Reduced activity of an immunogenic macromolecule Amylase Trypsin inhibitor (ATI) in wheat through CRISPR/Cas9 mediated multiple gene editing | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Reduced activity of an immunogenic macromolecule Amylase Trypsin inhibitor (ATI) in wheat through CRISPR/Cas9 mediated multiple gene editing Sachin Phogat, Ankur Poudel, Gayatri, Megha Kaushik, Jayanthi Madhavan, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5899900/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Wheat is the staple food for 40% of the world, providing 20% of dietary energy and protein. However, along with providing nutrition, wheat contains several anti-nutritional macromolecules. Amylase/Trypsin inhibitors (ATIs) are one such macromolecular proteins which have been known to cause allergic reactions like baker's asthma, auto-immunogenic reactions like Non-Celiac Wheat Sensitivity, and primary triggers for Celiac Disease in some predisposed humans. Bread wheat varieties without ATI molecules or with reduced activity have not yet been developed. Here, multiple genes of major ATI protein molecules were mutated using tRNA-based multiplex CRISPR/Cas9 genome editing technology. ATI proteins were extracted from wheat flours of gene-edited wheat lines along with unedited plants and subjected to quantification, detection by SDS-PAGE, fractionation by HPLC, and assayed the α-amylase and trypsin inhibition activity. Gene-edited Bobwhite wheat plant produced seeds with reduced (up to 30.61%) ATI content, which resulted in a reduction in α-amylase and trypsin inhibition activity to 50.74% and 44.90%, respectively. Another variety of bread wheat HD2967 also showed a significant reduction in ATIs content as well as a reduction in α-amylase and trypsin inhibition activity. This result suggests the possibility of developing low immunogenic wheat lines by multiple gene editing for the immunogenic macromolecules. Molecular Biology Biotechnology and Bioengineering Plant Molecular Biology and Genetics Immunogenic macromolecule Amylase/Trypsin inhibitors Multiplex Genome editing Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 1. Introduction Wheat has been a staple crop for centuries, providing energy and essential nutrients to human populations. Wheat grain is rich in carbohydrates, proteins, vitamins, minerals, fibres and trace elements [ 1 – 3 ]. Though wheat is consumed mainly as a source of carbohydrates, it also accounts for ∼20% of worldwide dietary protein [ 2 – 4 ]. Wheat proteins are broadly categorised into gluten (storage) and non-gluten (structural/ functional) fractions based on Osborne fractionation [ 5 ]. Gluten proteins provide viscoelastic properties to wheat flour, which makes it a unique component for various food products. Unfortunately, along with nutritional benefits, wheat also causes severe immunological disorders including auto-immune celiac disease (CD), allergic sensitivities like wheat-dependent exercise-induced anaphylaxis (WDEIA), baker’s asthma, irritable bowel syndrome (IBS), non-celiac wheat sensitivity (NCWS) [ 6 – 9 ]. CD is an autoimmune disease associated with chronic diarrhoea, malnutrition and abdominal distension [ 10 ], occur due to the small intestinal enteropathy induced by dietary gluten peptides from wheat, barley and rye in persons having human leucocyte antigen HLA-DQ2/8 as a major genetic predisposition. To prevent symptoms, people with CD must adhere to a gluten-free (GF) diet, which means no wheat, barley, or rye products in their food. Many processed non-wheat foods also contain gluten for its elastic property, and hence, maintaining a gluten-free diet is very challenging [ 11 ]. Efforts are being made to develop no or reduced gluten-containing wheat. Gil-Humanes et al. employed RNA interference to reduce the gliadin content and found the γ- gliadin was substantially reduced. Several allergenic epitopes of α-, γ-, and ω- gliadins in bread wheat were silenced using RNAi technology [ 12 ]. Other than gluten proteins, the water-soluble (albumin) fraction of wheat consists of most abundant protein molecules, Amylase/trypsin inhibitors (ATIs) [ 13 ], which mainly work as a plant defence system to protect starch and proteins in the grains [ 14 ] and influence starch metabolism during seed germination and development [ 15 ]. These bi-functional protein molecules become more relevant to wheat intolerance and have been found to play a major role in various common wheat-related pathologies, such as baker’s asthma [ 16 ], NCWS [ 17 ], and the onset of CD [ 18 – 20 ]. ATIs are also reported as important triggers of several allergies and activators of innate immunity [ 21 ]. In line with ATIs’ dose-dependent function as co-stimulatory molecules in the adaptive immunity of CD, they appear to promote other immune-mediated diseases within and outside the GI tract [ 22 ]. ATIs can act in two ways, either directly targeting specific pro-inflammatory receptors or indirectly impairing the activity of amylases and proteases (trypsin), resulting in accumulating undigested peptides with potential immunogenic properties [ 23 ]. Since the amylase inhibition activity was found earlier in these molecules, ATIs are also called wheat amylase inhibitors (WAI) [ 24 , 25 ]. In wheat, ATIs exist as monomeric (WMAI 0.28 family M.W 12kDa), homodimeric (WDAI 0.19 family M.W. 24kDa) and heterotetrameric (WTAI CM family M.W. 60kDa) which appear to activate Toll-Like Receptors TLR4 [ 26 ]. Heterotetramers typically comprise a CM1 or CM2 subunit paired with a CM16 or CM17 subunit, along with two CM3 subunits. Wheat ATIs are a family of compact, highly disulfide-linked, protease-resistant proteins with low primary structural similarity but extensive secondary structural homology. Due to these properties, processed or baked foods retained ATI bioactivity. Further, ATIs are found to be highly resistant to intestinal proteolysis. Their ingestion induces modest intestinal myeloid cell infiltration and activation and release of inflammatory mediators mostly in the colon, ileum and then in the duodenum [ 19 ]. Hence, ATIs may be the prime candidates which cause severe forms of non-celiac gluten (wheat) sensitivity and also celiac disease. According to our hypothesis, editing some of the major ATI genes may result in non-functional ATIs that could replace gluten-free diets for wheat-intolerant patients. Efforts are being made to develop wheat transgenics with reduced ATIs content, and expression of CM3 , CM16 and 0.28 ATIs was reduced by up to 80% using RNAi technology [ 8 ]. Subsequently, with the advent of the CRISPR/Cas9 technique, this was the automatic choice of gene inactivation and silencing due to its efficiency, precision, multiplexing capacity, low off-target mutation rate, and capacity to create transgene-free mutant plants. CRISPR/Cas9 technique has been utilized in various studies for knockout of genes in wheat improvement programs [ 27 – 29 ], and Camerlengo et al. have edited two ATI genes, CM3 and CM16 , using CRISPR/Cas9 technology in durum wheat, which led to the activation of other ATI 0.28 as a pleiotropic effect [ 30 ]. To prevent pleiotropic effects from other members of the ATI family, it is important to knock out as many ATI genes as possible since monomeric as well as the subunits of the dimeric and tetrameric ATIs are reported as allergens [ 31 – 33 ]. In addition, hexaploid bread wheat contains homeologs of many genes. All 17 ATIs reported are homeologue of one or the other ATI . So far, only two ATI genes of tetraploid durum wheat have been edited by CRISPR/Ca9 technology. Still, the knocking out all the potential immunogenic ATI genes in hexaploid bread wheat has not yet been reported. To inactivate the immunogenicity of ATIs through the CRISPR Cas9 approach, all the ATIs need to be targeted [ 15 , 18 , 22 ]. As these proteins have two functional domains, at least two sgRNA for each target ATI must be included in the constructs. However, there is a limit to incorporating the number of sgRNA in a single construct. So far, six sgRNA have been reported in single constructs [ 34 ], and we wanted to adopt the same. Though there is sequence homology among some of the ATIs, and hence designing one particular sgRNA is possible, which can knock out multiple ATIs , but still six sgRNA (in a single construct) may not be sufficient for knockout all the target ATIs . Therefore, the number of constructs needs to be more than one. Inserting more than one construct inside the wheat calli through Agrobacterium -mediated transformation is an unlikely proposition due to its poor efficiency [ 35 ]. Hence, the alternate Biolistic Gene Gun method needs to be adopted. Keeping all these aspects in mind, we planned to target 14 major ATIs (out of 17 reported so far) by designing two multiplex CRISPR/Cas9 constructs with six sgRNAs in each of them. We employed the biolistic gene gun bombardment strategy to simultaneously co-transform both constructs, avoiding Agrobacterium -mediated co-transformation, which is less effective. 2. Material and Methods 2.1. Plant Material Bobwhite and HD2967 genotypes of bread wheat were used for genome editing. Bobwhite seeds were procured from Dr. Parveen Chhuneja at Punjab Agricultural University Ludhiana, and HD2967 seeds were available with us at ICAR- Indian Agricultural Research Institute. 2.2. In silico analysis and target selection We selected 14 major ATIs ( 0.19, TraesCS3B02G111200, TraesCS3B02G111100, TraesCS3A02G095600, TraesCS3B02G111293, 0.28, 0.53, CM1, CM2, CM3-1, CM3-2, CM16, CM17 , and CMX ) for editing them. The gene sequences of all the 14 ATIs were retrieved from Ensembl Plant linked to the iwgsc_refseqv1.0 wheat genome sequence database, taking the Chinese spring wheat genome as a reference. All the ATI genes were PCR amplified and sequenced from Bobwhite and HD2967 wheat varieties using primers as given in Supplementary Table S1. Gene sequence information from the two genotypes was used to characterize gene structure and properties. Protein pI values and Protein instability index were calculated using the ExPASy ProtParam tool. Transmembrane helices are calculated using using Phobius software. Expasy ProtScale was used to search for a hydropathic value using the Kyte & Doolittle scale. Sub-cellular localization of proteins was determined using WoLF PSORT . Amino acid sequences of all ATIs were aligned using MegaX . 3-D structure for all fourteen ATIs from wild and edited type plants was predicted using Phyre2 software. CRISPR targets from ATIs were selected based on sequencing data of both genotypes. Based on the homology among different ATI s, the targets were selected from conserved regions in ATIs (Supplementary Figure S2). sgRNA targets were selected within functional domains annotated with Pfam ( https://www.ebi.ac.uk/interpro/ ). The secondary structure of sgRNA was predicted using RNAfold WebServer ( http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi ), and off-targets were predicted using CRISPR RGEN Cas-Offinder tool ( http://www.rgenome.net/cas-offinder/ ) (Supplementary Figure S3). A total of 12 targets were identified, having NGG as a protospacer adjacent motif (PAM) for knocking out 14 ATI s twice. The target sequences are depicted in Table 1 . Before making the final CRISPR constructs, all 12 targets were evaluated with in vitro cleavage assay following the manufacturer protocol. The EnGen® sgRNA Synthesis Kit, S. pyogenes (NEB #E3322S) was used for in vitro transcription of sgRNAs, Monarch® Spin RNA Cleanup Kit (50 µg) (NEB #T2040) to RNA cleanup and EnGen® Spy Cas9 HF1 for in vitro digestion of targeted template (NEB #M0667T). Table 1 Sequences of 12 selected targets to knockout 14 ATIs Sr. No. Target of Genes Target 1 Target 2 1. 0.19/0.53/ TraesCS3B02G111200/ TraesCS3B02G111100/ TraesCS3A02G095600/ TraesCS3B02G111293 CAATGGCAGCCAGGTGCCCG TCAGCTTCACCACCTCCCTC 2. 0.28 CAATCTCTTAGGACAGCCTC CACTACGCAACATGCTGCTG 3. CM1 & CM2 ACGACGCCTCGCAGCATTGC CAACCCGCTTGAAGGCTGCC 4. CM3-1 & CM3-2 ACTTGTGGCACCTTCACCCC GGCAGCAATACAACTTGGCG 5. CM16 & CM17 CCATGAAGTAGCGCAGCGCC GGAACTCCCCGGATGCCCTA 6. CMX GTGCTGCGACGAGCTGTCCA TAACGCCCGCCGCGAGTACG 2.3. Preparation of multiplex CRISPR/Cas9 constructs A modular cloning method [ 34 , 36 ] was used to prepare multiplex CRISPR/Cas9 constructs. We have utilized a tRNA-sgRNA expression system for the expression of six sgRNAs under a single TaU3 promoter [ 34 ]. Modular cloning here consists of 3 levels of cloning from level 0 to level 2. In Level-0 module cloning, 6 oligonucleotide targets were cloned into six different Level-0 vectors (pFH113, pAK002, pAK003, pAK004, pAK005, pAK006) using golden gate reaction with Bpi I restriction enzyme and T4 DNA ligase enzymes. The sequences of the primers used to generate the target oligonucleotides are provided in Supplementary Table 4. These Level-0 module vector backbones contained part of tRNA glycine and sgRNA scaffold. The resulting vectors were named pSP01, pSP02, pSP03, pSP04, pSP05 and pSP06 (Supplementary Fig. 5). Cloning fragments from all these 6 Level-0 vectors along with TaU3 promoter from pFH31 were cloned into Level-1 vector backbone (pICH47751) using golden gate reaction with Bsa I restriction enzyme and T4 DNA ligase enzymes. Finally, two Level-1 vectors were developed and named pSP1.1 and pSP1.2 (Supplementary Figure S6). To Develop Level-2 vector (Supplementary Figure S7), pPML1.1/pPML1.2 (contains six sgRNAs under Ta U3 promoter) and pFH66 (containing wheat codon optimized SpCas9 under ZmUbi promoter) and pFH114 ( Bar gene under ZmUbi promoter) and corresponding end linker (pICH41766) were cloned into a binary vector backbone (pICSL4723) using golden gate reaction with Bpi I restriction enzyme and T4 DNA ligase enzyme [ 34 , 36 ]. These level-2 vectors are named pPML2.1 and pPML2.2. 2.4. Explant preparation and Delivery of constructs The protocol designed by Sparks and Doherty was utilized to transform immature wheat scutella using biolistic bombardment [ 37 ]. Immature embryos (12–16 days after pollination (DAP), having an approximate diameter of 0.75 to 1.5 mm) were surface sterilized using 2% W/V sodium hypochlorite and 70% ethanol. Axis of each immature embryo was excised aseptically using a sterile scalpel. Excised scutella were put upside down on callus induction media (CIM) to keep the scutellum in touch with the media [ 38 ]. After 2 days of incubation on CIM, the scutella were co-bombarded with 2 mg gold particles (0.6µm diameter) (Bio-Rad, USA) coated with 4 µg of each pPML2.1 and pPML2.2 vector plasmids. In each experimental setup, three plates, each containing 25 scutella, were subjected to two rounds of bombardment. Particle bombardment is carried out using the PDS-1000/He particle delivery system (Bio-Rad Laboratories Ltd., UK). A rupture disc of 650 psi was used. The gap between the rupture disc and the macrocarrier was kept at 2.5 cm. The target distance between the stopping screen and the target plate was maintained at 5.5 cm. The 28–30 Hg vacuum was created at a flow rate of 5.0 vacuum, and 4.5 was kept as the vacuum vent rate [ 37 ]. Bombarded scutella were kept on resting media (CIM) at 22 ± 2°C in the dark for 1 week. 2.5. Selection and Regeneration of transformed Calli After 1 week of incubation at resting media, the bombarded calli were placed on selection media (containing CIM supplemented with 4 mg/l glufosinate-ammonium) at 22 ± 2°C in the dark. After an initial incubation period of two weeks, the calli were transferred to the second selection media containing CIM supplemented with 8 mg/l glufosinate-ammonium. The sub-culturing process occurred at 22 ± 2°C in complete darkness for an additional two weeks. After selection, the calli were placed onto the regeneration media containing MS media with BAP (2.5 mg/l), Zeatin (2.5 mg/l), NAA (0.25 mg/l), glufosinate-ammonium (4 mg/l), CuSO 4 (20 mg/l) at 22 ± 2°C in 16/8 light/dark hours for 2 weeks. Further subculturing, shoot separation from regenerated calli, transferring to root induction media, and hardening of regenerated plantlets were done as mentioned by [ 38 ]. 2.6. Molecular screening and analysis of mutations in regenerated plants Leaf sample was collected, and DNA was isolated from all the regenerated plants using the CTAB method [ 39 ]. Primers specific to Cas9 (SP99 primer = AAGAACCTGTCCGACGCCAT and SP100 primer = GGTGATCGTTTCCTCGCTCT) were used to amplify Cas9. Further, all 14 ATI discuss genes were amplified using the flanking primers (Supplementary Table 1) and DNA templates from all regenerated plants, and the amplicons were sequenced. ATI sequences obtained from transformed plants were mapped, aligned and compared using Geneious Prime, MegaX, DECODRv3.0 and BioEdit7.7 software for evaluating different types of mutations. 