\u003c/li\u003e\n\u003cli\u003eChen X, Li J, Kang R, Klionsky DJ, Tang D. Ferroptosis: machinery and regulation. \u003cem\u003eAutophagy\u003c/em\u003e 2021, \u003cstrong\u003e17\u003c/strong\u003e(9)\u003cstrong\u003e:\u003c/strong\u003e 2054-2081.\u003c/li\u003e\n\u003cli\u003eRen Y, Mao X, Xu H, Dang Q, Weng S, Zhang Y\u003cem\u003e, et al.\u003c/em\u003e Ferroptosis and EMT: key targets for combating cancer progression and therapy resistance. \u003cem\u003eCell Mol Life Sci\u003c/em\u003e 2023, \u003cstrong\u003e80\u003c/strong\u003e(9)\u003cstrong\u003e:\u003c/strong\u003e 263.\u003c/li\u003e\n\u003cli\u003eGuan X, Wang Y, Yu W, Wei Y, Lu Y, Dai E\u003cem\u003e, et al.\u003c/em\u003e Blocking Ubiquitin-Specific Protease 7 Induces Ferroptosis in Gastric Cancer via Targeting Stearoyl-CoA Desaturase. \u003cem\u003eAdv Sci (Weinh)\u003c/em\u003e 2024, \u003cstrong\u003e11\u003c/strong\u003e(18)\u003cstrong\u003e:\u003c/strong\u003e e2307899.\u003c/li\u003e\n\u003cli\u003eZhang XY, Li SS, Gu YR, Xiao LX, Ma XY, Chen XR\u003cem\u003e, et al.\u003c/em\u003e CircPIAS1 promotes hepatocellular carcinoma progression by inhibiting ferroptosis via the miR-455-3p/NUPR1/FTH1 axis. \u003cem\u003eMol Cancer\u003c/em\u003e 2024, \u003cstrong\u003e23\u003c/strong\u003e(1)\u003cstrong\u003e:\u003c/strong\u003e 113.\u003c/li\u003e\n\u003cli\u003eWang Y, Zhang Z, Sun W, Zhang J, Xu Q, Zhou X\u003cem\u003e, et al.\u003c/em\u003e Ferroptosis in colorectal cancer: Potential mechanisms and effective therapeutic targets. \u003cem\u003eBiomed Pharmacother\u003c/em\u003e 2022, \u003cstrong\u003e153:\u003c/strong\u003e 113524.\u003c/li\u003e\n\u003cli\u003eHua Y, Yang S, Zhang Y, Li J, Wang M, Yeerkenbieke P\u003cem\u003e, et al.\u003c/em\u003e Modulating ferroptosis sensitivity: environmental and cellular targets within the tumor microenvironment. \u003cem\u003eJ Exp Clin Cancer Res\u003c/em\u003e 2024, \u003cstrong\u003e43\u003c/strong\u003e(1)\u003cstrong\u003e:\u003c/strong\u003e 19.\u003c/li\u003e\n\u003cli\u003eZhang Y, Shi J, Liu X, Feng L, Gong Z, Koppula P\u003cem\u003e, et al.\u003c/em\u003e BAP1 links metabolic regulation of ferroptosis to tumour suppression. \u003cem\u003eNat Cell Biol\u003c/em\u003e 2018, \u003cstrong\u003e20\u003c/strong\u003e(10)\u003cstrong\u003e:\u003c/strong\u003e 1181-1192.\u003c/li\u003e\n\u003cli\u003eFriedmann Angeli JP, Krysko DV, Conrad M. Ferroptosis at the crossroads of cancer-acquired drug resistance and immune evasion. \u003cem\u003eNat Rev Cancer\u003c/em\u003e 2019, \u003cstrong\u003e19\u003c/strong\u003e(7)\u003cstrong\u003e:\u003c/strong\u003e 405-414.\u003c/li\u003e\n\u003cli\u003eSun T, Liu Z, Yang Q. The role of ubiquitination and deubiquitination in cancer metabolism. \u003cem\u003eMol Cancer\u003c/em\u003e 2020, \u003cstrong\u003e19\u003c/strong\u003e(1)\u003cstrong\u003e:\u003c/strong\u003e 146.\u003c/li\u003e\n\u003cli\u003eNing F, Xin H, Liu J, Lv C, Xu X, Wang M\u003cem\u003e, et al.\u003c/em\u003e Structure and function of USP5: Insight into physiological and pathophysiological roles. \u003cem\u003ePharmacol Res\u003c/em\u003e 2020, \u003cstrong\u003e157:\u003c/strong\u003e 104557.