Neuron Navigator 3 (NAV3) is Required for Heart Development in Zebrafish

Neuron Navigator 3 (NAV3) is Required for Heart Development in Zebrafish | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Neuron Navigator 3 (NAV3) is Required for Heart Development in Zebrafish Feng Lv, Xiaojuan Ge, Peipei Qian, Xiaofeng Lu, Dong Liu, Changsheng Chen This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1094321/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 17 Jan, 2022 Read the published version in Fish Physiology and Biochemistry → Version 1 posted 5 You are reading this latest preprint version Abstract As a tightly controlled biological process, cardiogenesis requires the specification and migration of a suite of cell types to form a particular three-dimensional configuration of the heart. Many genetic factors are involved in the formation and maturation of the heart, and any genetic mutations may result in severe cardiac failures. The neuron navigator (NAV) family consists of three vertebrate homologs (NAV1, NAV2, and NAV3) of the neural guidance molecule Uncoordinated-53 (UNC-53) in Caenorhabditis elegans . Although they are recognized as neural regulators, their expressions are also detected in many organs, including the heart, kidney, and liver. However, the functions of NAVs, regardless of neural guidance, remain largely unexplored. In our study, we found that nav3 gene was expressed in the cardiac region of zebrafish embryos from 24 to 48 hours post-fertilization (hpf) by means of in situ hybridization (ISH) assay. A CRISPR/Cas9-based genome editing method was utilized to delete the nav3 gene in zebrafish and loss-of-function of Nav3 resulted in a severe deficiency in its cardiac morphology and structure. The similar phenotypic defects of the knockout mutants could recur by nav3 morpholino injection and be rescued by nav3 mRNA injection. Dual-color fluorescence imaging of ventricle and atrium markers further confirmed the disruption of the heart development in nav3 -deleted mutants. Although the heart rate was not affected by the deletion of nav3 , the heartbeat intensity was decreased in the mutants. All these findings indicate that Nav3 was required for cardiogenesis in developing zebrafish embryos. Cardiogenesis Zebrafish Cardiac defects CRISPR/Cas9 in situ hybridization Figures Figure 1 Figure 2 Figure 3 Figure 4 Background Cardiogenesis is an indispensable process in vertebrates during embryogenesis, and the heart plays a vital role in the distribution of nutrients and oxygen in the embryos. Any failures during cardiogenesis will lead to cardiac malformations, further resulting in the death of the embryos. It is challenging to study heart development during embryogenesis. Compared with other mammalian models, such as mice, zebrafish offers several unique advantages for studying cardiac development (Gore et al., 2012; Liu and Stainier, 2012). First, the zebrafish embryos develop externally after fertilization, allowing direct non-invasive observation of heart development during cardiogenesis. Second, the optical transparency of zebrafish embryos allows high-resolution optical imaging. Third, zebrafish embryos can survive up to 7 days without a functional cardiovascular system to supply the nutrients and oxygen due to their tiny size, offering the possibility to analyze the phenotype of the cardiac defects. Besides, essential genes responsible for cardiac development are also highly conserved throughout vertebrates. Therefore, zebrafish is a valuable animal model for exploring the mechanisms underlying cardiac development. In zebrafish, the formation of a mature heart includes a series of cellular processes, including cell migration, proliferation, and differentiation (Buckingham et al., 2005; Keegan et al., 2004). Numerous genes are involved in embryonic cardiogenesis, such as bmp4 (Jiao et al., 2003), nppa (Grassini et al., 2018), vcana (Mittal et al., 2019), amhc , and vmhc (Berdougo et al., 2003; Yelon et al., 1999), as well as transcription factors nkx2.5 (Targoff et al., 2013), hand2 (Schindler et al., 2014), and GATA family members (Haworth et al., 2008; Holtzinger and Evans, 2007; Reiter et al., 1999). Nav3 , the vertebrate homology of C. elegans gene uncoordinated-53 ( unc-53 ), is one of the neural guidance genes, which plays a role in shaping the developing nervous system by modulating/guiding neural cell migration (Maes et al., 2002; Stringham et al., 2002). Moreover, NAV3 is identified as a microtubule-binding protein that regulates actin assembly in extensions of lamellipodia and filopodia (Klein et al., 2011). Although nav genes are mainly expressed in the brain, their slight expressions are also detected in the heart, kidney, and liver, suggesting potential roles of NAVs in organogenesis (Maes et al., 2002). In the present study, we focused on the effects of Nav3 on heart development in zebrafish. We found that nav3 was temporally expressed in the cardiac region from 24 h post-fertilization (hpf) to 48 hpf through in situ hybridization (ISH) assay, indicating its function in ventricle-atrium differentiation (Bakkers, 2011). Deletion of nav3 in zebrafish via CRISPR/Cas9 genome editing technique resulted in severe defects in heart development. Fluorescent imaging of ventricle marker ( vmhc ) and atrium marker ( amhc ) further confirmed the malformed morphogenesis of the cardiac structure in nav3 -null mutants. In addition to structural alterations, a significant decrease in heartbeat intensity (HI) was also detected in nav3 -/- mutants. Moreover, the phenotypic defects caused by loss-of-function of Nav3 could be rescued by nav3 mRNA injection. Collectively, our current work revealed a novel role of Nav3 in heart development, which might provide potential strategies for heart disease therapy and cardiac regeneration. Methods Zebrafish husbandry and strains The zebrafish (TU line) in this study was obtained from China Zebrafish Resource Centre and maintained in Jiangsu key laboratory of neuroregeneration of Nantong university. The transgenic zebrafish lines Tg(vmhc:mCherry::amhc:EGFP) and Tg(myl7:mCherry) were kindly provided by Dr. R. Zhang and Dr. T. Zhong, respectively. Tg(mef2a:EGFP) transgenic line was constructed by our lab previously (Lv et al., 2017). Tg(vmhc:mCherry::amhc:EGFP) and Tg(myl7:mCherry) were outcrossed with nav3 -null mutants to generate the Tg(nav3 -/- -vmhc:mCherry::amhc:EGFP) and Tg(nav3 -/- -mef2a-EGFP) homozygous lines. All zebrafish lines were maintained at 28.5℃. Whole-mount in situ hybridization (WISH) WISH with antisense RNA probes was performed as previously described (Krueger et al., 2011). The probe for the detection of NAV3 (NM_001045143.2) was cloned from cDNA fragments. The nav3 cDNA fragment was amplified with a forward primer: 5′-TCACCTTCTGACTCCACCAG-3′ and a reverse primer: 5′-GTTCGATGTTACGCGCTCAC-3′. After hybridization, images of the embryos were acquired with an Olympus stereomicroscope MVX10 equipped with an Olympus DP71 camera. Generation of nav3 -null mutants A CRISPR/Cas9-mediated approach was used to generate nav3 -deleted mutants. The target site of CRISPR/Cas9 designed to identify the sequence in the second exon of nav3 was 5′-CATACCCGATGGAGTTCTGC TGG -3′ (underlined was the PAM sequence). The template sequence of sgRNA for in vitro transcription was 5′-TAATACGACTCACTATAGCATACCCGATGGAGTTCTGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3′. For the sgRNA synthesis, a forward primer (5′-TAATACGACTCACTATAGCATACCCGATGGAGTTCTGCGTTTTAGAGCTAGAAATAGC-3′) containing a T7 promoter region and a nav3 gene-targeting region, and a universal reverse primer (5′-AAAAAAAGCACCGACTCGGTGCCAC-3′) were used in the PCR amplification with pT7 plasmid as the template to obtain the sgDNA, which was then transcribed into sgRNA in vitro using the T7 mMessage mMachine kit (Ambion). Micro-injection was performed with 1-cell stage zebrafish embryos, and each embryo was co-injected with 100 pg sgRNA and 200 pg Cas9 mRNA. G0 generations were examined by PCR, followed by Sanger sequencing. A mutant with a 55-bp deletion at the second exon was identified, leading to the occurrence of a stop codon downstream of the Cas9 cutting site. The heterozygous nav3 +/- mutants were incrossed to obtain the homozygous F2 progenies. Morpholino-mediated gene deletion of nav3 in zebrafish The nav3 gene-specific morpholino (Gene Tools, LLC) was used to block the splicing of nav3 pre-mRNA. The sequence of the morpholino antisense oligomer was 5′-CAGCCCATGTGCCATGCTGCTTCTG-3′. In the present study, 2 nL of 0.3 mM morpholino oligo was micro-injected into the embryos at the 1-cell stage. mRNA rescue experiment In the rescue experiment, 200 pg nav3 mRNA was co-injected into the embryos with the nav3 antisense morpholino. The cDNA fragment of nav3 was first subcloned into pCS2+ vector. To make the mRNA, the DNA plasmid was linearized with an appropriate restriction enzyme and transcribed in vitro using the SP6 mMessage mMachine kit (Ambion). Survival rate quantification Zebrafish embryos of WT and nav3 -null mutants were respectively collected after fertilization and divided into 10 tanks (100 embryos in each tank). The counts of surviving fishes per tank were determined at 1, 2, 3, 20, and 60 days post-fertilization (dpf). Afterward, the proportions of fish surviving at each time point were assessed. Confocal imaging and quantification Z ebrafish embryos of Tg(mef2a:EGFP) , Tg(nav3 - / - -mef2a:EGFP) , Tg(vmhc:mCherry::amhc:EGFP ) and Tg(nav3 - / - -vmhc:mCherry::amhc:EGFP) were anaesthetized with egg water/0.16 mg/mL tricaine/1% PTU (Sigma) and embedded in low-melting agarose. Living imaging was performed with Nikon A1R confocal microscopy. The heart rate of the embryo was defined as the beats per minute and counted under a dissecting microscope (Olympus). To examine the HI, the cardiac-labeled transgenic zebrafish lines Tg(mef2a:EGFP) and Tg(nav3 - / - -mef2a:EGFP) were used to visualize the hearts of WT and mutants, respectively. The cross-sectional areas of the chambers in GFP-labeled hearts in the dilated state (A d ) and contracted state (A c ) were respectively