2.7. Isolation of ATIs and analysis of Amylase/Trypsin enzyme inhibition assays ATIs from wheat flour were isolated using the protocol optimized by Sagu et al. with modifications [ 40 ]. Powdered wheat flour (100 mg) was defatted with 0.5 ml of petroleum ether by vortexing for 10 minutes, followed by centrifugation at 10000xg for 5 minutes at 4°C. The supernatant containing petroleum ether and dissolved fats was discarded, and the pellet was air-dried at room temperature (RT, 25°C) for 45 minutes. Chloroform: Methanol (2:1) (0.5 ml) was added to the dried pellet and vortexed for 3 hours at 4°C, followed by centrifugation at 10000 x g for 10 min. at 4°C. The supernatant was collected and left undisturbed overnight to evaporate chloroform and methanol solution. Next day, 0.4 ml of dissolving buffer (25 mM Tris-Cl, 1.67M NaCl, pH 9.1;) was added to the pellet and vortexed for 2 minutes, followed by sonication for 5 minutes, and then centrifuged at 10000 x g for 10 min. at 4°C. The clear supernatant containing ATIs was collected and quantified using Bradford reagent (Sigma, Merck, USA). The extracted ATIs were confirmed using SDS-PAGE (4% stacking, 15% running gel), where approximately a 14-15kD band was observed (since most of the monomeric ATI polypeptides are 14-15kD size). HPLC profiling of the extracted ATI solution was carried out in a Shimadzu UFLC system [ 40 ]. ATI solution (100µl) was injected through auto-injector, and different ATIs were separated using a Shim-pack GISS C18 column (Dimension: 250 mm length, 10mm internal diameter, 5 µm particle size) aqueous trifluoroacetic acid (0.1%) solution and aqueous acetonitrile (70%) solution were used as eluents A and B respectively in gradient mode at a flow rate of 1 ml/min (Supplementary Table S8). The amylase enzyme inhibition assay was carried out using a method developed by Xiao et al. (2006) with modification. α-amylase enzyme (Sigma, Merck, USA)12.2 unit/µl) was diluted 100 times with 0.02 M Phosphate buffer (PBS), pH 7.1. The diluted enzyme (80 µl) and extracted ATI solution (100 µl) were mixed and incubated at 37°C for 30 minutes. To the above solution, 120 µl of 1% soluble starch solution was mixed and incubated at RT for 5 minutes. To this solution, 60 µl of iodine solution (100 ml aqueous solution containing 340 mg Iodine (27mM) and 660 mg Potassium Iodide (40mM)) in) was mixed and absorbance was recorded at 600 nm using a microplate reader (BIOTEK, USA). To determine the % inhibition of α-amylase enzyme, the following formula was used: IAA (%) = [(AA T -AA C )/AA C ] × 100 Where, IAA is Inhibition of α-amylase activity, AA C is the amylase activity of the control (without ATIs) and AA T is the tested amylase activity in the presence of extracted ATIs at the same conditions. Trypsin enzyme inhibition was carried out using a modified azocasein protease assay [ 41 , 42 ]. Extracted ATI solution (100 µL) was mixed with 30 µL of 0.5% sodium bicarbonate buffer pH 8.3 and 20 µL of 0.25% trypsin-EDTA solution. 2.5% azocasein solution (125 µL) was added to the above solution, and the mixture was incubated at 37°C for 30 min. The above mixture (100 µL) was again mixed with 400 µL of 5% trichloroacetic acid solution and incubated at RT for 5 minutes, followed by centrifugation for 5 min at 10,000X g at 4°C. The above solution (400 µL) was mixed with 1200 µL of 500mM NaOH solution, and the absorbance was recorded at 440 nm. To determine the % inhibition of trypsin enzyme, the following formula was used: ITA (%) = [(TA C -TA T )/TA C ] × 100 Where, ITA is inhibition of trypsin activity, TA C is the trypsin activity of control and TA T is the tested trypsin activity in the presence of ATIs. 3. Results 3.1. In-Silico analysis of ATIs These 14 ATIs under study are either monomeric (WMAI), dimeric (WDAI) or tetrameric (WTAI) proteins, with their gene sizes ranging between 1566 and 2152 bp. Each gene contains a single exon of size ranging between 366 and 952. Details of gene size, exon size, copy number and locations of these 14 ATIs are given in Supplementary Table 9. All the ATIs are small proteins of molecular weight ranging from 13.843 to 18.319 kDa. The proteins CM2, CM16, CM17, TraesCS3B02G111200, TraesCS3B02G111100, 0.19, and 0.53 were found to be acidic, since their estimated pI values were less than 7 (pI 7). All ATIs showed a high alipathic index ranging between 75.73 to 95.23, which indicated that these proteins were highly thermostable. All the ATIs also showed a single transmembrane helix except 0.19, TraesCS3B02G111200, TraesCS3B02G111100, TraesCS3A02G095600, and 0.53. Hydropathic values revealed that hydrophobic amino acid residues predominated in the peptide chains of all ATIs. Our analysis showed all the ATIs were extracellular in nature, except CMX and TraesCS3B02G111200, which were found to be localized in the chloroplast. Multiple (amino acid) sequence alignment of all 14 ATIs revealed the presence of highly conserved amino acid domains within the same ATI group, as shown in Fig. 1 . Ten highly conserved cysteine residues were observed in all ATIs except for CMX, which has eight cysteine residues. The amino acid sequence similarity among different members of the ATI family varies between 30% and 95%. 3-D structure for all 14 ATIs showed that most of the regions of all the fourteen ATIs consisted of α-helix structure (Fig. 2 ). Structurally, they shared a common folding pattern, characterized by 4 to 5 α-helices and a brief antiparallel β-sheet. α-helix region was found in a range between 38 to 59%. 3.2. Development of CRISPR/Cas9 constructs for transformation Two final CRISPR/Cas9 vectors, each with 6 sgRNA under TaU3 promoter (position 3), wheat codon optimized SpCas9 under ZmUbi (position 2), and Bar gene under ZmUbi promoter (position 1), were assembled and named as pPML2.1 and pPML2.2 and transformed into E. coli for further multiplication and confirmation. These two vectors were confirmed by restriction digestion and sequencing, and the vector Maps are shown in Fig. 3 a and Fig. 3 b). 3.3. Transformation and Regeneration Two CRISPR/Cas9 multiplex constructs, each having 6 sgRNAs, were coated on gold particles and co-bombarded on immature wheat scutella using a Biolistic gun. Bombarded scutella were regenerated into the whole plant through callusing [ 38 ], which underwent two selection steps. Different stages of wheat transformation are depicted in Fig. 4 . 3.4. Molecular screening of transformed plants We have obtained 10 Bobwhite and 8 HD2967 regenerated plants after the transformation. However, our result showed that only one plant was PCR positive with the Cas9 gene in the case of Bobwhite (Fig. 5 ) and none in the case of HD2967. However, the sequence results showed many ATI genes were edited in one HD2967 regenerated plant in addition to the PCR-positive Bobwhite transgenic plant. Table 2 and Table 3 have details of the mutation results. Table 2 (Plant 1) Mutations in Bobwhite edited plant Sr. No. Name of ATI Nature of mutation Allele 1 Allele 2 Target 1 Target 2 Target 1 Target 2 1. 0.28 Heterozygous G to A C deletion G Deletion No Mutation 2. 0.19 Heterozygous No mutation GA Deletion C Deletion A Insertion 3. 0.53 Heterozygous A Insertion G Deletion TGC Deletion CT Insertion 4. TraesCS3B02G111200 Heterozygous No Mutation AG Deletion C Insertion G Insertion 5. TraesCS3B02G111100 Heterozygous GTG Deletion G Deletion C Insertion No Mutation 6. TraesCS3A02G095600 Heterozygous TGC Deletion GA Deletion C Insertion G Insertion 7. TraesCS3B02G111293 Homozygous T Deletion G Insertion T Deletion G Insertion 8. CM1 Heterozygous AT Insertion No Mutation GC Deletion No Mutation 9. CM2 Homozygous CT Deletion T Deletion CT Deletion T Deletion 10. CM3-1 Heterozygous 71 bp Deletion C Deletion C Deletion, GG Insertion 11. CM3-2 Heterozygous CC Deletion No Mutation CC Deletion A Insertion 12. CM 16 No Mutation 13. CM 17 No Mutation 14. CMX Heterozygous A Insertion C Deletion No Mutation C Deletion Table 3 Plant (2) Mutations in HD2967 edited plant Sr. No. Name of ATI Nature of mutation Allele 1 Allele 2 1. 0.28 Heterozygous AG Insertion No mutation 2. 0.19 Homozygous C Deletion 3. 0.53 Heterozygous C Deletion GGTGC Deletion 4. TraesCS3B02G111200 Heterozygous GCC Deletion C Insertion 5. TraesCS3B02G111100 Homozygous C Deletion 6. TraesCS3A02G095600 No Mutation 7. TraesCS3B02G111293 Heterozygous G Insertion No mutation 8. CM1 No Mutation 9. CM2 No Mutation 10. CM3-1 Heterozygous 8 bp Deletion A-T substitution 11. CM3-2 Homozygous C Insertion 12. CM 16 No Mutation 13. CM 17 No Mutation 14. CMX Heterozygous GAAC Insertion T Deletion, C Insertion 3.5. Mutations in different genes In our study, we targeted 14 ATI genes for mutation. Mutations in 12 ATI genes in the case of Bobwhite and 9 ATI genes in the case of HD2967 were observed in our study. Multiple sequence alignments of WT and mutants have been carried out for each ATI gene (CDS) and provided in Supplementary Figure S10. Some of the mutations were found to be homozygous, while some of them were heterozygous. We observed different types of mutations at both the targeted sites. 3.6. Comparative analysis of ATI peptides between the wild-type and mutated plants Due to the mutation in all ATI genes except CM16 and CM17 in the edited Bobwhite plant, the amino acid sequences were altered due to the frameshift mutation in most of the cases. Multiple sequence alignment showed the changes between WT and the mutants for each ATI gene sequence and ATI peptides sequence (Fig. 6 ). Details of edited ATI proteins with their different features and properties are given in Supplementary Table S11 and predicted 3D structures are shown in Supplementary figure S12. 3.7. Comparison of ATI concentration between edited and wild-type plants ATIs from T0 seeds of wild and edited plants was isolated, quantified and compared for both the mutant plants. The concentration of ATIs extracted from flour of wild-type Bobwhite and HD 2967 seeds were estimated at about 340 µg/100mg and 360 µg/100mg wheat flour, respectively. ATI concentration was found to be reduced by 30.61% and 20% for edited Bobwhite and edited HD2967 plants, respectively (Fig. 7 ). 3.8. Comparison of HPLC chromatogram between edited and wild-type plants HPLC results also showed that the total ATI content was reduced in the seeds of both the mutated plants, which was very apparent from the reduced peak area in the chromatograms. (Fig. 8 and Fig. 9 ). 3.9. α-Amylase enzyme inhibition activity The α-amylase enzyme inhibition activity was assessed using the ATIs extracted from seeds of wild type as well as mutated plants. 38.25% and 55.34% of α-amylase enzyme inhibition activity were assessed for ATIs extracted from seeds of edited Bobwhite and edited HD 2967 plants, respectively. Compared with the wild type, the α-amylase enzyme inhibition activity was found to be reduced by 50.74% and 37.84% for Edited Bobwhite and Edited HD2967, respectively, as shown in Fig. 10 . 3.10 Comparison of Trypsin enzyme inhibition activity of ATIs extracted from seeds of Wild type and Edited Bobwhite and HD2967 plants. Trypsin enzyme inhibition activity was assessed for ATIs extracted from seeds of edited Bobwhite and edited HD 2967 plants. 10.01% and 13.95% of Trypsin enzyme inhibition activity were assessed for ATIs extracted from seeds of edited Bobwhite and edited HD 2967 plants, respectively. Compared with the wild type, the trypsin enzyme inhibition activity was found to be reduced to 44.90% and 34.41% for Edited Bobwhite and Edited HD2967 resp., as shown in Fig. 11 . 4. Discussion One of the most widely grown crops in the world is wheat, which is a significant component of the typical human diet. Wheat grain provides 75–85% carbohydrates, 10–15% proteins, 2% lipids and minerals, and a considerable proportion of vitamins (thiamine and vitamin B) and minerals (zinc, iron) that convey substantial nutritional benefits to humans. Along with nutritional components, wheat also contains anti-nutritional molecules that cause various types of health-related issues in humans. Wheat ATI proteins were first investigated because of their crucial function in plant resistance to insects and microbiological pathogens, and more recently due to their allergenic effects in humans. It is now accepted worldwide that structural and metabolic proteins α-amylase/trypsin inhibitors (ATI) have a role in the development of wheat allergies (bakers' asthma), non-celiac wheat sensitivity (NCWS), and possibly celiac disease [ 16 , 21 ]. To date, 17 different copies of ATI genes have been reported. In the present study, 14 genes were identified and targeted twice to increase knockout efficiency. To target these 14 genes twice, 28 sgRNAs were required. However, we reduced the number of sgRNAs to 12 based on the sequence homology. Due to sufficient sequence homology in conserved regions, all the 14 genes were aligned and classified into six groups. A total of 12 potential targets were selected, and two targets were assigned to each group. In fact, each vector having 6 sgRNAs could target all the 14 genes, and hence by two vectors, all 14 genes were targeted twice. Such a large number of targets for knocking out in wheat is not reported. In case of ATI , two genes namely CM3 and CM16 were knocked out [ 30 ] in durum wheat, and the number of targets were 7. We ambitiously targeted 14 ATI in a single transformation, and probably no other gene editing methods like ZFN, TALENs, meganucleases could handle such a large number of gene editing other than CRISPR/Cas9 [ 43 , 44 ]. But even in case of CRISPR/ Cas9 technology, targeting 14 genes, with 12 sgRNAs through a single vector is a relatively difficult proposition. Though a larger number of sgRNA has been cloned in a vector [ 45 , 46 ], so far, a maximum of 6 sgRNAs in a single vector have produced successful editing in wheat [ 34 , 47 ]. This is mainly because a single promoter driven multiple sgRNA beyond a limit reduces transcription efficiency [ 45 , 46 ]. In addition, a single Cas9 enzyme may not be sufficient to edit up to 14 genes [ 48 , 49 ]. Therefore, we prepared two multiplex CRISPR/Cas9 constructs, each with 6 sgRNAs. These two CRISPR/Cas9 constructs could have been delivered through agrobacterium -mediated transformation, but we used biolistic bombardment mainly to avoid agrobacterium contamination, dependency on host-pathogen interactions, and more time-consuming protocol [ 50 ], and also to facilitate multigene delivery, compatibility with synthetic constructs and broad host range (genotypes) [ 51 , 52 ]. Regeneration after transformation is also another challenge in wheat crop. However, our optimized in vitro regeneration protocol could successfully regenerate a sufficient number of regenerated plants (18 plants). However, PCR analysis did not confirm most of the regenerated plants as positive transformants, which suggests the non-integration of the transgene into the wheat genome. In the case of one Bobwhite transgenic plant, transgene from both vectors was integrated, and the plants also showed mutation either in one or both targets in 12 out of 14 genes. This seems encouraging and corroborated with the earlier reports where multiple genes were targeted, and most of which were edited. Multiple gluten genes were knocked-out recently using CRISPR/Cas9 technology in wheat, where indels were observed in targeted γ- and ω-gliadin genes. Analysis of the seeds from the edited plants showed a 97.7% reduction in gluten content [ 53 ]. Mutations were observed in all the three targeted genes ( TaGW2 , TaLpx-1 , and TaMLO ) in wheat protoplast using endogenous tRNA-sgRNA expression system [ 54 ]. Interestingly, one of the regenerated HD2967 plants showed mutations in 9 out of 14 targeted genes, with editing in one target each, and all the targets were from the same constructs, pPML2.1. This is a case of transient expression of the transformed vector which did not get integrated into the genome, and probably only one vector was transformed into the explant which showed the transient expression. It has already been reported that transient expression of CRISPR/Cas9 components can lead to genome editing without the integration of transgenes in crops like wheat [ 30 , 55 ] and banana [ 56 ]. Our result showed most of the mutations in both plants resulted in 1–4 bp deletion within the editing window, resulting in frameshift mutations, leading to misfolding and premature termination of the protein. A few mutations were homozygous, while others were heterozygous in both edited plants. We have prepared 3D protein structures of all the mutated ATIs in both the edited plants, and compared them with their respective wild types. We found that some of the mutations lead to truncated protein with only 45 amino acids, which might or might not be extracted by the protocol we used. Probably due to this, the concentration of ATIs was reduced. The number of genes mutated in the case of Bobwhite is more than HD2967, which leads to more ATI content reduction in Bobwhite flour (30.51%) than that of HD2967 (20%). Several wheat ATIs can inhibit insect amylases, bacterial amylases and mammalian amylases [ 57 ]. This study evaluated the Bacillus licheniformis α-amylase and porcine trypsin enzyme inhibition activities of isolated ATIs. In the present study, α-amylase enzyme inhibition activity of ATIs from edited Bobwhite and HD2967 was found to be reduced to 50.74% and 37.84%, respectively, when compared to wild-type Plants. Similarly, the trypsin enzyme inhibition activity was found to be reduced to 44.90% and 34.41% for edited Bobwhite and HD2967, respectively, when compared to the wild type. Reduction in the functionality of ATIs was more in the seeds from the edited Bobwhite plant than in the HD2967 edited plant, mainly because the number of ATI gene disruptions was higher in Bobwhite. ATIs are biological compounds with distinct dual functions that bind to trypsin and α-amylase and turn them inactive. In fact, ATIs have two active sites in one single domain that bind to α-amylase and trypsin non-competitively and inhibit the activities of both enzymes [ 14 ]. Disruption of that domain resulted in a decrease in amylase and trypsin enzyme inhibition with similar intensity. This study is a proof of concept of multiple gene editing with a large number of targeted sgRNA at a time in a single transformation event. 