\u003c/li\u003e\n\u003cli\u003eGu J, Chen C, He P, Du Y, Zhu B. Unraveling the Immune Regulatory Functions of USP5: Implications for Disease Therapy. \u003cem\u003eBiomolecules\u003c/em\u003e 2024, \u003cstrong\u003e14\u003c/strong\u003e(6).\u003c/li\u003e\n\u003cli\u003eHill J, Nyathi Y. USP5 enhances SGTA mediated protein quality control. \u003cem\u003ePLoS One\u003c/em\u003e 2022, \u003cstrong\u003e17\u003c/strong\u003e(7)\u003cstrong\u003e:\u003c/strong\u003e e0257786.\u003c/li\u003e\n\u003cli\u003eChen Y, Xue H, Jin J. Applications of protein ubiquitylation and deubiquitylation in drug discovery. \u003cem\u003eJ Biol Chem\u003c/em\u003e 2024, \u003cstrong\u003e300\u003c/strong\u003e(5)\u003cstrong\u003e:\u003c/strong\u003e 107264.\u003c/li\u003e\n\u003cli\u003eHuang W, Liu X, Zhang Y, Deng M, Li G, Chen G\u003cem\u003e, et al.\u003c/em\u003e USP5 promotes breast cancer cell proliferation and metastasis by stabilizing HIF2\u0026alpha;. \u003cem\u003eJ Cell Physiol\u003c/em\u003e 2022, \u003cstrong\u003e237\u003c/strong\u003e(4)\u003cstrong\u003e:\u003c/strong\u003e 2211-2219.\u003c/li\u003e\n\u003cli\u003ePan J, Qiao Y, Chen C, Zang H, Zhang X, Qi F\u003cem\u003e, et al.\u003c/em\u003e USP5 facilitates non-small cell lung cancer progression through stabilization of PD-L1. \u003cem\u003eCell Death Dis\u003c/em\u003e 2021, \u003cstrong\u003e12\u003c/strong\u003e(11)\u003cstrong\u003e:\u003c/strong\u003e 1051.\u003c/li\u003e\n\u003cli\u003eZhang HH, Zhang AQ, Peng P, Huang L, Liu CY, Nie XR\u003cem\u003e, et al.\u003c/em\u003e USP5 facilitates bladder cancer progression by stabilizing the c-Jun protein. \u003cem\u003eCancer Cell Int\u003c/em\u003e 2024, \u003cstrong\u003e24\u003c/strong\u003e(1)\u003cstrong\u003e:\u003c/strong\u003e 32.\u003c/li\u003e\n\u003cli\u003eXie X, Matsumoto S, Endo A, Fukushima T, Kawahara H, Saeki Y\u003cem\u003e, et al.\u003c/em\u003e Deubiquitylases USP5 and USP13 are recruited to and regulate heat-induced stress granules through their deubiquitylating activities. \u003cem\u003eJ Cell Sci\u003c/em\u003e 2018, \u003cstrong\u003e131\u003c/strong\u003e(8).\u003c/li\u003e\n\u003cli\u003eShi S, Pan X, Chen M, Zhang L, Zhang S, Wang X\u003cem\u003e, et al.\u003c/em\u003e USP5 promotes lipopolysaccharide-induced apoptosis and inflammatory response by stabilizing the TXNIP protein. \u003cem\u003eHepatol Commun\u003c/em\u003e 2023, \u003cstrong\u003e7\u003c/strong\u003e(8).\u003c/li\u003e\n\u003cli\u003eLiu Y, Wang WM, Lu YF, Feng L, Li L, Pan MZ\u003cem\u003e, et al.\u003c/em\u003e Usp5 functions as an oncogene for stimulating tumorigenesis in hepatocellular carcinoma. \u003cem\u003eOncotarget\u003c/em\u003e 2017, \u003cstrong\u003e8\u003c/strong\u003e(31)\u003cstrong\u003e:\u003c/strong\u003e 50655-50664.\u003c/li\u003e\n\u003cli\u003eZheng Y, Wang L, Niu X, Guo Y, Zhao J, Li L\u003cem\u003e, et al.\u003c/em\u003e EOAI, a ubiquitin-specific peptidase 5 inhibitor, prevents non-small cell lung cancer progression by inducing DNA damage. \u003cem\u003eBMC Cancer\u003c/em\u003e 2023, \u003cstrong\u003e23\u003c/strong\u003e(1)\u003cstrong\u003e:\u003c/strong\u003e 28.