measured with ImageJ (Rueden et al., 2017). The HI was calculated by the equation as follows, HI = A d – A c . In our present analysis, five WT and mutant fishes were respectively selected, and each fish was measured for 20 successive heartbeats. Data analysis A two-tailed, unpaired Student’s t-test was used to determine statistical significance when comparing independent groups. P<0.05 was considered statistically significant. All results were presented as mean ± SD. Results Zebrafish nav3 is expressed in the heart during embryogenesis Zebrafish Nav3 has been previously reported as an ortholog of UNC-53 in C. elegans . Compared with other vertebrate NAV3 in humans, mice, and rats, as well as UNC-53 in C. elegans , zebrafish Nav3 was highly conserved among all these species (Supplemental Fig. S1). NAV3 is a huge protein consisting of more than 2,000 amino acids. It contains several conserved domains, including a putative calponin-homology domain (CH-domain), an LKK actin-binding domain, two Src Homology 3 (SH3) domains, and an ATP/GTP-binding AAA domain (Schmidt et al., 2009 ) (Fig. 1 A). The CH-domain is essential for the interaction with actin filaments, suggesting its role in the formation of lamellipodia and filopodia, and it would further drive cell movements. Phylogenic alignment also revealed the close relationship between zebrafish Nav3 and NAV3 of other species (Fig. 1 B). WISH was performed with zebrafish embryos from 18 hpf to 96 hpf to explore the spatiotemporal expression of zebrafish nav3 during embryogenesis. The nav3 mRNA transcripts could be detected at an early embryonic stage (18 hpf), while its expression was mainly restricted to the brain and somites (Fig. 1 C). A slight expression was also presented in cardiac primordium at the same developmental stage (Fig. 1 D, E). As nkx2.5 is specifically expressed in cardiac primordium, the ISH experiment with nkx2.5 probe could further confirm the expression of nav3 in the region of cardiac primordium (Fig. 1 F). At 24 hpf, nav3 was more specifically expressed in the brain, heart, and somites (Fig. 1 G-I). However, the expression of nav3 in somites became weaker, and it was rarely detected from 48 hpf. At 48 hpf, its expression was highly regionalized to the brain and heart (Fig. 1 J-L). At 96 hpf, there was almost no expression of nav3 in the heart, and its expression was found to be accumulated in other tissues, such as the gill arch, swim bladder, and intestine (Fig. 1 M-O), suggesting that its potential roles were not only restricted to nervous or cardiovascular system. Nav3 loss-of-function in zebrafish exhibits severe phenotypic defects and low survival rates3e4r To explore the effects of Nav3 deletion in heart development, a CRISPR/Cas9-based genome editing method was utilized to generate a nav3 -deleted mutant (Fig. 2 A). A 55-bp deletion at the second exon of nav3 led to the occurrence of a truncated protein (a 79-amino acid sequence versus the full-length sequence with 2,270 amino acids). The homozygous nav3 −/− mutants were further obtained through genetic selection. An obvious heart malformation phenotype was observed in nav3 -null zebrafish embryos. Compared with the wild-type (WT) counterparts, the nav3 −/− mutants displayed severe pericardial edemas not only at the early developmental stage but also in adult zebrafishes, although more than 70% of the nav3 −/− mutants died within 24 hpf (Fig. 2 B-H). Afterwards, only 8% of the mutants could successfully develop into adults (Fig. 2 H). Heart morphogenesis and function are disrupted in nav3 mutant zebrafish embryos To further evaluate the changes in cardiac morphology, structure, and function in nav3 -null mutants, the fluorescently labeled atrium-specific marker amhc and ventricle-specific marker vmhc were respectively adopted. Transgenic lines Tg(vmhc:mCherry::amhc:EGFP) and Tg(nav3 − / − -vmhc:mCherry::amhc:EGFP) were used to compare the heart morphological differences between WT and mutants. Both atrium and ventricle in nav3 −/− mutants at 72 hpf exhibited a long tubular-shaped morphology, and the boundary line between atrium and ventricle was not as clear as the WT (Fig. 3 A-F). Next, we compared the heart rate as well as the HI between WT and nav3 −/− mutants to check whether the heart functions were affected upon Nav3 loss-of-function. We found that the heart rate was not affected by the deletion of nav3 . The frequency was within a range of 150 to 200 times per minute in both WT and mutant strains (Fig. 3 S). However, the HI in WT and mutant strains was different. Here, we introduced a parameter defined as HI to indicate cardiac capacity. The areas of the GFP-labeled heart were measured in the dilated and contracted states (Fig. 3 G-R). The area difference between these two states was regarded as HI. The calculation formula was shown in Methods . The HI was significantly lower in the mutants compared with the WT siblings (Fig. 3 T). However, there was no obvious difference in heart rate between WT and mutants (Fig. 3 U). All these findings indicated that Nav3 deficiency resulted in heart development defects during zebrafish embryogenesis, including the cardiac structure and functional disruption. nav3 mRNA injection can rescue the cardiac defects in nav3 -deleted embryos To further confirm whether the abnormal phenotype of the mutant was caused by the deletion of nav3 , we injected a morpholino against nav3 mRNA into transgenic line Tg(myl7:mCherry) to delete nav3 . Tg(myl7:mCherry) line was under a WT background, and the cardiac marker myl7 (myosin light chain 7) was fluorescently labeled with mCherry fluorescent protein. Upon nav3 expression was down-regulated through morpholino injection, WT zebrafish embryos displayed a similar phenotype to nav3 −/− mutants. Moreover, fluorescent imaging of the heart in morpholino-injected embryos mimicked the abnormal cardiac morphology of nav3 -null mutants (Fig. 4 ). To verify that the phenotype of nav3 -morphants was attributed to the loss-of-function of Nav3 rather than non-specific effects, we performed a rescue experiment by injecting nav3 mRNA together with nav3 morpholino into 1-cell-stage zebrafish embryos of Tg(myl7:mCherry) . The nav3 mRNA injection partially rescued the phenotypic defects caused by the down-regulation of nav3 . Upon nav3 mRNA injection, the tubular-shaped ventricle and atrium structure of the nav3 -morphants were almost recovered to a normal state. However, compared with the WT counterparts, the rescued heart was slightly misshaped in the morphology, such as tubular-shaped ventricle. Additionally, the boundary between the ventricle and atrium became observable after nav3 mRNA injection (Fig. 4 ). Discussion As a complicated but coordinated biological process, the assembly of an intact heart involves the proliferation, differentiation, and migration of cardiomyocytes to form a functional contractile organ (Buckingham et al., 2005 ; Keegan et al., 2004 ; Liu and Stainier, 2012 ). A cohort of genes participate in this process and play important roles. Nav3 , the vertebrate homology of unc-53 in C.elegans , is first discovered as a neural guidance gene that is functional in cell migration and outgrowth of axons. Because cell movement is highly relevant to embryonic organogenesis and NAV3 is also involved in liver development (Klein et al., 2011 ), we hypothesized that NAV3 played a novel role in cardiogenesis. In our present study, we first examined the expression of nav3 in zebrafish during embryogenesis. The specific spatiotemporal expression of nav3 in the zebrafish heart region suggested its potential function in embryonic heart development beyond the nervous system. To confirm our prediction, we generated the nav3 -deleted mutants. Loss-of-function of Nav3 in zebrafish embryos displayed severe heart development defects, such as pericardial edemas and chamber malformations. Moreover, the function of the heart was affected by the deletion of Nav3. For instance, the HI was significantly decreased in mutants. However, the heart rates were similar in both WT and mutant embryos. The functional analysis revealed that loss of Nav3 resulted in an abnormal dilation and contraction in the heart. To confirm whether the phenotypic defects of the nav3 -null mutants were caused by the loss-of-function of Nav3, a morpholino-mediated gene knockdown experiment and a nav3 mRNA rescue experiment were performed. The pericardial edemas and heart morphogenesis malformations were reproduced in nav3 -deleted mutants and could also be partially rescued by co-injection of morpholino and nav3 mRNA. Additionally, the mRNA rescue experiment also recapitulated that the severe cardiac edema was not caused by the off-target effects triggered by sgRNA or morpholino injection. In our present work, we also noticed that the survival rates of nav3 -deleted mutants were significantly lower compared with their WT counterparts, especially from the very early developmental stage (from 24 hpf). Since zebrafish could survive up to 7 days without a functional cardiovascular system, the high mortality upon Nav3 deletion might not result from the cardiac defects and more probably be attributed to its dysfunction in the nervous system or immunity (Carlsson et al., 2013 ; Karenko et al., 2005 ). As mentioned above, Nav3 loss-of-function could lead to severe defects in zebrafish heart development. However, it remains largely unknown whether some essential cardiac-related genes are altered in nav3 -null mutants. In our preliminary experiments, we examined the expressions of nkx2.5 , hand2 , vmhc , and amhc in nav3 −/− mutants and WT zebrafish embryos using ISH. We found that the expressions of nkx2.5 and hand2 were slightly decreased after the deletion of nav3 (Supplemental Fig. S2). Although they both play roles in embryonic heart development, each of them also owns a distinct and specific function in regulating this process. Nkx2.5 determines the cardiomyocyte identity and can further maintain the vascular and atrial chamber morphology (Targoff et al., 2013 ). Hand2 is implicated as a regulator of cardiomyocyte production, which promotes