The ribosomal RNA synthesis ratio biomarker in Mycobacterium ulcerans for drug activity evaluation

The ribosomal RNA synthesis ratio biomarker in Mycobacterium ulcerans for drug activity evaluation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Short Report The ribosomal RNA synthesis ratio biomarker in Mycobacterium ulcerans for drug activity evaluation Juan Calvet-Seral, Emma Sáez-López, Patricio R. López-Expósito, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8335436/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract Buruli ulcer (BU), a neglected tropical disease caused by Mycobacterium ulcerans ( Mul ), requires a complex 8-week treatment regimen of rifampicin (RIF) and clarithromycin (CLA). The co-administration of amoxicillin/clavulanate (AMX/CLV) is currently under evaluation in clinical trials to reduce treatment duration. Conventional methods to assess in vitro drug efficacy against Mul , like colony-forming units (CFUs), are slow and cumbersome. The ribosomal RNA synthesis ratio (RS-ratio), a hallmark of active ribosome biogenesis, is a promising predictive biomarker for treatment shortening in tuberculosis; however, its application in Mul has not yet been explored. We implemented the RS-ratio for Mul by designing new sets of primers-probes for specific rRNA precursor and total rRNA sequences and combining them with a previously published primers-probe set into a single multiplexed droplet digital PCR (ddPCR) assay. This assay was applied to evaluate the in vitro activity of RIF, CLA, and AMX/CLV (as monotherapies and in combinations) against a Mul clinical strain using RNA extracts from a 28-day time-kill assay. RIF+AMX/CLV-containing combinations produced the most significant and rapid RS-ratio reductions, preceding the observed decline in bacterial burden in prior studies. In summary, this is the first report using the RS-ratio to evaluate antibiotic activity against Mul . Our findings validate the RS-ratio as a molecular tool for assessing the sterilizing potential of new regimens to inform future research and clinical trial designs for the treatment of BU. Evidence of in vitro sterilization of the RIF+CLA+AMX/CLV regimen supports its selection for BU treatment shortening in the BLMs4BU clinical trial (NCT05169554, PACTR202209521256638). RS-ratio Buruli ulcer Mycobacterium ulcerans biomarker treatment-shortening mycobacteria drug combinations Figures Figure 1 Figure 2 Figure 3 Figure 4 INTRODUCTION Mycobacterium ulcerans ( Mul ) is the causative agent of Buruli ulcer (BU), a debilitating skin-neglected tropical disease (NTD) that predominantly affects communities in rural areas with limited access to healthcare services. Despite its low mortality rate, BU can lead to significant morbidity due to the destruction of skin, soft tissues, and even bones. In the absence of early treatment, this may result in irreversible disfigurement and disability with high socio-economic burden and stigma. BU cases have been reported in 33 countries, with over 80% of global cases in the African Region, where nearly 50% of the affected individuals are children under the age of 15 ( 1 ). The current WHO-recommended antibiotic treatment involves an 8-week daily regimen of rifampicin (RIF) and clarithromycin (CLA). Treatment also includes extensive wound care, sometimes surgical intervention, and physiotherapy rehabilitation of movement limitations and disability, with lesion healing potentially lasting for several months. Treatment compliance can be difficult due to socioeconomic factors. A shortened and highly effective regimen would improve the care of BU patients and result in cost reduction. Consequently, the WHO requires evaluating promising medicines to provide new treatment options, including shortening the duration of treatment, as outlined in the WHO NTD Road Map 2021–2030 ( 1 , 2 ). In this context, using a drug repurposing approach, Arenaz et a l. ( 3 ) investigated the in vitro effects of combining various β-lactam antibiotics with RIF and/or CLA. By utilizing checkerboard assays, they demonstrated a strong synergistic effect of amoxicillin/clavulanate (AMX/CLV) with RIF, evidenced by a substantial reduction in the Minimum Inhibitory Concentration (MIC) of RIF and CLA at a fixed time point; these promising findings were subsequently corroborated by in vitro time-kill assays (TKA) ( 4 ), which paved the way for the BLMs4BU clinical trial currently underway in several African countries ( https://blms4bu.org/ ) (NCT05169554, PACTR202209521256638) ( 5 ). In addition, Saez et al . ( 4 ) conducted a comparative analysis of different in vitro readout measurements; this analysis demonstrated the value of a wide variety of biomarkers in BU research, correlating colony-forming units (CFUs) (the in vitro gold standard method for quantifying bacterial load) with optical density at 600 nm, luminescence production, quantification of the IS 2404 DNA by quantitative PCR (qPCR), and the 16S rRNA burden by reverse transcriptase qPCR ( 4 ). This comparison was motivated by the arduous nature of CFU determination for Mul , which necessitates manipulation in biosafety level 3 laboratories and is hampered by the bacterium's slow growth rate on agar, often requiring from one to three months for visible colonies to appear. Furthermore, the study identified 16S rRNA burden quantification and luminescence measurements as having the strongest correlation between them, and a satisfactory correlation with CFU determination, with luminescence being the most cost-effective method. However, beyond conventional phenotypic metrics such as CFU quantification, there is an emerging consensus on the translational significance of evaluating the molecular metabolic state of bacteria as a proxy for the sterilizing activity of drug regimens. Sterilizing drugs, which can eradicate all viable bacterial organisms, are imperative for achieving effective shortening treatment regimens. Ribosomal RNA (rRNA) constitutes a major component of the ribosome, comprising 80–85% of the total RNA present in cells. Its synthesis is subject to stringent regulation as it is a critical rate-limiting step for ribosome biogenesis and, consequently, protein synthesis and cell growth. The ribosomal RNA synthesis ratio (RS-ratio) has recently been described as a novel pharmacodynamic marker used to assess the effectiveness of drugs against Mycobacterium tuberculosis ( Mtb ) ( 6 ), which belongs to the same genus as Mul . The RS-ratio is a molecular assay that quantifies the abundance of a rapidly processed spacer region present in the precursor polycistronic rRNA (immature) relative to the stable final rRNA (mature) sequences. The ratio between these two types of rRNA (immature vs. mature) provides a measure of how actively the bacteria are synthesizing new ribosomes, which is a proxy for their physiological activity and replication rate. This provides different information than conventional markers, such as CFU or rRNA burden by 16S rRNA quantification. The RS-ratio is highly sensitive to the effect of sterilizing drugs, being a promising biomarker for the evaluation of the sterilizing activity of new regimens. In fact, pronounced and sustained reduction in the RS-ratio correlates with improved treatment outcomes and reduced relapse rates in murine models of tuberculosis (TB) ( 6 ). However, despite its potential, the application of the RS-ratio as a tool for drug activity evaluation has primarily focused on Mtb , with limited exploration in other mycobacterial species, as evidenced by the lack of reports in the case of Mul . In this study, we describe for the first time the in vitro development and application of the RS-ratio biomarker to Mul to evaluate the in vitro activity of RIF, CLA, and AMX/CLV and their combinations, currently under clinical investigation for BU treatment shortening. The results underpin the benefits of the RS-ratio as an in vitro biomarker and point to its relevance for future use at the clinical level. MATERIALS AND METHODS Genetic material. RNA from the clinical Mul isolate ITM 000932 was obtained from previous extractions of TKA experiments described by Saez et al. ( 4 ). RNA extracts from the Mtb H37Ra and Mycobacterium smegmatis ( Msm ) mc 2 155 strains were used to test amplicon design specificities. Complementary DNA (cDNA) was synthesised using the SuperScript IV VILO Master Mix (Invitrogen) in a 10 µL reaction volume, using 5 µL of RNA as template. Reverse transcription conditions were 25°C for 10 minutes, followed by 50°C for 15 minutes. Oligonucleotide Design for M. ulcerans rRNA Targets. Primers-probe sets for the quantification of the external transcribed spacer 1 (ETS1), internal transcribed spacer 1 (ITS1), and 23S rRNA of Mul were designed to target homologous regions to those used for RS-ratio calculations in Mtb ( 6 ) (Fig. 1 A). These sequences were designed, ensuring species specificity, aligning Mul , Mtb and Msm rRNA operon regions using SnapGene v8.0.3 software. To ensure high specificity and prevent cross-amplification, at least one oligonucleotide within each primer and probe set was designed to not align with the rRNA operons from published sequences of Mtb (NCBI accession number NC_018143) and Msm (NCBI accession number NC_008596) (Fig. 1 B). Specificity was confirmed using NCBI Nucleotide BLAST. Additionally, we used the primers-probe sequences for detecting the Mul 16S rRNA previously published ( 7 ), which already met the specificity criterion (Fig. 1 B I ). Fluorophore probes were selected to allow differential detection in the QX600 system (Bio-Rad) channels: Channel 1 for ETS1, Channel 2 for 23S rRNA, Channel 3 for 16S rRNA, and Channel 5 for ITS1. BioRad synthesized the ETS1, 23S, and 16S primers-probe sets, and the ITS1 primers-probe set was synthesized by CerTest S.L. (Table 1 ). Table 1 Primers and probes used to calculate the RS-ratio for M. ulcerans . Target Sequence 5´mod 3' mod Reference ETS1 Mul Fw CGTTTTTTTAGATGCCAGTTGATTG This Work Probe TCAGAGATACCTGACAAGAC FAM Iowa Black Rv TCGATAACGAGGTGAATTCAC 23S rRNA Mul Fw GCAGCGAAAGCGAGTCTGA This Work Probe TAGGGCGTATCCCCGTTAGGG HEX Iowa Black Rv GGGTCCAGAACATGCCACTAC 16S rRNA Mul Fw CGATCTGCCCTGCACTTC Beissner et al . 2012 ( 7 ) Probe CACAGGACATGAATCCCGTGGTC Cy5 Iowa Black Rv CCACACCGCAAAAGCTT ITS Mul Fw GGTGTGGTGTTTGAGAATTGGAT This Work Probe CAATTGATGCTCGCAAC ROX BHQ2 Rv CCACCAAAAGGCAGCGC Droplet digital PCR and RS-ratio determination for M. ulcerans. Primers and probe sets for droplet digital PCR (ddPCR) quantification were used in a single multiplexed reaction at Bio-Rad's recommended concentrations (900 nM for primers and 250 nM for probes) with ddPCR SuperMix for Probes (no dUTP) (Bio-Rad). Thermocycling conditions included an initial denaturation step at 95°C for 10 minutes, followed by 40 cycles of denaturation at 96°C for 30 seconds and annealing/extension at 60°C for 90 seconds. A signal stabilization step was performed at 98°C for 10 minutes, followed by a final hold at 4°C for at least 30 minutes before droplet reading and quantification in the QX600 system. The temperature ramp rate was set at 2°C/s for all steps. The number of copies for each target was determined from the partitioned droplets using the QuantaSoft v2.1 software (Bio-Rad). The RS-ratio was calculated as the ratio of the copy number of the precursor rRNA (ETS1 or ITS1) to the copy number of the total rRNA (23S or 16S), multiplied by 10 4 , as previously described ( 6 ). RESULTS Validation of specificity and ddPCR optimization for M. ulcerans RS-ratio determination. To experimentally confirm their specificity, the newly synthesized oligonucleotide sets were subjected to a series of tests using a multiplexed ddPCR reaction with cDNA extracts from Mul , Mtb , and Msm . The Mul cDNA sample saturated the quantification when undiluted, resulting in 100% positive droplets for all four targets (ETS1, ITS1, 23S rRNA, and 16S rRNA). Crucially, no positive droplets were obtained from the cDNA samples of Mtb and Msm , thus confirming the high specificity of the designed probes and primers for Mul targets (Fig. 2 A). The RS-ratio was determined for the Mul ITM 000932 isolate longitudinally exposed to RIF, CLA, and AMX/CLV at 1/2X, 1X, and 1X MIC values, respectively, both in monotherapy and in two- and three-way combinations ( 4 ). To ensure accurate quantification and prevent saturation of the ddPCR reaction, each cDNA extract from the Mul TKA samples ( 3 ) was optimized for specific dilution, allowing for quantifiable droplet numbers for all four targets (ETS1, ITS1, 23S rRNA, and 16S rRNA) (Fig. 2 B). Evaluation of dynamic range and selection of the optimal precursor/total rRNA pair. Four distinct RS-ratios were compared employing combinations of a single precursor rRNA (ETS1 or ITS1) and total rRNA (23S or 16S) (Fig. 3 ). All pairs demonstrated comparable trends across groups. In