Effects of the AMPAr antagonist, Perampanel, on Cognitive Function in Rats Exposed to Neonatal Iron Overload

Effects of the AMPAr antagonist, Perampanel, on Cognitive Function in Rats Exposed to Neonatal Iron Overload | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Effects of the AMPAr antagonist, Perampanel, on Cognitive Function in Rats Exposed to Neonatal Iron Overload José Afonso Corrêa Silva, Lariza Oliveira Souza, Maria Paula Arakaki Severo, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3809589/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 02 May, 2024 Read the published version in Molecular Neurobiology → Version 1 posted 7 You are reading this latest preprint version Abstract Iron accumulation has been associated with the pathogenesis of neurodegenerative diseases and memory decline. As previously described by our research group, iron overload in the neonatal period induces persistent memory deficits, increases oxidative stress, and apoptotic markers. The neuronal insult caused by iron excess generates an energetic imbalance that can alter glutamate concentrations and thus trigger excitotoxicity. Drugs that block glutamatergic receptor, eligibly mitigate neurotoxicity; among them, Perampanel (PER), a reversible AMPA receptor (AMPAR) antagonist. In the present study, we sought to investigate the neuroprotective effects of PER in rats subjected to iron overload in the neonatal period. Recognition and aversive memory were evaluated, AMPAR subunit phosphorylation, as well as the relative expression of genes such as GRIA1, GRIA2, DGL4 , and CAC , which code proteins involved in AMPAR anchoring. Male rats received vehicle or carbonyl iron (30 mg/kg) from the 12th to the 14th postnatal day and were treated with vehicle or PER (2 mg/kg) for 21 days in adulthood. The excess of iron caused recognition memory deficits and impaired emotional memory, and PER was able to improve the rodents' memory. Furthermore, iron overload increased the expression of the GRIA1 gene and decreased the expression of the DGL4 gene, demonstrating the influence of metal accumulation on the metabolism of AMPAR. These results suggest that iron can trigger changes in the expression of genes important for the assembly and anchoring of AMPAR and that blocking AMPAR with PER is capable of partially reversing the cognitive deficits caused by iron overload. AMPA receptors Iron overload Memory Neurotoxicity Perampanel Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 1. Introduction Aging is a stochastic phenomenon that progressively and irreversibly affects all living organisms. It is characterized by a precise mosaic of cellular and tissue changes that gradually reduce the organism's adaptability to its environment [ 1 ]. This decline in the body's biochemical and physiological functions is the result of the interplay between genetic factors, the environment, lifestyle, and the extent to which these components can cause DNA damage and hinder its repair [ 2 , 3 ]. Morphofunctional, histologic, and chemical disturbances also manifest within this system, primarily due to elevated levels of free radicals (FRs), resulting in oxidative stress [ 4 , 5 ]. The progression of degenerative damage may be exacerbated by elevated levels of certain metals such as iron, that when present in excess, can increase the permeability of the blood-brain barrier, leading to internal inflammation and neuronal toxicity. This association is well established in neurodegenerative diseases, where high iron levels have been identified in key pathological features, including neurofibrillary tangles in Alzheimer's disease (AD) [ 6 ] and protein misfolding and aggregation in mitochondrial dysfunction [ 7 ]. Despite the large amount of evidence in the literature that correlates iron accumulation in the Central Nervous System (CNS) and neurodegenerative diseases [ 8 ] further investigations are still needed to elucidate more clearly the mechanisms underlying iron neurotoxicity. In previous studies, our research group established an animal model of iron administration in the neonatal period, when maximum iron absorption into the CNS occurs, and described that the insult caused in the process generated behavioral and cognitive impairments [ 9 ], damaging recognition and emotional memory [ 10 ]. Furthermore, it was found that iron administration in the neonatal period led to