the generation of a proper number of cardiomyocytes during cardiogenesis (Schindler et al., 2014 ). As key regulators in heart development, the lower expressions of nkx2.5 and hand2 in nav3 −/− mutants supported its deficiency in cardiac development. This finding was consistent with the previous view that nkx2.5 maintains cardiac chamber identity, and hand2 regulates cardiac differentiation and morphogenesis (Schindler et al., 2014 ; Targoff et al., 2013 ). Although the structure and morphology of the atrium and ventricle were severely affected by the loss of nav3 , the expressions of both their markers remained unchanged (Supplemental Fig. S2). We assumed that the cardiac-related myosin chain genes were not affected by the deletion of Nav3, and the heart morphogenesis defects might result from other factors, such as nkx2.5 , or hand2 . Although nav3 is initially discovered as a neural guidance gene in the nervous system, the NAV family members have also been widely accepted as regulators in cell migration among several species (Cohen-Dvashi et al., 2015 ; Klein et al., 2011 ; Maes et al., 2002 ; Schmidt et al., 2009 ; Stringham et al., 2002 ). Moreover, it has been reported to act as a positive modulator in regulating the actin assembly in the extension of filopodia and lamellipodia during zebrafish liver development (Klein et al., 2011 ). As a complicated but orchestrated morphogenetic process, heart formation involves specification, differentiation, and migration of cardiac progenitor cells. Therefore, NAV3 might also play a role in heart development by facilitating the migration of cardiac progenitor cells or cardiomyocytes. Besides, crosstalk between NAV3 and other essential factors, such as nkx2.5 , might be involved in these crucial processes during cardiac development. Further efforts are needed to decipher the mechanism of NAV3-regulated cardiogenesis. Taken together, NAV3 was a potential regulator in cardiac development during embryogenesis. Conclusions The nav3 gene can be expressed in a variety of tissues or organs although it is initially identified as a neural guiding factor. Gene knockout of nav3 in zebrafish leads to severe development malformation of the heart. Moreover, the defective heart development can be rescued by nav3 mRNA injection. All these findings indicate that Nav3 was required for cardiogenesis in the development of zebrafish embryos. Abbreviations CH: calponin homology dpf: days post-fertilization HI: heartbeat intensity hpf: hours post-fertilization ISH: in situ hybridization NAV: Neuron Navigator SH3: Src Homology 3 UNC53: Uncoordianted-53 WISH: whole-mount in situ hybridization WT: wild-type Declarations Funding The research conducted in this manuscript was funded by National Natural Science Foundation of China (82000458) to CC, and start-up funding for Doctoral Research of Nantong Science and Technology College (NTKY-Dr2017001) to FL. It is also funded by Nantong Science and Technology Program (JC2021088), Open Program of Key Laboratory of Cultivation and High-value Utilization of Marine Organisms in Fujian Province (2019fjsccq08), Natural Science Foundation of the Jiangsu Higher Education Institutions of China (20KJB180008), the Science Foundation of Nantong City (JC2020023). The funding sources provided financial support for the experiments described, but had no role in the design of the study or collection, analysis, and interpretation of data or in writing the manuscript. Competing interests The authors declare that they have no competing interests. Ethics approval All animal-related experiments were carried out following the NIH Guidelines for the care and use of laboratory animals (http://oacu.od.nih.gov/regs/index.htm), and animal protocols were ethically approved by the Administration Committee of Experimental Animals of Nantong University, Jiangsu Province, China (Approval ID: 20180608-Z001). Transgenic zebrafish lines provided by others were approved by the owners with written informed consent. Consent to participate Not applicable. Consent for publication Not applicable. Availability of data and materials All data generated or analysed during this study are included in this published article and its supplementary information files. Code availability Not applicable. Authors' contributions CC and DL designed and conceptualised the project. FL, XG, PQ, and XL performed the experiment. FL and CC analyzed the data. CC wrote the manuscript. All authors read and approved the final manuscript. References Bakkers J (2011) Zebrafish as a model to study cardiac development and human cardiac disease. Cardiovasc Res 91:279–288 Berdougo E, Coleman H, Lee DH, Stainier DYR, Yelon D (2003) Mutation of weak atrium/atrial myosin heavy chain disrupts atrial function and influences ventricular morphogenesis in zebrafish. Development 130:6121–6129 Buckingham M, Meilhac S, Zaffran S (2005) Building the mammalian heart from two sources of myocardial cells. Nat Rev Genet 6:826–835 Carlsson E, Krohn K, Ovaska K, Lindberg P, Häyry V, Maliniemi P, Lintulahti A, Korja M, Kivisaari R, Hussein S et al (2013) Neuron navigator 3 alterations in nervous system tumors associate with tumor malignancy grade and prognosis. Genes Chromosomes Cancer 52:191–201 Cohen-Dvashi H, Ben‐Chetrit N, Russell R, Carvalho S, Lauriola M, Nisani S, Mancini M, Nataraj N, Kedmi M, Roth L et al (2015) Navigator‐3, a modulator of cell migration, may act as a suppressor of breast cancer progression. EMBO Mol Med 7:299–314 Gore AV, Monzo K, Cha YR, Pan W, Weinstein BM (2012) Vascular development in the zebrafish. Cold Spring Harb Perspect Med 2:1–21 Grassini DR, Lagendijk AK, De Angelis JE, Da Silva J, Jeanes A, Zettler N, Bower NI, Hogan BM, Smith KA (2018) Nppa and nppb act redundantly during zebrafish cardiac development to confine AVC marker expression and reduce cardiac jelly volume. Dev. Camb. 145 Haworth KE, Kotecha S, Mohun TJ, Latinkic BV (2008) GATA4 and GATA5 are essential for heart and liver development in Xenopus embryos. BMC Dev Biol 8:1–16 Holtzinger A, Evans T (2007) Gata5 and Gata6 are functionally redundant in zebrafish for specification of cardiomyocytes. Dev Biol 312:613–622 Jiao K, Kulessa H, Tompkins K, Zhou Y, Batts L, Baldwin HS, Hogan BLM (2003) An essential role of Bmp4 in the atrioventricular septation of the mouse heart. Genes Dev 17:2362–2367 Karenko L, Hahtola S, Päivinen S, Karhu R, Syrjä S, Kähkönen M, Nedoszytko B, Kytölä S, Zhou Y, Blazevic V et al (2005) Primary cutaneous T-cell lymphomas show a deletion or translocation affecting NAV3, the human UNC-53 homologue. Cancer Res 65:8101–8110 Keegan BR, Meyer D, Yelon D (2004) Organization of cardiac chamber progenitors in the zebrafish blastula. Development 131:3081–3091 Klein C, Mikutta J, Krueger J, Scholz K, Brinkmann J, Liu D, Veerkamp J, Siegel D, Abdelilah-Seyfried S, Noble F (2011) Neuron navigator 3a regulates liver organogenesis during zebrafish embryogenesis. Development 138 , 1935–1945 Krueger J, Liu D, Scholz K, Zimmer A, Shi Y, Klein C, Siekmann A, Schulte-Merker S, Cudmore M, Ahmed A et al (2011) Flt1 acts as a negative regulator of tip cell formation and branching morphogenesis in the zebrafish embryo. Development 138:2111–2120 Liu J, Stainier DYR (2012) Zebrafish in the study of early cardiac development. Circ Res 110:870–874 Lv F, Zhu C, Yan X, Wang X, Liu D (2017) Generation of a mef2aa:EGFP transgenic zebrafish line that expresses EGFP in muscle cells. Fish Physiol Biochem 43:287–294 Maes T, Barceló A, Buesa C (2002) Neuron navigator: A human gene family with homology to UNC-53, a cell guidance gene from Caenorhabditis elegans. Genomics 80:21–30 Mittal N, Yoon SH, Enomoto H, Hiroshi M, Shimizu A, Kawakami A, Fujita M, Watanabe H, Fukuda K, Makino S (2019) Versican is crucial for the initiation of cardiovascular lumen development in medaka (Oryzias latipes). Sci Rep 9:1–17 Reiter JF, Alexander J, Rodaway A, Yelon D, Patient R, Holder N, Stainier DYR (1999) Gata5 is required for the development of the heart and endoderm in zebrafish. Genes Dev 13:2983–2995 Rueden CT, Schindelin J, Hiner MC, DeZonia BE, Walter AE, Arena ET, Eliceiri KW (2017) ImageJ2: ImageJ for the next generation of scientific image data. BMC Bioinformatics 18:529 Schindler YL, Garske KM, Wang J, Firulli BA, Firulli AB, Poss KD, Yelon D (2014) Hand2 elevates cardiomyocyte production during zebrafish heart development and regeneration. Dev Camb 141:3112–3122 Schmidt KL, Marcus-Gueret N, Adeleye A, Webber J, Baillie D, Stringham EG (2009) The cell migration molecule UNC-53/NAV2 is linked to the ARP2/3 complex by ABI-1. Development 136:563–574 Stringham E, Pujol N, Vandekerckhove J, Bogaert T (2002) Unc-53 controls longitudinal migration in C. elegans. Development 129:3367–3379 Targoff KL, Colombo S, George V, Schell T, Kim SH, Solnica-Krezel L, Yelon D (2013) Nkx genes are essential for maintenance of ventricular identity. Dev Camb 140:4203–4213 Yelon D, Horne SA, Stainier DYR (1999) Restricted expression of cardiac myosin genes reveals regulated aspects of heart tube assembly in zebrafish. Dev Biol 214:23–37 Supplementary Files supplementaryfigure.pdf Supplementary Figure S1. Multiple sequence alignment of NAV3 among species by using T-Coffee ( href="http://tcoffee.crg.cat/" rel="noopener noreferrer" target="_blank">http://tcoffee.crg.cat/).Supplementary Figure S2. Expressions of cardiac-related genes in WT and nav3 -/- mutants at 24 hpf. The expression of the corresponding gene is outlined with a white dashed line. The digits at the lower left position of each panel indicate the number of fishes with typical phenotype in total observed ones. Cite Share Download PDF Status: Published Journal Publication published 17 Jan, 2022 Read the published version in Fish Physiology and Biochemistry → Version 1 posted Editorial decision: Minor revisions 07 Jan, 2022 Reviews received at journal 28 Dec, 2021 Reviewers invited by journal 23 Dec, 2021 Editor assigned by journal 23 Nov, 2021 First submitted to journal 18 Nov, 2021 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1094321","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":72244311,"identity":"cfaae360-1adf-4026-bd51-065bb35cd2fb","order_by":0,"name":"Feng