\u003c/li\u003e\n\u003cli\u003eNakajima S, Lan L, Wei L, Hsieh CL, Rapić-Otrin V, Yasui A\u003cem\u003e, et al.\u003c/em\u003e Ubiquitin-specific protease 5 is required for the efficient repair of DNA double-strand breaks. \u003cem\u003ePLoS One\u003c/em\u003e 2014, \u003cstrong\u003e9\u003c/strong\u003e(1)\u003cstrong\u003e:\u003c/strong\u003e e84899.\u003c/li\u003e\n\u003cli\u003eHwang J, Park A, Kim C, Kim CG, Kwak J, Kim B\u003cem\u003e, et al.\u003c/em\u003e Inhibition of IRP2-dependent reprogramming of iron metabolism suppresses tumor growth in colorectal cancer. \u003cem\u003eCell Commun Signal\u003c/em\u003e 2024, \u003cstrong\u003e22\u003c/strong\u003e(1)\u003cstrong\u003e:\u003c/strong\u003e 412.\u003c/li\u003e\n\u003cli\u003eZhang Z, Ji Y, Hu N, Yu Q, Zhang X, Li J\u003cem\u003e, et al.\u003c/em\u003e Ferroptosis-induced anticancer effect of resveratrol with a biomimetic nano-delivery system in colorectal cancer treatment. \u003cem\u003eAsian J Pharm Sci\u003c/em\u003e 2022, \u003cstrong\u003e17\u003c/strong\u003e(5)\u003cstrong\u003e:\u003c/strong\u003e 751-766.\u003c/li\u003e\n\u003cli\u003eYan B, Guo J, Wang Z, Ning J, Wang H, Shu L\u003cem\u003e, et al.\u003c/em\u003e The ubiquitin-specific protease 5 mediated deubiquitination of LSH links metabolic regulation of ferroptosis to hepatocellular carcinoma progression. \u003cem\u003eMedComm (2020)\u003c/em\u003e 2023, \u003cstrong\u003e4\u003c/strong\u003e(4)\u003cstrong\u003e:\u003c/strong\u003e e337.\u003c/li\u003e\n\u003cli\u003eLu L, Jifu C, Xia J, Wang J. E3 ligases and DUBs target ferroptosis: A potential therapeutic strategy for neurodegenerative diseases. \u003cem\u003eBiomed Pharmacother\u003c/em\u003e 2024, \u003cstrong\u003e175:\u003c/strong\u003e 116753.\u003c/li\u003e\n\u003cli\u003eD\u0026apos;Arcy P, Wang X, Linder S. Deubiquitinase inhibition as a cancer therapeutic strategy. \u003cem\u003ePharmacol Ther\u003c/em\u003e 2015, \u003cstrong\u003e147:\u003c/strong\u003e 32-54.\u003c/li\u003e\n\u003cli\u003eHan S, Yu C, Qiu M, Xiong X, Peng H, Song X\u003cem\u003e, et al.\u003c/em\u003e USP13 regulates ferroptosis in chicken follicle granulosa cells by deubiquitinating ATG7. \u003cem\u003ePoult Sci\u003c/em\u003e 2024, \u003cstrong\u003e103\u003c/strong\u003e(11)\u003cstrong\u003e:\u003c/strong\u003e 104209.\u003c/li\u003e\n\u003cli\u003eChen H, Ferguson CJ, Mitchell DC, Risch I, Titus A, Paulo JA\u003cem\u003e, et al.\u003c/em\u003e The Hao-Fountain syndrome protein USP7 regulates neuronal connectivity in the brain via a novel p53-independent ubiquitin signaling pathway. \u003cem\u003eCell Rep\u003c/em\u003e 2025, \u003cstrong\u003e44\u003c/strong\u003e(2)\u003cstrong\u003e:\u003c/strong\u003e 115231.\u003c/li\u003e\n\u003cli\u003eHong KS, Ryu KJ, Kim H, Kim M, Park SH, Kim T\u003cem\u003e, et al.\u003c/em\u003e MSK1 promotes colorectal cancer metastasis by increasing Snail protein stability through USP5-mediated Snail deubiquitination. \u003cem\u003eExp Mol Med\u003c/em\u003e 2025.