the conditions where the RS-ratio barely changed over time, such as untreated control, CLA, and AMX/CLV, the different pairs tested (ETS1/23S, ITS1/23S, ETS1/16S, and ITS1/16S) mostly overlapped; however, different dynamic ranges were observed in the conditions in which drug combinations induced a reduction of the RS-ratio. Here, ITS1/16S and ITS1/23S pairs had the lower change, while ETS1/23S and ETS1/16S pairs showed higher change, having the strongest dynamic range the ETS1/23S pair. Thus, the ETS1/23S pair was selected for further comparisons with other biomarkers (Fig. 4 ). RS-ratio kinetics reveal differential metabolic responses of M. ulcerans to RIF, CLA, and AMX/CLV combinations. The untreated Mul growth control exhibited an elevated RS-ratio (≈ 2000) (Fig. 4 A, black circles), which underwent a slight decrease when the culture reached the stationary growth phase (≈ 900–1500 at day 7) (Fig. 4 B, black circles). Exposure to RIF monotherapy resulted in a substantial reduction in the RS-ratio (≈ 200) after 7 days of incubation, with a slight recovery at relatively low levels (≈ 400) until the end of the 28-day assay (Fig. 4 A, purple circles). Conversely, CLA monotherapy led to a marginal increasing effect (≈ 3000) on the RS-ratio (Fig. 4 A, orange circles), while AMX/CLV did not significantly affect the RS-ratio (Fig. 4 A, grey circles). The combination of CLA + AMX/CLV led to an increasing effect in the RS-ratio levels (≈ 4000) at day 3 (Fig. 4 A, red circles) that dropped close to levels of the untreated growth control after day 7. On the contrary, RIF-containing combos consistently induced a decrease in the RS-ratio, though the intensity and kinetics of this effect appear to be dependent upon the accompanying drug. The RIF + CLA combo reduced the RS-ratio to levels comparable to those attained with RIF monotherapy (≈ 250) at days 7 and 10 (Fig. 4 A, yellow circles). However, after day 14 of incubation, the RS-ratio of Mul treated with RIF + CLA showed a recovery to similar levels to the untreated control (≈ 700–900) that was stronger and faster than the slight increase observed in Mul treated with RIF monotherapy. In contrast, both the RIF + AMX/CLV combination and the triple combination (RIF + CLA + AMX/CLV) (Fig. 4 A, green and blue circles, respectively) induced the fastest and most potent decreases of the RS-ratio of the conditions tested. A visible reduction (≈ 200) was already evident at day 3, reaching the maximal inhibition (≈ 50–60) between days 7 and 10. After day 14, the RS-ratio began to recover (≈ 400), but the levels of the untreated sample were not reached even at day 28. Importantly, this recovery was not identified by CFUs or luminescence biomarkers ( Fig. 4 B and C) . DISCUSION This study has investigated for the first time the implementation of the RS-ratio biomarker to assess the in vitro activity of drugs against Mul . To this end, four sequences of the rRNA operon of Mul were targeted using a primer-probe set previously described (7) and three newly designed primer-probe sets. The implementation of a single multiplexed ddPCR assay confirms the specificity of the different primer-probe sets. Although we used only two closely related mycobacteria ( Mtb and Msm ) as internal controls for specificity, our results support previous reports for the 16S rRNA Mul set (7). In silico alignment using NCBI BlastN predicted potential cross-amplification only with M. marinum due to high sequence identity in the rRNA operon region. Nevertheless, only lesions in early stages can appear similar, with clearly differential clinical signs and epidemiology. While our work is currently circumscribed to in vitro drug activity evaluations, testing against a panel of potential BU-relevant skin-coinfection species would be beneficial to provide a more comprehensive validation of the primers and probes in clinical samples. Additionally, we tested various combinations of precursor-to-total rRNA ratios using a multiplexed ddPCR assay, and we observed that the ETS1/23S rRNA pair demonstrated the highest dynamic range ( Figure 3 ). The observed variations in the dynamic range of the distinct pairs in response to various treatments could be hypothesized to be a consequence of both the direct impact on precursor rRNA transcription and the effect on precursor rRNA maturation pathways. A thorough investigation into the underlying causes of these differences in dynamic range is beyond the scope of this study. However, these findings underscore the importance of empirically exploring various precursor/total rRNA pairs to identify the most suitable one before implementing the RS-ratio biomarker for a new organism. A substantial reduction in the RS-ratio in Mul treated with RIF monotherapy was observed despite RIF being purposely added at half of its MIC for the corresponding strain (the study performed by Sáez et al. was designed to identify synergistic interactions among RIF, CLA, and AMX/CLV, not to test the full range of activity of the compounds alone). Nonetheless, this effect was not observed with CLA and AMX/CLV, which were also sub-dosed at their respective 1xMIC values. This observed behavior of the RS-ratio in response to different drugs could be explained by the mechanism of action of each drug. RIF, a cornerstone sterilizing drug in the treatment of Mtb and other mycobacterial infections, inhibits transcription by binding to the DNA-dependent RNA polymerase ß-subunit, encoded by the rpoB gene (8–10). In accordance with prior observations in Mtb (6,11), RIF reduced the RS-ratio of Mul , likely by directly inhibiting the transcription of precursor-rRNAs. Although there are no extant reports on the effect of CLA or AMX/CLV on the RS-ratio of Mtb , our findings are also consistent with documented observed effects of other drugs with a similar mechanism of action in Mtb . The macrolide CLA inhibits protein translation of bacterial mRNAs by binding to the 23S rRNA in the 50S subunit of the ribosome (12). As previously documented, pharmaceutical agents that target translation by binding to the ribosome, such as aminoglycosides (streptomycin) or oxazolidinones (linezolid) (6,11), cause a modest initial increase in Mtb RS-ratio, similar to our observations with CLA against Mul . This might represent a potential bacterial response to overcome the inhibition of ribosomal activity. AMX, a semisynthetic penicillin derivative from the ß-lactam family of antibiotics, exerts its antimicrobial effect by inhibiting bacterial cell wall synthesis, thereby preventing peptidoglycan cross-linking by transpeptidase proteins (13). However, its activity against mycobacteria is hindered due to the constitutive expression of BlaC (a ß-lactamase in mycobacteria), which is also present in Mul (14) . Nevertheless, this natural resistance mechanism can be counteracted by the co-administration of CLV, a ß-lactamase inhibitor (3,15). Our findings with AMX/CLV are consistent with previous reports showing that other cell wall synthesis inhibitors, such as isoniazid and ethambutol, have a minimal impact on reducing the RS-ratio of Mtb even at concentrations several times above their MIC, despite targeting different pathways in cell wall biosynthesis (6,11). Our data on the activity of the different combinations against Mul using the RS-ratio ( Figure 4 A ) support previous findings reported by Saez et al. (4). RIF+AMX/CLV-containing combinations induced the most pronounced reductions in RS-ratio and were also identified as the most potent regimens by other biomarkers ( Figure 4 B and C) . This observation is consistent with the notion that the RS-ratio functions as a more expeditious biomarker of sterilizing drug activity. As reported in Mtb (6), stronger reductions in the RS-ratio appear to correlate with enhanced sterilizing effects, a proxy for improved treatment outcomes even with shorter treatments. This finding is in accordance with the ongoing clinical trials aiming to shorten BU treatment from 8 weeks to 4 weeks by the inclusion of AMX/CLV to the WHO RIF+CLA recommended treatment (NCT05169554, PACTR202209521256638) (5,16). The experimental model employed for assessing the RS-ratio in Mul in this study has some limitations. In the context of the in vitro TKA samples used to implement the RS-ration in Mul (4), drugs were administered only at the onset of the experiment at sub-optimal concentrations, which implies that drug concentrations do not remain constant and stable throughout the duration of the experiment. In fact, this approach does not consider the dynamic drug exposure and varying half-lives of the compounds in the in vitro assay media, which are key considerations for drug effect in vivo . For instance, RIF has an in vitro half-life of approximately seven days, with about 75% degradation after 14 days of incubation in 7H9 medium at 37°C (17–19). A comparable or even shorter half-life (14.2 h) has been documented for CLA (17), while the half-life of AMX fluctuates extensively (from 27.4 h to 10 days) contingent on media conditions (20–23). Indeed, a slight recovery in the RS-ratio was observed after 10 days of incubation in the different RIF-containing treatments, including those containing AMX/CLV, even as bacterial burden levels continued to decline ( Figure 4 B and C) (4). This phenomenon may be attributed to the initial sub-optimal concentration of RIF (1/2X MIC) and the degradation of the compound over time, thereby limiting the efficacy of the drug and enabling bacterial metabolic recovery. In a preceding time-kill assay study on Mtb , even concentrations of RIF 20X MIC were unable to prevent bacterial regrowth at endpoint due to RIF degradation in the assay medium (19). A detailed comparison between conditions of RIF monotherapy and RIF-CLA combination reveals a faster recovery of the RS-ratio in the presence of CLA after day 10 (Figure 2A). This is in line with previous observations showing that monotherapy CLA administration results in a modest increase in the RS-ratio. With a similar drug stability in the assay medium, the observed accelerated recovery is likely due to the differential initial dose and a negative impact of CLA on the activity of RIF, allowing for the overcoming of the RS-ratio reducing effect of RIF when its concentrations decline over time. This increase in the RS-ratio anticipates a potential antagonistic effect observed after day 21 with other biomarkers; for example, luminescence from the RIF-CLA combination is reduced more slowly than that from RIF monotherapy ( Figure 4 C) (4). The addition of AMX/CLV to RIF-containing regimens led to the most significant reductions in the RS-ratio ( Figure 4 A) in line with observations with other biomarkers ( Figure 4 B and C) . In a previous study (19), the combination of RIF with beta-lactams and, in particular, first-generation cephalosporins demonstrated a capacity to prevent bacterial regrowth at endpoint, despite the substantial drug degradation of both compounds in the assay medium. At the time, no correlation was performed with the RS-ratio, but together with the present data, it provides the first insights into the sterilizing effect of RIF and beta-lactams (i.e., AMX/CLV) combinations against mycobacterial species. Although RS-ratio recovery patterns were observed in our analysis, the experimental design was only powered to identify synergistic interactions (i.e., drugs were evaluated at sub-optimal concentrations) and not to assess the full capacity of drugs alone or in combination, which would have required higher doses, such as in the above-mentioned study (19). Consequently, RS-ratio recovery patterns observed in this study suggest the existence of a residual bacterial subpopulation that survived the initial treatments. This sub-population could have potentially resumed metabolic activity once drug concentrations dropped below the effective levels, suggesting that culture regrowth might be expected if longer TKA times were provided. As such, the RS-ratio has the potential to function as an early monitoring biomarker, capable not only of ranking potential sterilizing drug combinations but also of detecting the early onset of metabolic bacterial reactivation and regrowth. Further investigations should be done to confirm whether the RS-ratio could also be used for detecting the presence of bacterial resistance or tolerance. Interestingly, even at sub-optimal concentrations, the combination of RIF+AMX/CLV was more effective than both drugs alone, supporting the synergistic interaction which correlates with the shortening potential of the novel regimen. While the administration of a single dose of suboptimal concentrations of different drugs is useful for the understanding of in vitro synergistic drug interactions against Mul , it does not accurately represent in vivo and clinical exposures needed for translational efforts. Optimal drug concentrations