Lv","email":"","orcid":"","institution":"Nantong College of Science and Technology","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Feng","middleName":"","lastName":"Lv","suffix":""},{"id":72244312,"identity":"90558aa9-44d8-4f21-be19-54028031351f","order_by":1,"name":"Xiaojuan Ge","email":"","orcid":"","institution":"Nantong University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xiaojuan","middleName":"","lastName":"Ge","suffix":""},{"id":72244313,"identity":"26d39c5b-4e99-4b4e-b3f2-50a84d8de290","order_by":2,"name":"Peipei Qian","email":"","orcid":"","institution":"Nantong University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Peipei","middleName":"","lastName":"Qian","suffix":""},{"id":72244314,"identity":"0a4fab58-2f90-40b3-9a50-27bf0d15cc47","order_by":3,"name":"Xiaofeng Lu","email":"","orcid":"","institution":"Nantong University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xiaofeng","middleName":"","lastName":"Lu","suffix":""},{"id":72244315,"identity":"4eb07153-7f50-479e-9031-a73b120b4cf0","order_by":4,"name":"Dong Liu","email":"","orcid":"","institution":"Nantong University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Dong","middleName":"","lastName":"Liu","suffix":""},{"id":72244316,"identity":"7fc1bdb0-f2d0-404d-a2d8-b94d33765b2d","order_by":5,"name":"Changsheng Chen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAtElEQVRIiWNgGAWjYHACNiC2gTB5SNCSBlFNipbDJGjhb2B+9uDjjvN59hIJjA/etjHImxPSInGAzdxw5pnbxTwSCcyGc9sYDHc2ENBiwMDDJs3bdjuxRyIBxGBIMDhAjJa/bedAWth/E6+Fse0A2BZmorRIHGYzk+xtS07sOfOwWXLOOQnDDYS08Lc3P5P42WaX2N6efPDDmzIbeYK2MDDDWYwNIFsJqR8Fo2AUjIJRQAwAAJ+sNlHwevVCAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0001-6774-0781","institution":"Nantong University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Changsheng","middleName":"","lastName":"Chen","suffix":""}],"badges":[],"createdAt":"2021-11-19 03:21:49","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1094321/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1094321/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s10695-022-01049-5","type":"published","date":"2022-01-18T02:49:37+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":16809910,"identity":"2c839f4d-a306-4edf-b802-8c5e0e1b551a","added_by":"auto","created_at":"2021-12-28 19:00:33","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":9221172,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogeny of NAV3 among species and the spatiotemporal expression of zebrafish \u003cem\u003enav3\u003c/em\u003e during embryogenesis. (A) Schematic representation of essential domains in NAV3 protein. It contains a calponin-homology domain, an LKK actin-binding domain, two putative SH3 domains, and ATPase domains of the AAA type. (B) Zebrafish Nav3 is closely related to other vertebrate homologs. A neighbor-joining tree was produced with MEAG5.0 software, displaying the relationships of NAV3 full-length amino acid sequences in \u003cem\u003eDanio rerio\u003c/em\u003e (XP_021330780.1), \u003cem\u003eHomo sapiens\u003c/em\u003e (NP_001019554.1), \u003cem\u003eRattus norvegicus\u003c/em\u003e (NP_001178711.1), \u003cem\u003eMus musculus\u003c/em\u003e (NP_001074504.1), and \u003cem\u003eCaenorhabditis elegans\u003c/em\u003e (Q7YSI9). \u003cem\u003eNav3\u003c/em\u003e expression was detected with WISH at 18 (C-E), 24 (G-I), 48 (J-L), and 96 hpf (M-O). (C) \u003cem\u003eNav3\u003c/em\u003e expression was detected in the brain (\u003cem\u003eb\u003c/em\u003e, green arrowhead) and somites (\u003cem\u003ess\u003c/em\u003e, magenta arrowhead). (D) Dorsal view of zebrafish embryo at 18 hpf. (E) A magnification view of the boxed area in D. \u003cem\u003eNav3\u003c/em\u003e was expressed in the cardiac primordium (\u003cem\u003ecp\u003c/em\u003e, yellow arrowhead). (F) The expression of \u003cem\u003enkx2.5\u003c/em\u003e was in the cardiac primordium in zebrafish embryos at 18 hpf. At 24 hpf, \u003cem\u003enav3\u003c/em\u003e expression could be detected in the heart region (G, lateral view) and somites (H, dorsal view). Heart, \u003cem\u003eh\u003c/em\u003e. (I) Images of the cross-section of zebrafish embryos. The red dashed lines indicate the cutting positions. (J-L) Expression of \u003cem\u003enav3\u003c/em\u003e was restricted to the heart at 48 hpf. Images were taken with a lateral view (J), dorsal view (K), and cross-sectional view (L). (M) Lateral view of \u003cem\u003enav3\u003c/em\u003e expression at 96 hpf. \u003cem\u003eNav3\u003c/em\u003e RNA transcripts were accumulated in the gill arch (\u003cem\u003ega\u003c/em\u003e, blue arrowhead). (N) Magnification view of the boxed area in M exhibits obvious \u003cem\u003enav3\u003c/em\u003e expression in the swim bladder (\u003cem\u003esb\u003c/em\u003e) and intestine (\u003cem\u003ei\u003c/em\u003e). (O) Image of the cross-sectional area indicates the \u003cem\u003enav3\u003c/em\u003e expression in \u003cem\u003ega\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-1094321/v1/fbbc3bc46a18a263c550fb2c.png"},{"id":16809908,"identity":"3ceddf96-d599-43cb-ad2b-cc66c381fb64","added_by":"auto","created_at":"2021-12-28 19:00:33","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":7571735,"visible":true,"origin":"","legend":"\u003cp\u003eDeletion of zebrafish Nav3 leads to phenotypic defects in embryos and adults. (A) Schematic representation of \u003cem\u003enav3\u003c/em\u003e deletion in zebrafish through CRISPR/Cas9. The designed CRIPSR sequence locates at the second exon of \u003cem\u003enav3\u003c/em\u003e. (B-G) Lateral views of WT (B, D, and F) and \u003cem\u003enav3\u003c/em\u003e-null mutants (C, E, and G) at 48 hpf (B and C), 5 dpf (D and E), and 145 dpf (F and G). The digits at the lower left position of each panel indicate the number of fishes with typical phenotype in total observed ones. (H) Survival rates of WT and \u003cem\u003enav3\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e mutants raised at 28.5°C within 1, 2, 3, 20, and 60 dpf. Error bars indicate standard deviation. ***, p\u0026lt;0.001.\u0026nbsp;\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-1094321/v1/f57834c17a592847fbf85fe5.png"},{"id":16809912,"identity":"5456ad1e-1c17-4bce-9262-0ad02a30e6ae","added_by":"auto","created_at":"2021-12-28 19:00:33","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":9806850,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eNav3-\u003c/em\u003edeleted zebrafish embryos exhibit cardiac defects during cardiogenesis. (A-F) Lateral and ventral views of WT siblings and \u003cem\u003enav3\u003c/em\u003e-deleted mutants at 72 hpf. The atrium and ventricle were fluorescently labeled with GFP (green) and mCherry (red), respectively. Scale bars, 100 µm. The digits in the upper right corner of each panel indicate the number of zebrafish larvae with typical phenotype in total observed ones. (G-U) Functional analyses of heart in zebrafish embryos. (G-R) Fluorescently labeled heart chambers were imaged in the dilated and contracted states, respectively. (S) The difference in the heart chamber area between a contiguous dilated and contracted state was defined as the HI. Scale bars, 50 µm. (T and U) HI and heart rate of WT and \u003cem\u003enav3\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e mutants at 72 hpf (n=10 in both WT and mutants). Error bars indicate standard deviation. **, p\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-1094321/v1/25082f65bb3695e8a77e12ba.png"},{"id":16809911,"identity":"7367e590-c5d3-4411-89f7-9e1fc7b65976","added_by":"auto","created_at":"2021-12-28 19:00:33","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":5921138,"visible":true,"origin":"","legend":"","description":"","filename":"Fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-1094321/v1/f37731157e4fb5e672816eff.png"},{"id":17405953,"identity":"1afaad9c-e325-4042-ae11-a9a71bf89b37","added_by":"auto","created_at":"2022-01-18 02:49:41","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4869744,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1094321/v1/994bf3a7-17f2-44ee-bb05-f9549c32d813.pdf"},{"id":16809909,"identity":"8ec4ee07-2721-4148-8f98-6de84fe50b19","added_by":"auto","created_at":"2021-12-28 19:00:33","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":2734463,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary Figure S1.\u003c/strong\u003e Multiple sequence alignment of NAV3 among species by using T-Coffee (\u003ca href=\"http://tcoffee.crg.cat/\" rel=\"noopener noreferrer\" target=\"_blank\"\u003ehttp://tcoffee.crg.cat/\u003c/a\u003e).\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eSupplementary Figure S2. \u003c/strong\u003eExpressions of cardiac-related genes in WT and\u003cem\u003e nav3\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e mutants at 24 hpf. The expression of the corresponding gene is outlined with a white dashed line. The digits at the lower left position of each panel indicate the number of fishes with typical phenotype in total observed ones.\u003c/p\u003e","description":"","filename":"supplementaryfigure.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1094321/v1/aa43460f05c33ab43ca07cf7.pdf"}],"financialInterests":"","formattedTitle":"\u003cp\u003eNeuron Navigator 3 (NAV3) is Required for Heart Development in Zebrafish\u003c/p\u003e","fulltext":[{"header":"Background","content":"\u003cp\u003eCardiogenesis is an indispensable process in vertebrates during embryogenesis, and the heart plays a vital role in the distribution of nutrients and oxygen in the embryos. Any failures during cardiogenesis will lead to cardiac malformations, further resulting in the death of the embryos. It is challenging to study heart development during embryogenesis. Compared with other mammalian models, such as mice, zebrafish offers several unique advantages for studying cardiac development\u0026nbsp;(Gore et al., 2012; Liu and Stainier, 2012). First, the zebrafish embryos develop externally after fertilization, allowing direct non-invasive observation of heart development during cardiogenesis. Second, the optical transparency of zebrafish embryos allows high-resolution optical imaging. Third, zebrafish embryos can survive up to 7 days without a functional cardiovascular system to supply the nutrients and oxygen due to their tiny size, offering the possibility to analyze the phenotype of the cardiac defects. Besides, essential genes responsible for cardiac development are also highly conserved throughout vertebrates. Therefore, zebrafish is a valuable animal model for exploring the mechanisms underlying cardiac development.