oxidative damage [ 11 ], increased expression of apoptosis markers [ 12 , 13 ], changes in mitochondrial function [ 13 ], impaired autophagy [ 14 ] and induced the accumulation of ubiquitinated proteins [ 10 ]. In addition, several studies have reported profound changes in brains of patients affected by Parkinson’s disease (PD), including significant depletion of the antioxidant glutathione (GSH), reduced mitochondrial complex I activity, DNA oxidation, and elevated levels of free iron [ 15 ]. These findings are consistent with the work of Zhu et al. [ 5 ], who observed elevated iron levels in degenerating dopaminergic neurons, and the research of Castellani et al. [ 16 ], who identified iron-reactive Lewy bodies along with aggregated proteins such as α-synuclein. When generated in sufficient quantities, FRs can suppress defense mechanisms against oxidative stress, leading to metabolic and cellular perturbations, including DNA strand breaks and changes in intracellular Ca²+ levels. These changes result from increased permeability of calcium channels, including AMPA-type glutamatergic receptors (AMPARs). Importantly, there is growing evidence that Ca²+ permeability in AMPARs directly influences synaptic plasticity and contributes to the pathophysiology of various neuronal disorders [ 17 ]. The development of novel drugs targeting AMPA receptor antagonism is a growing field that aims to mitigate the harmful effects of calcium ion accumulation and provide neuroprotection [ 18 ]. Perampanel (PER) represents the first of a novel class of antiepileptic drugs that utilize non-competitive AMPAR antagonism. It has demonstrated efficacy and clinical tolerability in patients 12 years of age and older [ 18 , 19 ]. Notably, this drug was recently approved in the U.S.A. for the treatment of epilepsy, including partial-onset seizures and primary tonic-clonic seizures, and as adjunctive therapy in the treatment of Lafora disease and Lance-Adams syndrome. It has also shown promise in reducing myoclonic seizures and providing neuroprotection [ 18 , 20 ]. Given the clinical importance of understanding the mechanisms of action of new drugs in the field of neuroprotection, this study sought to investigate the neuroprotective capabilities of PER, and the involvement of AMPAR in iron-induced neurotoxicity. Specifically, neonatal Wistar rats were exposed to elevated iron levels and the effect of iron accumulation on the expression of different subunits of the AMPA receptor was evaluated. We also aimed at evaluating whether PER would be able to attenuate iron-induced memory impairments. The study encompassed behavioral assessments of cognition in the animals, as well as an examination of the hippocampus to provide cellular insights into the mechanisms of neuroprotection and associated pathways. The study evaluated the expression and phosphorylation levels of AMPA receptor subunits, GluA2 and GluA1, and assessed the mRNA expression of proteins such as PSD-95, a scaffolding protein for the AMPA receptor, and stargazer transmembrane interaction protein, a transmembrane protein responsible for anchoring and stabilizing AMPA receptors in the plasma membrane. 2. Materials and Methods 2.1 Animals Twenty-three pregnant Wistar rats were obtained from the Centro de Reprodução e Experimentação em Animais de Laboratório (CREAL), Federal University of Rio Grande do Sul, Porto Alegre, RS, Brazil, where the pharmacological treatments and behavioral experiments were conducted. After birth, each litter was adjusted within 48h to contain eight rat pups including offspring of both genders. Each pup was kept together with its mother in a plastic cage with sawdust bedding in a room temperature of 21 ± 1°C and a 12/12 h light/dark cycle. At the age of 3 weeks, pups were weaned, and the males were selected and maintained in groups of three to five in individually ventilated cages with sawdust bedding. For postnatal treatments, animals were given standardized pellet food and tap water ad libitum. All behavioral experiments were performed at light phase between 09:00 a.m and 4:30 p.m. All experimental procedures were performed in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals (8th Edition 2011) and the Brazilian Guidelines for the Care and Use of Animals in Research and Teaching (DBCA, published by CONCEA, MCTI, Brazil). All procedures performed in studies involving animals were in accordance with the ethical standards of the institution at which the studies were conducted and approved by the Institutional Ethics Committee of the Federal University of Rio Grande do Sul (permit number: 35604). All efforts were made to minimize the number of animals and their suffering. We used the ARRIVE guidelines 2.0 for reporting animal research. 