will yield enhanced reductions of the RS-ratio in Mul , in accordance with documented evidence of RIF dose-response effects against Mtb, both in vivo (6) and in vitro (11). Therefore, there is compelling rationale for implementing the RS-ratio analysis in in vivo models, when necessary, and in more complex in vitro models, such as the Hollow Fibre System (HFS), which provides dynamic measures of pharmacokinetic and pharmacodynamic relationships of antimicrobial treatments against a given pathogen. The HFS was endorsed by the European Medicines Agency for the study of Mtb drug treatments (24), and it is currently under further optimization (25). We have described for the first time the implementation of the RS-ratio biomarker for BU research, measuring bacterial metabolic activity and growth dynamics together with in vitro drug activity against Mul . These activities align with WHO-recommended key areas of development of rapid diagnostic tests for BU that can be used at the primary health care level (1). The RS-ratio offered novel insights into the impact of pharmaceutical agents on persistent bacterial activity, a capability that conventional gold standard methodologies of bacterial load quantification by CFU enumeration do not possess. In addition, research conducted with Mtb has demonstrated that a substantial decrease in the RS-ratio is associated with treatment-shortening properties of novel regimens, which our data support for the RIF-AMX/CLV-based combinations currently under evaluation in two clinical trials (https://blms4bu.org/) (NCT05169554, PACTR202209521256638). This finding suggests that the RS-ratio biomarker has the potential to inform the development of more efficacious and efficient regimens for the treatment of BU, TB, and even other infectious diseases. Furthermore, the results obtained clearly indicate the high potential of the RS-ratio as an in vitro biomarker, justifying further investigation into its prospective use as a novel biomarker in both animal models and clinical settings for the monitoring of BU treatment effectiveness. Abbreviations 16S 16S rRNA 23S 23S rRNA AMX Amoxicillin BU Buruli ulcer cDNA complementary DNA CFUs Colony-forming units CLA Clarithromycin CLV Clavulanate ddPCR droplet digital PCR ETS External transcribed spacer HFS Hollow Fibre system ITS Internal transcribed spacer MIC Minimum Inhibitory Concentration Msm Mycobacterium smegmatis Mtb Mycobacterium tuberculosis Mul Mycobacterium ulcerans NTD Neglected Tropical Diseases RIF Rifampicin rRNAs ribosomal RNAs RS-ratio ribosomal RNA synthesis ratio TB Tuberculosis TKA Time-kill assay Declarations ACKNOWLEDGMENTS We would like to acknowledge the technical staff of the CleanRooms of the Bioengineering facility core of Universidad Carlos III de Madrid, which housed our experimental activities. Use of AI statement. Language models from Google, Gemini, and DeepL Write were used for assistance with the harmonization of text and the correction of grammatical and stylistic errors in the preparation of this manuscript. Authors are solely responsible for the accurate content of this work. Funding : Innovative Medicines Initiatives 2 Joint Undertaking (JU) (grant 853989, https://era4tb.org/) to JJV, supported by the European Union’s Horizon 2020 Research and Innovation Program and EFPIA, and the Global Alliance for TB Drug Development Non-Profit Organization, Bill & Melinda Gates Foundation, University of Dundee. (http://www.imi.europa.eu); and the Tres Cantos Open Lab Foundation (grant TC281) to SRG. Funders did not play any role in the study design, data collection and analysis, decision to publish, or manuscript preparation. This work reflects only the author's views, and the JU is not responsible for any use that may be made of the information it contains. AUTHOR CONTRIBUTIONS Conceptualization : JCS, SFB, SGR, AML. Data curation : JCS. Formal analysi s: JCS, ESL. Funding and project administration : JJV, SRG. Investigation : JCS. Methodology : JCS. Supervision : SFB, AML. Visualization : JCS, ESL, PLE. Original draft writing : JCS. Writing – review & editing : All authors. References WHO. Buruli ulcer in Africa: 20 years of progress | WHO | Regional Office for Africa [Internet]. 2025 [cited 2025 Nov 24]. Available from: https://www.afro.who.int/publications/buruli-ulcer-africa-20-years-progress WHO. Ending the Neglect to Attain the Sustainable Development Goals : A Road Map for Neglected Tropical Diseases 2021-2030 [Internet]. World Health Organization; 2021 [cited 2025 Dec 9]. p. 196. Available from: https://www.who.int/publications/i/item/9789240010352 Arenaz-Callao MP, González del Río R, Lucía Quintana A, Thompson CJ, Mendoza-Losana A, Ramón-García S. Triple oral beta-lactam containing therapy for Buruli ulcer treatment shortening. Phillips RO, editor. PLoS Negl Trop Dis [Internet]. 2019 Jan 28 [cited 2025 May 5];13(1):e0007126. Available from: https://dx.plos.org/10.1371/journal.pntd.0007126 Sáez-López E, Millán-Placer AC, Lucía A, Ramóngarcía S. Amoxicillin/clavulanate in combination with rifampicin/clarithromycin is bactericidal against Mycobacterium ulcerans. PLoS Negl Trop Dis. 2024 Apr 1;18(4). Johnson RC, Sáez-López E, Anagonou ES, Kpoton GG, Ayelo AG, Gnimavo RS, et al. Comparison of 8 weeks standard treatment (rifampicin plus clarithromycin) vs. 4 weeks standard plus amoxicillin/clavulanate treatment [RC8 vs. RCA4] to shorten Buruli ulcer disease therapy (the BLMs4BU trial): study protocol for a randomized controlled multi-centre trial in Benin. Trials [Internet]. 2022 Jul 8 [cited 2022 Jul 19];23(1):559. Available from: http://www.ncbi.nlm.nih.gov/pubmed/35804454 Walter ND, Born SEMM, Robertson GT, Reichlen M, Dide-Agossou C, Ektnitphong VA, et al. Mycobacterium tuberculosis precursor rRNA as a measure of treatment-shortening activity of drugs and regimens. Nat Commun [Internet]. 2021 May 18;12(1):2899. Available from: http://dx.doi.org/10.1038/s41467-021-22833-6 Beissner M, Symank D, Phillips RO, Amoako YA, Awua-Boateng NY, Sarfo FS, et al. Detection of Viable Mycobacterium ulcerans in Clinical Samples by a Novel Combined 16S rRNA Reverse Transcriptase/IS2404 Real-Time qPCR Assay. Small PLC, editor. PLoS Negl Trop Dis [Internet]. 2012 Aug 28;6(8):e1756. Available from: https://dx.plos.org/10.1371/journal.pntd.0001756 Konno K, Oizumi K, Oka S. Mode of action of rifampin on mycobacteria. II. Biosynthetic studies on the inhibition of ribonucleic acid polymerase of Mycobacterium bovis BCG by rifampin and uptake of rifampin- 14 C by Mycobacterium phlei. Am Rev Respir Dis [Internet]. 1973 Jun;107(6):1006–12. Available from: http://www.atsjournals.org/doi/abs/10.1164/arrd.1973.107.6.1006 White RJ, Lancini GC, Silvestri LG. Mechanism of action of rifampin on Mycobacterium smegmatis. J Bacteriol. 1971;108(2):737–41. Honore N, Cole ST. Molecular basis of rifampin resistance in Mycobacterium leprae. Antimicrob Agents Chemother [Internet]. 1993 Mar;37(3):414–8. Available from: http://www.ncbi.nlm.nih.gov/pubmed/8460911 Reichlen MJ, Born SEM, Lyons MA, Rossmassler K, Reid J, Robertson GT, et al. Standardized RS Ratio Metrics To Assess Tuberculosis Antimicrobial Efficacy and Potency. Antimicrob Agents Chemother [Internet]. 2023 Jan 24 [cited 2025 Mar 11];67(1). Available from: https://journals.asm.org/doi/10.1128/aac.01483-22 Alvarez-Elcoro S, Enzler MJ. The Macrolides: Erythromycin, Clarithromycin, and Azithromycin. Mayo Clin Proc [Internet]. 1999 Jun 1 [cited 2025 Aug 22];74(6):613–34. Available from: https://www.sciencedirect.com/science/article/abs/pii/S0025619611641402 Castle SS. Amoxicillin. xPharm: The Comprehensive Pharmacology Reference [Internet]. 2007 Jan 1 [cited 2025 Aug 22];1–6. Available from: https://www.sciencedirect.com/science/article/abs/pii/B978008055232361222X Gupta SK, Drancourt M, Rolain JM. In silico prediction of antibiotic resistance in mycobacterium ulcerans AGY99 through whole genome sequence analysis. American Journal of Tropical Medicine and Hygiene [Internet]. 2017 [cited 2025 Aug 22];97(3):810–4. Available from: https://pmc.ncbi.nlm.nih.gov/articles/PMC5590560/ Ramón-García S, González del Río R, Arenaz-Callao MP, Boshoff HI, Rullas J, Anca S, et al. Sanfetrinem, an oral β-lactam antibiotic repurposed for the treatment of tuberculosis. Drug Resistance Updates [Internet]. 2025 May 1 [cited 2025 Aug 22];80. Available from: https://pubmed.ncbi.nlm.nih.gov/40020440/ BLMs4BU Project | Reducing Treatment of Buruli Ulcer [Internet]. [cited 2025 May 6]. Available from: https://blms4bu.org/ Schoutrop ELM, Brouwer MAE, Jenniskens JCA, Ferro BE, Mouton JW, Aarnoutse RE, et al. The stability of antimycobacterial drugs in media used for drug susceptibility testing. Diagn Microbiol Infect Dis. 2018 Dec;92(4):305–8. Yu X, Jiang G, Li H, Zhao Y, Zhang H, Zhao L, et al. Rifampin Stability in 7H9 Broth and Löwenstein-Jensen Medium. J Clin Microbiol. 2011 Mar;49(3):784–9. Ramón-García S, González Del Río R, Villarejo AS, Sweet GD, Cunningham F, Barros D, et al. Repurposing clinically approved cephalosporins for tuberculosis therapy. Sci Rep. 2016 Sep 28;6:34293. Samara E, Moriarty TF, Decosterd LA, Richards RG, Gautier E, Wahl P. Antibiotic stability over six weeks in aqueous solution at body temperature with and without heat treatment that mimics the curing of bone cement. Bone Joint Res. 2017 May;6(5):296–306. Erah P. The stability of amoxycillin, clarithromycin and metronidazole in gastric juice: relevance to the treatment of Helicobacter pylori infection. Journal of Antimicrobial Chemotherapy. 1997 Jan 1;39(1):5–12. Moore TD, Horton R, Utrup LJ, Miller LA, Poupard JA. Stability of amoxicillin-clavulanate in BACTEC medium determined by high-performance liquid chromatography and bioassay. J Clin Microbiol. 1996 May;34(5):1321–2. Lallemand EA, Lacroix MZ, Toutain PL, Boullier S, Ferran AA, Bousquet-Melou A. In vitro Degradation of Antimicrobials during Use of Broth Microdilution Method Can Increase the Measured Minimal Inhibitory and Minimal Bactericidal Concentrations. Front Microbiol. 2016 Dec 21;7. Cavaleri M, Manolis E. Hollow fiber system model for tuberculosis: The European Medicines Agency experience. Clinical Infectious Diseases. 2015;61:S1–4. Aguilar-Ayala DA, Sanz-García F, Rabodoarivelo MS, Susanto BO, Bailo R, Eveque-Mourroux MR, et al. Evaluation of critical parameters in the hollow-fibre system for tuberculosis: A case study of moxifloxacin. Br J Clin Pharmacol [Internet]. 2024 Jul 1 [cited 2025 Aug 22];90(7):1711–27. Available from: /doi/pdf/10.1111/bcp.16068 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 30 Dec, 2025 Reviews received at journal 29 Dec, 2025 Reviews received at journal 27 Dec, 2025 Reviewers agreed at journal 18 Dec, 2025 Reviewers agreed at journal 16 Dec, 2025 Reviewers invited by journal 16 Dec, 2025 Editor assigned by journal 12 Dec, 2025 Submission checks completed at journal 12 Dec, 2025 First submitted to journal 11 Dec, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8335436","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Short Report","associatedPublications":[],"authors":[{"id":562513543,"identity":"e78453c2-911d-4819-8ac1-0b1dd62ee622","order_by":0,"name":"Juan Calvet-Seral","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA5UlEQVRIie2OMQ6CMBSGS5qUpe4kErhCicdxwUUWmjA6dOgEC9G1JF7CG0BIysLgEXByccDdGEswuhVGE/st73/J+9ofAIPhB7E4sEo1PTTubJYClEJWb0XO+2lQNnzMcPocZnVX490j2i+zM8QMrYGddfpi+ZbUuCU0ddsEYulSrja9IgCpilQpThzCBUeUO7G+mCXsviqeJEKjAin3rxPFBCblnZMQOVE5Kg6YKJbHSdnLVaCKgeooJU1xrFeCrDl1IfN8X0SX7sYYPdiNvljAP1E1HAbS3iv8b7T1jxsMBsP/8gJQTkXAR/6wJwAAAABJRU5ErkJggg==","orcid":"","institution":"Universidad Carlos III de Madrid","correspondingAuthor":true,"prefix":"","firstName":"Juan","middleName":"","lastName":"Calvet-Seral","suffix":""},{"id":562513545,"identity":"251c02e4-0f1b-4070-b19b-a78969d45730","order_by":1,"name":"Emma Sáez-López","email":"","orcid":"","institution":"University of Zaragoza","correspondingAuthor":false,"prefix":"","firstName":"Emma","middleName":"","lastName":"Sáez-López","suffix":""},{"id":562513546,"identity":"d2ba1617-923b-4910-86ad-e3365f89fd33","order_by":2,"name":"Patricio R. López-Expósito","email":"","orcid":"","institution":"Universidad Carlos III de Madrid","correspondingAuthor":false,"prefix":"","firstName":"Patricio","middleName":"R.","lastName":"López-Expósito","suffix":""},{"id":562513551,"identity":"3829cea2-ef8f-4d4e-a606-3be6125f28c1","order_by":3,"name":"Santiago Ferrer-Bazaga","email":"","orcid":"","institution":"Universidad Carlos III de Madrid","correspondingAuthor":false,"prefix":"","firstName":"Santiago","middleName":"","lastName":"Ferrer-Bazaga","suffix":""},{"id":562513553,"identity":"5fddf143-04f5-4b4e-8a9a-3794d05a4b76","order_by":4,"name":"Juan José Vaquero","email":"","orcid":"","institution":"Universidad Carlos III de