\u003c/p\u003e\n\u003cp\u003eIn zebrafish, the formation of a mature heart includes a series of cellular processes, including cell migration, proliferation, and differentiation\u0026nbsp;(Buckingham et al., 2005; Keegan et al., 2004). Numerous genes are involved in embryonic cardiogenesis, such as \u003cem\u003ebmp4\u003c/em\u003e (Jiao et al., 2003), \u003cem\u003enppa\u003c/em\u003e (Grassini et al., 2018), \u003cem\u003evcana\u003c/em\u003e (Mittal et al., 2019), \u003cem\u003eamhc\u003c/em\u003e, and \u003cem\u003evmhc\u003c/em\u003e (Berdougo et al., 2003; Yelon et al., 1999), as well as transcription factors \u003cem\u003enkx2.5\u003c/em\u003e (Targoff et al., 2013), \u003cem\u003ehand2\u003c/em\u003e (Schindler et al., 2014), and GATA family members\u0026nbsp;(Haworth et al., 2008; Holtzinger and Evans, 2007; Reiter et al., 1999). \u003cem\u003eNav3\u003c/em\u003e, the vertebrate homology of \u003cem\u003eC. elegans\u003c/em\u003e gene uncoordinated-53 (\u003cem\u003eunc-53\u003c/em\u003e), is one of the neural guidance genes, which plays a role in shaping the developing nervous system by modulating/guiding neural cell migration\u0026nbsp;(Maes et al., 2002; Stringham et al., 2002). Moreover, NAV3 is identified as a microtubule-binding protein that regulates actin assembly in extensions of lamellipodia and filopodia\u0026nbsp;(Klein et al., 2011). Although \u003cem\u003enav\u003c/em\u003e genes are mainly expressed in the brain, their slight expressions are also detected in the heart, kidney, and liver, suggesting potential roles of NAVs in organogenesis\u0026nbsp;(Maes et al., 2002). In the present study, we focused on the effects of Nav3 on heart development in zebrafish. We found that \u003cem\u003enav3\u003c/em\u003e was temporally expressed in the cardiac region from 24 h post-fertilization (hpf) to 48 hpf through in situ hybridization (ISH) assay, indicating its function in ventricle-atrium differentiation\u0026nbsp;(Bakkers, 2011).\u003c/p\u003e\n\u003cp\u003eDeletion of \u003cem\u003enav3\u003c/em\u003e in zebrafish via CRISPR/Cas9 genome editing technique resulted in severe defects in heart development. Fluorescent imaging of ventricle marker (\u003cem\u003evmhc\u003c/em\u003e) and atrium marker (\u003cem\u003eamhc\u003c/em\u003e) further confirmed the malformed morphogenesis of the cardiac structure in \u003cem\u003enav3\u003c/em\u003e-null mutants. In addition to structural alterations, a significant decrease in heartbeat intensity (HI) was also detected in \u003cem\u003enav3\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e mutants. Moreover, the phenotypic defects caused by loss-of-function of Nav3 could be rescued by \u003cem\u003enav3\u003c/em\u003e mRNA injection. Collectively, our current work revealed a novel role of Nav3 in heart development, which might provide potential strategies for heart disease therapy and cardiac regeneration.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003eZebrafish husbandry and strains\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe zebrafish (TU line) in this study was obtained from China Zebrafish Resource Centre and maintained in Jiangsu key laboratory of neuroregeneration of Nantong university. The transgenic zebrafish lines \u003cem\u003eTg(vmhc:mCherry::amhc:EGFP)\u003c/em\u003e and \u003cem\u003eTg(myl7:mCherry)\u003c/em\u003e were kindly provided by Dr. R. Zhang and Dr. T. Zhong, respectively. \u003cem\u003eTg(mef2a:EGFP)\u003c/em\u003e transgenic line was constructed by our lab previously\u0026nbsp;(Lv et al., 2017). \u003cem\u003eTg(vmhc:mCherry::amhc:EGFP)\u003c/em\u003e and \u003cem\u003eTg(myl7:mCherry)\u003c/em\u003e were outcrossed with \u003cem\u003enav3\u003c/em\u003e-null mutants to generate the \u003cem\u003eTg(nav3\u003csup\u003e-/-\u003c/sup\u003e-vmhc:mCherry::amhc:EGFP)\u003c/em\u003e and \u003cem\u003eTg(nav3\u003csup\u003e-/-\u003c/sup\u003e-mef2a-EGFP)\u0026nbsp;\u003c/em\u003ehomozygous lines. All zebrafish lines were maintained at 28.5℃.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWhole-mount in situ hybridization (WISH)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWISH with antisense RNA probes was performed as previously described\u0026nbsp;(Krueger et al., 2011). The probe for the detection of NAV3 (NM_001045143.2) was cloned from cDNA fragments. The \u003cem\u003enav3\u003c/em\u003e cDNA fragment was amplified with a forward primer: 5\u0026prime;-TCACCTTCTGACTCCACCAG-3\u0026prime; and a reverse primer: 5\u0026prime;-GTTCGATGTTACGCGCTCAC-3\u0026prime;. After hybridization, images of the embryos were acquired with an Olympus stereomicroscope MVX10 equipped with an Olympus DP71 camera.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGeneration of \u003cem\u003enav3\u003c/em\u003e-null mutants\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA CRISPR/Cas9-mediated approach was used to generate \u003cem\u003enav3\u003c/em\u003e-deleted mutants. The target site of CRISPR/Cas9 designed to identify the sequence in the second exon of \u003cem\u003enav3\u003c/em\u003e was 5\u0026prime;-CATACCCGATGGAGTTCTGC\u003cu\u003eTGG\u003c/u\u003e-3\u0026prime; (underlined was the PAM sequence). The template sequence of sgRNA for \u003cem\u003ein vitro\u003c/em\u003e transcription was 5\u0026prime;-TAATACGACTCACTATAGCATACCCGATGGAGTTCTGCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT-3\u0026prime;. For the sgRNA synthesis, a forward primer (5\u0026prime;-TAATACGACTCACTATAGCATACCCGATGGAGTTCTGCGTTTTAGAGCTAGAAATAGC-3\u0026prime;) containing a T7 promoter region and a \u003cem\u003enav3\u003c/em\u003e gene-targeting region, and a universal reverse primer (5\u0026prime;-AAAAAAAGCACCGACTCGGTGCCAC-3\u0026prime;) were used in the PCR amplification with pT7 plasmid as the template to obtain the sgDNA, which was then transcribed into sgRNA \u003cem\u003ein vitro\u003c/em\u003e using the T7 mMessage mMachine kit (Ambion). Micro-injection was performed with 1-cell stage zebrafish embryos, and each embryo was co-injected with 100 pg sgRNA and 200 pg Cas9 mRNA. G0 generations were examined by PCR, followed by Sanger sequencing. A mutant with a 55-bp deletion at the second exon was identified, leading to the occurrence of a stop codon downstream of the Cas9 cutting site. The heterozygous \u003cem\u003enav3\u003c/em\u003e\u003csup\u003e+/-\u003c/sup\u003e mutants were incrossed to obtain the homozygous F2 progenies.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMorpholino-mediated gene deletion of \u003cem\u003enav3\u003c/em\u003e in zebrafish\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe \u003cem\u003enav3\u003c/em\u003e gene-specific morpholino (Gene Tools, LLC) was used to block the splicing of \u003cem\u003enav3\u003c/em\u003e pre-mRNA. The sequence of the morpholino antisense oligomer was 5\u0026prime;-CAGCCCATGTGCCATGCTGCTTCTG-3\u0026prime;. In the present study, 2 nL of 0.3 mM morpholino oligo was micro-injected into the embryos at the 1-cell stage.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003emRNA rescue experiment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn the rescue experiment, 200 pg \u003cem\u003enav3\u003c/em\u003e mRNA was co-injected into the embryos with the \u003cem\u003enav3\u003c/em\u003e antisense morpholino. The cDNA fragment of \u003cem\u003enav3\u003c/em\u003e was first subcloned into pCS2+ vector. To make the mRNA, the DNA plasmid was linearized with an appropriate restriction enzyme and transcribed \u003cem\u003ein vitro\u003c/em\u003e using the SP6 mMessage mMachine kit (Ambion).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSurvival rate quantification\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eZebrafish embryos of WT and \u003cem\u003enav3\u003c/em\u003e-null mutants were respectively collected after fertilization and divided into 10 tanks (100 embryos in each tank). The counts of surviving fishes per tank were determined at 1, 2, 3, 20, and 60 days post-fertilization (dpf). Afterward, the proportions of fish surviving at each time point were assessed.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConfocal imaging and quantification\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eZ\u003c/em\u003eebrafish embryos of \u003cem\u003eTg(mef2a:EGFP)\u003c/em\u003e, \u003cem\u003eTg(nav3\u003csup\u003e-\u003c/sup\u003e/\u003csup\u003e-\u003c/sup\u003e-mef2a:EGFP)\u003c/em\u003e, \u003cem\u003eTg(vmhc:mCherry::amhc:EGFP\u003c/em\u003e) and \u003cem\u003eTg(nav3\u003csup\u003e-\u003c/sup\u003e/\u003csup\u003e-\u003c/sup\u003e-vmhc:mCherry::amhc:EGFP)\u003c/em\u003e were anaesthetized with egg water/0.16 mg/mL tricaine/1% PTU (Sigma) and embedded in low-melting agarose. Living imaging was performed with Nikon A1R confocal microscopy.\u003c/p\u003e\n\u003cp\u003eThe heart rate of the embryo was defined as the beats per minute and counted under a dissecting microscope (Olympus). To examine the HI, the cardiac-labeled transgenic zebrafish lines \u003cem\u003eTg(mef2a:EGFP)\u003c/em\u003e and \u003cem\u003eTg(nav3\u003csup\u003e-\u003c/sup\u003e/\u003csup\u003e-\u003c/sup\u003e-mef2a:EGFP)\u003c/em\u003e were used to visualize the hearts of WT and mutants, respectively. The cross-sectional areas of the chambers in GFP-labeled hearts in the dilated state (A\u003csub\u003ed\u003c/sub\u003e) and contracted state (A\u003csub\u003ec\u003c/sub\u003e) were respectively measured with ImageJ\u0026nbsp;(Rueden et al., 2017). The HI was calculated by the equation as follows, HI = A\u003csub\u003ed\u003c/sub\u003e \u0026ndash; A\u003csub\u003ec\u003c/sub\u003e. In our present analysis, five WT and mutant fishes were respectively selected, and each fish was measured for 20 successive heartbeats.