5. Conclusion This study demonstrates the reduction in ATI activity by successfully mutating 12 genes in wheat through a single transformation using biolistic methods. We also found transient expression of the CRISPR/Cas9 vector, which efficiently induced targeted mutations in wheat without genomic integration of the construct. Furthermore, our findings indicated that the reduction in α-amylase enzyme (ATI) content depends on the number of ATI genes mutated and the degree of truncation in their sequences. This work highlights the potential of biolistic-mediated genome editing for achieving multiplexed gene targeting in polyploid crops, especially to knock out multiple genes responsible for immunogenicity in wheat. Declarations Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. CRediT authorship contribution statement Sachin Phogat: Methodology, Investigation, Formal analysis, Conceptualization, Visualization, Writing - original draft, Writing - review & editing. Ankur Poudel: Formal analysis, Visualization. Gayatri: Methodology,Writing - review & editing. Megha Kaushik: Methodology, Investigation. Jayanthi Madhavan : Methodology, Validation, Writing - review & editing. Amitha Mithra Sevanthi: Writing - review & editing. Jasdeep Charath Padaria: Writing - review & editing. Vladimir Nekrasov: Methodology, Writing - review & editing. Pradeep Kumar Singh: Writing - review & editing. Pranab Kumar Mandal : Conceptualization, Methodology, Project administration, Resources, Supervision, Writing - original draft, Writing - review & editing. Acknowledgements The authors acknowledge the financial support by CRP on Biofortification, the Indian Council of Agricultural Research (ICAR) and the Department of Biotechnology, Govt. of India for carrying out the work. The first author wants to acknowledge the University Grant Commission and ICAR-NAHEP-CAAST for providing fellowship during this study. The authors want to Acknowledge Dr Parveen Chhuneja for providing the seeds of the Bobwhite variety of wheat. Vladimir Nekrasov received funding from the Biotechnology and Biological Sciences Research Council of the United Kingdom through the Delivering Sustainable Wheat program (BB/X011003/1). The authors would also like to acknowledge the support and guidance the Director, ICAR-National Institute for Plant Biotechnology, New Delhi, provided. References P. Giraldo, E. Benavente, F. Manzano-Agugliaro, E. Gimenez, Worldwide research trends on wheat and barley: A bibliometric comparative analysis, Agronomy 9 (2019) 352. M. Acevedo, J.D. Zurn, G. Molero, P. Singh, X. He, M. Aoun, P. Juliana, H. Bockleman, M. Bonman, M. El-Sohl, The role of wheat in global food security, in: Agric. Dev. Sustain. Intensif., Routledge, 2018: pp. 81–110. B. Shiferaw, M. Smale, H.-J. Braun, E. Duveiller, M. Reynolds, G. Muricho, Crops that feed the world 10. Past successes and future challenges to the role played by wheat in global food security, Food Secur. 5 (2013) 291–317. A. Breiman, D. Graur, Wheat evolution, Isr. J. Plant Sci. 43 (1995) 85–98. T.B. Osborne, C.L. Voorhees, PROTEIDS OF THE WHEAT KERNEL., J. Am. Chem. Soc. 16 (1894) 524–535. L.K. Kucek, L.D. Veenstra, P. Amnuaycheewa, M.E. Sorrells, A grounded guide to gluten: how modern genotypes and processing impact wheat sensitivity, Compr. Rev. Food Sci. Food Saf. 14 (2015) 285–302. K.A. Scherf, K. Brockow, T. Biedermann, P. Koehler, H. Wieser, Wheat‐dependent exercise‐induced anaphylaxis, Clin. Exp. Allergy 46 (2016) 10–20. R.M. Kalunke, S. Tundo, F. Sestili, F. Camerlengo, D. Lafiandra, R. Lupi, C. Larré, S. Denery-Papini, S. Islam, W. Ma, Reduction of allergenic potential in bread wheat RNAi transgenic lines silenced for CM3, CM16 and 0.28 ATI genes, Int. J. Mol. Sci. 21 (2020) 5817. P.R. Shewry, Wheat, J. Exp. Bot. 60 (2009) 1537–1553. D. Stepniak, F. Koning, Celiac disease—sandwiched between innate and adaptive immunity, Hum. Immunol. 67 (2006) 460–468. C. Ciacci, P. Ciclitira, M. Hadjivassiliou, K. Kaukinen, J.F. Ludvigsson, N. McGough, D.S. Sanders, J. Woodward, J.N. Leonard, G.L. Swift, The gluten-free diet and its current application in coeliac disease and dermatitis herpetiformis, United Eur. Gastroenterol. J. 3 (2015) 121–135. J. Gil-Humanes, F. Pistón, S. Tollefsen, L.M. Sollid, F. Barro, Effective shutdown in the expression of celiac disease-related wheat gliadin T-cell epitopes by RNA interference, Proc. Natl. Acad. Sci. 107 (2010) 17023–17028. S. Geisslitz, P. Weegels, P. Shewry, V. Zevallos, S. Masci, M. Sorrells, A. Gregorini, M. Colomba, D. Jonkers, X. Huang, Wheat amylase/trypsin inhibitors (ATIs): occurrence, function and health aspects, Eur. J. Nutr. (2022) 1–8. R.A. Islamov, O. V Fursov, Bifunctional inhibitor of α-amylase/trypsin from wheat grain, Appl. Biochem. Microbiol. 43 (2007) 379–382. A.S. Tatham, P.R. Shewry, Allergens to wheat and related cereals, Clin. Exp. Allergy 38 (2008) 1712–1726. G. Salcedo, R. Sanchez-Monge, G. Garcia-Casado, A. Armentia, L. Gomez, D. Barber, The cereal α-amylase/trypsin inhibitor family associated with bakers’ asthma and food allergy, Plant Food Allergens (2004) 70–84. C. Catassi, L. Elli, B. Bonaz, G. Bouma, A. Carroccio, G. Castillejo, C. Cellier, F. Cristofori, L. De Magistris, J. Dolinsek, Diagnosis of non-celiac gluten sensitivity (NCGS): the Salerno experts’ criteria, Nutrients 7 (2015) 4966–4977. Y. Junker, S. Zeissig, S.-J. Kim, D. Barisani, H. Wieser, D.A. Leffler, V. Zevallos, T.A. Libermann, S. Dillon, T.L. Freitag, Wheat amylase trypsin inhibitors drive intestinal inflammation via activation of toll-like receptor 4, J. Exp. Med. 209 (2012) 2395–2408. V.F. Zevallos, V. Raker, S. Tenzer, C. Jimenez-Calvente, M. Ashfaq-Khan, N. Rüssel, G. Pickert, H. Schild, K. Steinbrink, D. Schuppan, Nutritional wheat amylase-trypsin inhibitors promote intestinal inflammation via activation of myeloid cells, Gastroenterology 152 (2017) 1100–1113. S. Tundo, R. Lupi, M. Lafond, T. Giardina, C. Larré, S. Denery-Papini, M. Morisset, R. Kalunke, F. Sestili, S. Masci, Wheat ATI CM3, CM16 and 0.28 allergens produced in Pichia pastoris display a different eliciting potential in food allergy to wheat, Plants 7 (2018) 101. Y. Reig-Otero, J. Mañes, L. Manyes, Amylase–trypsin inhibitors in wheat and other cereals as potential activators of the effects of nonceliac gluten sensitivity, J. Med. Food 21 (2018) 207–214. D. Schuppan, V. Zevallos, Wheat amylase trypsin inhibitors as nutritional activators of innate immunity, Dig. Dis. 33 (2015) 260–263. M. Cuccioloni, M. Mozzicafreddo, I. Ali, L. Bonfili, V. Cecarini, A.M. Eleuteri, M. Angeletti, Interaction between wheat alpha-amylase/trypsin bi-functional inhibitor and mammalian digestive enzymes: Kinetic, equilibrium and structural characterization of binding, Food Chem. 213 (2016) 571–578. P. Carbonero, F. García-Olmedo, A multigene family of trypsin/α-amylase inhibitors from cereals, in: Seed Proteins, Springer, 1999: pp. 617–633. S. Geisslitz, P. Shewry, F. Brouns, A.H.P. America, G.P.I. Caio, M. Daly, S. d’Amico, R. De Giorgio, L. Gilissen, H. Grausgruber, Wheat ATIs: characteristics and role in human disease, Front. Nutr. (2021) 265. F.M. Dupont, W.H. Vensel, C.K. Tanaka, W.J. Hurkman, S.B. Altenbach, Deciphering the complexities of the wheat flour proteome using quantitative two-dimensional electrophoresis, three proteases and tandem mass spectrometry, Proteome Sci. 9 (2011) 1–29. Y. Zhang, J. Li, S. Chen, X. Ma, H. Wei, C. Chen, N. Gao, Y. Zou, D. Kong, T. Li, An APETALA2/ethylene responsive factor, OsEBP89 knockout enhances adaptation to direct-seeding on wet land and tolerance to drought stress in rice, Mol. Genet. Genomics 295 (2020) 941–956. Y. Kamiya, F. Abe, M. Mikami, M. Endo, K. Kawaura, A rapid method for detection of mutations induced by CRISPR/Cas9-based genome editing in common wheat, Plant Biotechnol. 37 (2020) 247–251. S. Phogat, A. Poudel, A. Bharati, A. Kumar, P.K. Mandal, Recent Advances in CRISPR-Cas for Climate Resilient Agriculture in Cereals, Clim. Agric. (2024) 343–371. F. Camerlengo, A. Frittelli, C. Sparks, A. Doherty, D. Martignago, C. Larré, R. Lupi, F. Sestili, S. Masci, CRISPR-Cas9 multiplex editing of the α-amylase/trypsin inhibitor genes to reduce allergen proteins in durum wheat, Front. Sustain. Food Syst. 4 (2020) 104. S.T. Sagu, L. Zimmermann, E. Landgräber, T. Homann, G. Huschek, H. Özpinar, F.J. Schweigert, H.M. Rawel, Comprehensive characterization and relative quantification of α-amylase/trypsin inhibitors from wheat cultivars by targeted HPLC-MS/MS, Foods 9 (2020) 1448. J. Fränken, U. Stephan, H.E. Meyer, W. König, Identification of alpha-amylase inhibitor as a major allergen of wheat flour, Int. Arch. Allergy Immunol. 104 (1994) 171–174. I. Sander, P. Rozynek, H. Rihs, V. Van Kampen, F.T. Chew, W.S. Lee, N. Kotschy‐Lang, R. Merget, T. Brüning, M. Raulf‐Heimsoth, Multiple wheat flour allergens and cross‐reactive carbohydrate determinants bind IgE in baker’s asthma, Allergy 66 (2011) 1208–1215. F. Hahn, A. Korolev, L. Sanjurjo Loures, V. Nekrasov, A modular cloning toolkit for genome editing in plants, BMC Plant Biol. 20 (2020) 1–10. Q. Yao, L. Cong, G. He, J. Chang, K. Li, G. Yang, Optimization of wheat co-transformation procedure with gene cassettes resulted in an improvement in transformation frequency, Mol. Biol. Rep. 34 (2007) 61–67. C. Engler, M. Youles, R. Gruetzner, T.-M. Ehnert, S. Werner, J.D.G. Jones, N.J. Patron, S. Marillonnet, A golden gate modular cloning toolbox for plants, ACS Synth. Biol. 3 (2014) 839–843. C.A. Sparks, A. Doherty, Genetic transformation of common wheat (Triticum aestivum L.) using biolistics, in: Biolistic DNA Deliv. Plants, Springer, 2020: pp. 229–250. S. Phogat, A. Poudel, R. Bhurta, G. Kalwan, J. Madhavan, J.C. Padaria, P.K. Singh, T. Vinutha, P.K. Mandal, An improved in-vitro regeneration protocol using scutellum of mature and immature embryos of wheat, Indian J. Genet. Plant Breed. 83 (2023) 195–204. M.G. Murray, W.F. Thompson, Rapid isolation of high molecular weight plant DNA., Nucleic Acids Res. 8 (1980) 4321–4325. https://doi.org/10.1093/nar/8.19.4321. S. Tchewonpi Sagu, G. Huschek, J. Bönick, T. Homann, H.M. Rawel, A New Approach of Extraction of α-Amylase/trypsin Inhibitors from Wheat (Triticum aestivum L.), Based on Optimization Using Plackett–Burman and Box–Behnken Designs, Molecules 24 (2019) 3589. G.D.G. de Fernando, P.F. Fox, Study of proteolysis during the processing of a dry fermented pork sausage, Meat Sci. 30 (1991) 367–383. S.T. Sagu, E.J. Nso, T. Homann, C. Kapseu, H.M. Rawel, Extraction and purification of beta-amylase from stems of Abrus precatorius by three phase partitioning, Food Chem. 183 (2015) 144–153. H. Wang, H. Yang, C.S. Shivalila, M.M. Dawlaty, A.W. Cheng, F. Zhang, R. Jaenisch, One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering, Cell 153 (2013) 910–918. B. Minkenberg, M. Wheatley, Y. Yang, CRISPR/Cas9-Enabled Multiplex Genome Editing and Its Application, 1st ed., Elsevier Inc., 2017. https://doi.org/10.1016/bs.pmbts.2017.05.003. N.S. McCarty, A.E. Graham, L. Studená, R. Ledesma-Amaro, Multiplexed CRISPR technologies for gene editing and transcriptional regulation. Nat Commun 11: 1281, (2020). L. Xu, L. Zhao, Y. Gao, J. Xu, R. Han, Empower multiplex cell and tissue-specific CRISPR-mediated gene manipulation with self-cleaving ribozymes and tRNA, Nucleic Acids Res. 45 (2017) e28–e28. W.-N. Kim, H.-J. Kim, Y.-S. Chung, H.-U. Kim, Construction of multiple guide RNAs in CRISPR/Cas9 vector using stepwise or simultaneous golden gate cloning: Case study for targeting the FAD2 and FATB multigene in soybean, Plants 10 (2021) 2542. P.-Y. Chen, Y. Qian, D. Del Vecchio, A model for resource competition in CRISPR-mediated gene repression, in: 2018 IEEE Conf. Decis. Control, IEEE, 2018: pp. 4333–4338. S. Zhang, C.A. Voigt, Engineered dCas9 with reduced toxicity in bacteria: implications for genetic circuit design, Nucleic Acids Res. 46 (2018) 11115–11125. S.B. Gelvin, Agrobacterium -mediated plant transformation: the biology behind the “gene-jockeying” tool, Microbiol. Mol. Biol. Rev. 67 (2003) 16–37. B. Lacroix, V. Citovsky, Biolistic approach for transient gene expression studies in plants, Biolistic DNA Deliv. Plants Methods Protoc. (2020) 125–139. B. Paes de Melo, I.T. Lourenço-Tessutti, C.V. Morgante, N.C. Santos, L.B. Pinheiro, C.B. de Jesus Lins, M.C.M. Silva, L.L.P. Macedo, E.P.B. Fontes, M.F. Grossi-de-Sa, Soybean embryonic axis transformation: combining biolistic and Agrobacterium -mediated protocols to overcome typical complications of in vitro plant regeneration, Front. Plant Sci. 11 (2020) 1228. S. Sánchez-León, M. Marín-Sanz, M.H. Guzmán-López, M. Gavilán-Camacho, E. Simón, F. Barro, CRISPR/Cas9-mediated multiplex gene editing of gamma and omega gliadins: paving the way for gliadin-free wheat, J. Exp. Bot. 75 (2024) 7079–7095. W. Wang, Q. Pan, F. He, A. Akhunova, S. Chao, H. Trick, E. Akhunov, Transgenerational CRISPR-Cas9 Activity Facilitates Multiplex Gene Editing in Allopolyploid Wheat, Cris. J. 1 (2018) 65–74. https://doi.org/10.1089/crispr.2017.0010. Y. Zhang, Z. Liang, Y. Zong, Y. Wang, J. Liu, K. Chen, J.L. Qiu, C. Gao, Efficient and transgene-free genome editing in wheat through transient expression of CRISPR/Cas9 DNA or RNA, Nat. Commun. 7 (2016) 1–8. https://doi.org/10.1038/ncomms12617. P. Awasthi, S. Khan, H. Lakhani, S. Chaturvedi, N. Kaur, J. Singh, A.K. Kesarwani, S. Tiwari, Transgene-free genome editing supports the role of carotenoid cleavage dioxygenase 4 as a negative regulator of β-carotene in banana, J. Exp. Bot. 73 (2022) 3401–3416. O.L. Franco, D.J. Rigden, F. R. Melo, C. Bloch Jr, C.P. Silva, M.F. Grossi de Sá, Activity of wheat α‐amylase inhibitors towards bruchid α‐amylases and structural explanation of observed specificities, Eur. J. Biochem. 267 (2000) 2166–2173. Additional Declarations The authors declare no competing interests. Supplementary Files S1.Table.docx S1. Primer sequences used for the amplification of ATI genes S2.Figure.jpg S2. Fig. Selection of targets within conserved regions S3.Figure.jpg S3. Fig.Prediction of secondary structure of GuideRNAand off-targets S4.Table.docx S4. The primer sequences for 12 targets to make oligos for cloning in level 0 cloning S5.Figure.jpg S5. Fig. Level 0 constructs pSP0.1, pSP0.2, pSP0.3, pSP0.4, pSP0.5, pSP0.6 S6.Figure.jpg S6. Fig.Level 1 constructs pSP1.1 and pSP1.2 S7.Figure.jpg S7. Fig. Level 2 constructs pPML2.1 and pPML2.2 S8.Table.docx S8. Different solvent gradients used for ATIs detection S9.Table.docx S9. Details and different features of wild type ATIs S10.Figure.jpg S10. Fig. Alignment of 0.28 sequences from edited plants with wild type (WT: Wild type plant, P1: edited Bobwhite plant, P2: edited HD2967 Plant, A1: Allele 1, A2: Allele 2, 0: No mutation, +1: 1bp Insertion, -1: 1bp Deletion) S11.Table.docx S11. Details of ATI proteins and their different features as well as properties S12.Figure.jpg S12. Fig.Comparison of predicted structure of wild type ATI proteins with edited ATIs. Where, WT- Wild Type, P1- Edited HD2967 plant, P2- Edited Bobwhite plant, A1- Allele one, A2- Allele second Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5899900","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":406950604,"identity":"63baf08a-9f65-4617-8352-b8704dee2b98","order_by":0,"name":"Sachin Phogat","email":"","orcid":"","institution":"Indian Council of Agricultural Research (ICAR) National Institute for Plant Biotechnology, New Delhi, 110012, India","correspondingAuthor":false,"prefix":"","firstName":"Sachin","middleName":"","lastName":"Phogat","suffix":""},{"id":406958007,"identity":"ef174261-7582-4097-b391-68dc6bd9c42d","order_by":1,"name":"Ankur Poudel","email":"","orcid":"","institution":"Indian Council of Agricultural Research (ICAR) National Institute for Plant Biotechnology, New Delhi, 110012, India","correspondingAuthor":false,"prefix":"","firstName":"Ankur","middleName":"","lastName":"Poudel","suffix":""},{"id":406958008,"identity":"4d65f971-cbfc-4121-9918-3da629ba556b","order_by":2,"name":"Gayatri","email":"","orcid":"","institution":"Indian Council of Agricultural Research (ICAR) National Institute for Plant Biotechnology, New Delhi, 110012, India","correspondingAuthor":false,"prefix":"","firstName":"","middleName":"","lastName":"Gayatri","suffix":""},{"id":406958009,"identity":"5c30312a-1cab-420c-8f34-c4311bc47391","order_by":3,"name":"Megha Kaushik","email":"","orcid":"","institution":"Indian Council of Agricultural Research (ICAR) National Institute for Plant Biotechnology, New Delhi, 110012, India","correspondingAuthor":false,"prefix":"","firstName":"Megha","middleName":"","lastName":"Kaushik","suffix":""},{"id":406958010,"identity":"ffff3681-26ff-47c5-a33d-0747aedfa539","order_by":4,"name":"Jayanthi Madhavan","email":"","orcid":"","institution":"Indian Agricultural Research Institute, Pusa Campus, New Delhi, India","correspondingAuthor":false,"prefix":"","firstName":"Jayanthi","middleName":"","lastName":"Madhavan","suffix":""},{"id":406958011,"identity":"333a40b5-f150-446d-8f60-e2b76f8be634","order_by":5,"name":"Amitha Mithra Sevanthi","email":"","orcid":"","institution":"Indian Council of Agricultural Research (ICAR) National Institute for Plant Biotechnology, New Delhi, 110012, India","correspondingAuthor":false,"prefix":"","firstName":"Amitha","middleName":"Mithra","lastName":"Sevanthi","suffix":""},{"id":406958012,"identity":"7263262a-b088-4fc9-932e-9cc5f6883fff","order_by":6,"name":"Jasdeep Chatrath Padaria","email":"","orcid":"","institution":"Indian Council of Agricultural Research (ICAR) National Institute for Plant Biotechnology, New Delhi, 110012, India","correspondingAuthor":false,"prefix":"","firstName":"Jasdeep","middleName":"Chatrath","lastName":"Padaria","suffix":""},{"id":406958013,"identity":"9f6c2393-c0ae-4e8e-8754-bd19f2157bd5","order_by":7,"name":"Vladimir Nekrasov","email":"","orcid":"","institution":"Plant Sciences and the Bioeconomy, Rothamsted Research, Harpenden, United Kingdom","correspondingAuthor":false,"prefix":"","firstName":"Vladimir","middleName":"","lastName":"Nekrasov","suffix":""},{"id":406958014,"identity":"37dd6753-9bb1-4a1f-8bce-ca89b2d7661c","order_by":8,"name":"Pradeep Kumar Singh","email":"","orcid":"","institution":"Indian Agricultural Research Institute, Pusa Campus, New Delhi, India","correspondingAuthor":false,"prefix":"","firstName":"Pradeep","middleName":"Kumar","lastName":"Singh","suffix":""},{"id":406958015,"identity":"41206d80-870f-41ff-adfe-f807187fec71","order_by":9,"name":"Pranab Kumar Mandal","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABFklEQVRIiWNgGAWjYLACxoYEGJOZgY+9AUgbWJCghY3nAEiLBClaJMAc3FrMpQ8/e/BzR1ri2vazTzf83GEtzyb5/OqGHwUSDPzt3QnYtFj2pZkb9p7JSdx2Jt3sZu+ZdMM26Zyymz1Ah0mcObsBmxaDMwxmErxtFYnbDqSx3eBtO8wI1JJ2gweoxUAiF4cW9m+Sf0Fazj9ju/m37bB9m+SZtJt/8GrhMZPmbQM67EYa222gLYltEuzHbuOzxbKHp0xa9kya8bYbz9huy7alJ7fx5LDdljGQ4MHlF3Me9m2Sb3cky247n8Z2822btW0/+/FnN9/8sZHjb+/F7jAsYjxgQR5synFpYX+AS/UoGAWjYBSMTAAAOKVmt2B4HlUAAAAASUVORK5CYII=","orcid":"","institution":"Indian Council of Agricultural Research (ICAR) National Institute for Plant Biotechnology, New Delhi, 110012, India","correspondingAuthor":true,"prefix":"","firstName":"Pranab","middleName":"Kumar","lastName":"Mandal","suffix":""}],"badges":[],"createdAt":"2025-01-25 06:58:57","currentVersionCode":1,"declarations":{"humanSubjects":false,"vertebrateSubjects":false,"conflictsOfInterestStatement":false,"humanSubjectEthicalGuidelines":false,"humanSubjectConsent":false,"humanSubjectClinicalTrial":false,"humanSubjectCaseReport":false,"vertebrateSubjectEthicalGuidelines":false},"doi":"10.21203/rs.3.rs-5899900/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5899900/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":75076743,"identity":"641e0d8b-09d2-43b2-a2dc-a041081e00f1","added_by":"auto","created_at":"2025-01-30 08:05:30","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":384809,"visible":true,"origin":"","legend":"\u003cp\u003eAlignment of amino acid sequences of 14\u003cem\u003e \u003c/em\u003eATIs showing conserved cysteine residues.