Madrid","correspondingAuthor":false,"prefix":"","firstName":"Juan","middleName":"José","lastName":"Vaquero","suffix":""},{"id":562513556,"identity":"f54f4c71-6a11-40e3-a6af-22ba98463650","order_by":5,"name":"Santiago Ramón-García","email":"","orcid":"","institution":"University of Zaragoza","correspondingAuthor":false,"prefix":"","firstName":"Santiago","middleName":"","lastName":"Ramón-García","suffix":""},{"id":562513562,"identity":"17e7b8a8-d66d-4363-98e8-9c2efb02d323","order_by":6,"name":"Alfonso Mendoza-Losana","email":"","orcid":"","institution":"Universidad Carlos III de Madrid","correspondingAuthor":false,"prefix":"","firstName":"Alfonso","middleName":"","lastName":"Mendoza-Losana","suffix":""}],"badges":[],"createdAt":"2025-12-11 10:23:49","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8335436/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8335436/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":98585743,"identity":"04d6ca07-4c34-4762-8870-ab801db075bf","added_by":"auto","created_at":"2025-12-19 09:29:31","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3004286,"visible":true,"origin":"","legend":"","description":"","filename":"TheribosomalRNAsynthesisratiobiomarkerinMycobacteriumulceransfordrugactivityevaluationMaintextSubmission.docx","url":"https://assets-eu.researchsquare.com/files/rs-8335436/v1/40b12e6b62219542ad9daae2.docx"},{"id":98585739,"identity":"18d1a058-18c7-4c5e-a184-cb944e83bc52","added_by":"auto","created_at":"2025-12-19 09:29:31","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8511,"visible":true,"origin":"","legend":"","description":"","filename":"49e3ce57f486427fa7be5c21ec9b6b53.json","url":"https://assets-eu.researchsquare.com/files/rs-8335436/v1/ce6cd9f9b74ba7a39bd9239f.json"},{"id":98627934,"identity":"fd422ace-ff62-4845-9ff3-55e0e266447f","added_by":"auto","created_at":"2025-12-19 17:10:47","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":92672,"visible":true,"origin":"","legend":"","description":"","filename":"49e3ce57f486427fa7be5c21ec9b6b531enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8335436/v1/5a2eadef8cb39e6504eeb340.xml"},{"id":98627755,"identity":"150b8368-7843-44b7-9129-c5f02d5f2215","added_by":"auto","created_at":"2025-12-19 17:10:37","extension":"emf","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1393652,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.emf","url":"https://assets-eu.researchsquare.com/files/rs-8335436/v1/6958b8ee87a79180b16d6d76.emf"},{"id":98627987,"identity":"75ba5910-0dc3-4c42-9302-049fb877ade6","added_by":"auto","created_at":"2025-12-19 17:10:50","extension":"emf","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3859408,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.emf","url":"https://assets-eu.researchsquare.com/files/rs-8335436/v1/b6688c3c99f6577b6617b2d1.emf"},{"id":98627738,"identity":"133eb62f-3faf-41ef-90a3-342ba4a91e31","added_by":"auto","created_at":"2025-12-19 17:10:36","extension":"emf","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2011372,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.emf","url":"https://assets-eu.researchsquare.com/files/rs-8335436/v1/01cb897b34205ad1568fd50d.emf"},{"id":98628754,"identity":"4b67a8b2-d60d-4611-b0ef-de3f880ecd45","added_by":"auto","created_at":"2025-12-19 17:12:22","extension":"emf","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1756596,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.emf","url":"https://assets-eu.researchsquare.com/files/rs-8335436/v1/5cc2c6b7048577a4c9a0d3bd.emf"},{"id":98585749,"identity":"4a719454-bc12-4d53-9779-b259bd1b00c7","added_by":"auto","created_at":"2025-12-19 09:29:31","extension":"emf","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2885180,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.emf","url":"https://assets-eu.researchsquare.com/files/rs-8335436/v1/9fd8e3a95af3771cba50c0be.emf"},{"id":98627962,"identity":"97d8eba4-8faa-4221-a07a-e340efd44064","added_by":"auto","created_at":"2025-12-19 17:10:49","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":27102,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8335436/v1/5f9aa2363967f15fda788de9.png"},{"id":98585741,"identity":"8da2e21a-0f1d-4a9c-b3bb-24ee738b66ab","added_by":"auto","created_at":"2025-12-19 09:29:31","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":33894,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8335436/v1/b9a614bc50cb442a5294a29f.png"},{"id":98774962,"identity":"084cecbf-8997-456c-a68d-08708265e2eb","added_by":"auto","created_at":"2025-12-22 12:17:34","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":32914,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8335436/v1/da2b8666e0624c74b081532d.png"},{"id":98629123,"identity":"5b01163e-3c98-44d2-9e9f-2f8e94c94cad","added_by":"auto","created_at":"2025-12-19 17:13:17","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":26020,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8335436/v1/f7842ab8a8e5f27945c90749.png"},{"id":98585745,"identity":"19dbf088-6f4b-4fa9-9c81-e29f0686f2b7","added_by":"auto","created_at":"2025-12-19 09:29:31","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":36653,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8335436/v1/c7818215b5f8b4674f76810f.png"},{"id":98585752,"identity":"754bafad-024b-4cd2-b743-248f42b9e5df","added_by":"auto","created_at":"2025-12-19 09:29:31","extension":"xml","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":93809,"visible":true,"origin":"","legend":"","description":"","filename":"49e3ce57f486427fa7be5c21ec9b6b531structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8335436/v1/08f9cb591ab82f3840425742.xml"},{"id":98585755,"identity":"98e5e32c-8315-4ee4-a481-07ca191c416a","added_by":"auto","created_at":"2025-12-19 09:29:31","extension":"html","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":105241,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8335436/v1/1f9da306b233e37f8f5d609c.html"},{"id":98585734,"identity":"4714eccc-0aed-4d03-a06c-3246adb25763","added_by":"auto","created_at":"2025-12-19 09:29:30","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":78167,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Localization and \u003cstrong\u003e(B)\u003c/strong\u003e Specific alignments compared with\u003cem\u003e Mtb \u003c/em\u003eand \u003cem\u003eMsm\u003c/em\u003e rRNA operons of the \u003cstrong\u003eI)\u003c/strong\u003e 16S, \u003cstrong\u003eII)\u003c/strong\u003e23S, \u003cstrong\u003eIII)\u003c/strong\u003e ETS1, and \u003cstrong\u003eIV) \u003c/strong\u003eITS1 primers-probe sets synthesized to calculate the RS-ratio in \u003cem\u003eMul\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8335436/v1/4b6a0e69c3397e1274e93397.jpg"},{"id":98585736,"identity":"3a49ae7e-f238-43dd-8cb3-097e7367fac6","added_by":"auto","created_at":"2025-12-19 09:29:30","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":85755,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMultiplexed \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eMul\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eddPCR.\u003c/strong\u003e \u003cstrong\u003e(A)\u003c/strong\u003e \u003cem\u003eMul \u003c/em\u003eddPCR is species-specific. Quadruple positive droplets were obtained with high concentrations of \u003cem\u003eMul\u003c/em\u003e cDNA, whereas quadruple negative droplets were obtained with cDNA from\u003cem\u003e Mtb \u003c/em\u003eor \u003cem\u003eMsm\u003c/em\u003e.\u003cstrong\u003e(B)\u003c/strong\u003e \u003cem\u003eMul\u003c/em\u003e cDNA samples need to be diluted to allow target quantification. Several 10-fold dilutions of the \u003cem\u003eMul\u003c/em\u003ecDNA were required to obtain different positive and negative droplet populations, allowing for the quantification of the different targets.\u003c/p\u003e","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8335436/v1/948e89079dc53ba5184ae39b.jpg"},{"id":98585735,"identity":"648e0e0e-0ad9-4f9f-be02-1e48914d82d7","added_by":"auto","created_at":"2025-12-19 09:29:30","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":85049,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eComparison of four diverse RS-ratio determinations in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eM. ulcerans\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e exposed to rifampicin, clarithromycin, and amoxicillin/clavulanate combinations\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e.\u003c/strong\u003e\u003c/em\u003e Comparison of the diverse RS-ratio determinations using the different possible pairs of targets ETS1/23S, ITS1/23S, ETS1/16S, and ITS1/16S in \u003cem\u003eMul\u003c/em\u003e samples. Values were calculated as: copies of ETS1 or ITS1 divided by copies of 23S or 16S and multiplied by 10\u003csup\u003e4\u003c/sup\u003e. RIF was used at 0.025 µg/mL (1/2X MIC), CLA at 0.0625 µg/mL (1X MIC), and AMX at 0.125 µg/mL (1X MIC in the presence of CLV). CLV was added at a fixed 5 µg/mL concentration. RS-ratio values represent the mean of two or three measures with different cDNA dilutions. Error bars indicate the standard deviation. RIF, rifampicin; CLA, clarithromycin; AMX/CLV, amoxicillin/clavulanate.\u003c/p\u003e","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8335436/v1/604baf162267e86447bf45d9.jpg"},{"id":98627477,"identity":"0fc91e9c-4a6f-4e11-9eb9-5756084b41f6","added_by":"auto","created_at":"2025-12-19 17:10:23","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":54409,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eIn vitro \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eRS-ratio kinetics of rifampicin, clarithromycin, and amoxicillin/clavulanate combinations against \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eM. ulcerans \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ein different biomarkers\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e.\u003c/strong\u003e\u003c/em\u003e The activity of different drugs alone, in pair-wise and triple combination, was evaluated in time-kill assays against the \u003cem\u003eMul\u003c/em\u003e ITM 000932 isolate by \u003cstrong\u003e(A) \u003c/strong\u003eRS-ratio (ETS1/23S, copies of ETS1 divided by copies of 23S and multiplied by 10\u003csup\u003e4\u003c/sup\u003e), and compared with the biomarkers previously published by Sáez et al. (4), like \u003cstrong\u003e(B)\u003c/strong\u003e colony-forming units, and \u003cstrong\u003e(C)\u003c/strong\u003e luminescence units. RIF was used at 0.025 µg/mL (1/2X MIC), CLA at 0.0625 µg/mL (1X MIC), and AMX at 0.125 µg/mL (1X MIC in the presence of CLV). CLV was added at a fixed 5 µg/mL concentration. RS-ratio values represent the mean of two or three measures with different cDNA dilutions. Error bars indicate the standard deviation. Untr, untreated growth control, RIF, rifampicin; CLA, clarithromycin; AMX/CLV, amoxicillin/clavulanate; CFU, Colony Forming Units; RLU, Relative Light Units\u003c/p\u003e","description":"","filename":"4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8335436/v1/15a8638f4e615e7e20fe3d5d.jpg"},{"id":98782707,"identity":"ddff8942-88a4-4f2e-8b3c-8ae6879bfbbd","added_by":"auto","created_at":"2025-12-22 12:40:45","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1251700,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8335436/v1/75d73afb-f4c3-4af7-889d-7a07d6527b20.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"The ribosomal RNA synthesis ratio biomarker in Mycobacterium ulcerans for drug activity evaluation","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003e \u003cem\u003eMycobacterium ulcerans\u003c/em\u003e (\u003cem\u003eMul\u003c/em\u003e) is the causative agent of Buruli ulcer (BU), a debilitating skin-neglected tropical disease (NTD) that predominantly affects communities in rural areas with limited access to healthcare services. Despite its low mortality rate, BU can lead to significant morbidity due to the destruction of skin, soft tissues, and even bones. In the absence of early treatment, this may result in irreversible disfigurement and disability with high socio-economic burden and stigma. BU cases have been reported in 33 countries, with over 80% of global cases in the African Region, where nearly 50% of the affected individuals are children under the age of 15 (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). The current WHO-recommended antibiotic treatment involves an 8-week daily regimen of rifampicin (RIF) and clarithromycin (CLA). Treatment also includes extensive wound care, sometimes surgical intervention, and physiotherapy rehabilitation of movement limitations and disability, with lesion healing potentially lasting for several months. Treatment compliance can be difficult due to socioeconomic factors. A shortened and highly effective regimen would improve the care of BU patients and result in cost reduction. Consequently, the WHO requires evaluating promising medicines to provide new treatment options, including shortening the duration of treatment, as outlined in the WHO NTD Road Map 2021\u0026ndash;2030 (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn this context, using a drug repurposing approach, Arenaz \u003cem\u003eet a\u003c/em\u003el. (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e) investigated the \u003cem\u003ein vitro\u003c/em\u003e effects of combining various β-lactam antibiotics with RIF and/or CLA. By utilizing checkerboard assays, they demonstrated a strong synergistic effect of amoxicillin/clavulanate (AMX/CLV) with RIF, evidenced by a substantial reduction in the Minimum Inhibitory Concentration (MIC) of RIF and CLA at a fixed time point; these promising findings were subsequently corroborated by \u003cem\u003ein vitro\u003c/em\u003e time-kill assays (TKA) (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e), which paved the way for the BLMs4BU clinical trial currently underway in several African countries (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://blms4bu.org/\u003c/span\u003e\u003cspan address=\"https://blms4bu.