\u003c/li\u003e\n\u003cli\u003eCai B, Zhao J, Zhang Y, Liu Y, Ma C, Yi F\u003cem\u003e, et al.\u003c/em\u003e USP5 attenuates NLRP3 inflammasome activation by promoting autophagic degradation of NLRP3. \u003cem\u003eAutophagy\u003c/em\u003e 2022, \u003cstrong\u003e18\u003c/strong\u003e(5)\u003cstrong\u003e:\u003c/strong\u003e 990-1004.\u003c/li\u003e\n\u003cli\u003ePetruzzelli R, Gaudino S, Amendola G, Sessa R, Puzone S, Di Concilio R\u003cem\u003e, et al.\u003c/em\u003e Role of the cold shock domain protein A in the transcriptional regulation of HBG expression. \u003cem\u003eBr J Haematol\u003c/em\u003e 2010, \u003cstrong\u003e150\u003c/strong\u003e(6)\u003cstrong\u003e:\u003c/strong\u003e 689-699.\u003c/li\u003e\n\u003cli\u003eLiu RT, Wang GR, Liu C, Qiu J, Yan LK, Li XJ\u003cem\u003e, et al.\u003c/em\u003e RNAi-mediated downregulation of DNA binding protein A inhibits tumorigenesis in colorectal cancer. \u003cem\u003eInt J Mol Med\u003c/em\u003e 2016, \u003cstrong\u003e38\u003c/strong\u003e(3)\u003cstrong\u003e:\u003c/strong\u003e 703-712.\u003c/li\u003e\n\u003cli\u003eYasen M, Obulhasim G, Kajino K, Mogushi K, Mizushima H, Tanaka S\u003cem\u003e, et al.\u003c/em\u003e DNA binding protein A expression and methylation status in hepatocellular carcinoma and the adjacent tissue. \u003cem\u003eInt J Oncol\u003c/em\u003e 2012, \u003cstrong\u003e40\u003c/strong\u003e(3)\u003cstrong\u003e:\u003c/strong\u003e 789-797.\u003c/li\u003e\n\u003cli\u003ePan W, Wang L, Zhang XF, Zhang H, Zhang J, Wang G\u003cem\u003e, et al.\u003c/em\u003e Hypoxia-induced microRNA-191 contributes to hepatic ischemia/reperfusion injury through the ZONAB/Cyclin D1 axis. \u003cem\u003eCell Death Differ\u003c/em\u003e 2019, \u003cstrong\u003e26\u003c/strong\u003e(2)\u003cstrong\u003e:\u003c/strong\u003e 291-305.\u003c/li\u003e\n\u003cli\u003eLuciani A, Festa BP, Chen Z, Devuyst O. Defective autophagy degradation and abnormal tight junction-associated signaling drive epithelial dysfunction in cystinosis. \u003cem\u003eAutophagy\u003c/em\u003e 2018, \u003cstrong\u003e14\u003c/strong\u003e(7)\u003cstrong\u003e:\u003c/strong\u003e 1157-1159.\u003c/li\u003e\n\u003cli\u003eQin HL, Wang XJ, Yang BX, Du B, Yun XL. Notoginsenoside R1 attenuates breast cancer progression by targeting CCND2 and YBX3. \u003cem\u003eChin Med J (Engl)\u003c/em\u003e 2021, \u003cstrong\u003e134\u003c/strong\u003e(5)\u003cstrong\u003e:\u003c/strong\u003e 546-554.\u003c/li\u003e\n\u003cli\u003eJiang L, Kon N, Li T, Wang SJ, Su T, Hibshoosh H\u003cem\u003e, et al.\u003c/em\u003e Ferroptosis as a p53-mediated activity during tumour suppression. \u003cem\u003eNature\u003c/em\u003e 2015, \u003cstrong\u003e520\u003c/strong\u003e(7545)\u003cstrong\u003e:\u003c/strong\u003e 57-62.\u003c/li\u003e\n\u003cli\u003eZhou Q, Meng Y, Li D, Yao L, Le J, Liu Y\u003cem\u003e, et al.\u003c/em\u003e Ferroptosis in cancer: From molecular mechanisms to therapeutic strategies. \u003cem\u003eSignal Transduct Target Ther\u003c/em\u003e 2024, \u003cstrong\u003e9\u003c/strong\u003e(1)\u003cstrong\u003e:\u003c/strong\u003e 55.