\u003c/p\u003e","description":"","filename":"Figure.1..jpg","url":"https://assets-eu.researchsquare.com/files/rs-5899900/v1/b531b88b6752ff583f25e230.jpg"},{"id":75076774,"identity":"6c5e6131-2df9-47ac-80b1-651bc364a47d","added_by":"auto","created_at":"2025-01-30 08:05:33","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":860698,"visible":true,"origin":"","legend":"\u003cp\u003e3-D structure and different regions of fourteen ATIs.\u003c/p\u003e","description":"","filename":"Figure.2..jpg","url":"https://assets-eu.researchsquare.com/files/rs-5899900/v1/91336aae8b28654b9128a582.jpg"},{"id":75076746,"identity":"c68d505d-2a12-43f6-bda9-0c535d80420a","added_by":"auto","created_at":"2025-01-30 08:05:30","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":527475,"visible":true,"origin":"","legend":"\u003cp\u003ea) Vector map of pPML2.1 b) Vector map of pPML2.2\u003c/p\u003e","description":"","filename":"Figure.3..jpg","url":"https://assets-eu.researchsquare.com/files/rs-5899900/v1/127c048911db4a12c796cb14.jpg"},{"id":75076775,"identity":"3c57ee7f-d3c9-491a-b21d-e245727edd48","added_by":"auto","created_at":"2025-01-30 08:05:33","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1340919,"visible":true,"origin":"","legend":"\u003cp\u003eStages of wheat transformation (a) Immature embryos 15 DAP (b) Arrangement of scutella in CIM media before bombardment (c-d) Induced calli at selection media (e-f) Regenerating calli (g-h) Shoots in regenerating calli (i-j) Root induction in shoots (k) Plant tissue culture raised transformed wheat plant at booting stage.\u003c/p\u003e","description":"","filename":"Figure.4..jpg","url":"https://assets-eu.researchsquare.com/files/rs-5899900/v1/f93bb65b1e0b99c8ffe9c42a.jpg"},{"id":75076768,"identity":"d3392e49-534c-4d46-8f7d-7dad7d7d373a","added_by":"auto","created_at":"2025-01-30 08:05:32","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":107715,"visible":true,"origin":"","legend":"\u003cp\u003eGel image for screening of transformed plants for the presence of transgene\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-5899900/v1/448ea5b0e4c9eeb7d148ce08.png"},{"id":75076782,"identity":"eea407a9-e266-47d2-9b22-e46df232ae82","added_by":"auto","created_at":"2025-01-30 08:05:33","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1914517,"visible":true,"origin":"","legend":"\u003cp\u003eMultiple sequence alignment of mutated peptides with wild-type\u003c/p\u003e","description":"","filename":"Figure.6..jpg","url":"https://assets-eu.researchsquare.com/files/rs-5899900/v1/a3a588a7fb3e5cc57239fb8e.jpg"},{"id":75078036,"identity":"c4cb6a85-83bb-4214-87b2-27b8b2f6358b","added_by":"auto","created_at":"2025-01-30 08:13:34","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":222621,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of ATI concentration between wild-type and edited plants. Seeds of both the edited plants showed a substantial reduction in ATI content.\u003c/p\u003e","description":"","filename":"Figure.7..jpg","url":"https://assets-eu.researchsquare.com/files/rs-5899900/v1/0537fbd76ca96e21e69764ab.jpg"},{"id":75076776,"identity":"d0f8d29b-f31c-4cc2-aefc-8b4a9486a3aa","added_by":"auto","created_at":"2025-01-30 08:05:33","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":17497,"visible":true,"origin":"","legend":"\u003cp\u003eHPLC profile of\u003cstrong\u003e \u003c/strong\u003etotal ATIs in Bobwhite wheat flour before and after mutation\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-5899900/v1/a8b35f1e3ab9a1dade2ae737.png"},{"id":75076748,"identity":"5a57ba8d-fd5f-42bc-88b8-6625ee9bfa2a","added_by":"auto","created_at":"2025-01-30 08:05:31","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":17595,"visible":true,"origin":"","legend":"\u003cp\u003eHPLC profile of\u003cstrong\u003e \u003c/strong\u003etotal ATIs in HD2967 wheat flour before and after mutation\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-5899900/v1/a247aa5be19b27322f3374cc.png"},{"id":75076767,"identity":"651afae1-b06c-4e70-9737-287112eef2f9","added_by":"auto","created_at":"2025-01-30 08:05:32","extension":"jpg","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":263018,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of α-amylase enzyme inhibition activity between WT and edited wheat. ‘*’ indicates significant differences (P\u0026lt;0.05) in amylase enzyme inhibition between wild-type and Edited plants. Values are means ± SE, n=3.\u003c/p\u003e","description":"","filename":"Figure.10..jpg","url":"https://assets-eu.researchsquare.com/files/rs-5899900/v1/26b36692659d5346d642f7cc.jpg"},{"id":75076750,"identity":"5acc2d43-b3d8-4bc2-beff-be32c910bc43","added_by":"auto","created_at":"2025-01-30 08:05:31","extension":"jpg","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":216061,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of Trypsin enzyme inhibition activity between WT and edited wheat.\u003c/p\u003e\n\u003cp\u003e‘*’ indicates significant differences (P\u0026lt;0.05) in trypsin enzyme inhibition between wild-type and edited plants. Values are means ± SE, n=3.\u003c/p\u003e","description":"","filename":"Figure.11..jpg","url":"https://assets-eu.researchsquare.com/files/rs-5899900/v1/a1d531eb0835fe2d90531fa7.jpg"},{"id":75076818,"identity":"cbe9de6e-9aab-4cc1-9b6a-269abc192567","added_by":"auto","created_at":"2025-01-30 08:05:35","extension":"jpg","order_by":12,"title":"Figure 12","display":"","copyAsset":false,"role":"figure","size":1288226,"visible":true,"origin":"","legend":"\u003cp\u003eSummary picture showing the steps of developing multiple \u003cem\u003eATI\u003c/em\u003e gene-edited wheat. a. \u0026amp; b.) Multiplex CRISPR/Cas9 vectors c.) Biolistic bombardment apparatus d.) \u003cem\u003ein vitro\u003c/em\u003ecleavage assay e.) scutella arranged in the centre of the Petri plate for bombardment f.) callus induction and selection g.) shoot regeneration and rooting h.) booting in regenerated plants i.) Transgene integration screening j.) indels in multiple genes k.) comparison of the 3-D structure of proteins l.) comparison of ATI concentration in seeds of wild and edited plants m.) comparison of α-amylase inhibition activity in seeds of wild and edited plants n.) comparison of trypsin inhibition activity in seeds of wild and edited plants\u003c/p\u003e","description":"","filename":"Fig.Cloncluding.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5899900/v1/4c84f211f3f2a423336d8a2a.jpg"},{"id":75078039,"identity":"7e5af5c2-f2bf-4b36-b153-aeff86c0c192","added_by":"auto","created_at":"2025-01-30 08:13:42","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":8495735,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5899900/v1/055e6dd4-071d-4567-9a7d-21445f72ead6.pdf"},{"id":75076777,"identity":"59287b92-c19f-4a19-8eb7-5a50da122e26","added_by":"auto","created_at":"2025-01-30 08:05:33","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":17456,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eS1.\u003c/strong\u003e Primer sequences used for the amplification of \u003cem\u003eATI \u003c/em\u003egenes\u003c/p\u003e","description":"","filename":"S1.Table.docx","url":"https://assets-eu.researchsquare.com/files/rs-5899900/v1/a2a763e11835d89879d2934b.docx"},{"id":75076754,"identity":"542f786f-4186-4998-a04b-886dfc0d227c","added_by":"auto","created_at":"2025-01-30 08:05:31","extension":"jpg","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":960460,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eS2. Fig. \u003c/strong\u003eSelection of targets within conserved regions\u003c/p\u003e","description":"","filename":"S2.Figure.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5899900/v1/38bdc76096d0a0543dd423cd.jpg"},{"id":75076765,"identity":"567746a3-3229-4bb8-a62d-89a94f447c43","added_by":"auto","created_at":"2025-01-30 08:05:32","extension":"jpg","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":516799,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eS3. Fig.\u003c/strong\u003ePrediction of secondary structure of GuideRNAand off-targets\u003c/p\u003e","description":"","filename":"S3.Figure.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5899900/v1/96b4ea6874c82d9647a8cfd7.jpg"},{"id":75076789,"identity":"f11452b9-b9b7-470e-9b39-77940c2a8ba3","added_by":"auto","created_at":"2025-01-30 08:05:33","extension":"docx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":15275,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eS4.\u003c/strong\u003e The primer sequences for 12 targets to make oligos for cloning in level 0 cloning\u003c/p\u003e","description":"","filename":"S4.Table.docx","url":"https://assets-eu.researchsquare.com/files/rs-5899900/v1/898e33505038d5181c5a3761.docx"},{"id":75076778,"identity":"96cbeeac-fee7-4d95-836a-81eceadae19f","added_by":"auto","created_at":"2025-01-30 08:05:33","extension":"jpg","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":656406,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eS5. Fig. \u003c/strong\u003eLevel 0 constructs pSP0.1, pSP0.2, pSP0.3, pSP0.4, pSP0.5, pSP0.6\u003c/p\u003e","description":"","filename":"S5.Figure.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5899900/v1/f5b860287e40b51022010cc1.jpg"},{"id":75076747,"identity":"ef433247-e6b2-445d-91c5-2debc38808b8","added_by":"auto","created_at":"2025-01-30 08:05:30","extension":"jpg","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":617028,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eS6. Fig.\u003c/strong\u003eLevel 1 constructs pSP1.1 and pSP1.2\u003c/p\u003e","description":"","filename":"S6.Figure.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5899900/v1/433a3b00b70643a6f606dea6.jpg"},{"id":75076760,"identity":"cd3e3d8a-b01d-423e-a827-58ae42368b64","added_by":"auto","created_at":"2025-01-30 08:05:31","extension":"jpg","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":463755,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eS7. Fig. \u003c/strong\u003e\u0026nbsp;Level 2 constructs pPML2.1 and pPML2.2\u003c/p\u003e","description":"","filename":"S7.Figure.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5899900/v1/16eb0b42c66302e6cc19257a.jpg"},{"id":75078033,"identity":"3f9c1f99-ef4f-4ccf-aee2-eeadcd5fc322","added_by":"auto","created_at":"2025-01-30 08:13:33","extension":"docx","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":14396,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eS8\u003c/strong\u003e. Different solvent gradients used for ATIs detection\u003c/p\u003e","description":"","filename":"S8.Table.docx","url":"https://assets-eu.researchsquare.com/files/rs-5899900/v1/bc23b46ab3b0c8d52886a387.docx"},{"id":75076772,"identity":"9302264a-640f-47c5-9a1c-29ead6255c4f","added_by":"auto","created_at":"2025-01-30 08:05:32","extension":"docx","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":17729,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eS9. Details and different features of wild type ATIs\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"S9.Table.docx","url":"https://assets-eu.researchsquare.com/files/rs-5899900/v1/17a1abf39c787411d9f78dcb.docx"},{"id":75076796,"identity":"7acedd67-2158-484e-b495-87d4081b428e","added_by":"auto","created_at":"2025-01-30 08:05:34","extension":"jpg","order_by":10,"title":"","display":"","copyAsset":false,"role":"supplement","size":2149737,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eS10. Fig. \u003c/strong\u003eAlignment of 0.28 sequences from edited plants with wild type (WT: Wild type plant, P1: edited Bobwhite plant, P2: edited HD2967 Plant, A1: Allele 1, A2: Allele 2, 0: No mutation, +1: 1bp Insertion, -1: 1bp Deletion)\u003c/p\u003e","description":"","filename":"S10.Figure.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5899900/v1/3a88b13c26b9974f2d76aca9.jpg"},{"id":75076751,"identity":"535f9870-a7ca-4d67-abb9-e566ee6f9a3c","added_by":"auto","created_at":"2025-01-30 08:05:31","extension":"docx","order_by":11,"title":"","display":"","copyAsset":false,"role":"supplement","size":30080,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eS11. \u003c/strong\u003eDetails of ATI proteins and their different features as well as properties\u003c/p\u003e","description":"","filename":"S11.Table.docx","url":"https://assets-eu.researchsquare.com/files/rs-5899900/v1/39cb29777bc4967f60834c8d.docx"},{"id":75076799,"identity":"27f21414-d283-4ed8-a8dd-9d77895694ca","added_by":"auto","created_at":"2025-01-30 08:05:34","extension":"jpg","order_by":12,"title":"","display":"","copyAsset":false,"role":"supplement","size":982626,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eS12. Fig.\u003c/strong\u003eComparison of predicted structure of wild type ATI proteins with edited ATIs. Where, WT- Wild Type, P1- Edited HD2967 plant, P2- Edited Bobwhite plant, A1- Allele one, A2- Allele second\u003c/p\u003e","description":"","filename":"S12.Figure.