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA two-tailed, unpaired Student\u0026rsquo;s t-test was used to determine statistical significance when comparing independent groups. P\u0026lt;0.05 was considered statistically significant. All results were presented as mean \u0026plusmn; SD.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eZebrafish\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003enav3\u003c/span\u003e \u003cb\u003eis expressed in the heart during embryogenesis\u003c/b\u003e\u003c/p\u003e \u003cp\u003eZebrafish Nav3 has been previously reported as an ortholog of UNC-53 in \u003cem\u003eC. elegans\u003c/em\u003e. Compared with other vertebrate NAV3 in humans, mice, and rats, as well as UNC-53 in \u003cem\u003eC. elegans\u003c/em\u003e, zebrafish Nav3 was highly conserved among all these species (Supplemental Fig. S1). NAV3 is a huge protein consisting of more than 2,000 amino acids. It contains several conserved domains, including a putative calponin-homology domain (CH-domain), an LKK actin-binding domain, two Src Homology 3 (SH3) domains, and an ATP/GTP-binding AAA domain (Schmidt et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2009\u003c/span\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). The CH-domain is essential for the interaction with actin filaments, suggesting its role in the formation of lamellipodia and filopodia, and it would further drive cell movements. Phylogenic alignment also revealed the close relationship between zebrafish Nav3 and NAV3 of other species (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWISH was performed with zebrafish embryos from 18 hpf to 96 hpf to explore the spatiotemporal expression of zebrafish \u003cem\u003enav3\u003c/em\u003e during embryogenesis. The \u003cem\u003enav3\u003c/em\u003e mRNA transcripts could be detected at an early embryonic stage (18 hpf), while its expression was mainly restricted to the brain and somites (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). A slight expression was also presented in cardiac primordium at the same developmental stage (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD, E). As \u003cem\u003enkx2.5\u003c/em\u003e is specifically expressed in cardiac primordium, the ISH experiment with \u003cem\u003enkx2.5\u003c/em\u003e probe could further confirm the expression of \u003cem\u003enav3\u003c/em\u003e in the region of cardiac primordium (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF). At 24 hpf, \u003cem\u003enav3\u003c/em\u003e was more specifically expressed in the brain, heart, and somites (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG-I). However, the expression of \u003cem\u003enav3\u003c/em\u003e in somites became weaker, and it was rarely detected from 48 hpf. At 48 hpf, its expression was highly regionalized to the brain and heart (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eJ-L). At 96 hpf, there was almost no expression of \u003cem\u003enav3\u003c/em\u003e in the heart, and its expression was found to be accumulated in other tissues, such as the gill arch, swim bladder, and intestine (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eM-O), suggesting that its potential roles were not only restricted to nervous or cardiovascular system.\u003c/p\u003e \u003cp\u003e \u003cb\u003eNav3 loss-of-function in zebrafish exhibits severe phenotypic defects and low survival rates3e4r\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo explore the effects of Nav3 deletion in heart development, a CRISPR/Cas9-based genome editing method was utilized to generate a \u003cem\u003enav3\u003c/em\u003e-deleted mutant (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). A 55-bp deletion at the second exon of \u003cem\u003enav3\u003c/em\u003e led to the occurrence of a truncated protein (a 79-amino acid sequence versus the full-length sequence with 2,270 amino acids). The homozygous \u003cem\u003enav3\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mutants were further obtained through genetic selection. An obvious heart malformation phenotype was observed in \u003cem\u003enav3\u003c/em\u003e-null zebrafish embryos. Compared with the wild-type (WT) counterparts, the \u003cem\u003enav3\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mutants displayed severe pericardial edemas not only at the early developmental stage but also in adult zebrafishes, although more than 70% of the \u003cem\u003enav3\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mutants died within 24 hpf (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB-H). Afterwards, only 8% of the mutants could successfully develop into adults (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eHeart morphogenesis and function are disrupted in\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003enav3\u003c/span\u003e \u003cb\u003emutant zebrafish embryos\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo further evaluate the changes in cardiac morphology, structure, and function in \u003cem\u003enav3\u003c/em\u003e-null mutants, the fluorescently labeled atrium-specific marker \u003cem\u003eamhc\u003c/em\u003e and ventricle-specific marker \u003cem\u003evmhc\u003c/em\u003e were respectively adopted. Transgenic lines \u003cem\u003eTg(vmhc:mCherry::amhc:EGFP)\u003c/em\u003e and \u003cem\u003eTg(nav3\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e/\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;\u003c/em\u003e\u003c/sup\u003e\u003cem\u003e-vmhc:mCherry::amhc:EGFP)\u003c/em\u003e were used to compare the heart morphological differences between WT and mutants. Both atrium and ventricle in \u003cem\u003enav3\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mutants at 72 hpf exhibited a long tubular-shaped morphology, and the boundary line between atrium and ventricle was not as clear as the WT (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-F). Next, we compared the heart rate as well as the HI between WT and \u003cem\u003enav3\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mutants to check whether the heart functions were affected upon Nav3 loss-of-function. We found that the heart rate was not affected by the deletion of \u003cem\u003enav3\u003c/em\u003e. The frequency was within a range of 150 to 200 times per minute in both WT and mutant strains (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eS). However, the HI in WT and mutant strains was different. Here, we introduced a parameter defined as HI to indicate cardiac capacity. The areas of the GFP-labeled heart were measured in the dilated and contracted states (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG-R). The area difference between these two states was regarded as HI. The calculation formula was shown in \u003cb\u003eMethods\u003c/b\u003e. The HI was significantly lower in the mutants compared with the WT siblings (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eT). However, there was no obvious difference in heart rate between WT and mutants (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eU). All these findings indicated that Nav3 deficiency resulted in heart development defects during zebrafish embryogenesis, including the cardiac structure and functional disruption.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003enav3\u003c/span\u003e \u003cb\u003emRNA injection can rescue the cardiac defects in\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003enav3\u003c/span\u003e\u003cb\u003e-deleted embryos\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo further confirm whether the abnormal phenotype of the mutant was caused by the deletion of \u003cem\u003enav3\u003c/em\u003e, we injected a morpholino against \u003cem\u003enav3\u003c/em\u003e mRNA into transgenic line \u003cem\u003eTg(myl7:mCherry)\u003c/em\u003e to delete \u003cem\u003enav3\u003c/em\u003e. \u003cem\u003eTg(myl7:mCherry)\u003c/em\u003e line was under a WT background, and the cardiac marker \u003cem\u003emyl7\u003c/em\u003e (myosin light chain 7) was fluorescently labeled with mCherry fluorescent protein. Upon \u003cem\u003enav3\u003c/em\u003e expression was down-regulated through morpholino injection, WT zebrafish embryos displayed a similar phenotype to \u003cem\u003enav3\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mutants. Moreover, fluorescent imaging of the heart in morpholino-injected embryos mimicked the abnormal cardiac morphology of \u003cem\u003enav3\u003c/em\u003e-null mutants (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo verify that the phenotype of \u003cem\u003enav3\u003c/em\u003e-morphants was attributed to the loss-of-function of Nav3 rather than non-specific effects, we performed a rescue experiment by injecting \u003cem\u003enav3\u003c/em\u003e mRNA together with \u003cem\u003enav3\u003c/em\u003e morpholino into 1-cell-stage zebrafish embryos of \u003cem\u003eTg(myl7:mCherry)\u003c/em\u003e. The \u003cem\u003enav3\u003c/em\u003e mRNA injection partially rescued the phenotypic defects caused by the down-regulation of \u003cem\u003enav3\u003c/em\u003e. Upon \u003cem\u003enav3\u003c/em\u003e mRNA injection, the tubular-shaped ventricle and atrium structure of the \u003cem\u003enav3\u003c/em\u003e-morphants were almost recovered to a normal state. However, compared with the WT counterparts, the rescued heart was slightly misshaped in the morphology, such as tubular-shaped ventricle. Additionally, the boundary between the ventricle and atrium became observable after \u003cem\u003enav3\u003c/em\u003e mRNA injection (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eAs a complicated but coordinated biological process, the assembly of an intact heart involves the proliferation, differentiation, and migration of cardiomyocytes to form a functional contractile organ (Buckingham et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Keegan et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Liu and Stainier, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). A cohort of genes participate in this process and play important roles. \u003cem\u003eNav3\u003c/em\u003e, the vertebrate homology of \u003cem\u003eunc-53\u003c/em\u003e in \u003cem\u003eC.elegans\u003c/em\u003e, is first discovered as a neural guidance gene that is functional in cell migration and outgrowth of axons. Because cell movement is highly relevant to embryonic organogenesis and NAV3 is also involved in liver development (Klein et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2011\u003c/span\u003e), we hypothesized that NAV3 played a novel role in cardiogenesis. In our present study, we first examined the expression of \u003cem\u003enav3\u003c/em\u003e in zebrafish during embryogenesis. The specific spatiotemporal expression of \u003cem\u003enav3\u003c/em\u003e in the zebrafish heart region suggested its potential function in embryonic heart development beyond the nervous system. To confirm our prediction, we generated the \u003cem\u003enav3\u003c/em\u003e-deleted mutants. Loss-of-function of Nav3 in zebrafish embryos displayed severe heart development defects, such as pericardial edemas and chamber malformations. Moreover, the function of the heart was affected by the deletion of Nav3. For instance, the HI was significantly decreased in mutants. However, the heart rates were similar in both WT and mutant embryos. The functional analysis revealed that loss of Nav3 resulted in an abnormal dilation and contraction in the heart.