2.2 Experimental Design With the aim of evaluating the effects of iron overload on the expression of AMPA receptor (AMPAR) subunits and proteins related to AMPAR functionality and investigating the effects of subchronic use of PER, a non-competitive AMPAR antagonist, on the cognitive deficit of animals, litters were randomly assigned (simple randomization) to receive either iron carbonyl (N = 27) or vehicle solution (N = 30). Only male pups from each litter received the treatment from postnatal days 12th to 14th, and each single animal represented an experimental unit. All litters (those that received iron and those that received vehicle) were kept in the same room with their respective mothers under the same environmental conditions. Subsequently, at the age of 3 months, the two groups were further semi-randomly divided into four groups, resulting in four experimental groups: Veh-Veh (N = 16, control group), Veh-Perampanel (N = 14), Iron-Veh (N = 14), and Iron-Perampanel (N = 13). During treatments, all groups of rats were kept in the same room under the same environmental conditions. Although no significant stress or suffering were expected from the treatments with iron or PER, animals were daily inspected for signals of distress, suffering and unexpected health issues. None of the animals had to be withdrawn from the study due to health issues. After 14 days of PER treatment, rats were tested in the novel object recognition task and open field. Seven days later, they were submitted to inhibitory avoidance memory task. Twenty-four hours after the completion of behavioral task, all rats were euthanized by decapitation, and their hippocampi were quickly removed and stored in − 80°C freezer for posterior RT-PCR or western blot analysis. Experimental design is shown in Fig. 1 . Sample size was estimated based on previous studies published from our research group and others. Usually, behavioral tasks, such as those used in the present study, require a sample size between 12–15 animals in each group. The use of this sample size allows consistent and reproducible results for behavioral analysis [ 9 – 11 ]. Based on previously published research by our group, for biochemical analysis, including blood tests, gene expression, and protein analysis using western blot, we used a sample size varying from 3 to 6 animals in each group [ 11 , 13 , 14 ]. No inclusion or exclusion criteria were established a priori . No exclusions of animals or data points were performed. 2.3 Pharmacological Treatments 2.3.1 Neonatal Iron Treatment The neonatal iron treatment was performed as previously described [ 13 , 10 ]. Briefly, 12-day-old rat pups from randomly assigned litters (simple randomization) received a single oral daily dose (10 ml/kg solution volume) of vehicle (5% sorbitol in water, control group) or 30 mg/kg of body weight of Fe2+ (iron carbonyl, Sigma-Aldrich, São Paulo, Brazil) via a metallic gastric tube (gavage), over 3 days (postnatal days 12–14). Rats in each group (vehicle or iron) were derived from 5 to 6 different litters, to avoid a possible litter effect. 2.3.2 Perampanel Adult (3-month-old) rats, treated neonatally with vehicle or iron, as described above, received a daily gavage of vehicle (Tween 80 – saline solution 1:16 v/v) or Perampanel (PER) (2 mg/kg, Fycompa®) for 21 consecutive days. Drug solutions were freshly prepared immediately prior to administration, with dissolving the tablet and calculating the dose. Rats were euthanized by decapitation at 24h after the last injection of PER treatment. Brains were quickly dissected and hippocampi were isolated and stored at -80ºC for subsequent RT-qPCR. The dose of PER was chosen based on previous animal studies [ 21 , 22 ]. Potential confounders, such as the type of treatments or animal/cage location, were avoided throughout the experiment by marking animals with a color/number code on the tail, the identification of cages by number and treatment and the organization of cages according to their treatment/number, always on the same rack. Identifications of animals and cages were routinely checked and renewed whenever necessary. All research team members were aware of the allocation of animals during the treatments, except for the person that performed the behavioral testing. 