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5899900/v1/abb135c171a5a9e9a7c686c5.jpg"}],"financialInterests":"The authors declare no competing interests.","formattedTitle":"\u003cp\u003e\u003cstrong\u003eReduced activity of an immunogenic macromolecule Amylase Trypsin inhibitor (ATI) in wheat through CRISPR/Cas9 mediated multiple gene editing\u003c/strong\u003e\u003c/p\u003e","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eWheat has been a staple crop for centuries, providing energy and essential nutrients to human populations. Wheat grain is rich in carbohydrates, proteins, vitamins, minerals, fibres and trace elements [\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Though wheat is consumed mainly as a source of carbohydrates, it also accounts for \u0026sim;20% of worldwide dietary protein [\u003cspan additionalcitationids=\"CR3\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Wheat proteins are broadly categorised into gluten (storage) and non-gluten (structural/ functional) fractions based on Osborne fractionation [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Gluten proteins provide viscoelastic properties to wheat flour, which makes it a unique component for various food products. Unfortunately, along with nutritional benefits, wheat also causes severe immunological disorders including auto-immune celiac disease (CD), allergic sensitivities like wheat-dependent exercise-induced anaphylaxis (WDEIA), baker\u0026rsquo;s asthma, irritable bowel syndrome (IBS), non-celiac wheat sensitivity (NCWS) [\u003cspan additionalcitationids=\"CR7 CR8\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. CD is an autoimmune disease associated with chronic diarrhoea, malnutrition and abdominal distension [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], occur due to the small intestinal enteropathy induced by dietary gluten peptides from wheat, barley and rye in persons having human leucocyte antigen HLA-DQ2/8 as a major genetic predisposition. To prevent symptoms, people with CD must adhere to a gluten-free (GF) diet, which means no wheat, barley, or rye products in their food. Many processed non-wheat foods also contain gluten for its elastic property, and hence, maintaining a gluten-free diet is very challenging [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eEfforts are being made to develop no or reduced gluten-containing wheat. Gil-Humanes et al. employed RNA interference to reduce the gliadin content and found the γ- gliadin was substantially reduced. Several allergenic epitopes of α-, γ-, and ω- gliadins in bread wheat were silenced using RNAi technology [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOther than gluten proteins, the water-soluble (albumin) fraction of wheat consists of most abundant protein molecules, Amylase/trypsin inhibitors (ATIs) [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], which mainly work as a plant defence system to protect starch and proteins in the grains [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e] and influence starch metabolism during seed germination and development [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. These bi-functional protein molecules become more relevant to wheat intolerance and have been found to play a major role in various common wheat-related pathologies, such as baker\u0026rsquo;s asthma [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], NCWS [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], and the onset of CD [\u003cspan additionalcitationids=\"CR19\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. ATIs are also reported as important triggers of several allergies and activators of innate immunity [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. In line with ATIs\u0026rsquo; dose-dependent function as co-stimulatory molecules in the adaptive immunity of CD, they appear to promote other immune-mediated diseases within and outside the GI tract [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. ATIs can act in two ways, either directly targeting specific pro-inflammatory receptors or indirectly impairing the activity of amylases and proteases (trypsin), resulting in accumulating undigested peptides with potential immunogenic properties [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Since the amylase inhibition activity was found earlier in these molecules, ATIs are also called wheat amylase inhibitors (WAI) [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. In wheat, ATIs exist as monomeric (WMAI 0.28 family M.W 12kDa), homodimeric (WDAI 0.19 family M.W. 24kDa) and heterotetrameric (WTAI CM family M.W. 60kDa) which appear to activate Toll-Like Receptors TLR4 [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Heterotetramers typically comprise a CM1 or CM2 subunit paired with a CM16 or CM17 subunit, along with two CM3 subunits. Wheat ATIs are a family of compact, highly disulfide-linked, protease-resistant proteins with low primary structural similarity but extensive secondary structural homology. Due to these properties, processed or baked foods retained ATI bioactivity. Further, ATIs are found to be highly resistant to intestinal proteolysis. Their ingestion induces modest intestinal myeloid cell infiltration and activation and release of inflammatory mediators mostly in the colon, ileum and then in the duodenum [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Hence, ATIs may be the prime candidates which cause severe forms of non-celiac gluten (wheat) sensitivity and also celiac disease. According to our hypothesis, editing some of the major \u003cem\u003eATI\u003c/em\u003e genes may result in non-functional ATIs that could replace gluten-free diets for wheat-intolerant patients. Efforts are being made to develop wheat transgenics with reduced ATIs content, and expression of \u003cem\u003eCM3\u003c/em\u003e, \u003cem\u003eCM16\u003c/em\u003e and \u003cem\u003e0.28 ATIs\u003c/em\u003e was reduced by up to 80% using RNAi technology [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Subsequently, with the advent of the CRISPR/Cas9 technique, this was the automatic choice of gene inactivation and silencing due to its efficiency, precision, multiplexing capacity, low off-target mutation rate, and capacity to create transgene-free mutant plants. CRISPR/Cas9 technique has been utilized in various studies for knockout of genes in wheat improvement programs [\u003cspan additionalcitationids=\"CR28\" citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], and Camerlengo et al. have edited two \u003cem\u003eATI\u003c/em\u003e genes, \u003cem\u003eCM3\u003c/em\u003e and \u003cem\u003eCM16\u003c/em\u003e, using CRISPR/Cas9 technology in durum wheat, which led to the activation of other \u003cem\u003eATI 0.28\u003c/em\u003e as a pleiotropic effect [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. To prevent pleiotropic effects from other members of the \u003cem\u003eATI\u003c/em\u003e family, it is important to knock out as many \u003cem\u003eATI\u003c/em\u003e genes as possible since monomeric as well as the subunits of the dimeric and tetrameric \u003cem\u003eATIs\u003c/em\u003e are reported as allergens [\u003cspan additionalcitationids=\"CR32\" citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn addition, hexaploid bread wheat contains homeologs of many genes. All 17 \u003cem\u003eATIs\u003c/em\u003e reported are homeologue of one or the other \u003cem\u003eATI\u003c/em\u003e. So far, only two \u003cem\u003eATI\u003c/em\u003e genes of tetraploid durum wheat have been edited by CRISPR/Ca9 technology. Still, the knocking out all the potential immunogenic \u003cem\u003eATI\u003c/em\u003e genes in hexaploid bread wheat has not yet been reported.\u003c/p\u003e \u003cp\u003eTo inactivate the immunogenicity of ATIs through the CRISPR Cas9 approach, all the \u003cem\u003eATIs\u003c/em\u003e need to be targeted [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. As these proteins have two functional domains, at least two sgRNA for each target \u003cem\u003eATI\u003c/em\u003e must be included in the constructs. However, there is a limit to incorporating the number of sgRNA in a single construct. So far, six sgRNA have been reported in single constructs [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e], and we wanted to adopt the same. Though there is sequence homology among some of the ATIs, and hence designing one particular sgRNA is possible, which can knock out multiple \u003cem\u003eATIs\u003c/em\u003e, but still six sgRNA (in a single construct) may not be sufficient for knockout all the target \u003cem\u003eATIs\u003c/em\u003e. Therefore, the number of constructs needs to be more than one. Inserting more than one construct inside the wheat calli through \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated transformation is an unlikely proposition due to its poor efficiency [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Hence, the alternate Biolistic Gene Gun method needs to be adopted. Keeping all these aspects in mind, we planned to target 14 major \u003cem\u003eATIs\u003c/em\u003e (out of 17 reported so far) by designing two multiplex CRISPR/Cas9 constructs with six sgRNAs in each of them. We employed the biolistic gene gun bombardment strategy to simultaneously co-transform both constructs, avoiding \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated co-transformation, which is less effective.\u003c/p\u003e"},{"header":"2. Material and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Plant Material\u003c/h2\u003e \u003cp\u003eBobwhite and HD2967 genotypes of bread wheat were used for genome editing. Bobwhite seeds were procured from Dr. Parveen Chhuneja at Punjab Agricultural University Ludhiana, and HD2967 seeds were available with us at ICAR- Indian Agricultural Research Institute.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. \u003cem\u003eIn silico\u003c/em\u003e analysis and target selection\u003c/h2\u003e \u003cp\u003eWe selected 14 major \u003cem\u003eATIs\u003c/em\u003e (\u003cem\u003e0.19, TraesCS3B02G111200, TraesCS3B02G111100, TraesCS3A02G095600, TraesCS3B02G111293, 0.28, 0.53, CM1, CM2, CM3-1, CM3-2, CM16, CM17\u003c/em\u003e, and \u003cem\u003eCMX\u003c/em\u003e) for editing them. The gene sequences of all the 14 \u003cem\u003eATIs\u003c/em\u003e were retrieved from Ensembl Plant linked to the iwgsc_refseqv1.0 wheat genome sequence database, taking the Chinese spring wheat genome as a reference. All the \u003cem\u003eATI\u003c/em\u003e genes were PCR amplified and sequenced from Bobwhite and HD2967 wheat varieties using primers as given in Supplementary Table S1. Gene sequence information from the two genotypes was used to characterize gene structure and properties. Protein pI values and Protein instability index were calculated using the \u003cem\u003eExPASy ProtParam\u003c/em\u003e tool. Transmembrane helices are calculated using using \u003cem\u003ePhobius\u003c/em\u003e software. \u003cem\u003eExpasy ProtScale\u003c/em\u003e was used to search for a hydropathic value using the Kyte \u0026amp; Doolittle scale. Sub-cellular localization of proteins was determined using \u003cem\u003eWoLF PSORT\u003c/em\u003e. Amino acid sequences of all ATIs were aligned using \u003cem\u003eMegaX\u003c/em\u003e. 3-D structure for all fourteen ATIs from wild and edited type plants was predicted using \u003cem\u003ePhyre2\u003c/em\u003e software. CRISPR targets from \u003cem\u003eATIs\u003c/em\u003e were selected based on sequencing data of both genotypes. Based on the homology among different \u003cem\u003eATI\u003c/em\u003es, the targets were selected from conserved regions in \u003cem\u003eATIs\u003c/em\u003e (Supplementary Figure S2). sgRNA targets were selected within functional domains annotated with \u003cem\u003ePfam\u003c/em\u003e (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ebi.ac.uk/interpro/\u003c/span\u003e\u003cspan address=\"https://www.ebi.ac.uk/interpro/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The secondary structure of sgRNA was predicted using \u003cem\u003eRNAfold WebServer\u003c/em\u003e (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi\u003c/span\u003e\u003cspan address=\"http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), and off-targets were predicted using \u003cem\u003eCRISPR RGEN Cas-Offinder\u003c/em\u003e tool (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.rgenome.net/cas-offinder/\u003c/span\u003e\u003cspan address=\"http://www.rgenome.net/cas-offinder/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) (Supplementary Figure S3). A total of 12 targets were identified, having NGG as a protospacer adjacent motif (PAM) for knocking out 14 \u003cem\u003eATI\u003c/em\u003es twice. The target sequences are depicted in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Before making the final CRISPR constructs, all 12 targets were evaluated with \u003cem\u003ein vitro\u003c/em\u003e cleavage assay following the manufacturer protocol. The EnGen\u0026reg; sgRNA Synthesis Kit, \u003cem\u003eS. pyogenes\u003c/em\u003e (NEB #E3322S) was used for \u003cem\u003ein vitro\u003c/em\u003e transcription of sgRNAs, Monarch\u0026reg; Spin RNA Cleanup Kit (50 \u0026micro;g) (NEB #T2040) to RNA cleanup and EnGen\u0026reg; Spy Cas9 HF1 for \u003cem\u003ein vitro\u003c/em\u003e digestion of targeted template (NEB #M0667T).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSequences of 12 selected targets to knockout 14 \u003cem\u003eATIs\u003c/em\u003e\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSr. No.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTarget of Genes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTarget 1\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTarget 2\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003e0.19/0.53/ TraesCS3B02G111200/ TraesCS3B02G111100/ TraesCS3A02G095600/ TraesCS3B02G111293\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAATGGCAGCCAGGTGCCCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTCAGCTTCACCACCTCCCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003e0.28\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAATCTCTTAGGACAGCCTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCACTACGCAACATGCTGCTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eCM1\u003c/em\u003e \u0026amp; \u003cem\u003eCM2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACGACGCCTCGCAGCATTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCAACCCGCTTGAAGGCTGCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eCM3-1\u003c/em\u003e \u0026amp; \u003cem\u003eCM3-2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACTTGTGGCACCTTCACCCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGGCAGCAATACAACTTGGCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eCM16\u003c/em\u003e \u0026amp; \u003cem\u003eCM17\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCATGAAGTAGCGCAGCGCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGGAACTCCCCGGATGCCCTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e6.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eCMX\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTGCTGCGACGAGCTGTCCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTAACGCCCGCCGCGAGTACG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Preparation of multiplex CRISPR/Cas9 constructs\u003c/h2\u003e \u003cp\u003eA modular cloning method [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e] was used to prepare multiplex CRISPR/Cas9 constructs. We have utilized a tRNA-sgRNA expression system for the expression of six sgRNAs under a single TaU3 promoter [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Modular cloning here consists of 3 levels of cloning from level 0 to level 2. In Level-0 module cloning, 6 oligonucleotide targets were cloned into six different Level-0 vectors (pFH113, pAK002, pAK003, pAK004, pAK005, pAK006) using golden gate reaction with \u003cem\u003eBpi\u003c/em\u003eI restriction enzyme and T4 DNA ligase enzymes. The sequences of the primers used to generate the target oligonucleotides are provided in Supplementary Table\u0026nbsp;4. These Level-0 module vector backbones contained part of tRNA glycine and sgRNA scaffold. The resulting vectors were named pSP01, pSP02, pSP03, pSP04, pSP05 and pSP06 (Supplementary Fig.\u0026nbsp;5). Cloning fragments from all these 6 Level-0 vectors along with TaU3 promoter from pFH31 were cloned into Level-1 vector backbone (pICH47751) using golden gate reaction with \u003cem\u003eBsa\u003c/em\u003eI restriction enzyme and T4 DNA ligase enzymes. Finally, two Level-1 vectors were developed and named pSP1.1 and pSP1.2 (Supplementary Figure S6). To Develop Level-2 vector (Supplementary Figure S7), pPML1.1/pPML1.2 (contains six sgRNAs under \u003cem\u003eTa\u003c/em\u003eU3 promoter) and pFH66 (containing wheat codon optimized \u003cem\u003eSpCas9\u003c/em\u003e under ZmUbi promoter) and pFH114 (\u003cem\u003eBar\u003c/em\u003e gene under ZmUbi promoter) and corresponding end linker (pICH41766) were cloned into a binary vector backbone (pICSL4723) using golden gate reaction with \u003cem\u003eBpi\u003c/em\u003eI restriction enzyme and T4 DNA ligase enzyme [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. These level-2 vectors are named pPML2.1 and pPML2.2.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Explant preparation and Delivery of constructs\u003c/h2\u003e \u003cp\u003eThe protocol designed by Sparks and Doherty was utilized to transform immature wheat scutella using biolistic bombardment [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Immature embryos (12\u0026ndash;16 days after pollination (DAP), having an approximate diameter of 0.75 to 1.5 mm) were surface sterilized using 2% W/V sodium hypochlorite and 70% ethanol. Axis of each immature embryo was excised aseptically using a sterile scalpel. Excised scutella were put upside down on callus induction media (CIM) to keep the scutellum in touch with the media [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. After 2 days of incubation on CIM, the scutella were co-bombarded with 2 mg gold particles (0.6\u0026micro;m diameter) (Bio-Rad, USA) coated with 4 \u0026micro;g of each pPML2.1 and pPML2.2 vector plasmids. In each experimental setup, three plates, each containing 25 scutella, were subjected to two rounds of bombardment. Particle bombardment is carried out using the PDS-1000/He particle delivery system (Bio-Rad Laboratories Ltd., UK). A rupture disc of 650 psi was used. The gap between the rupture disc and the macrocarrier was kept at 2.5 cm. The target distance between the stopping screen and the target plate was maintained at 5.5 cm. The 28\u0026ndash;30 Hg vacuum was created at a flow rate of 5.0 vacuum, and 4.5 was kept as the vacuum vent rate [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Bombarded scutella were kept on resting media (CIM) at 22\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C in the dark for 1 week.