\u003c/li\u003e\n\u003cli\u003eZhao L, Zhou X, Xie F, Zhang L, Yan H, Huang J\u003cem\u003e, et al.\u003c/em\u003e Ferroptosis in cancer and cancer immunotherapy. \u003cem\u003eCancer Commun (Lond)\u003c/em\u003e 2022, \u003cstrong\u003e42\u003c/strong\u003e(2)\u003cstrong\u003e:\u003c/strong\u003e 88-116.\u003c/li\u003e\n\u003cli\u003eChen P, Li X, Zhang R, Liu S, Xiang Y, Zhang M\u003cem\u003e, et al.\u003c/em\u003e Combinative treatment of \u0026beta;-elemene and cetuximab is sensitive to KRAS mutant colorectal cancer cells by inducing ferroptosis and inhibiting epithelial-mesenchymal transformation. \u003cem\u003eTheranostics\u003c/em\u003e 2020, \u003cstrong\u003e10\u003c/strong\u003e(11)\u003cstrong\u003e:\u003c/strong\u003e 5107-5119.\u003c/li\u003e\n\u003cli\u003eZhang C, Liu X, Jin S, Chen Y, Guo R. Ferroptosis in cancer therapy: a novel approach to reversing drug resistance. \u003cem\u003eMol Cancer\u003c/em\u003e 2022, \u003cstrong\u003e21\u003c/strong\u003e(1)\u003cstrong\u003e:\u003c/strong\u003e 47.\u003c/li\u003e\n\u003cli\u003eYan H, Talty R, Aladelokun O, Bosenberg M, Johnson CH. Ferroptosis in colorectal cancer: a future target? \u003cem\u003eBr J Cancer\u003c/em\u003e 2023, \u003cstrong\u003e128\u003c/strong\u003e(8)\u003cstrong\u003e:\u003c/strong\u003e 1439-1451.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"cell-death-and-disease","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cddis","sideBox":"Learn more about [Cell Death \u0026 Disease](http://www.nature.com/cddis/)","snPcode":"41419","submissionUrl":"https://mts-cddis.nature.com/cgi-bin/main.plex","title":"Cell Death \u0026 Disease","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"USP5, YBX3, ferroptosis, lysosome degradation, colorectal cancer","lastPublishedDoi":"10.21203/rs.3.rs-6569374/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6569374/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eColorectal cancer(CRC)is the third most common malignant tumor globally and has become a major public health issue, posing a severe threat to human health. Ferroptosis, an iron-dependent form of regulated cell death, has emerged as a promising therapeutic target in CRC treatment. Despite its significant clinical potential, the precise regulatory mechanisms underlying ferroptosis, particularly its role in ferroptosis within CRC, remain to be fully elucidated. Previous studies, including our own work, have revealed that various deubiquitinases (DUBs) are involved in regulating cellular processes; however, the specific mechanisms by which these enzymes contribute to ferroptosis in CRC remain unclear. In this study, we identify USP5 as a key regulator of ferroptosis in CRC. Traditionally recognized as a deubiquitinase, USP5 modulates cellular physiological activities through deubiquitination. However, our findings show that USP5, distinct from its conventional deubiquitination function, suppresses ferroptosis by promoting the lysosomal degradation of YBX3 (Y-box binding protein 3). Under normal conditions, YBX3 facilitates