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) (NCT05169554, PACTR202209521256638) (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). In addition, Saez \u003cem\u003eet al\u003c/em\u003e. (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e) conducted a comparative analysis of different \u003cem\u003ein vitro\u003c/em\u003e readout measurements; this analysis demonstrated the value of a wide variety of biomarkers in BU research, correlating colony-forming units (CFUs) (the \u003cem\u003ein vitro\u003c/em\u003e gold standard method for quantifying bacterial load) with optical density at 600 nm, luminescence production, quantification of the IS\u003cem\u003e2404\u003c/em\u003e DNA by quantitative PCR (qPCR), and the 16S rRNA burden by reverse transcriptase qPCR (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). This comparison was motivated by the arduous nature of CFU determination for \u003cem\u003eMul\u003c/em\u003e, which necessitates manipulation in biosafety level 3 laboratories and is hampered by the bacterium's slow growth rate on agar, often requiring from one to three months for visible colonies to appear. Furthermore, the study identified 16S rRNA burden quantification and luminescence measurements as having the strongest correlation between them, and a satisfactory correlation with CFU determination, with luminescence being the most cost-effective method. However, beyond conventional phenotypic metrics such as CFU quantification, there is an emerging consensus on the translational significance of evaluating the molecular metabolic state of bacteria as a proxy for the sterilizing activity of drug regimens. Sterilizing drugs, which can eradicate all viable bacterial organisms, are imperative for achieving effective shortening treatment regimens.\u003c/p\u003e \u003cp\u003eRibosomal RNA (rRNA) constitutes a major component of the ribosome, comprising 80\u0026ndash;85% of the total RNA present in cells. Its synthesis is subject to stringent regulation as it is a critical rate-limiting step for ribosome biogenesis and, consequently, protein synthesis and cell growth. The ribosomal RNA synthesis ratio (RS-ratio) has recently been described as a novel pharmacodynamic marker used to assess the effectiveness of drugs against \u003cem\u003eMycobacterium tuberculosis\u003c/em\u003e (\u003cem\u003eMtb\u003c/em\u003e) (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e), which belongs to the same genus as \u003cem\u003eMul\u003c/em\u003e. The RS-ratio is a molecular assay that quantifies the abundance of a rapidly processed spacer region present in the precursor polycistronic rRNA (immature) relative to the stable final rRNA (mature) sequences. The ratio between these two types of rRNA (immature \u003cem\u003evs.\u003c/em\u003e mature) provides a measure of how actively the bacteria are synthesizing new ribosomes, which is a proxy for their physiological activity and replication rate. This provides different information than conventional markers, such as CFU or rRNA burden by 16S rRNA quantification.\u003c/p\u003e \u003cp\u003eThe RS-ratio is highly sensitive to the effect of sterilizing drugs, being a promising biomarker for the evaluation of the sterilizing activity of new regimens. In fact, pronounced and sustained reduction in the RS-ratio correlates with improved treatment outcomes and reduced relapse rates in murine models of tuberculosis (TB) (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). However, despite its potential, the application of the RS-ratio as a tool for drug activity evaluation has primarily focused on \u003cem\u003eMtb\u003c/em\u003e, with limited exploration in other mycobacterial species, as evidenced by the lack of reports in the case of \u003cem\u003eMul\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eIn this study, we describe for the first time the \u003cem\u003ein vitro\u003c/em\u003e development and application of the RS-ratio biomarker to \u003cem\u003eMul\u003c/em\u003e to evaluate the \u003cem\u003ein vitro\u003c/em\u003e activity of RIF, CLA, and AMX/CLV and their combinations, currently under clinical investigation for BU treatment shortening. The results underpin the benefits of the RS-ratio as an \u003cem\u003ein vitro\u003c/em\u003e biomarker and point to its relevance for future use at the clinical level.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cp\u003e \u003cb\u003eGenetic material.\u003c/b\u003e RNA from the clinical \u003cem\u003eMul\u003c/em\u003e isolate ITM 000932 was obtained from previous extractions of TKA experiments described by Saez \u003cem\u003eet al.\u003c/em\u003e (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). RNA extracts from the \u003cem\u003eMtb\u003c/em\u003e H37Ra and \u003cem\u003eMycobacterium smegmatis\u003c/em\u003e (\u003cem\u003eMsm\u003c/em\u003e) mc\u003csup\u003e2\u003c/sup\u003e155 strains were used to test amplicon design specificities. Complementary DNA (cDNA) was synthesised using the SuperScript IV VILO Master Mix (Invitrogen) in a 10 \u0026micro;L reaction volume, using 5 \u0026micro;L of RNA as template. Reverse transcription conditions were 25\u0026deg;C for 10 minutes, followed by 50\u0026deg;C for 15 minutes.\u003c/p\u003e \u003cp\u003e \u003cb\u003eOligonucleotide Design for\u003c/b\u003e \u003cb\u003eM. ulcerans\u003c/b\u003e \u003cb\u003erRNA Targets.\u003c/b\u003e Primers-probe sets for the quantification of the external transcribed spacer 1 (ETS1), internal transcribed spacer 1 (ITS1), and 23S rRNA of \u003cem\u003eMul\u003c/em\u003e were designed to target homologous regions to those used for RS-ratio calculations in \u003cem\u003eMtb\u003c/em\u003e (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). These sequences were designed, ensuring species specificity, aligning \u003cem\u003eMul\u003c/em\u003e, \u003cem\u003eMtb\u003c/em\u003e and \u003cem\u003eMsm\u003c/em\u003e rRNA operon regions using SnapGene v8.0.3 software. To ensure high specificity and prevent cross-amplification, at least one oligonucleotide within each primer and probe set was designed to not align with the rRNA operons from published sequences of \u003cem\u003eMtb\u003c/em\u003e (NCBI accession number NC_018143) and \u003cem\u003eMsm\u003c/em\u003e (NCBI accession number NC_008596) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Specificity was confirmed using NCBI Nucleotide BLAST. Additionally, we used the primers-probe sequences for detecting the \u003cem\u003eMul\u003c/em\u003e 16S rRNA previously published (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e), which already met the specificity criterion (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB\u003cb\u003eI\u003c/b\u003e). Fluorophore probes were selected to allow differential detection in the QX600 system (Bio-Rad) channels: Channel 1 for ETS1, Channel 2 for 23S rRNA, Channel 3 for 16S rRNA, and Channel 5 for ITS1. BioRad synthesized the ETS1, 23S, and 16S primers-probe sets, and the ITS1 primers-probe set was synthesized by CerTest S.L. (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers and probes used to calculate the RS-ratio for \u003cem\u003eM. ulcerans\u003c/em\u003e.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eTarget\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e5\u0026acute;mod\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3' mod\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eReference\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eETS1 \u003cem\u003eMul\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFw\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGTTTTTTTAGATGCCAGTTGATTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eThis Work\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eProbe\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCAGAGATACCTGACAAGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFAM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eIowa Black\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRv\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCGATAACGAGGTGAATTCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e23S rRNA \u003cem\u003eMul\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFw\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCAGCGAAAGCGAGTCTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eThis Work\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eProbe\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTAGGGCGTATCCCCGTTAGGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eHEX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eIowa Black\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRv\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGGTCCAGAACATGCCACTAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e16S rRNA \u003cem\u003eMul\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFw\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGATCTGCCCTGCACTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eBeissner \u003cem\u003eet al\u003c/em\u003e. 2012 (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eProbe\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACAGGACATGAATCCCGTGGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCy5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eIowa Black\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRv\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCACACCGCAAAAGCTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eITS \u003cem\u003eMul\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFw\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGTGTGGTGTTTGAGAATTGGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eThis Work\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eProbe\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAATTGATGCTCGCAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eROX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eBHQ2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRv\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCACCAAAAGGCAGCGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eDroplet digital PCR and RS-ratio determination for\u003c/b\u003e \u003cb\u003eM. ulcerans.\u003c/b\u003e Primers and probe sets for droplet digital PCR (ddPCR) quantification were used in a single multiplexed reaction at Bio-Rad's recommended concentrations (900 nM for primers and 250 nM for probes) with ddPCR SuperMix for Probes (no dUTP) (Bio-Rad). Thermocycling conditions included an initial denaturation step at 95\u0026deg;C for 10 minutes, followed by 40 cycles of denaturation at 96\u0026deg;C for 30 seconds and annealing/extension at 60\u0026deg;C for 90 seconds. A signal stabilization step was performed at 98\u0026deg;C for 10 minutes, followed by a final hold at 4\u0026deg;C for at least 30 minutes before droplet reading and quantification in the QX600 system. The temperature ramp rate was set at 2\u0026deg;C/s for all steps. The number of copies for each target was determined from the partitioned droplets using the QuantaSoft v2.1 software (Bio-Rad). The RS-ratio was calculated as the ratio of the copy number of the precursor rRNA (ETS1 or ITS1) to the copy number of the total rRNA (23S or 16S), multiplied by 10\u003csup\u003e4\u003c/sup\u003e, as previously described (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e"},{"header":"RESULTS","content":"\u003cp\u003e \u003cb\u003eValidation of specificity and ddPCR optimization for\u003c/b\u003e \u003cb\u003eM. ulcerans\u003c/b\u003e \u003cb\u003eRS-ratio determination.