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Selection and Regeneration of transformed Calli\u003c/h2\u003e \u003cp\u003eAfter 1 week of incubation at resting media, the bombarded calli were placed on selection media (containing CIM supplemented with 4 mg/l glufosinate-ammonium) at 22\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C in the dark. After an initial incubation period of two weeks, the calli were transferred to the second selection media containing CIM supplemented with 8 mg/l glufosinate-ammonium. The sub-culturing process occurred at 22\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C in complete darkness for an additional two weeks. After selection, the calli were placed onto the regeneration media containing MS media with BAP (2.5 mg/l), Zeatin (2.5 mg/l), NAA (0.25 mg/l), glufosinate-ammonium (4 mg/l), CuSO\u003csub\u003e4\u003c/sub\u003e (20 mg/l) at 22\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C in 16/8 light/dark hours for 2 weeks. Further subculturing, shoot separation from regenerated calli, transferring to root induction media, and hardening of regenerated plantlets were done as mentioned by [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Molecular screening and analysis of mutations in regenerated plants\u003c/h2\u003e \u003cp\u003eLeaf sample was collected, and DNA was isolated from all the regenerated plants using the CTAB method [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Primers specific to Cas9 (SP99 primer\u0026thinsp;=\u0026thinsp;AAGAACCTGTCCGACGCCAT and SP100 primer\u0026thinsp;=\u0026thinsp;GGTGATCGTTTCCTCGCTCT) were used to amplify Cas9. Further, all 14 ATI discuss genes were amplified using the flanking primers (Supplementary Table\u0026nbsp;1) and DNA templates from all regenerated plants, and the amplicons were sequenced. \u003cem\u003eATI\u003c/em\u003e sequences obtained from transformed plants were mapped, aligned and compared using \u003cem\u003eGeneious Prime, MegaX, DECODRv3.0\u003c/em\u003e and \u003cem\u003eBioEdit7.7\u003c/em\u003e software for evaluating different types of mutations.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Isolation of ATIs and analysis of Amylase/Trypsin enzyme inhibition assays\u003c/h2\u003e \u003cp\u003eATIs from wheat flour were isolated using the protocol optimized by Sagu et al. with modifications [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Powdered wheat flour (100 mg) was defatted with 0.5 ml of petroleum ether by vortexing for 10 minutes, followed by centrifugation at 10000xg for 5 minutes at 4\u0026deg;C. The supernatant containing petroleum ether and dissolved fats was discarded, and the pellet was air-dried at room temperature (RT, 25\u0026deg;C) for 45 minutes. Chloroform: Methanol (2:1) (0.5 ml) was added to the dried pellet and vortexed for 3 hours at 4\u0026deg;C, followed by centrifugation at 10000 x g for 10 min. at 4\u0026deg;C. The supernatant was collected and left undisturbed overnight to evaporate chloroform and methanol solution. Next day, 0.4 ml of dissolving buffer (25 mM Tris-Cl, 1.67M NaCl, pH 9.1;) was added to the pellet and vortexed for 2 minutes, followed by sonication for 5 minutes, and then centrifuged at 10000 x g for 10 min. at 4\u0026deg;C. The clear supernatant containing ATIs was collected and quantified using Bradford reagent (Sigma, Merck, USA). The extracted ATIs were confirmed using SDS-PAGE (4% stacking, 15% running gel), where approximately a 14-15kD band was observed (since most of the monomeric ATI polypeptides are 14-15kD size). HPLC profiling of the extracted ATI solution was carried out in a Shimadzu UFLC system [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. ATI solution (100\u0026micro;l) was injected through auto-injector, and different ATIs were separated using a Shim-pack GISS C18 column (Dimension: 250 mm length, 10mm internal diameter, 5 \u0026micro;m particle size) aqueous trifluoroacetic acid (0.1%) solution and aqueous acetonitrile (70%) solution were used as eluents A and B respectively in gradient mode at a flow rate of 1 ml/min (Supplementary Table S8).\u003c/p\u003e \u003cp\u003eThe \u003cb\u003eamylase enzyme inhibition\u003c/b\u003e assay was carried out using a method developed by Xiao et al. (2006) with modification. α-amylase enzyme (Sigma, Merck, USA)12.2 unit/\u0026micro;l) was diluted 100 times with 0.02 M Phosphate buffer (PBS), pH 7.1. The diluted enzyme (80 \u0026micro;l) and extracted ATI solution (100 \u0026micro;l) were mixed and incubated at 37\u0026deg;C for 30 minutes. To the above solution, 120 \u0026micro;l of 1% soluble starch solution was mixed and incubated at RT for 5 minutes. To this solution, 60 \u0026micro;l of iodine solution (100 ml aqueous solution containing 340 mg Iodine (27mM) and 660 mg Potassium Iodide (40mM)) in) was mixed and absorbance was recorded at 600 nm using a microplate reader (BIOTEK, USA). To determine the % inhibition of α-amylase enzyme, the following formula was used:\u003c/p\u003e \u003cp\u003eIAA (%) = [(AA\u003csub\u003eT\u003c/sub\u003e-AA\u003csub\u003eC\u003c/sub\u003e)/AA\u003csub\u003eC\u003c/sub\u003e] \u0026times; 100\u003c/p\u003e \u003cp\u003eWhere, IAA is Inhibition of α-amylase activity, AA\u003csub\u003eC\u003c/sub\u003e is the amylase activity of the control (without ATIs) and AA\u003csub\u003eT\u003c/sub\u003e is the tested amylase activity in the presence of extracted ATIs at the same conditions.\u003c/p\u003e \u003cp\u003e \u003cb\u003eTrypsin enzyme inhibition\u003c/b\u003e was carried out using a modified azocasein protease assay [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Extracted ATI solution (100 \u0026micro;L) was mixed with 30 \u0026micro;L of 0.5% sodium bicarbonate buffer pH 8.3 and 20 \u0026micro;L of 0.25% trypsin-EDTA solution. 2.5% azocasein solution (125 \u0026micro;L) was added to the above solution, and the mixture was incubated at 37\u0026deg;C for 30 min. The above mixture (100 \u0026micro;L) was again mixed with 400 \u0026micro;L of 5% trichloroacetic acid solution and incubated at RT for 5 minutes, followed by centrifugation for 5 min at 10,000X g at 4\u0026deg;C. The above solution (400 \u0026micro;L) was mixed with 1200 \u0026micro;L of 500mM NaOH solution, and the absorbance was recorded at 440 nm. To determine the % inhibition of trypsin enzyme, the following formula was used:\u003c/p\u003e \u003cp\u003eITA (%) = [(TA\u003csub\u003eC\u003c/sub\u003e-TA\u003csub\u003eT\u003c/sub\u003e)/TA\u003csub\u003eC\u003c/sub\u003e] \u0026times; 100\u003c/p\u003e \u003cp\u003eWhere, ITA is inhibition of trypsin activity, TA\u003csub\u003eC\u003c/sub\u003e is the trypsin activity of control and TA\u003csub\u003eT\u003c/sub\u003e is the tested trypsin activity in the presence of ATIs.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003e\u003cem\u003e3.1. In-Silico\u003c/em\u003e analysis of \u003cem\u003eATIs\u003c/em\u003e\u003c/h2\u003e\n \u003cp\u003eThese 14 \u003cem\u003eATIs\u003c/em\u003e under study are either monomeric (WMAI), dimeric (WDAI) or tetrameric (WTAI) proteins, with their gene sizes ranging between 1566 and 2152 bp. Each gene contains a single exon of size ranging between 366 and 952. Details of gene size, exon size, copy number and locations of these 14 \u003cem\u003eATIs\u003c/em\u003e are given in Supplementary Table 9.\u003c/p\u003e\n \u003cp\u003eAll the ATIs are small proteins of molecular weight ranging from 13.843 to 18.319 kDa. The proteins CM2, CM16, CM17, TraesCS3B02G111200, TraesCS3B02G111100, 0.19, and 0.53 were found to be acidic, since their estimated pI values were less than 7 (pI\u0026thinsp;\u0026lt;\u0026thinsp;7), whereas 0.28, TraesCS3A02G095600, TraesCS3B02G111293, CM1, CM3-1, CM3-2, and CMX were basic in nature as their pI values were more than 7 (pI\u0026thinsp;\u0026gt;\u0026thinsp;7). All ATIs showed a high alipathic index ranging between 75.73 to 95.23, which indicated that these proteins were highly thermostable. All the ATIs also showed a single transmembrane helix except 0.19, TraesCS3B02G111200, TraesCS3B02G111100, TraesCS3A02G095600, and 0.53. Hydropathic values revealed that hydrophobic amino acid residues predominated in the peptide chains of all ATIs. Our analysis showed all the ATIs were extracellular in nature, except CMX and TraesCS3B02G111200, which were found to be localized in the chloroplast. Multiple (amino acid) sequence alignment of all 14 ATIs revealed the presence of highly conserved amino acid domains within the same ATI group, as shown in Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e. Ten highly conserved cysteine residues were observed in all ATIs except for CMX, which has eight cysteine residues. The amino acid sequence similarity among different members of the ATI family varies between 30% and 95%.\u003c/p\u003e\n \u003cp\u003e3-D structure for all 14 ATIs showed that most of the regions of all the fourteen ATIs consisted of \u0026alpha;-helix structure (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). Structurally, they shared a common folding pattern, characterized by 4 to 5 \u0026alpha;-helices and a brief antiparallel \u0026beta;-sheet. \u0026alpha;-helix region was found in a range between 38 to 59%.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003e3.2. Development of CRISPR/Cas9 constructs for transformation\u003c/h2\u003e\n \u003cp\u003eTwo final CRISPR/Cas9 vectors, each with 6 sgRNA under TaU3 promoter (position 3), wheat codon optimized SpCas9 under ZmUbi (position 2), and Bar gene under ZmUbi promoter (position 1), were assembled and named as pPML2.1 and pPML2.2 and transformed into \u003cem\u003eE. coli\u003c/em\u003e for further multiplication and confirmation. These two vectors were confirmed by restriction digestion and sequencing, and the vector Maps are shown in Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ea and Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eb).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003e3.3. Transformation and Regeneration\u003c/h2\u003e\n \u003cp\u003eTwo CRISPR/Cas9 multiplex constructs, each having 6 sgRNAs, were coated on gold particles and co-bombarded on immature wheat scutella using a Biolistic gun. Bombarded scutella were regenerated into the whole plant through callusing [\u003cspan class=\"CitationRef\"\u003e38\u003c/span\u003e], which underwent two selection steps. Different stages of wheat transformation are depicted in Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n \u003ch2\u003e3.4. Molecular screening of transformed plants\u003c/h2\u003e\n \u003cp\u003eWe have obtained 10 Bobwhite and 8 HD2967 regenerated plants after the transformation. However, our result showed that only one plant was PCR positive with the \u003cem\u003eCas9\u003c/em\u003e gene in the case of Bobwhite (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e) and none in the case of HD2967. However, the sequence results showed many \u003cem\u003eATI\u003c/em\u003e genes were edited in one HD2967 regenerated plant in addition to the PCR-positive Bobwhite transgenic plant. Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e and Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e have details of the mutation results.\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tab2\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003e(Plant 1) Mutations in Bobwhite edited plant\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"7\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eSr. No.\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eName of \u003cem\u003eATI\u003c/em\u003e\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" rowspan=\"2\"\u003e\n \u003cp\u003eNature of mutation\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eAllele 1\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eAllele 2\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eTarget 1\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eTarget 2\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eTarget 1\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eTarget 2\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003e0.28\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHeterozygous\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eG to A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eC deletion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eG Deletion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNo Mutation\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003e0.19\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHeterozygous\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNo mutation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGA Deletion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eC Deletion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eA Insertion\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003e0.53\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHeterozygous\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eA Insertion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eG Deletion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTGC Deletion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCT Insertion\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eTraesCS3B02G111200\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHeterozygous\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNo Mutation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAG Deletion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eC Insertion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eG Insertion\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eTraesCS3B02G111100\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHeterozygous\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGTG Deletion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eG Deletion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eC Insertion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNo Mutation\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eTraesCS3A02G095600\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHeterozygous\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTGC Deletion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGA Deletion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eC Insertion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eG Insertion\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eTraesCS3B02G111293\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHomozygous\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eT Deletion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eG Insertion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eT Deletion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eG Insertion\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eCM1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHeterozygous\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAT Insertion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNo Mutation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGC Deletion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNo Mutation\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eCM2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHomozygous\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCT Deletion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eT Deletion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCT Deletion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eT Deletion\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eCM3-1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHeterozygous\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003e71 bp Deletion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eC Deletion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eC Deletion, GG Insertion\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e11.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eCM3-2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHeterozygous\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCC Deletion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNo Mutation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCC Deletion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eA Insertion\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e12.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eCM 16\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"5\"\u003e\n \u003cp\u003eNo Mutation\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e13.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eCM 17\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"5\"\u003e\n \u003cp\u003eNo Mutation\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e14.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eCMX\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHeterozygous\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eA Insertion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eC Deletion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNo Mutation\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eC Deletion\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cdiv class=\"gridtable\"\u003e\n \u003cdiv align=\"left\" class=\"colspec\"\u003e\u003cbr\u003e\u003c/div\u003e\u0026nbsp;\u003ctable id=\"Tab3\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003ePlant (2) Mutations in HD2967 edited plant\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"5\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSr. No.