2.4 Behavioral analysis 2.4.1 Open field Open field exploratory activity was analyzed 24 h before object recognition training session. This behavioral session was also used as habituation to the field. An open field arena (40 cm × 45 cm × 60 cm), made of plywood with a front glass wall and floor divided into 12 equal squares by black lines, was used. The animals were placed in the lower left corner to then explore freely for 5 minutes. The experimental session was videotaped and subsequently analyzed by an experimenter blinded to the animals’ experimental condition The latency to start locomotion, line crossings, number of rearings, and the number of fecal pellets were counted using a stopwatch and two manual counters during the experimental sessions. The evaluated parameters are indicative of the animals’ locomotion and anxiety [ 23 ]. 2.4.2 Novel Object Recognition Test Animals were habituated to the empty open field, 24 h before the training session, as described above. In the training session, rats were placed in the same open rectangular field (45 × 40 × 60 cm), with sawdust covering its floor, in which they were exposed to two identical objects (A1 and A2), for 5 minutes. To evaluate the long-term memory retention (LTM), 24 h after the training session, the rats were allowed to explore the open field for 5 minutes in the presence of two objects: the familiar object (A) and a new object (B). These objects were placed in the same locations as in the training session. All objects used had similar textures, colors and sizes, but different shapes. The objects were positioned in two adjacent corners, 9 cm from the walls and between trials, the objects were washed with 10% ethanol [ 24 ]. All experimental sessions were videotaped and subsequently analyzed by an experimenter blinded to the animals’ experimental condition. Exploration of the objects was measured using two stopwatches to record the time spent exploring them during the experimental sessions. Exploration was defined as: smelling or touching the object with the nose or the forepaws. The recognition index was expressed by the equation TB/(TA + TB), where: TA = time spent exploring the familiar object (A) and TB = time spent exploring the new object [ 25 , 26 ]. 2.4.3 Inhibitory Avoidance Task We used the single-trial, step-down inhibitory avoidance (IA) conditioning as an established model of fear-motivated memory. In IA training, animals learn to associate a location in the training apparatus with an aversive stimulus (footshock). The IA behavioral training and retention test procedures were described in previous reports [ 10 ]. The IA apparatus was a 50 × 25 × 25-cm3 acrylic box (Albarsh, Porto Alegre, Brazil) whose floor consisted of parallel stainless-steel bars (1-mm diameter) spaced 1 cm apart. A 7-cm wide, 2.5-cm high platform was placed on the floor of the box against the left wall. On the training trial, rats were placed on the platform, and their latency to step-down on the grid with all four paws was measured with an automatic device. Immediately after stepping down on the grid, rats received a mild footshock (0.4 mA) and were removed from the apparatus immediately afterwards. A retention test trial was carried out 24 h after the training trial. The retention test trial was procedurally identical to training, except that no footshock was presented. Step-down latencies (in seconds) on the retention test trial (maximum 180 s) were used as a measure of IA retention. Behavioral procedures were performed by an experimenter blinded to animals’ experimental condition. 2.5 Preparation of Samples for Molecular Analysis Twenty-four hours after the completion of inhibitory avoidance testing, rats were euthanized by decapitation and hippocampi were rapidly dissected. For organization purposes, and to ensure that the rapidly dissected hippocampal samples were immediately placed in the adequate solutions (RNA-later for RT-qPCR and protease inhibitor for WB) and snap-frozen, we used a procedure in which the left hemisphere was placed in a refrigerated RNA-later solution (Sigma-Aldrich, São Paulo, Brazil) for RT-qPCR assays and the right hemisphere was placed in a protease inhibitor solution (Complete Mini, Roche Applied Science, Mannheim, Germany) also refrigerated for the Western blot tests. Samples were stored at -80°C for subsequent analysis. 