\u003c/b\u003e To experimentally confirm their specificity, the newly synthesized oligonucleotide sets were subjected to a series of tests using a multiplexed ddPCR reaction with cDNA extracts from \u003cem\u003eMul\u003c/em\u003e, \u003cem\u003eMtb\u003c/em\u003e, and \u003cem\u003eMsm\u003c/em\u003e. The \u003cem\u003eMul\u003c/em\u003e cDNA sample saturated the quantification when undiluted, resulting in 100% positive droplets for all four targets (ETS1, ITS1, 23S rRNA, and 16S rRNA). Crucially, no positive droplets were obtained from the cDNA samples of \u003cem\u003eMtb\u003c/em\u003e and \u003cem\u003eMsm\u003c/em\u003e, thus confirming the high specificity of the designed probes and primers for \u003cem\u003eMul\u003c/em\u003e targets (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe RS-ratio was determined for the \u003cem\u003eMul\u003c/em\u003e ITM 000932 isolate longitudinally exposed to RIF, CLA, and AMX/CLV at 1/2X, 1X, and 1X MIC values, respectively, both in monotherapy and in two- and three-way combinations (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). To ensure accurate quantification and prevent saturation of the ddPCR reaction, each cDNA extract from the \u003cem\u003eMul\u003c/em\u003e TKA samples (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e) was optimized for specific dilution, allowing for quantifiable droplet numbers for all four targets (ETS1, ITS1, 23S rRNA, and 16S rRNA) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003cb\u003eEvaluation of dynamic range and selection of the optimal precursor/total rRNA pair.\u003c/b\u003e Four distinct RS-ratios were compared employing combinations of a single precursor rRNA (ETS1 or ITS1) and total rRNA (23S or 16S) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). All pairs demonstrated comparable trends across groups. In the conditions where the RS-ratio barely changed over time, such as untreated control, CLA, and AMX/CLV, the different pairs tested (ETS1/23S, ITS1/23S, ETS1/16S, and ITS1/16S) mostly overlapped; however, different dynamic ranges were observed in the conditions in which drug combinations induced a reduction of the RS-ratio. Here, ITS1/16S and ITS1/23S pairs had the lower change, while ETS1/23S and ETS1/16S pairs showed higher change, having the strongest dynamic range the ETS1/23S pair. Thus, the ETS1/23S pair was selected for further comparisons with other biomarkers (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eRS-ratio kinetics reveal differential metabolic responses of\u003c/b\u003e \u003cb\u003eM. ulcerans\u003c/b\u003e \u003cb\u003eto RIF, CLA, and AMX/CLV combinations.\u003c/b\u003e The untreated \u003cem\u003eMul\u003c/em\u003e growth control exhibited an elevated RS-ratio (\u0026asymp;\u0026thinsp;2000) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, black circles), which underwent a slight decrease when the culture reached the stationary growth phase (\u0026asymp;\u0026thinsp;900\u0026ndash;1500 at day 7) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB, black circles). Exposure to RIF monotherapy resulted in a substantial reduction in the RS-ratio (\u0026asymp;\u0026thinsp;200) after 7 days of incubation, with a slight recovery at relatively low levels (\u0026asymp;\u0026thinsp;400) until the end of the 28-day assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, purple circles). Conversely, CLA monotherapy led to a marginal increasing effect (\u0026asymp;\u0026thinsp;3000) on the RS-ratio (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, orange circles), while AMX/CLV did not significantly affect the RS-ratio (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, grey circles). The combination of CLA\u0026thinsp;+\u0026thinsp;AMX/CLV led to an increasing effect in the RS-ratio levels (\u0026asymp;\u0026thinsp;4000) at day 3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, red circles) that dropped close to levels of the untreated growth control after day 7. On the contrary, RIF-containing combos consistently induced a decrease in the RS-ratio, though the intensity and kinetics of this effect appear to be dependent upon the accompanying drug. The RIF\u0026thinsp;+\u0026thinsp;CLA combo reduced the RS-ratio to levels comparable to those attained with RIF monotherapy (\u0026asymp;\u0026thinsp;250) at days 7 and 10 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, yellow circles). However, after day 14 of incubation, the RS-ratio of \u003cem\u003eMul\u003c/em\u003e treated with RIF\u0026thinsp;+\u0026thinsp;CLA showed a recovery to similar levels to the untreated control (\u0026asymp;\u0026thinsp;700\u0026ndash;900) that was stronger and faster than the slight increase observed in \u003cem\u003eMul\u003c/em\u003e treated with RIF monotherapy. In contrast, both the RIF\u0026thinsp;+\u0026thinsp;AMX/CLV combination and the triple combination (RIF\u0026thinsp;+\u0026thinsp;CLA\u0026thinsp;+\u0026thinsp;AMX/CLV) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, green and blue circles, respectively) induced the fastest and most potent decreases of the RS-ratio of the conditions tested. A visible reduction (\u0026asymp;\u0026thinsp;200) was already evident at day 3, reaching the maximal inhibition (\u0026asymp;\u0026thinsp;50\u0026ndash;60) between days 7 and 10. After day 14, the RS-ratio began to recover (\u0026asymp;\u0026thinsp;400), but the levels of the untreated sample were not reached even at day 28. Importantly, this recovery was not identified by CFUs or luminescence biomarkers \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB \u003cb\u003eand C)\u003c/b\u003e.\u003c/p\u003e"},{"header":"DISCUSION","content":"\u003cp\u003eThis study has investigated for the first time the implementation of the RS-ratio biomarker to assess the \u003cem\u003ein vitro\u0026nbsp;\u003c/em\u003eactivity of drugs against \u003cem\u003eMul\u003c/em\u003e. To this end, four sequences of the rRNA operon of \u003cem\u003eMul\u0026nbsp;\u003c/em\u003ewere targeted using a primer-probe set previously described (7) and three newly designed primer-probe sets. The implementation of a single multiplexed ddPCR assay confirms the specificity of the different primer-probe sets. Although we used only two closely related mycobacteria (\u003cem\u003eMtb\u003c/em\u003e and \u003cem\u003eMsm\u003c/em\u003e) as internal controls for specificity, our results support previous reports for the 16S rRNA \u003cem\u003eMul\u003c/em\u003e set (7). \u003cem\u003eIn silico\u003c/em\u003e alignment using NCBI BlastN predicted potential cross-amplification only with \u003cem\u003eM. marinum\u003c/em\u003e due to high sequence identity in the rRNA operon region. Nevertheless, only lesions in early stages can appear similar, with clearly differential clinical signs and epidemiology. While our work is currently circumscribed to \u003cem\u003ein vitro\u0026nbsp;\u003c/em\u003edrug activity evaluations, testing against a panel of potential BU-relevant skin-coinfection species would be beneficial to provide a more comprehensive validation of the primers and probes in clinical samples.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAdditionally, we tested various combinations of precursor-to-total rRNA ratios using a multiplexed ddPCR assay, and we observed that the ETS1/23S rRNA pair demonstrated the highest dynamic range (\u003cstrong\u003eFigure 3\u003c/strong\u003e). The observed variations in the dynamic range of the distinct pairs in response to various treatments could be hypothesized to be a consequence of both the direct impact on precursor rRNA transcription and the effect on precursor rRNA maturation pathways. A thorough investigation into the underlying causes of these differences in dynamic range is beyond the scope of this study. However, these findings underscore the importance of empirically exploring various precursor/total rRNA pairs to identify the most suitable one before implementing the RS-ratio biomarker for a new organism.\u003c/p\u003e\n\u003cp\u003eA substantial reduction in the RS-ratio in \u003cem\u003eMul\u0026nbsp;\u003c/em\u003etreated with RIF monotherapy was observed despite RIF being purposely added at half of its MIC for the corresponding strain (the study performed by Sáez \u003cem\u003eet al.\u003c/em\u003e was designed to identify synergistic interactions among RIF, CLA, and AMX/CLV, not to test the full range of activity of the compounds alone). Nonetheless, this effect was not observed with CLA and AMX/CLV, which were also sub-dosed at their respective 1xMIC values. This observed behavior of the RS-ratio in response to different drugs could be explained by the mechanism of action of each drug. RIF, a cornerstone sterilizing drug in the treatment of\u003cem\u003e\u0026nbsp;Mtb\u0026nbsp;\u003c/em\u003eand other mycobacterial infections, inhibits transcription by binding to the DNA-dependent RNA polymerase ß-subunit, encoded by the \u003cem\u003erpoB\u003c/em\u003e gene (8–10). In accordance with prior observations in\u003cem\u003e\u0026nbsp;Mtb\u0026nbsp;\u003c/em\u003e(6,11), RIF reduced the RS-ratio of \u003cem\u003eMul\u003c/em\u003e, likely by directly inhibiting the transcription of precursor-rRNAs. Although there are no extant reports on the effect of CLA or AMX/CLV on the RS-ratio of \u003cem\u003eMtb\u003c/em\u003e, our findings are also consistent with documented observed effects of other drugs with a similar mechanism of action in \u003cem\u003eMtb\u003c/em\u003e. The macrolide CLA inhibits protein translation of bacterial mRNAs by binding to the 23S rRNA in the 50S subunit of the ribosome (12). As previously documented, pharmaceutical agents that target translation by binding to the ribosome, such as aminoglycosides (streptomycin) or oxazolidinones (linezolid)\u0026nbsp;(6,11), cause a modest initial increase in \u003cem\u003eMtb\u003c/em\u003e RS-ratio, similar to our observations with CLA against \u003cem\u003eMul\u003c/em\u003e. This might represent a potential bacterial response to overcome the inhibition of ribosomal activity.\u0026nbsp;AMX, a semisynthetic penicillin derivative from the ß-lactam family of antibiotics, exerts its antimicrobial effect by inhibiting bacterial cell wall synthesis, thereby preventing peptidoglycan cross-linking by transpeptidase proteins (13). However, its activity against mycobacteria is hindered due to the constitutive expression of BlaC (a ß-lactamase in mycobacteria), which is also present in \u003cem\u003eMul (14)\u003c/em\u003e. Nevertheless, this natural resistance mechanism can be counteracted by the co-administration of CLV, a ß-lactamase inhibitor (3,15). Our findings with AMX/CLV are consistent with previous reports showing that other cell wall synthesis inhibitors, such as isoniazid and ethambutol, have a minimal impact on reducing the RS-ratio of \u003cem\u003eMtb\u003c/em\u003e even at concentrations several times above their MIC, despite targeting different pathways in cell wall biosynthesis (6,11).\u003c/p\u003e\n\u003cp\u003eOur data on the activity of the different combinations against \u003cem\u003eMul\u003c/em\u003e using the RS-ratio (\u003cstrong\u003eFigure 4\u003c/strong\u003e\u003cstrong\u003eA\u003c/strong\u003e) support previous findings reported by Saez \u003cem\u003eet al.\u003c/em\u003e (4). RIF+AMX/CLV-containing combinations induced the most pronounced reductions in RS-ratio and were also identified as the most potent regimens by other biomarkers \u003cstrong\u003e(\u003c/strong\u003e\u003cstrong\u003eFigure 4\u003c/strong\u003e\u003cstrong\u003eB and C)\u003c/strong\u003e. This observation is consistent with the notion that the RS-ratio functions as a more expeditious biomarker of sterilizing drug activity. As reported in\u003cem\u003e\u0026nbsp;Mtb\u0026nbsp;\u003c/em\u003e(6), stronger reductions in the RS-ratio appear to correlate with enhanced sterilizing effects, a proxy for improved treatment outcomes even with shorter treatments. This finding is in accordance with the ongoing clinical trials aiming to shorten BU treatment from 8 weeks to 4 weeks by the inclusion of AMX/CLV to the WHO RIF+CLA recommended treatment (NCT05169554, PACTR202209521256638) (5,16).\u003c/p\u003e\n\u003cp\u003eThe experimental model employed for assessing the RS-ratio in \u003cem\u003eMul\u003c/em\u003e in this study has some limitations. In the context of the \u003cem\u003ein vitro\u003c/em\u003e TKA samples used to implement the RS-ration in \u003cem\u003eMul\u003c/em\u003e (4), drugs were administered only at the onset of the experiment at sub-optimal concentrations, which implies that drug concentrations do not remain constant and stable throughout the duration of the experiment. In fact, this approach does not consider the dynamic drug exposure and varying half-lives of the compounds in the \u003cem\u003ein vitro\u0026nbsp;\u003c/em\u003eassay media, which are key considerations for drug effect \u003cem\u003ein vivo\u003c/em\u003e. For instance, RIF has an \u003cem\u003ein vitro\u003c/em\u003e half-life of approximately seven days, with about 75% degradation after 14 days of incubation in 7H9 medium at 37°C (17–19). A comparable or even shorter half-life (14.2 h) has been documented for CLA (17), while the half-life of AMX fluctuates extensively (from 27.4 h to 10 days) contingent on media conditions (20–23). Indeed, a slight recovery in the RS-ratio was observed after 10 days of incubation in the different RIF-containing treatments, including those containing AMX/CLV, even as bacterial burden levels continued to decline \u003cstrong\u003e(\u003c/strong\u003e\u003cstrong\u003eFigure 4\u003c/strong\u003e\u003cstrong\u003eB and C)\u0026nbsp;\u003c/strong\u003e(4). This phenomenon may be attributed to the initial sub-optimal concentration of RIF (1/2X MIC) and the degradation of the compound over time, thereby limiting the efficacy of the drug and enabling bacterial metabolic recovery. In a preceding time-kill assay study on \u003cem\u003eMtb\u003c/em\u003e, even concentrations of RIF 20X MIC were unable to prevent bacterial regrowth at endpoint due to RIF degradation in the assay medium (19).