\u003c/p\u003e \u003cp\u003eTo confirm whether the phenotypic defects of the \u003cem\u003enav3\u003c/em\u003e-null mutants were caused by the loss-of-function of Nav3, a morpholino-mediated gene knockdown experiment and a \u003cem\u003enav3\u003c/em\u003e mRNA rescue experiment were performed. The pericardial edemas and heart morphogenesis malformations were reproduced in \u003cem\u003enav3\u003c/em\u003e-deleted mutants and could also be partially rescued by co-injection of morpholino and \u003cem\u003enav3\u003c/em\u003e mRNA. Additionally, the mRNA rescue experiment also recapitulated that the severe cardiac edema was not caused by the off-target effects triggered by sgRNA or morpholino injection.\u003c/p\u003e \u003cp\u003eIn our present work, we also noticed that the survival rates of \u003cem\u003enav3\u003c/em\u003e-deleted mutants were significantly lower compared with their WT counterparts, especially from the very early developmental stage (from 24 hpf). Since zebrafish could survive up to 7 days without a functional cardiovascular system, the high mortality upon Nav3 deletion might not result from the cardiac defects and more probably be attributed to its dysfunction in the nervous system or immunity (Carlsson et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Karenko et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2005\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAs mentioned above, Nav3 loss-of-function could lead to severe defects in zebrafish heart development. However, it remains largely unknown whether some essential cardiac-related genes are altered in \u003cem\u003enav3\u003c/em\u003e-null mutants. In our preliminary experiments, we examined the expressions of \u003cem\u003enkx2.5\u003c/em\u003e, \u003cem\u003ehand2\u003c/em\u003e, \u003cem\u003evmhc\u003c/em\u003e, and \u003cem\u003eamhc\u003c/em\u003e in \u003cem\u003enav3\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mutants and WT zebrafish embryos using ISH. We found that the expressions of \u003cem\u003enkx2.5\u003c/em\u003e and \u003cem\u003ehand2\u003c/em\u003e were slightly decreased after the deletion of \u003cem\u003enav3\u003c/em\u003e (Supplemental Fig. S2). Although they both play roles in embryonic heart development, each of them also owns a distinct and specific function in regulating this process. \u003cem\u003eNkx2.5\u003c/em\u003e determines the cardiomyocyte identity and can further maintain the vascular and atrial chamber morphology (Targoff et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). \u003cem\u003eHand2\u003c/em\u003e is implicated as a regulator of cardiomyocyte production, which promotes the generation of a proper number of cardiomyocytes during cardiogenesis (Schindler et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). As key regulators in heart development, the lower expressions of \u003cem\u003enkx2.5\u003c/em\u003e and \u003cem\u003ehand2\u003c/em\u003e in \u003cem\u003enav3\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mutants supported its deficiency in cardiac development. This finding was consistent with the previous view that \u003cem\u003enkx2.5\u003c/em\u003e maintains cardiac chamber identity, and \u003cem\u003ehand2\u003c/em\u003e regulates cardiac differentiation and morphogenesis (Schindler et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Targoff et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Although the structure and morphology of the atrium and ventricle were severely affected by the loss of \u003cem\u003enav3\u003c/em\u003e, the expressions of both their markers remained unchanged (Supplemental Fig. S2). We assumed that the cardiac-related myosin chain genes were not affected by the deletion of Nav3, and the heart morphogenesis defects might result from other factors, such as \u003cem\u003enkx2.5\u003c/em\u003e, or \u003cem\u003ehand2\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eAlthough \u003cem\u003enav3\u003c/em\u003e is initially discovered as a neural guidance gene in the nervous system, the NAV family members have also been widely accepted as regulators in cell migration among several species (Cohen-Dvashi et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Klein et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Maes et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Schmidt et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Stringham et al., \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2002\u003c/span\u003e). Moreover, it has been reported to act as a positive modulator in regulating the actin assembly in the extension of filopodia and lamellipodia during zebrafish liver development (Klein et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). As a complicated but orchestrated morphogenetic process, heart formation involves specification, differentiation, and migration of cardiac progenitor cells. Therefore, NAV3 might also play a role in heart development by facilitating the migration of cardiac progenitor cells or cardiomyocytes. Besides, crosstalk between NAV3 and other essential factors, such as \u003cem\u003enkx2.5\u003c/em\u003e, might be involved in these crucial processes during cardiac development. Further efforts are needed to decipher the mechanism of NAV3-regulated cardiogenesis. Taken together, NAV3 was a potential regulator in cardiac development during embryogenesis.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eThe \u003cem\u003enav3\u003c/em\u003e gene can be expressed in a variety of tissues or organs although it is initially identified as a neural guiding factor. Gene knockout of \u003cem\u003enav3\u003c/em\u003e in zebrafish leads to severe development malformation of the heart. Moreover, the defective heart development can be rescued by nav3 mRNA injection. All these findings indicate that Nav3 was required for cardiogenesis in the development of zebrafish embryos.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eCH: calponin homology\u003c/p\u003e\n\u003cp\u003edpf: days post-fertilization\u003c/p\u003e\n\u003cp\u003eHI: heartbeat intensity\u003c/p\u003e\n\u003cp\u003ehpf: hours post-fertilization\u003c/p\u003e\n\u003cp\u003eISH: in situ hybridization\u003c/p\u003e\n\u003cp\u003eNAV: Neuron Navigator\u003c/p\u003e\n\u003cp\u003eSH3: Src Homology 3\u003c/p\u003e\n\u003cp\u003eUNC53: Uncoordianted-53\u003c/p\u003e\n\u003cp\u003eWISH: whole-mount in situ hybridization\u003c/p\u003e\n\u003cp\u003eWT: wild-type\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe research conducted in this manuscript was funded by National Natural Science Foundation of China (82000458) to CC, and start-up funding for Doctoral Research of Nantong Science and Technology College (NTKY-Dr2017001) to FL. It is also funded by Nantong Science and Technology Program (JC2021088), Open Program of Key Laboratory of Cultivation and High-value Utilization of Marine Organisms in Fujian Province (2019fjsccq08), Natural Science Foundation of the Jiangsu Higher Education Institutions of China (20KJB180008), the Science Foundation of Nantong City (JC2020023). The funding sources provided financial support for the experiments described, but had no role in the design of the study or collection, analysis, and interpretation of data or in writing the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal-related experiments were carried out following the NIH Guidelines for the care and use of laboratory animals (http://oacu.od.nih.gov/regs/index.htm), and animal protocols were ethically approved by the Administration Committee of Experimental Animals of Nantong University, Jiangsu Province, China (Approval ID: 20180608-Z001). Transgenic zebrafish lines provided by others were approved by the owners with written informed consent.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analysed during this study are included in this published article and its supplementary information files.