2.6 Western Blot Analysis Proteins were extracted in 1X RIPA buffer (Thermo Fisher Scientific, Waltham, USA) containing protease inhibitor cocktail and sodium orthovanadate (1mM). After 10 min in ice, samples were centrifuged at 13,500 rpm for 10 min. The supernatant was collected, and the protein content was determined using Bradford assay [ 27 ]. Aliquots were stored at − 80°C. Twenty-five micrograms of protein were separated on a 9% SDS polyacrylamide gel and transferred electrophoretically to a PVDF membrane (Immobilon-P, Millipore, Burlington, USA). Membranes were blocked with 5% nonfat dry milk in TBS containing 0.1% Triton X-100 and were incubated overnight with one of the following antibodies: anti-β-actin (cat. # ab6276, Abcam, Cambridge, UK) at 1:5,000, anti-phospho GluA1 (S845) (cat. # ab7632, Abcam, Cambridge, UK) at 1:1,000, anti-phospho GuA2 (S880) (cat. # ab52180) Abcam, Cambridge, UK) at 1:500, anti-GluA1 (cat. # ab31232, Abcam, Cambridge, UK) at 1:1,000, and anti-GluA2 (cat. # ab133477, Abcam, Cambridge, UK) at 1:1,000. Goat polyclonal anti-mouse IgG (cat. # A4416) at 1:10,000, and goat polyclonal anti-rabbit IgG (cat. # A0545) at 1:80,000 (both from Sigma-Aldrich, St. Louis, USA) secondary antibodies were used and detected using Millipore Immobilon Western Chemiluminescent HRP Substrate (Millipore, Burlington, USA). Prestained molecular weight protein markers (Precision Plus Protein™ Kaleidoscope™ Prestained Protein Standards, Bio-Rad Laboratories, Hercules, USA) were used to determine the detected bands' molecular weight and confirm target specificity of antibodies. Images were obtained using an ImageQuant LAS 500 (GE Healthcare, Chicago, USA). The densitometry quantification was performed by an experimenter blinded to groups’ experimental condition, using ImageJ software ( http://rsb.info.nih.gov/ij/ ). Phosphorylation levels were normalized by the respective total protein levels. Total blotting protein levels of samples were normalized according to each sample’s β-actin protein levels [ 13 , 28 ]. 2.7 RT-PCR TRIZOL (Life Techonologies, Carlsbad, USA) was used to extract and isolate total RNA according to the manufacturer's instructions. Total RNA quantity and quality were determined spectrophotometrically using a BioPhotometer Plus (Eppendorf, Germany). Complementary DNA (cDNA) was synthesized from 2µg of total RNA using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems™, Foster City, USA). The cDNA from each sample was used as a template for gene expression analysis through real-time quantitative polymerase chain reaction (RT-qPCR) using GoTaq® Probe qPCR Master Mix (Promega, Madison, USA) and specific primers for each gene: the transmembrane interacting proteins stargazer ( CAC gene) and scaffold PSD-95 ( DLG4 gene), GluA1 ( GRIA1 gene) and GluA2 ( GRIA2 gene) and the constitutive genes Gadp and Rpl13. Primers' sequences are listed in Table 1 . RTqPCR conditions were optimized to yield an amplification efficiency of 95% -105%. Products were run on an agarose gel to verify the correct amplification length. The specificity of the amplified products was confirmed by analyzing the dissociation (melt) curves at the end of each reaction. The relative expression of the genes analyzed was calculated for each sample by the relative comparative (ΔΔCT) method. All samples were run in triplicates. Table 1 Primers used in RT-qPCR analysis Gene Sequences CACNG2 F CTTCAAAGGTCTGTGCAAGC R AAAGCAGGATCACACTCAGG DLG4 F GAGTGCTTCTCAGCCATCGT R TAGGGGCCTGAGAGGTCTTC GRIA1 F CGAAGCGGATGAAGGGTTTCT R TGGATTGCATGGACTTGGGG GRIA2 F GGGGAGGTGATTCCAAGGAAAA R CACCAGCATTGCCAAACCAA GAPDH F GTCTCCTCTGACTTCAACAGCG R ACCACCCTGTTGCTGTAGCCAA RPL13 F CTCAAGGTGTTTGACGGCATCC R TACTTCCAGCCAACCTCGTGAG Statistical Analysis Data were tabulated and analyzed using SPSS v software. 