the degradation of SLC7A11 (solute carrier family 7 member 11), whereas USP5 mediates YBX3 degradation, thereby stabilizing SLC7A11, enhancing CRC cell survival, and promoting tumor progression. In patient-derived organoid and xenograft models, USP5 knockout significantly increased the sensitivity of cancer cells to ferroptosis and inhibited tumor growth. Moreover, additional knockout of YBX3 restored the stability of SLC7A11, highlighting the complex regulatory network between USP5, YBX3, and SLC7A11. Systematic functional assays and mechanistic studies further confirmed that the USP5/YBX3/SLC7A11 axis is a central pathway for ferroptosis resistance in CRC. These findings offer new insights into therapeutic strategies for CRC, particularly in the context of ferroptosis-targeting therapies.\u003c/p\u003e","manuscriptTitle":"USP5 Regulates Ferroptosis in Colorectal Cancer by Targeting the YBX3/SLC7A11 Axis Through Lysosomal Degradation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-05-23 06:59:43","doi":"10.21203/rs.3.rs-6569374/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2025-06-02T14:42:49+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2025-05-30T14:44:10+00:00","index":1,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2025-05-27T08:38:13+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2025-05-21T13:00:36+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2025-05-20T16:12:56+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2025-05-20T15:58:15+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-05-01T13:42:07+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cell Death \u0026 Disease","date":"2025-05-01T05:33:05+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-05-01T05:33:05+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"cell-death-and-disease","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cddis","sideBox":"Learn more about [Cell Death \u0026 Disease](http://www.nature.com/cddis/)","snPcode":"41419","submissionUrl":"https://mts-cddis.nature.com/cgi-bin/main.plex","title":"Cell Death \u0026 Disease","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"d2a2d890-3d96-4d5f-bc1c-c37b7dd53995","owner":[],"postedDate":"May 23rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":48808302,"name":"Biological sciences/Cancer/Oncogenes"},{"id":48808303,"name":"Biological sciences/Cell biology/Cell death"}],"tags":[],"updatedAt":"2025-11-11T08:11:38+00:00","versionOfRecord":{"articleIdentity":"rs-6569374","link":"https://doi.org/10.1038/s41419-025-08146-2","journal":{"identity":"cell-death-and-disease","isVorOnly":false,"title":"Cell Death \u0026 Disease"},"publishedOn":"2025-11-10 05:00:00","publishedOnDateReadable":"November 10th, 2025"},"versionCreatedAt":"2025-05-23 06:59:43","video":"","vorDoi":"10.1038/s41419-025-08146-2","vorDoiUrl":"https://doi.org/10.1038/s41419-025-08146-2","workflowStages":[]},"version":"v1","identity":"rs-6569374","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6569374","identity":"rs-6569374","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00