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCode availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCC and DL designed and conceptualised the project. FL, XG, PQ, and XL performed the experiment. FL and CC analyzed the data. CC wrote the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBakkers J (2011) Zebrafish as a model to study cardiac development and human cardiac disease. Cardiovasc Res 91:279\u0026ndash;288\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBerdougo E, Coleman H, Lee DH, Stainier DYR, Yelon D (2003) Mutation of weak atrium/atrial myosin heavy chain disrupts atrial function and influences ventricular morphogenesis in zebrafish. Development 130:6121\u0026ndash;6129\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBuckingham M, Meilhac S, Zaffran S (2005) Building the mammalian heart from two sources of myocardial cells. Nat Rev Genet 6:826\u0026ndash;835\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarlsson E, Krohn K, Ovaska K, Lindberg P, H\u0026auml;yry V, Maliniemi P, Lintulahti A, Korja M, Kivisaari R, Hussein S et al (2013) Neuron navigator 3 alterations in nervous system tumors associate with tumor malignancy grade and prognosis. Genes Chromosomes Cancer 52:191\u0026ndash;201\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCohen-Dvashi H, Ben‐Chetrit N, Russell R, Carvalho S, Lauriola M, Nisani S, Mancini M, Nataraj N, Kedmi M, Roth L et al (2015) Navigator‐3, a modulator of cell migration, may act as a suppressor of breast cancer progression. EMBO Mol Med 7:299\u0026ndash;314\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGore AV, Monzo K, Cha YR, Pan W, Weinstein BM (2012) Vascular development in the zebrafish. Cold Spring Harb Perspect Med 2:1\u0026ndash;21\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrassini DR, Lagendijk AK, De Angelis JE, Da Silva J, Jeanes A, Zettler N, Bower NI, Hogan BM, Smith KA (2018) Nppa and nppb act redundantly during zebrafish cardiac development to confine AVC marker expression and reduce cardiac jelly volume. Dev. Camb. \u003cem\u003e145\u003c/em\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHaworth KE, Kotecha S, Mohun TJ, Latinkic BV (2008) GATA4 and GATA5 are essential for heart and liver development in Xenopus embryos. BMC Dev Biol 8:1\u0026ndash;16\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHoltzinger A, Evans T (2007) Gata5 and Gata6 are functionally redundant in zebrafish for specification of cardiomyocytes. Dev Biol 312:613\u0026ndash;622\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiao K, Kulessa H, Tompkins K, Zhou Y, Batts L, Baldwin HS, Hogan BLM (2003) An essential role of Bmp4 in the atrioventricular septation of the mouse heart. Genes Dev 17:2362\u0026ndash;2367\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKarenko L, Hahtola S, P\u0026auml;ivinen S, Karhu R, Syrj\u0026auml; S, K\u0026auml;hk\u0026ouml;nen M, Nedoszytko B, Kyt\u0026ouml;l\u0026auml; S, Zhou Y, Blazevic V et al (2005) Primary cutaneous T-cell lymphomas show a deletion or translocation affecting NAV3, the human UNC-53 homologue. Cancer Res 65:8101\u0026ndash;8110\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKeegan BR, Meyer D, Yelon D (2004) Organization of cardiac chamber progenitors in the zebrafish blastula. Development 131:3081\u0026ndash;3091\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKlein C, Mikutta J, Krueger J, Scholz K, Brinkmann J, Liu D, Veerkamp J, Siegel D, Abdelilah-Seyfried S, Noble F (2011) Neuron navigator 3a regulates liver organogenesis during zebrafish embryogenesis. Development \u003cem\u003e138\u003c/em\u003e, 1935\u0026ndash;1945\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKrueger J, Liu D, Scholz K, Zimmer A, Shi Y, Klein C, Siekmann A, Schulte-Merker S, Cudmore M, Ahmed A et al (2011) Flt1 acts as a negative regulator of tip cell formation and branching morphogenesis in the zebrafish embryo. Development 138:2111\u0026ndash;2120\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu J, Stainier DYR (2012) Zebrafish in the study of early cardiac development. Circ Res 110:870\u0026ndash;874\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLv F, Zhu C, Yan X, Wang X, Liu D (2017) Generation of a mef2aa:EGFP transgenic zebrafish line that expresses EGFP in muscle cells. Fish Physiol Biochem 43:287\u0026ndash;294\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaes T, Barcel\u0026oacute; A, Buesa C (2002) Neuron navigator: A human gene family with homology to UNC-53, a cell guidance gene from Caenorhabditis elegans. Genomics 80:21\u0026ndash;30\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMittal N, Yoon SH, Enomoto H, Hiroshi M, Shimizu A, Kawakami A, Fujita M, Watanabe H, Fukuda K, Makino S (2019) Versican is crucial for the initiation of cardiovascular lumen development in medaka (Oryzias latipes). Sci Rep 9:1\u0026ndash;17\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReiter JF, Alexander J, Rodaway A, Yelon D, Patient R, Holder N, Stainier DYR (1999) Gata5 is required for the development of the heart and endoderm in zebrafish. Genes Dev 13:2983\u0026ndash;2995\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRueden CT, Schindelin J, Hiner MC, DeZonia BE, Walter AE, Arena ET, Eliceiri KW (2017) ImageJ2: ImageJ for the next generation of scientific image data. BMC Bioinformatics 18:529\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchindler YL, Garske KM, Wang J, Firulli BA, Firulli AB, Poss KD, Yelon D (2014) Hand2 elevates cardiomyocyte production during zebrafish heart development and regeneration. Dev Camb 141:3112\u0026ndash;3122\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchmidt KL, Marcus-Gueret N, Adeleye A, Webber J, Baillie D, Stringham EG (2009) The cell migration molecule UNC-53/NAV2 is linked to the ARP2/3 complex by ABI-1. Development 136:563\u0026ndash;574\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStringham E, Pujol N, Vandekerckhove J, Bogaert T (2002) Unc-53 controls longitudinal migration in C. elegans. Development 129:3367\u0026ndash;3379\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTargoff KL, Colombo S, George V, Schell T, Kim SH, Solnica-Krezel L, Yelon D (2013) Nkx genes are essential for maintenance of ventricular identity. Dev Camb 140:4203\u0026ndash;4213\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYelon D, Horne SA, Stainier DYR (1999) Restricted expression of cardiac myosin genes reveals regulated aspects of heart tube assembly in zebrafish. Dev Biol 214:23\u0026ndash;37\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"fish-physiology-and-biochemistry","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"fish","sideBox":"Learn more about [Fish Physiology and Biochemistry](https://www.springer.com/journal/10695)","snPcode":"10695","submissionUrl":"https://submission.nature.com/new-submission/10695/3","title":"Fish Physiology and Biochemistry","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Cardiogenesis, Zebrafish, Cardiac defects, CRISPR/Cas9, in situ hybridization ","lastPublishedDoi":"10.21203/rs.3.rs-1094321/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1094321/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAs a tightly controlled biological process, cardiogenesis requires the specification and migration of a suite of cell types to form a particular three-dimensional configuration of the heart. Many genetic factors are involved in the formation and maturation of the heart, and any genetic mutations may result in severe cardiac failures. The neuron navigator (NAV) family consists of three vertebrate homologs (NAV1, NAV2, and NAV3) of the neural guidance molecule Uncoordinated-53 (UNC-53) in \u003cem\u003eCaenorhabditis elegans\u003c/em\u003e. Although they are recognized as neural regulators, their expressions are also detected in many organs, including the heart, kidney, and liver. However, the functions of NAVs, regardless of neural guidance, remain largely unexplored. In our study, we found that \u003cem\u003enav3\u003c/em\u003e gene was expressed in the cardiac region of zebrafish embryos from 24 to 48 hours post-fertilization (hpf) by means of in situ hybridization (ISH) assay. A CRISPR/Cas9-based genome editing method was utilized to delete the \u003cem\u003enav3\u003c/em\u003e gene in zebrafish and loss-of-function of Nav3 resulted in a severe deficiency in its cardiac morphology and structure. The similar phenotypic defects of the knockout mutants could recur by \u003cem\u003enav3\u003c/em\u003e morpholino injection and be rescued by \u003cem\u003enav3\u003c/em\u003e mRNA injection. Dual-color fluorescence imaging of ventricle and atrium markers further confirmed the disruption of the heart development in \u003cem\u003enav3\u003c/em\u003e-deleted mutants. Although the heart rate was not affected by the deletion of \u003cem\u003enav3\u003c/em\u003e, the heartbeat intensity was decreased in the mutants. All these findings indicate that Nav3 was required for cardiogenesis in developing zebrafish embryos.\u003c/p\u003e","manuscriptTitle":"Neuron Navigator 3 (NAV3) is Required for Heart Development in Zebrafish","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2021-12-28 19:00:30","doi":"10.21203/rs.3.rs-1094321/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Minor revisions","date":"2022-01-07T14:39:11+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2021-12-28T10:49:21+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2021-12-23T16:43:17+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2021-11-24T04:01:48+00:00","index":"","fulltext":""},{"type":"submitted","content":"Fish Physiology and Biochemistry","date":"2021-11-18T22:21:27+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"fish-physiology-and-biochemistry","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"fish","sideBox":"Learn more about [Fish Physiology and Biochemistry](https://www.springer.com/journal/10695)","snPcode":"10695","submissionUrl":"https://submission.nature.com/new-submission/10695/3","title":"Fish Physiology and Biochemistry","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"e003a222-aa46-43f9-98fd-827070511774","owner":[],"postedDate":"December 28th, 2021","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2022-01-18T02:49:37+00:00","versionOfRecord":{"articleIdentity":"rs-1094321","link":"https://doi.org/10.1007/s10695-022-01049-5","journal":{"identity":"fish-physiology-and-biochemistry","isVorOnly":false,"title":"Fish Physiology and Biochemistry"},"publishedOn":"2022-01-18 02:49:37","publishedOnDateReadable":"January 18th, 2022"},"versionCreatedAt":"2021-12-28 19:00:30","video":"","vorDoi":"10.1007/s10695-022-01049-5","vorDoiUrl":"https://doi.org/10.1007/s10695-022-01049-5","workflowStages":[]},"version":"v1","identity":"rs-1094321","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1094321","identity":"rs-1094321","version":["v1"]},"buildId":"GqpaHPwrfC8PjnIFayRh5","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}