26.0 (IBM, Armonk, NY, USA). The assumptions of normality and homogeneity of variances were assessed with the Shapiro-Wilk test and Levene’s test, respectively. Behavioral parameters evaluated in the open field, recognition indexes, latencies to step-down and data from Western blot and RT-PCR experiments are expressed as mean ± standard error (S.E.). Statistical comparisons were performed using two-way analysis of variance (2-way ANOVA), with neonatal treatment (vehicle or iron) and adult treatment (vehicle or perampanel) as fixed factors, to identify possible interaction effects of iron treatment and PER. One-way ANOVA, followed by Tukey’s post hoc test, was used to test differences between the experimental groups. Effect sizes of the results obtained for 2-way ANOVA were analyzed with Partial Eta Squared (ηρ2) test. In all comparisons, p values less than 0.05 were considered to indicate statistical significance. 3. Results We aimed at investigating whether PER could recover memory deficits induced by iron overload. Firstly, animals were tested in the object recognition task. The comparison of recognition indexes using 2-way ANOVA indicated that the experimental groups did not show significant differences in the training session. No significant main effect of iron treatment (F (1,38) = 0.03, ηρ2 = 0.001, p = 0.864), PER (F (1,38) = 0.00, ηρ2 < 0.0001, p = 0.994), nor interactions were observed (F (1,38) = 0.177, ηρ2 = 0.005, p = 0.677, Fig. 2 ). However, when we compared the recognition indices in the long-term memory test session, we noticed a significant main effect of iron treatment in the neonatal period (F (1,38) = 8.68, ηρ2 = 0.186, p = 0.005), revealed by a significantly lower recognition index in these groups, indicating that iron causes recognition memory impairments, according to previous results from our research group. No significant main effect of PER in the adulthood was found (F (1,38) = 0.012, ηρ2 > 0.0001, p = 0.912). Although the recognition index of the iron-treated group that received PER (Fe-PER) in the adulthood was higher than the Fe-Veh group, interaction between iron and PER felt short of significance (F (1,38) = 3.75, ηρ2 = 0.090, p = 0.060, Fig. 2 ). However, multiple comparisons of retention test recognition indexes indicated that the iron-treated group that received PER in adulthood (Fe-PER), showed no difference in comparison to the control group (Sorb-Veh; p = 0.137), suggesting that treatment with PER in adulthood was capable of improving, at least in part, the memory of animals treated with iron in the neonatal period (Fig. 2 ). Next, we decided to test the animals in the inhibitory avoidance task, a type of emotionally regulated memory task. The comparison of latencies using 2-way ANOVA indicated that the experimental groups did not show significant differences in the training session. We observed no significant main effects of iron (F (1,53) = 0.43, ηρ2 = 0.008, p = 0.515), PER (F (1,53) = 1.13, ηρ2 = 0.021, p = 0.293), nor interaction (F (1,53) = 0.59, ηρ2 = 0.011, p = 0.445). However, when we compared the latencies in the long-term memory test session, we noticed a significant main effect of iron (F (1,53) = 13.72, ηρ2 = 0.206, p = 0.001), indicating that iron causes emotional memory impairment, confirming previous results from our research group. No significant main effect of PER in the adulthood (F (1,53) = 0.79, ηρ2 = 0.015, p = 0.379). However, 2-way ANOVA revealed a significant interaction between iron and PER (F (1,53) = 5.70, ηρ2 = 0.097, p = 0.021, Fig. 3 ), Moreover, multiple comparisons indicated that the iron-treated group that received PER in adulthood (Fe-PER) showed no difference compared to the control group (Sorb-Veh; p = 0.200). These findings suggest that treatment with PER in the adulthood was able to reverse the emotional memory impairment induced by iron in the neonatal period (Fig. 3 ). To control for possible motor, exploratory, or motivational alterations induced by iron treatment or PER we analyzed behavior in an open field. Multiple comparisons of the parameters analyzed in the open field showed no statistically significant differences among the groups in the latency to start locomotion (F (3,38) = 2.25, p = 0.099), number of crossings (F (3,38) = 1.71, p = 0.182), number of rearings (F (3,38) = 2.68, p = 0.061), and number of fecal pellets produced during the session (F (3,38) = 2.13, p = 0.112) (Table 2 ). Table 2 Open field behavior Group Latency to start locomotion (s) Number of line crossings Number of rearings Number of fecal pellets N Sorb-Veh 9.72 ± 1.27 100.00 ± 2.94 31.75 ± 1.52 1.33 ± 0.43 12 Sorb-PER 7.31 ± 1.47 104.56 ± 6.82 31.56 ± 2.26 2.78 ± 0.68 9 Iron-Veh 12.12 ± 1.26. 