\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eName of \u003cem\u003eATI\u003c/em\u003e\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eNature of mutation\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eAllele 1\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eAllele 2\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003e0.28\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHeterozygous\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAG Insertion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNo mutation\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003e0.19\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHomozygous\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eC Deletion\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003e0.53\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHeterozygous\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eC Deletion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGTGC Deletion\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eTraesCS3B02G111200\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHeterozygous\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCC Deletion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eC Insertion\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eTraesCS3B02G111100\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHomozygous\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eC Deletion\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eTraesCS3A02G095600\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"3\"\u003e\n \u003cp\u003eNo Mutation\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eTraesCS3B02G111293\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHeterozygous\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eG Insertion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eNo mutation\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eCM1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"3\"\u003e\n \u003cp\u003eNo Mutation\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eCM2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"3\"\u003e\n \u003cp\u003eNo Mutation\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eCM3-1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHeterozygous\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8 bp Deletion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eA-T substitution\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e11.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eCM3-2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHomozygous\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eC Insertion\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e12.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eCM 16\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"3\"\u003e\n \u003cp\u003eNo Mutation\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e13.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eCM 17\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"3\"\u003e\n \u003cp\u003eNo Mutation\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e14.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eCMX\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHeterozygous\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGAAC Insertion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eT Deletion, C Insertion\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n \u003ch2\u003e3.5. Mutations in different genes\u003c/h2\u003e\n \u003cp\u003eIn our study, we targeted 14 \u003cem\u003eATI\u003c/em\u003e genes for mutation. Mutations in 12 \u003cem\u003eATI\u003c/em\u003e genes in the case of Bobwhite and 9 \u003cem\u003eATI\u003c/em\u003e genes in the case of HD2967 were observed in our study. Multiple sequence alignments of WT and mutants have been carried out for each \u003cem\u003eATI\u003c/em\u003e gene (CDS) and provided in Supplementary Figure S10. Some of the mutations were found to be homozygous, while some of them were heterozygous. We observed different types of mutations at both the targeted sites.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n \u003ch2\u003e3.6. Comparative analysis of ATI peptides between the wild-type and mutated plants\u003c/h2\u003e\n \u003cp\u003eDue to the mutation in all \u003cem\u003eATI\u003c/em\u003e genes except CM16 and CM17 in the edited Bobwhite plant, the amino acid sequences were altered due to the frameshift mutation in most of the cases. Multiple sequence alignment showed the changes between WT and the mutants for each \u003cem\u003eATI\u003c/em\u003e gene sequence and ATI peptides sequence (Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e). Details of edited ATI proteins with their different features and properties are given in Supplementary Table S11 and predicted 3D structures are shown in Supplementary figure S12.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\n \u003ch2\u003e3.7. Comparison of ATI concentration between edited and wild-type plants\u003c/h2\u003e\n \u003cp\u003eATIs from T0 seeds of wild and edited plants was isolated, quantified and compared for both the mutant plants. The concentration of ATIs extracted from flour of wild-type Bobwhite and HD 2967 seeds were estimated at about 340 \u0026micro;g/100mg and 360 \u0026micro;g/100mg wheat flour, respectively. ATI concentration was found to be reduced by 30.61% and 20% for edited Bobwhite and edited HD2967 plants, respectively (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\n \u003ch2\u003e3.8. Comparison of HPLC chromatogram between edited and wild-type plants\u003c/h2\u003e\n \u003cp\u003eHPLC results also showed that the total ATI content was reduced in the seeds of both the mutated plants, which was very apparent from the reduced peak area in the chromatograms. (Fig. \u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003e and Fig. \u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\n \u003ch2\u003e3.9. \u0026alpha;-Amylase enzyme inhibition activity\u003c/h2\u003e\n \u003cp\u003eThe \u0026alpha;-amylase enzyme inhibition activity was assessed using the ATIs extracted from seeds of wild type as well as mutated plants. 38.25% and 55.34% of \u0026alpha;-amylase enzyme inhibition activity were assessed for ATIs extracted from seeds of edited Bobwhite and edited HD 2967 plants, respectively. Compared with the wild type, the \u0026alpha;-amylase enzyme inhibition activity was found to be reduced by 50.74% and 37.84% for Edited Bobwhite and Edited HD2967, respectively, as shown in Fig. \u003cspan class=\"InternalRef\"\u003e10\u003c/span\u003e.\u003c/p\u003e\u003cspan\u003e\n \u003cp\u003e\u003cstrong\u003e3.10 Comparison of Trypsin enzyme inhibition activity of ATIs extracted from seeds of Wild type and Edited Bobwhite and HD2967 plants.\u003c/strong\u003e\u003c/p\u003e\n \u003c/span\u003e\n \u003cp\u003eTrypsin enzyme inhibition activity was assessed for ATIs extracted from seeds of edited Bobwhite and edited HD 2967 plants. 10.01% and 13.95% of Trypsin enzyme inhibition activity were assessed for ATIs extracted from seeds of edited Bobwhite and edited HD 2967 plants, respectively. Compared with the wild type, the trypsin enzyme inhibition activity was found to be reduced to 44.90% and 34.41% for Edited Bobwhite and Edited HD2967 resp., as shown in Fig. \u003cspan class=\"InternalRef\"\u003e11\u003c/span\u003e.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eOne of the most widely grown crops in the world is wheat, which is a significant component of the typical human diet. Wheat grain provides 75\u0026ndash;85% carbohydrates, 10\u0026ndash;15% proteins, 2% lipids and minerals, and a considerable proportion of vitamins (thiamine and vitamin B) and minerals (zinc, iron) that convey substantial nutritional benefits to humans. Along with nutritional components, wheat also contains anti-nutritional molecules that cause various types of health-related issues in humans. Wheat ATI proteins were first investigated because of their crucial function in plant resistance to insects and microbiological pathogens, and more recently due to their allergenic effects in humans. It is now accepted worldwide that structural and metabolic proteins α-amylase/trypsin inhibitors (ATI) have a role in the development of wheat allergies (bakers' asthma), non-celiac wheat sensitivity (NCWS), and possibly celiac disease [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTo date, 17 different copies of \u003cem\u003eATI\u003c/em\u003e genes have been reported. In the present study, 14 genes were identified and targeted twice to increase knockout efficiency. To target these 14 genes twice, 28 sgRNAs were required. However, we reduced the number of sgRNAs to 12 based on the sequence homology. Due to sufficient sequence homology in conserved regions, all the 14 genes were aligned and classified into six groups. A total of 12 potential targets were selected, and two targets were assigned to each group. In fact, each vector having 6 sgRNAs could target all the 14 genes, and hence by two vectors, all 14 genes were targeted twice. Such a large number of targets for knocking out in wheat is not reported. In case of \u003cem\u003eATI\u003c/em\u003e, two genes namely \u003cem\u003eCM3\u003c/em\u003e and \u003cem\u003eCM16\u003c/em\u003e were knocked out [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e] in durum wheat, and the number of targets were 7. We ambitiously targeted 14 \u003cem\u003eATI\u003c/em\u003e in a single transformation, and probably no other gene editing methods like ZFN, TALENs, meganucleases could handle such a large number of gene editing other than CRISPR/Cas9 [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. But even in case of CRISPR/ Cas9 technology, targeting 14 genes, with 12 sgRNAs through a single vector is a relatively difficult proposition. Though a larger number of sgRNA has been cloned in a vector [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e], so far, a maximum of 6 sgRNAs in a single vector have produced successful editing in wheat [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. This is mainly because a single promoter driven multiple sgRNA beyond a limit reduces transcription efficiency [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. In addition, a single Cas9 enzyme may not be sufficient to edit up to 14 genes [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Therefore, we prepared two multiplex CRISPR/Cas9 constructs, each with 6 sgRNAs. These two CRISPR/Cas9 constructs could have been delivered through \u003cem\u003eagrobacterium\u003c/em\u003e-mediated transformation, but we used biolistic bombardment mainly to avoid \u003cem\u003eagrobacterium\u003c/em\u003e contamination, dependency on host-pathogen interactions, and more time-consuming protocol [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e], and also to facilitate multigene delivery, compatibility with synthetic constructs and broad host range (genotypes) [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eRegeneration after transformation is also another challenge in wheat crop. However, our optimized \u003cem\u003ein vitro\u003c/em\u003e regeneration protocol could successfully regenerate a sufficient number of regenerated plants (18 plants). However, PCR analysis did not confirm most of the regenerated plants as positive transformants, which suggests the non-integration of the transgene into the wheat genome. In the case of one Bobwhite transgenic plant, transgene from both vectors was integrated, and the plants also showed mutation either in one or both targets in 12 out of 14 genes. This seems encouraging and corroborated with the earlier reports where multiple genes were targeted, and most of which were edited. Multiple gluten genes were knocked-out recently using CRISPR/Cas9 technology in wheat, where indels were observed in targeted \u003cem\u003eγ-\u003c/em\u003e and \u003cem\u003eω-gliadin\u003c/em\u003e genes. Analysis of the seeds from the edited plants showed a 97.7% reduction in gluten content [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. Mutations were observed in all the three targeted genes (\u003cem\u003eTaGW2\u003c/em\u003e, \u003cem\u003eTaLpx-1\u003c/em\u003e, and \u003cem\u003eTaMLO\u003c/em\u003e) in wheat protoplast using endogenous tRNA-sgRNA expression system [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eInterestingly, one of the regenerated HD2967 plants showed mutations in 9 out of 14 targeted genes, with editing in one target each, and all the targets were from the same constructs, pPML2.1. This is a case of transient expression of the transformed vector which did not get integrated into the genome, and probably only one vector was transformed into the explant which showed the transient expression. It has already been reported that transient expression of CRISPR/Cas9 components can lead to genome editing without the integration of transgenes in crops like wheat [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e] and banana [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. Our result showed most of the mutations in both plants resulted in 1\u0026ndash;4 bp deletion within the editing window, resulting in frameshift mutations, leading to misfolding and premature termination of the protein. A few mutations were homozygous, while others were heterozygous in both edited plants.\u003c/p\u003e \u003cp\u003eWe have prepared 3D protein structures of all the mutated ATIs in both the edited plants, and compared them with their respective wild types. We found that some of the mutations lead to truncated protein with only 45 amino acids, which might or might not be extracted by the protocol we used. Probably due to this, the concentration of ATIs was reduced. The number of genes mutated in the case of Bobwhite is more than HD2967, which leads to more ATI content reduction in Bobwhite flour (30.51%) than that of HD2967 (20%). Several wheat ATIs can inhibit insect amylases, bacterial amylases and mammalian amylases [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. This study evaluated the \u003cem\u003eBacillus licheniformis\u003c/em\u003e α-amylase and porcine trypsin enzyme inhibition activities of isolated ATIs. In the present study, α-amylase enzyme inhibition activity of ATIs from edited Bobwhite and HD2967 was found to be reduced to 50.74% and 37.84%, respectively, when compared to wild-type Plants. Similarly, the trypsin enzyme inhibition activity was found to be reduced to 44.90% and 34.41% for edited Bobwhite and HD2967, respectively, when compared to the wild type. Reduction in the functionality of ATIs was more in the seeds from the edited Bobwhite plant than in the HD2967 edited plant, mainly because the number of \u003cem\u003eATI\u003c/em\u003e gene disruptions was higher in Bobwhite. ATIs are biological compounds with distinct dual functions that bind to trypsin and α-amylase and turn them inactive. In fact, ATIs have two active sites in one single domain that bind to α-amylase and trypsin non-competitively and inhibit the activities of both enzymes [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Disruption of that domain resulted in a decrease in amylase and trypsin enzyme inhibition with similar intensity. This study is a proof of concept of multiple gene editing with a large number of targeted sgRNA at a time in a single transformation event.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eThis study demonstrates the reduction in ATI activity by successfully mutating 12 genes in wheat through a single transformation using biolistic methods. We also found transient expression of the CRISPR/Cas9 vector, which efficiently induced targeted mutations in wheat without genomic integration of the construct. Furthermore, our findings indicated that the reduction in\u0026nbsp;α-amylase enzyme (ATI) content depends on the number of \u003cem\u003eATI\u003c/em\u003e genes mutated and the degree of truncation in their sequences. This work highlights the potential of biolistic-mediated genome editing for achieving multiplexed gene targeting in polyploid crops, especially to knock out multiple genes responsible for immunogenicity in wheat.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eDeclaration of competing interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCRediT authorship contribution statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSachin Phogat:\u003c/strong\u003e Methodology, Investigation, Formal analysis, Conceptualization, Visualization, Writing - original draft, Writing - review \u0026amp; editing. \u003cstrong\u003eAnkur Poudel:\u003c/strong\u003e Formal analysis, Visualization.\u003cstrong\u003e\u0026nbsp;Gayatri:\u0026nbsp;\u003c/strong\u003eMethodology,Writing - review \u0026amp; editing.\u003cstrong\u003e\u0026nbsp;Megha Kaushik:\u0026nbsp;\u003c/strong\u003eMethodology, Investigation.\u003cstrong\u003eJayanthi Madhavan\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e Methodology, Validation, Writing - review \u0026amp; editing.\u003cstrong\u003eAmitha Mithra Sevanthi:\u0026nbsp;\u003c/strong\u003eWriting - review \u0026amp; editing.\u0026nbsp;\u003cstrong\u003eJasdeep Charath Padaria:\u0026nbsp;\u003c/strong\u003eWriting - review \u0026amp; editing.\u003cstrong\u003eVladimir Nekrasov:\u003c/strong\u003e Methodology, Writing - review \u0026amp; editing.\u0026nbsp;\u003cstrong\u003ePradeep Kumar Singh:\u0026nbsp;\u003c/strong\u003eWriting - review \u0026amp; editing. \u003cstrong\u003ePranab Kumar Mandal\u003c/strong\u003e: Conceptualization, Methodology, Project administration, Resources, Supervision, Writing - original draft, Writing - review \u0026amp; editing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors acknowledge the financial support by CRP on Biofortification, the Indian Council of Agricultural Research (ICAR) and the Department of Biotechnology, Govt. \u0026nbsp;of India for carrying out the work. The first author wants to acknowledge the University Grant Commission and ICAR-NAHEP-CAAST for providing fellowship during this study. The authors want to Acknowledge Dr Parveen Chhuneja for providing the seeds of the Bobwhite variety of wheat. Vladimir Nekrasov received funding from the Biotechnology and Biological Sciences Research Council of the United Kingdom through the Delivering Sustainable Wheat program (BB/X011003/1). The authors would also like to acknowledge the support and guidance the Director, ICAR-National Institute for Plant Biotechnology, New Delhi, provided.