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eA detailed comparison between conditions of RIF monotherapy and RIF-CLA combination reveals a faster recovery of the RS-ratio in the presence of CLA after day 10 (Figure 2A). This is in line with previous observations showing that monotherapy CLA administration results in a modest increase in the RS-ratio. With a similar drug stability in the assay medium, the observed accelerated recovery is likely due to the differential initial dose and a negative impact of CLA on the activity of RIF, allowing for the overcoming of the RS-ratio reducing effect of RIF when its concentrations decline over time. This increase in the RS-ratio anticipates a potential antagonistic effect observed after day 21 with other biomarkers; for example, luminescence from the RIF-CLA combination is reduced more slowly than that from RIF monotherapy \u003cstrong\u003e(\u003c/strong\u003e\u003cstrong\u003eFigure 4\u003c/strong\u003e\u003cstrong\u003eC)\u0026nbsp;\u003c/strong\u003e(4).\u003c/p\u003e\n\u003cp\u003eThe addition of AMX/CLV to RIF-containing regimens led to the most significant reductions in the RS-ratio \u003cstrong\u003e(\u003c/strong\u003e\u003cstrong\u003eFigure 4\u003c/strong\u003e\u003cstrong\u003eA)\u0026nbsp;\u003c/strong\u003ein line with observations with other biomarkers \u003cstrong\u003e(\u003c/strong\u003e\u003cstrong\u003eFigure 4\u003c/strong\u003e\u003cstrong\u003eB and C)\u003c/strong\u003e. In a previous study (19), the combination of RIF with beta-lactams and, in particular, first-generation cephalosporins demonstrated a capacity to prevent bacterial regrowth at endpoint, despite the substantial drug degradation of both compounds in the assay medium. At the time, no correlation was performed with the RS-ratio, but together with the present data, it provides the first insights into the sterilizing effect of RIF and beta-lactams (i.e., AMX/CLV) combinations against mycobacterial species. Although RS-ratio recovery patterns were observed in our analysis, the experimental design was only powered to identify synergistic interactions (i.e., drugs were evaluated at sub-optimal concentrations) and not to assess the full capacity of drugs alone or in combination, which would have required higher doses, such as in the above-mentioned study (19). Consequently, RS-ratio recovery patterns observed in this study suggest the existence of a residual bacterial subpopulation that survived the initial treatments. This sub-population could have potentially resumed metabolic activity once drug concentrations dropped below the effective levels, suggesting that culture regrowth might be expected if longer TKA times were provided. As such, the RS-ratio has the potential to function as an early monitoring biomarker, capable not only of ranking potential sterilizing drug combinations but also of detecting the early onset of metabolic bacterial reactivation and regrowth. Further investigations should be done to confirm whether the RS-ratio could also be used for detecting the presence of bacterial resistance or tolerance. Interestingly, even at sub-optimal concentrations, the combination of RIF+AMX/CLV was more effective than both drugs alone, supporting the synergistic interaction which correlates with the shortening potential of the novel regimen.\u003c/p\u003e\n\u003cp\u003eWhile the administration of a single dose of suboptimal concentrations of different drugs is useful for the understanding of \u003cem\u003ein vitro\u003c/em\u003e synergistic drug interactions against \u003cem\u003eMul\u003c/em\u003e, it does not accurately represent \u003cem\u003ein vivo\u003c/em\u003e and clinical exposures needed for translational efforts. Optimal drug concentrations will yield enhanced reductions of the RS-ratio in \u003cem\u003eMul\u003c/em\u003e, in accordance with documented evidence of RIF dose-response effects against\u003cem\u003e\u0026nbsp;Mtb,\u003c/em\u003e both \u003cem\u003ein vivo\u003c/em\u003e (6) and \u003cem\u003ein vitro\u003c/em\u003e (11).\u0026nbsp;Therefore, there is compelling rationale for implementing the RS-ratio analysis in \u003cem\u003ein vivo\u0026nbsp;\u003c/em\u003emodels, when necessary, and in more complex \u003cem\u003ein vitro\u0026nbsp;\u003c/em\u003emodels, such as the Hollow Fibre System (HFS), which provides dynamic measures of pharmacokinetic and pharmacodynamic relationships of antimicrobial treatments against a given pathogen. The HFS was endorsed by the European Medicines Agency for the study of\u003cem\u003e\u0026nbsp;Mtb\u0026nbsp;\u003c/em\u003edrug treatments (24), and it is currently under further optimization (25).\u003c/p\u003e\n\u003cp\u003eWe have described for the first time the implementation of the RS-ratio biomarker for BU research, measuring bacterial metabolic activity and growth dynamics together with \u003cem\u003ein vitro\u0026nbsp;\u003c/em\u003edrug activity against \u003cem\u003eMul\u003c/em\u003e. These activities align with WHO-recommended key areas of development of rapid diagnostic tests for BU that can be used at the primary health care level (1). The RS-ratio offered novel insights into the impact of pharmaceutical agents on persistent bacterial activity, a capability that conventional gold standard methodologies of bacterial load quantification by CFU enumeration do not possess. In addition, research conducted with\u003cem\u003e\u0026nbsp;Mtb\u0026nbsp;\u003c/em\u003ehas demonstrated that a substantial decrease in the RS-ratio is associated with treatment-shortening properties of novel regimens, which our data support for the RIF-AMX/CLV-based combinations currently under evaluation in two clinical trials (https://blms4bu.org/) (NCT05169554, PACTR202209521256638). This finding suggests that the RS-ratio biomarker has the potential to inform the development of more efficacious and efficient regimens for the treatment of BU, TB, and even other infectious diseases. Furthermore, the results obtained clearly indicate the high potential of the RS-ratio as an \u003cem\u003ein vitro\u003c/em\u003e biomarker, justifying further investigation into its prospective use as a novel biomarker in both animal models and clinical settings for the monitoring of BU treatment effectiveness.\u0026nbsp;\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"378\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 85px;\"\u003e\n \u003cp\u003e16S\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 293px;\"\u003e\n \u003cp\u003e16S rRNA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 85px;\"\u003e\n \u003cp\u003e23S\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 293px;\"\u003e\n \u003cp\u003e23S rRNA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 85px;\"\u003e\n \u003cp\u003eAMX\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 293px;\"\u003e\n \u003cp\u003eAmoxicillin\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 85px;\"\u003e\n \u003cp\u003eBU\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 293px;\"\u003e\n \u003cp\u003eBuruli ulcer\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 85px;\"\u003e\n \u003cp\u003ecDNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 293px;\"\u003e\n \u003cp\u003ecomplementary DNA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 85px;\"\u003e\n \u003cp\u003eCFUs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 293px;\"\u003e\n \u003cp\u003eColony-forming units\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 85px;\"\u003e\n \u003cp\u003eCLA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 293px;\"\u003e\n \u003cp\u003eClarithromycin\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 85px;\"\u003e\n \u003cp\u003eCLV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 293px;\"\u003e\n \u003cp\u003eClavulanate\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 85px;\"\u003e\n \u003cp\u003eddPCR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 293px;\"\u003e\n \u003cp\u003edroplet digital PCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 85px;\"\u003e\n \u003cp\u003eETS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 293px;\"\u003e\n \u003cp\u003eExternal transcribed spacer\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 85px;\"\u003e\n \u003cp\u003eHFS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 293px;\"\u003e\n \u003cp\u003eHollow Fibre system\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 85px;\"\u003e\n \u003cp\u003eITS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 293px;\"\u003e\n \u003cp\u003eInternal transcribed spacer\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 85px;\"\u003e\n \u003cp\u003eMIC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 293px;\"\u003e\n \u003cp\u003eMinimum Inhibitory Concentration\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 85px;\"\u003e\n \u003cp\u003eMsm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 293px;\"\u003e\n \u003cp\u003eMycobacterium smegmatis\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 85px;\"\u003e\n \u003cp\u003eMtb\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 293px;\"\u003e\n \u003cp\u003eMycobacterium tuberculosis\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 85px;\"\u003e\n \u003cp\u003eMul\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 293px;\"\u003e\n \u003cp\u003eMycobacterium ulcerans\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 85px;\"\u003e\n \u003cp\u003eNTD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 293px;\"\u003e\n \u003cp\u003eNeglected Tropical Diseases\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 85px;\"\u003e\n \u003cp\u003eRIF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 293px;\"\u003e\n \u003cp\u003eRifampicin\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 85px;\"\u003e\n \u003cp\u003erRNAs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 293px;\"\u003e\n \u003cp\u003eribosomal RNAs\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 85px;\"\u003e\n \u003cp\u003eRS-ratio\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 293px;\"\u003e\n \u003cp\u003eribosomal RNA synthesis ratio\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 85px;\"\u003e\n \u003cp\u003eTB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 293px;\"\u003e\n \u003cp\u003eTuberculosis\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 85px;\"\u003e\n \u003cp\u003eTKA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 293px;\"\u003e\n \u003cp\u003eTime-kill assay\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eACKNOWLEDGMENTS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to acknowledge the technical staff of the CleanRooms of the Bioengineering facility core of Universidad Carlos III de Madrid, which housed our experimental activities.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eUse of AI statement.\u003c/strong\u003e Language models from Google, Gemini, and DeepL Write were used for assistance with the harmonization of text and the correction of grammatical and stylistic errors in the preparation of this manuscript. Authors are solely responsible for the accurate content of this work.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e: Innovative Medicines Initiatives 2 Joint Undertaking (JU) (grant 853989, https://era4tb.org/) to JJV, supported by the European Union\u0026rsquo;s Horizon 2020 Research and Innovation Program and EFPIA, and the Global Alliance for TB Drug Development Non-Profit Organization, Bill \u0026amp; Melinda Gates Foundation, University of Dundee. (http://www.imi.europa.eu); and the Tres Cantos Open Lab Foundation (grant TC281) to SRG. Funders did not play any role in the study design, data collection and analysis, decision to publish, or manuscript preparation. This work reflects only the author\u0026apos;s views, and the JU is not responsible for any use that may be made of the information it contains.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAUTHOR CONTRIBUTIONS\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConceptualization\u003c/strong\u003e: JCS, SFB, SGR, AML. \u003cstrong\u003eData curation\u003c/strong\u003e: JCS. \u003cstrong\u003eFormal analysi\u003c/strong\u003es: JCS, ESL. \u003cstrong\u003eFunding and project administration\u003c/strong\u003e: JJV, SRG. \u003cstrong\u003eInvestigation\u003c/strong\u003e: JCS. \u003cstrong\u003eMethodology\u003c/strong\u003e: JCS. \u003cstrong\u003eSupervision\u003c/strong\u003e: SFB, AML. \u003cstrong\u003eVisualization\u003c/strong\u003e: JCS, ESL, PLE. \u003cstrong\u003eOriginal draft writing\u003c/strong\u003e: JCS. \u003cstrong\u003eWriting \u0026ndash; review \u0026amp; editing\u003c/strong\u003e: All authors.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eWHO. Buruli ulcer in Africa: 20 years of progress | WHO | Regional Office for Africa [Internet]. 2025 [cited 2025 Nov 24]. Available from: https://www.afro.who.int/publications/buruli-ulcer-africa-20-years-progress\u003c/li\u003e\n\u003cli\u003eWHO. Ending the Neglect to Attain the Sustainable Development Goals : A Road Map for Neglected Tropical Diseases 2021-2030 [Internet]. World Health Organization; 2021 [cited 2025 Dec 9]. p. 196. Available from: https://www.who.int/publications/i/item/9789240010352\u003c/li\u003e\n\u003cli\u003eArenaz-Callao MP, Gonz\u0026aacute;lez del R\u0026iacute;o R, Luc\u0026iacute;a Quintana A, Thompson CJ, Mendoza-Losana A, Ram\u0026oacute;n-Garc\u0026iacute;a S. Triple oral beta-lactam containing therapy for Buruli ulcer treatment shortening. Phillips RO, editor. PLoS Negl Trop Dis [Internet]. 2019 Jan 28 [cited 2025 May 5];13(1):e0007126. Available from: https://dx.plos.org/10.1371/journal.pntd.0007126\u003c/li\u003e\n\u003cli\u003eS\u0026aacute;ez-L\u0026oacute;pez E, Mill\u0026aacute;n-Placer AC, Luc\u0026iacute;a A, Ram\u0026oacute;ngarc\u0026iacute;a S. Amoxicillin/clavulanate in combination with rifampicin/clarithromycin is bactericidal against Mycobacterium ulcerans. PLoS Negl Trop Dis. 2024 Apr 1;18(4). \u003c/li\u003e\n\u003cli\u003eJohnson RC, S\u0026aacute;ez-L\u0026oacute;pez E, Anagonou ES, Kpoton GG, Ayelo AG, Gnimavo RS, et al. Comparison of 8 weeks standard treatment (rifampicin plus clarithromycin) vs. 4 weeks standard plus amoxicillin/clavulanate treatment [RC8 vs. RCA4] to shorten Buruli ulcer disease therapy (the BLMs4BU trial): study protocol for a randomized controlled multi-centre trial in Benin. Trials [Internet]. 2022 Jul 8 [cited 2022 Jul 19];23(1):559. Available from: http://www.ncbi.nlm.nih.gov/pubmed/35804454\u003c/li\u003e\n\u003cli\u003eWalter ND, Born SEMM, Robertson GT, Reichlen M, Dide-Agossou C, Ektnitphong VA, et al. Mycobacterium tuberculosis precursor rRNA as a measure of treatment-shortening activity of drugs and regimens. Nat Commun [Internet]. 2021 May 18;12(1):2899. Available from: http://dx.doi.org/10.1038/s41467-021-22833-6\u003c/li\u003e\n\u003cli\u003eBeissner M, Symank D, Phillips RO, Amoako YA, Awua-Boateng NY, Sarfo FS, et al. Detection of Viable Mycobacterium ulcerans in Clinical Samples by a Novel Combined 16S rRNA Reverse Transcriptase/IS2404 Real-Time qPCR Assay. Small PLC, editor. PLoS Negl Trop Dis [Internet]. 2012 Aug 28;6(8):e1756. Available from: https://dx.plos.org/10.1371/journal.pntd.0001756\u003c/li\u003e\n\u003cli\u003eKonno K, Oizumi K, Oka S. Mode of action of rifampin on mycobacteria. II. Biosynthetic studies on the inhibition of ribonucleic acid polymerase of Mycobacterium bovis BCG by rifampin and uptake of rifampin- 14 C by Mycobacterium phlei. Am Rev Respir Dis [Internet]. 1973 Jun;107(6):1006\u0026ndash;12. Available from: http://www.atsjournals.org/doi/abs/10.1164/arrd.1973.107.6.1006\u003c/li\u003e\n\u003cli\u003eWhite RJ, Lancini GC, Silvestri LG. Mechanism of action of rifampin on Mycobacterium smegmatis. J Bacteriol. 1971;108(2):737\u0026ndash;41. \u003c/li\u003e\n\u003cli\u003eHonore N, Cole ST. Molecular basis of rifampin resistance in Mycobacterium leprae. Antimicrob Agents Chemother [Internet]. 1993 Mar;37(3):414\u0026ndash;8. Available from: http://www.ncbi.nlm.nih.gov/pubmed/8460911\u003c/li\u003e\n\u003cli\u003eReichlen MJ, Born SEM, Lyons MA, Rossmassler K, Reid J, Robertson GT, et al. Standardized RS Ratio Metrics To Assess Tuberculosis Antimicrobial Efficacy and Potency. Antimicrob Agents Chemother [Internet]. 2023 Jan 24 [cited 2025 Mar 11];67(1). Available from: https://journals.asm.org/doi/10.1128/aac.01483-22\u003c/li\u003e\n\u003cli\u003eAlvarez-Elcoro S, Enzler MJ. The Macrolides: Erythromycin, Clarithromycin, and Azithromycin. Mayo Clin Proc [Internet]. 1999 Jun 1 [cited 2025 Aug 22];74(6):613\u0026ndash;34. Available from: https://www.sciencedirect.com/science/article/abs/pii/S0025619611641402\u003c/li\u003e\n\u003cli\u003eCastle SS. Amoxicillin. xPharm: The Comprehensive Pharmacology Reference [Internet]. 2007 Jan 1 [cited 2025 Aug 22];1\u0026ndash;6. Available from: https://www.sciencedirect.com/science/article/abs/pii/B978008055232361222X\u003c/li\u003e\n\u003cli\u003eGupta SK, Drancourt M, Rolain JM. In silico prediction of antibiotic resistance in mycobacterium ulcerans AGY99 through whole genome sequence analysis. American Journal of Tropical Medicine and Hygiene [Internet]. 2017 [cited 2025 Aug 22];97(3):810\u0026ndash;4. Available from: https://pmc.ncbi.nlm.nih.gov/articles/PMC5590560/\u003c/li\u003e\n\u003cli\u003eRam\u0026oacute;n-Garc\u0026iacute;a S, Gonz\u0026aacute;lez del R\u0026iacute;o R, Arenaz-Callao MP, Boshoff HI, Rullas J, Anca S, et al. Sanfetrinem, an oral \u0026beta;-lactam antibiotic repurposed for the treatment of tuberculosis. Drug Resistance Updates [Internet]. 2025 May 1 [cited 2025 Aug 22];80. Available from: https://pubmed.ncbi.nlm.nih.gov/40020440/\u003c/li\u003e\n\u003cli\u003eBLMs4BU Project | Reducing Treatment of Buruli Ulcer [Internet]. [cited 2025 May 6]. Available from: https://blms4bu.org/\u003c/li\u003e\n\u003cli\u003eSchoutrop ELM, Brouwer MAE, Jenniskens JCA, Ferro BE, Mouton JW, Aarnoutse RE, et al. The stability of antimycobacterial drugs in media used for drug susceptibility testing. Diagn Microbiol Infect Dis. 2018 Dec;92(4):305\u0026ndash;8. \u003c/li\u003e\n\u003cli\u003eYu X, Jiang G, Li H, Zhao Y, Zhang H, Zhao L, et al. Rifampin Stability in 7H9 Broth and L\u0026ouml;wenstein-Jensen Medium. J Clin Microbiol. 2011 Mar;49(3):784\u0026ndash;9. \u003c/li\u003e\n\u003cli\u003eRam\u0026oacute;n-Garc\u0026iacute;a S, Gonz\u0026aacute;lez Del R\u0026iacute;o R, Villarejo AS, Sweet GD, Cunningham F, Barros D, et al. Repurposing clinically approved cephalosporins for tuberculosis therapy. Sci Rep. 2016 Sep 28;6:34293. \u003c/li\u003e\n\u003cli\u003eSamara E, Moriarty TF, Decosterd LA, Richards RG, Gautier E, Wahl P. Antibiotic stability over six weeks in aqueous solution at body temperature with and without heat treatment that mimics the curing of bone cement. Bone Joint Res. 2017 May;6(5):296\u0026ndash;306. \u003c/li\u003e\n\u003cli\u003eErah P. The stability of amoxycillin, clarithromycin and metronidazole in gastric juice: relevance to the treatment of Helicobacter pylori infection. Journal of Antimicrobial Chemotherapy. 1997 Jan 1;39(1):5\u0026ndash;12. \u003c/li\u003e\n\u003cli\u003eMoore TD, Horton R, Utrup LJ, Miller LA, Poupard JA. Stability of amoxicillin-clavulanate in BACTEC medium determined by high-performance liquid chromatography and bioassay. J Clin Microbiol. 1996 May;34(5):1321\u0026ndash;2. \u003c/li\u003e\n\u003cli\u003eLallemand EA, Lacroix MZ, Toutain PL, Boullier S, Ferran AA, Bousquet-Melou A. In vitro Degradation of Antimicrobials during Use of Broth Microdilution Method Can Increase the Measured Minimal Inhibitory and Minimal Bactericidal Concentrations. Front Microbiol. 2016 Dec 21;7. \u003c/li\u003e\n\u003cli\u003eCavaleri M, Manolis E. Hollow fiber system model for tuberculosis: The European Medicines Agency experience. Clinical Infectious Diseases. 2015;61:S1\u0026ndash;4. \u003c/li\u003e\n\u003cli\u003eAguilar-Ayala DA, Sanz-Garc\u0026iacute;a F, Rabodoarivelo MS, Susanto BO, Bailo R, Eveque-Mourroux MR, et al. Evaluation of critical parameters in the hollow-fibre system for tuberculosis: A case study of moxifloxacin. Br J Clin Pharmacol [Internet]. 2024 Jul 1 [cited 2025 Aug 22];90(7):1711\u0026ndash;27. Available from: /doi/pdf/10.1111/bcp.16068\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":true,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"infectious-diseases-of-poverty","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"idop","sideBox":"Learn more about [Infectious Diseases of Poverty](http://idpjournal.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/idop/default.aspx","title":"Infectious Diseases of Poverty","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"RS-ratio, Buruli ulcer, Mycobacterium ulcerans, biomarker, treatment-shortening, mycobacteria, drug combinations","lastPublishedDoi":"10.21203/rs.3.rs-8335436/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8335436/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBuruli ulcer (BU), a neglected tropical disease caused by \u003cem\u003eMycobacterium ulcerans\u003c/em\u003e (\u003cem\u003eMul\u003c/em\u003e), requires a complex 8-week treatment regimen of rifampicin (RIF) and clarithromycin (CLA). The co-administration of amoxicillin/clavulanate (AMX/CLV) is currently under evaluation in clinical trials to reduce treatment duration. Conventional methods to assess \u003cem\u003ein vitro \u003c/em\u003edrug efficacy against \u003cem\u003eMul\u003c/em\u003e, like colony-forming units (CFUs), are slow and cumbersome. The ribosomal RNA synthesis ratio (RS-ratio), a hallmark of active ribosome biogenesis, is a promising predictive biomarker for treatment shortening in tuberculosis; however, its application in \u003cem\u003eMul\u003c/em\u003e has not yet been explored.\u003c/p\u003e\n\u003cp\u003eWe implemented the RS-ratio for \u003cem\u003eMul \u003c/em\u003eby designing new sets of primers-probes for specific rRNA precursor and total rRNA sequences and combining them with a previously published primers-probe set into a single multiplexed droplet digital PCR (ddPCR) assay. This assay was applied to evaluate the \u003cem\u003ein vitro\u003c/em\u003e activity of RIF, CLA, and AMX/CLV (as monotherapies and in combinations) against a \u003cem\u003eMul\u003c/em\u003e clinical strain using RNA extracts from a 28-day time-kill assay. RIF+AMX/CLV-containing combinations produced the most significant and rapid RS-ratio reductions, preceding the observed decline in bacterial burden in prior studies.\u003c/p\u003e\n\u003cp\u003eIn summary, this is the first report using the RS-ratio to evaluate antibiotic activity against \u003cem\u003eMul\u003c/em\u003e. Our findings validate the RS-ratio as a molecular tool for assessing the sterilizing potential of new regimens to inform future research and clinical trial designs for the treatment of BU. Evidence of \u003cem\u003ein vitro\u003c/em\u003e sterilization of the RIF+CLA+AMX/CLV regimen supports its selection for BU treatment shortening in the BLMs4BU clinical trial (NCT05169554, PACTR202209521256638).\u003c/p\u003e","manuscriptTitle":"The ribosomal RNA synthesis ratio biomarker in Mycobacterium ulcerans for drug activity evaluation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-19 09:29:26","doi":"10.21203/rs.3.rs-8335436/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-12-31T02:17:46+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-29T17:18:07+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-12-27T07:58:40+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"112716503320360492343578113612740170286","date":"2025-12-18T15:13:03+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"71171164799866281448852241445219440123","date":"2025-12-16T17:45:02+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-12-16T15:08:49+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-12-12T08:50:27+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-12-12T08:46:03+00:00","index":"","fulltext":""},{"type":"submitted","content":"Infectious Diseases of Poverty","date":"2025-12-11T09:56:47+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"infectious-diseases-of-poverty","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"idop","sideBox":"Learn more about [Infectious Diseases of Poverty](http://idpjournal.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/idop/default.aspx","title":"Infectious Diseases of Poverty","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e68d4b12-3120-4fb5-b645-9d9176495c53","owner":[],"postedDate":"December 19th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-04-21T03:53:25+00:00","versionOfRecord":[],"versionCreatedAt":"2025-12-19 09:29:26","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8335436","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8335436","identity":"rs-8335436","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}