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eP. Giraldo, E. Benavente, F. Manzano-Agugliaro, E. Gimenez, Worldwide research trends on wheat and barley: A bibliometric comparative analysis, Agronomy 9 (2019) 352.\u003c/li\u003e\n \u003cli\u003eM. Acevedo, J.D. Zurn, G. Molero, P. Singh, X. He, M. Aoun, P. Juliana, H. Bockleman, M. Bonman, M. El-Sohl, The role of wheat in global food security, in: Agric. Dev. Sustain. Intensif., Routledge, 2018: pp. 81\u0026ndash;110.\u003c/li\u003e\n \u003cli\u003eB. Shiferaw, M. Smale, H.-J. Braun, E. Duveiller, M. Reynolds, G. Muricho, Crops that feed the world 10. Past successes and future challenges to the role played by wheat in global food security, Food Secur. 5 (2013) 291\u0026ndash;317.\u003c/li\u003e\n \u003cli\u003eA. Breiman, D. Graur, Wheat evolution, Isr. J. Plant Sci. 43 (1995) 85\u0026ndash;98.\u003c/li\u003e\n \u003cli\u003eT.B. Osborne, C.L. Voorhees, PROTEIDS OF THE WHEAT KERNEL., J. Am. Chem. Soc. 16 (1894) 524\u0026ndash;535.\u003c/li\u003e\n \u003cli\u003eL.K. Kucek, L.D. Veenstra, P. Amnuaycheewa, M.E. Sorrells, A grounded guide to gluten: how modern genotypes and processing impact wheat sensitivity, Compr. Rev. Food Sci. Food Saf. 14 (2015) 285\u0026ndash;302.\u003c/li\u003e\n \u003cli\u003eK.A. Scherf, K. Brockow, T. Biedermann, P. Koehler, H. Wieser, Wheat‐dependent exercise‐induced anaphylaxis, Clin. Exp. Allergy 46 (2016) 10\u0026ndash;20.\u003c/li\u003e\n \u003cli\u003eR.M. Kalunke, S. Tundo, F. Sestili, F. Camerlengo, D. Lafiandra, R. Lupi, C. Larr\u0026eacute;, S. Denery-Papini, S. Islam, W. Ma, Reduction of allergenic potential in bread wheat RNAi transgenic lines silenced for CM3, CM16 and 0.28 ATI genes, Int. J. Mol. Sci. 21 (2020) 5817.\u003c/li\u003e\n \u003cli\u003eP.R. Shewry, Wheat, J. Exp. Bot. 60 (2009) 1537\u0026ndash;1553.\u003c/li\u003e\n \u003cli\u003eD. Stepniak, F. Koning, Celiac disease\u0026mdash;sandwiched between innate and adaptive immunity, Hum. Immunol. 67 (2006) 460\u0026ndash;468.\u003c/li\u003e\n \u003cli\u003eC. Ciacci, P. Ciclitira, M. Hadjivassiliou, K. Kaukinen, J.F. Ludvigsson, N. McGough, D.S. Sanders, J. Woodward, J.N. Leonard, G.L. Swift, The gluten-free diet and its current application in coeliac disease and dermatitis herpetiformis, United Eur. Gastroenterol. J. 3 (2015) 121\u0026ndash;135.\u003c/li\u003e\n \u003cli\u003eJ. Gil-Humanes, F. Pist\u0026oacute;n, S. Tollefsen, L.M. Sollid, F. Barro, Effective shutdown in the expression of celiac disease-related wheat gliadin T-cell epitopes by RNA interference, Proc. Natl. Acad. Sci. 107 (2010) 17023\u0026ndash;17028.\u003c/li\u003e\n \u003cli\u003eS. Geisslitz, P. Weegels, P. Shewry, V. Zevallos, S. Masci, M. Sorrells, A. Gregorini, M. Colomba, D. Jonkers, X. Huang, Wheat amylase/trypsin inhibitors (ATIs): occurrence, function and health aspects, Eur. J. Nutr. (2022) 1\u0026ndash;8.\u003c/li\u003e\n \u003cli\u003eR.A. Islamov, O. V Fursov, Bifunctional inhibitor of \u0026alpha;-amylase/trypsin from wheat grain, Appl. Biochem. Microbiol. 43 (2007) 379\u0026ndash;382.\u003c/li\u003e\n \u003cli\u003eA.S. Tatham, P.R. Shewry, Allergens to wheat and related cereals, Clin. Exp. Allergy 38 (2008) 1712\u0026ndash;1726.\u003c/li\u003e\n \u003cli\u003eG. Salcedo, R. Sanchez-Monge, G. Garcia-Casado, A. Armentia, L. Gomez, D. Barber, The cereal \u0026alpha;-amylase/trypsin inhibitor family associated with bakers\u0026rsquo; asthma and food allergy, Plant Food Allergens (2004) 70\u0026ndash;84.\u003c/li\u003e\n \u003cli\u003eC. Catassi, L. Elli, B. Bonaz, G. Bouma, A. Carroccio, G. Castillejo, C. Cellier, F. Cristofori, L. De Magistris, J. Dolinsek, Diagnosis of non-celiac gluten sensitivity (NCGS): the Salerno experts\u0026rsquo; criteria, Nutrients 7 (2015) 4966\u0026ndash;4977.\u003c/li\u003e\n \u003cli\u003eY. Junker, S. Zeissig, S.-J. Kim, D. Barisani, H. Wieser, D.A. Leffler, V. Zevallos, T.A. Libermann, S. Dillon, T.L. Freitag, Wheat amylase trypsin inhibitors drive intestinal inflammation via activation of toll-like receptor 4, J. Exp. Med. 209 (2012) 2395\u0026ndash;2408.\u003c/li\u003e\n \u003cli\u003eV.F. Zevallos, V. Raker, S. Tenzer, C. Jimenez-Calvente, M. Ashfaq-Khan, N. R\u0026uuml;ssel, G. Pickert, H. Schild, K. Steinbrink, D. Schuppan, Nutritional wheat amylase-trypsin inhibitors promote intestinal inflammation via activation of myeloid cells, Gastroenterology 152 (2017) 1100\u0026ndash;1113.\u003c/li\u003e\n \u003cli\u003eS. Tundo, R. Lupi, M. Lafond, T. Giardina, C. Larr\u0026eacute;, S. Denery-Papini, M. Morisset, R. Kalunke, F. Sestili, S. Masci, Wheat ATI CM3, CM16 and 0.28 allergens produced in Pichia pastoris display a different eliciting potential in food allergy to wheat, Plants 7 (2018) 101.\u003c/li\u003e\n \u003cli\u003eY. Reig-Otero, J. Ma\u0026ntilde;es, L. Manyes, Amylase\u0026ndash;trypsin inhibitors in wheat and other cereals as potential activators of the effects of nonceliac gluten sensitivity, J. Med. Food 21 (2018) 207\u0026ndash;214.\u003c/li\u003e\n \u003cli\u003eD. Schuppan, V. Zevallos, Wheat amylase trypsin inhibitors as nutritional activators of innate immunity, Dig. Dis. 33 (2015) 260\u0026ndash;263.\u003c/li\u003e\n \u003cli\u003eM. Cuccioloni, M. Mozzicafreddo, I. Ali, L. Bonfili, V. Cecarini, A.M. Eleuteri, M. Angeletti, Interaction between wheat alpha-amylase/trypsin bi-functional inhibitor and mammalian digestive enzymes: Kinetic, equilibrium and structural characterization of binding, Food Chem. 213 (2016) 571\u0026ndash;578.\u003c/li\u003e\n \u003cli\u003eP. Carbonero, F. Garc\u0026iacute;a-Olmedo, A multigene family of trypsin/\u0026alpha;-amylase inhibitors from cereals, in: Seed Proteins, Springer, 1999: pp. 617\u0026ndash;633.\u003c/li\u003e\n \u003cli\u003eS. Geisslitz, P. Shewry, F. Brouns, A.H.P. America, G.P.I. Caio, M. Daly, S. d\u0026rsquo;Amico, R. De Giorgio, L. Gilissen, H. Grausgruber, Wheat ATIs: characteristics and role in human disease, Front. Nutr. (2021) 265.\u003c/li\u003e\n \u003cli\u003eF.M. Dupont, W.H. Vensel, C.K. Tanaka, W.J. Hurkman, S.B. Altenbach, Deciphering the complexities of the wheat flour proteome using quantitative two-dimensional electrophoresis, three proteases and tandem mass spectrometry, Proteome Sci. 9 (2011) 1\u0026ndash;29.\u003c/li\u003e\n \u003cli\u003eY. Zhang, J. Li, S. Chen, X. Ma, H. Wei, C. Chen, N. Gao, Y. Zou, D. Kong, T. Li, An APETALA2/ethylene responsive factor, OsEBP89 knockout enhances adaptation to direct-seeding on wet land and tolerance to drought stress in rice, Mol. Genet. Genomics 295 (2020) 941\u0026ndash;956.\u003c/li\u003e\n \u003cli\u003eY. Kamiya, F. Abe, M. Mikami, M. Endo, K. Kawaura, A rapid method for detection of mutations induced by CRISPR/Cas9-based genome editing in common wheat, Plant Biotechnol. 37 (2020) 247\u0026ndash;251.\u003c/li\u003e\n \u003cli\u003eS. Phogat, A. Poudel, A. Bharati, A. Kumar, P.K. Mandal, Recent Advances in CRISPR-Cas for Climate Resilient Agriculture in Cereals, Clim. Agric. (2024) 343\u0026ndash;371.\u003c/li\u003e\n \u003cli\u003eF. Camerlengo, A. Frittelli, C. Sparks, A. Doherty, D. Martignago, C. Larr\u0026eacute;, R. Lupi, F. Sestili, S. Masci, CRISPR-Cas9 multiplex editing of the \u0026alpha;-amylase/trypsin inhibitor genes to reduce allergen proteins in durum wheat, Front. Sustain. Food Syst. 4 (2020) 104.\u003c/li\u003e\n \u003cli\u003eS.T. Sagu, L. Zimmermann, E. Landgr\u0026auml;ber, T. Homann, G. Huschek, H. \u0026Ouml;zpinar, F.J. Schweigert, H.M. Rawel, Comprehensive characterization and relative quantification of \u0026alpha;-amylase/trypsin inhibitors from wheat cultivars by targeted HPLC-MS/MS, Foods 9 (2020) 1448.\u003c/li\u003e\n \u003cli\u003eJ. Fr\u0026auml;nken, U. Stephan, H.E. Meyer, W. K\u0026ouml;nig, Identification of alpha-amylase inhibitor as a major allergen of wheat flour, Int. Arch. Allergy Immunol. 104 (1994) 171\u0026ndash;174.\u003c/li\u003e\n \u003cli\u003eI. Sander, P. Rozynek, H. Rihs, V. Van Kampen, F.T. Chew, W.S. Lee, N. Kotschy‐Lang, R. Merget, T. Br\u0026uuml;ning, M. Raulf‐Heimsoth, Multiple wheat flour allergens and cross‐reactive carbohydrate determinants bind IgE in baker\u0026rsquo;s asthma, Allergy 66 (2011) 1208\u0026ndash;1215.\u003c/li\u003e\n \u003cli\u003eF. Hahn, A. Korolev, L. Sanjurjo Loures, V. Nekrasov, A modular cloning toolkit for genome editing in plants, BMC Plant Biol. 20 (2020) 1\u0026ndash;10.\u003c/li\u003e\n \u003cli\u003eQ. Yao, L. Cong, G. He, J. Chang, K. Li, G. Yang, Optimization of wheat co-transformation procedure with gene cassettes resulted in an improvement in transformation frequency, Mol. Biol. Rep. 34 (2007) 61\u0026ndash;67.\u003c/li\u003e\n \u003cli\u003eC. Engler, M. Youles, R. Gruetzner, T.-M. Ehnert, S. Werner, J.D.G. Jones, N.J. Patron, S. Marillonnet, A golden gate modular cloning toolbox for plants, ACS Synth. Biol. 3 (2014) 839\u0026ndash;843.\u003c/li\u003e\n \u003cli\u003eC.A. Sparks, A. Doherty, Genetic transformation of common wheat (Triticum aestivum L.) using biolistics, in: Biolistic DNA Deliv. Plants, Springer, 2020: pp. 229\u0026ndash;250.\u003c/li\u003e\n \u003cli\u003eS. Phogat, A. Poudel, R. Bhurta, G. Kalwan, J. Madhavan, J.C. Padaria, P.K. Singh, T. Vinutha, P.K. Mandal, An improved in-vitro regeneration protocol using scutellum of mature and immature embryos of wheat, Indian J. Genet. Plant Breed. 83 (2023) 195\u0026ndash;204.\u003c/li\u003e\n \u003cli\u003eM.G. Murray, W.F. Thompson, Rapid isolation of high molecular weight plant DNA., Nucleic Acids Res. 8 (1980) 4321\u0026ndash;4325. https://doi.org/10.1093/nar/8.19.4321.\u003c/li\u003e\n \u003cli\u003eS. Tchewonpi Sagu, G. Huschek, J. B\u0026ouml;nick, T. Homann, H.M. Rawel, A New Approach of Extraction of \u0026alpha;-Amylase/trypsin Inhibitors from Wheat (Triticum aestivum L.), Based on Optimization Using Plackett\u0026ndash;Burman and Box\u0026ndash;Behnken Designs, Molecules 24 (2019) 3589.\u003c/li\u003e\n \u003cli\u003eG.D.G. de Fernando, P.F. Fox, Study of proteolysis during the processing of a dry fermented pork sausage, Meat Sci. 30 (1991) 367\u0026ndash;383.\u003c/li\u003e\n \u003cli\u003eS.T. Sagu, E.J. Nso, T. Homann, C. Kapseu, H.M. Rawel, Extraction and purification of beta-amylase from stems of Abrus precatorius by three phase partitioning, Food Chem. 183 (2015) 144\u0026ndash;153.\u003c/li\u003e\n \u003cli\u003eH. Wang, H. Yang, C.S. Shivalila, M.M. Dawlaty, A.W. Cheng, F. Zhang, R. Jaenisch, One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering, Cell 153 (2013) 910\u0026ndash;918.\u003c/li\u003e\n \u003cli\u003eB. Minkenberg, M. Wheatley, Y. Yang, CRISPR/Cas9-Enabled Multiplex Genome Editing and Its Application, 1st ed., Elsevier Inc., 2017. https://doi.org/10.1016/bs.pmbts.2017.05.003.\u003c/li\u003e\n \u003cli\u003eN.S. McCarty, A.E. Graham, L. Studen\u0026aacute;, R. Ledesma-Amaro, Multiplexed CRISPR technologies for gene editing and transcriptional regulation. Nat Commun 11: 1281, (2020).\u003c/li\u003e\n \u003cli\u003eL. Xu, L. Zhao, Y. Gao, J. Xu, R. Han, Empower multiplex cell and tissue-specific CRISPR-mediated gene manipulation with self-cleaving ribozymes and tRNA, Nucleic Acids Res. 45 (2017) e28\u0026ndash;e28.\u003c/li\u003e\n \u003cli\u003eW.-N. Kim, H.-J. Kim, Y.-S. Chung, H.-U. Kim, Construction of multiple guide RNAs in CRISPR/Cas9 vector using stepwise or simultaneous golden gate cloning: Case study for targeting the FAD2 and FATB multigene in soybean, Plants 10 (2021) 2542.\u003c/li\u003e\n \u003cli\u003eP.-Y. Chen, Y. Qian, D. Del Vecchio, A model for resource competition in CRISPR-mediated gene repression, in: 2018 IEEE Conf. Decis. Control, IEEE, 2018: pp. 4333\u0026ndash;4338.\u003c/li\u003e\n \u003cli\u003eS. Zhang, C.A. Voigt, Engineered dCas9 with reduced toxicity in bacteria: implications for genetic circuit design, Nucleic Acids Res. 46 (2018) 11115\u0026ndash;11125.\u003c/li\u003e\n \u003cli\u003eS.B. Gelvin, \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated plant transformation: the biology behind the \u0026ldquo;gene-jockeying\u0026rdquo; tool, Microbiol. Mol. Biol. Rev. 67 (2003) 16\u0026ndash;37.\u003c/li\u003e\n \u003cli\u003eB. Lacroix, V. Citovsky, Biolistic approach for transient gene expression studies in plants, Biolistic DNA Deliv. Plants Methods Protoc. (2020) 125\u0026ndash;139.\u003c/li\u003e\n \u003cli\u003eB. Paes de Melo, I.T. Louren\u0026ccedil;o-Tessutti, C.V. Morgante, N.C. Santos, L.B. Pinheiro, C.B. de Jesus Lins, M.C.M. Silva, L.L.P. Macedo, E.P.B. Fontes, M.F. Grossi-de-Sa, Soybean embryonic axis transformation: combining biolistic and \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated protocols to overcome typical complications of in vitro plant regeneration, Front. Plant Sci. 11 (2020) 1228.\u003c/li\u003e\n \u003cli\u003eS. S\u0026aacute;nchez-Le\u0026oacute;n, M. Mar\u0026iacute;n-Sanz, M.H. Guzm\u0026aacute;n-L\u0026oacute;pez, M. Gavil\u0026aacute;n-Camacho, E. Sim\u0026oacute;n, F. Barro, CRISPR/Cas9-mediated multiplex gene editing of gamma and omega gliadins: paving the way for gliadin-free wheat, J. Exp. Bot. 75 (2024) 7079\u0026ndash;7095.\u003c/li\u003e\n \u003cli\u003eW. Wang, Q. Pan, F. He, A. Akhunova, S. Chao, H. Trick, E. Akhunov, Transgenerational CRISPR-Cas9 Activity Facilitates Multiplex Gene Editing in Allopolyploid Wheat, Cris. J. 1 (2018) 65\u0026ndash;74. https://doi.org/10.1089/crispr.2017.0010.\u003c/li\u003e\n \u003cli\u003eY. Zhang, Z. Liang, Y. Zong, Y. Wang, J. Liu, K. Chen, J.L. Qiu, C. Gao, Efficient and transgene-free genome editing in wheat through transient expression of CRISPR/Cas9 DNA or RNA, Nat. Commun. 7 (2016) 1\u0026ndash;8. https://doi.org/10.1038/ncomms12617.\u003c/li\u003e\n \u003cli\u003eP. Awasthi, S. Khan, H. Lakhani, S. Chaturvedi, N. Kaur, J. Singh, A.K. Kesarwani, S. Tiwari, Transgene-free genome editing supports the role of carotenoid cleavage dioxygenase 4 as a negative regulator of \u0026beta;-carotene in banana, J. Exp. Bot. 73 (2022) 3401\u0026ndash;3416.\u003c/li\u003e\n \u003cli\u003eO.L. Franco, D.J. Rigden, F. R. Melo, C. Bloch Jr, C.P. Silva, M.F. Grossi de S\u0026aacute;, Activity of wheat \u0026alpha;‐amylase inhibitors towards bruchid \u0026alpha;‐amylases and structural explanation of observed specificities, Eur. J. Biochem. 267 (2000) 2166\u0026ndash;2173.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[{"identity":"19a87cba-e7e1-438f-ab2a-2423a312d629","identifier":"10.13039/501100001503","name":"Indian Council of Agricultural Research","awardNumber":"CS/F.No.16-8/2017-IA","order_by":0},{"identity":"7fbcbe92-7e38-44d9-aae5-3a8d4b8f13b0","identifier":"10.13039/501100000268","name":"Biotechnology and Biological Sciences Research Council","awardNumber":"(BB/X011003/1)","order_by":1}],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"Indian Council of Agricultural Research (ICAR) National Institute for Plant Biotechnology, New Delhi, 110012, India","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Immunogenic macromolecule, Amylase/Trypsin inhibitors, Multiplex Genome editing","lastPublishedDoi":"10.21203/rs.3.rs-5899900/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5899900/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eWheat is the staple food for 40% of the world, providing 20% of dietary energy and protein. However, along with providing nutrition, wheat contains several anti-nutritional macromolecules. Amylase/Trypsin inhibitors (ATIs) are one such macromolecular proteins which have been known to cause allergic reactions like baker's asthma, auto-immunogenic reactions like Non-Celiac Wheat Sensitivity, and primary triggers for Celiac Disease in some predisposed humans. Bread wheat varieties without ATI molecules or with reduced activity have not yet been developed. Here, multiple genes of major ATI protein molecules were mutated using tRNA-based multiplex CRISPR/Cas9 genome editing technology. ATI proteins were extracted from wheat flours of gene-edited wheat lines along with unedited plants and subjected to quantification, detection by SDS-PAGE, fractionation by HPLC, and assayed the α-amylase and trypsin inhibition activity. Gene-edited Bobwhite wheat plant produced seeds with reduced (up to 30.61%) ATI content, which resulted in a reduction in α-amylase and trypsin inhibition activity to 50.74% and 44.90%, respectively. Another variety of bread wheat HD2967 also showed a significant reduction in ATIs content as well as a reduction in α-amylase and trypsin inhibition activity. This result suggests the possibility of developing low immunogenic wheat lines by multiple gene editing for the immunogenic macromolecules.\u003c/p\u003e","manuscriptTitle":"Reduced activity of an immunogenic macromolecule Amylase Trypsin inhibitor (ATI) in wheat through CRISPR/Cas9 mediated multiple gene editing","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-01-30 08:05:23","doi":"10.21203/rs.3.rs-5899900/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"d3dd74c2-6433-4442-a950-81450318f84f","owner":[],"postedDate":"January 30th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":43401491,"name":"Molecular Biology"},{"id":43401492,"name":"Biotechnology and Bioengineering"},{"id":43401493,"name":"Plant Molecular Biology and Genetics"}],"tags":[],"updatedAt":"2025-01-30T08:05:24+00:00","versionOfRecord":[],"versionCreatedAt":"2025-01-30 08:05:23","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5899900","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5899900","identity":"rs-5899900","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.