89.73 ± 3.70 37.27 ± 0.98 1.54 ± 0.51 11 Iron-PER 8.58 ± 1.40 104.10 ± 7.51 31.40 ± 2.28 3.30 ± 0.97 10 Open-field behavior was analyzed during the habituation session for the object recognition task. Data are expressed as mean ± SEM. Multiple comparisons indicated no significant differences when the latency to start locomotion, number of crossings, number of rearings, and fecal pellets produced during the session were compared To gain a better understanding on the mechanisms involved with the deleterious effects of iron excess on cognition and possible reversion effects of PER, we next decided to examine the levels of GLUA1 and GLUA2 AMPAR subunits and their phosphorylated forms. Two-way ANOVA showed no significant main effects of iron (F (1,14) = 0.31, ηρ2 = 0.022, p = 0.585), PER (F (1,14) = 0.14, ηρ2 = 0.010, p = 0.711), nor interactions (F (1,14) = 0.024, ηρ2 = 0.002, p = 0.880) when analyzing total GLUA1 levels (Fig. 4 b). However, when comparing pGLUA1 levels, a significant interaction (F (1,16) = 6.99, ηρ2 = 0.304, p = 0.0177) between iron and PER treatments was revealed (Fig. 4 a). Although no main effect of iron (F (1,16) = 1.93, ηρ2 = 0.107 p = 0.184) or PER (F (1,16) = 1.12, ηρ2 = 0.065, p = 0.306) were observed, multiple comparisons of groups showed a significant difference between the group treated with iron in the neonatal period (Fe-Veh) and the control group (Sorb-Veh, p = 0.024, Tukey’s multiple comparison test), and a significant difference between the iron-treated group that received Vehicle (Fe-Veh) and the iron-treated group that received PER in the adulthood (Fe-PER, p = 0.041, Fig. 4 a). These findings suggest that iron increased pGLUA1 and PER was able to reverse this effect. In relation to GLUA2, neither total GLUA2 levels nor p-GLUA2 were affected by iron or PER. Two way ANOVA analysis of total GLUA2 levels indicated no main effect of iron (F (1,14) = 0.21, ηρ2 = 0.015, p = 0.653), PER (F (1,14) = 0.57, ηρ2 = 0.039, p = 0.463), nor interaction (F (1,14) = 0.45, ηρ2 = 0.031, p = 0.513, Fig. 4 d). Likewise, no significant main effect of iron (F (1,16) = 1.20, ηρ2 = 0.070, p = 0.289), PER (F (1,16) = 0.40, ηρ2 = 0.024, p = 0.536), nor interaction (F (1,16) = 0.92, ηρ2 = 0.054, p = 0.352) were revealed when analyzing p-GLUA2 (Fig. 4 c). Also, multiple comparison test revealed no significant differences among the groups. We also sought to analyze mRNA expression of AMPAR subunits, GLUA1 and GLUA2, and scaffolding proteins related to AMPAR anchoring in the membrane, stargazin and PSD-95. As can be seen in Fig. 5 , the analysis of GRIA1 gene expression, indicated a significant main effect of iron treatment (F (1,13) = 5.52, ηρ2 = 0.298, p = 0.035), which increased GRIA1 expression. No significant main effect of PER (F (1,13) = 2.33, ηρ2 = 0,152, p = 0.151) nor interaction was observed (F (1,13) = 1.48, ηρ2 = 0.103, p = 0.245). On the other hand, GRIA2 mRNA expression was not affected by iron treatment (F (1,19) = 2.48, ηρ2 = 0.115, p = 0.132). No significant main effect of PER (F (1,19) = 1.07, ηρ2 = 0.053, p = 0.314) nor significant interaction was observed when analyzing GRIA2 mRNA expression (F (1,19) = 0.59, ηρ2 = 0.030, p = 0.453). Additionally, we found a significant main effect of iron on the mRNA expression of the DLG4 gene (F (1,14) = 13.44, ηρ2 = 0.490, p = 0.03), in which iron treatment decreased the expression of this gene, that codes for the PSD-95 protein. No significant main effect of PER (F (1,14) = 3.61, ηρ2 = 0.205, p = 0.078) nor interaction was found (F (1,14) = 0.74, ηρ2 = 0.050, p = 0.403). The analysis of mRNA expression of CAC revealed no significant main effects of iron (F (1,14) = 0.64, ηρ2 = 0.044, p = 0.437), PER (F (1,14) = 0.03, ηρ2 = 0.002, p = 0.866), nor interaction (F (1,14) = 0.06, ηρ2 = 0.005, p = 0.804). 4. Discussion The present findings show that iron overload in the neonatal period resulted in cognitive impairment in both behavioral tests, as previously demonstrated by our research group [ 9 , 24 , 14 , 29 ]. Our results also showed that subchronic treatment with Perampanel (PER) in the adulthood was able to reverse the memory impairments induced by iron overload. No motor or exploratory alterations that could interfere with memory acquisition, following iron or PER treatments were observed when open field results were analyzed. The effect of PER on recognition memory corroborates the findings of Mohammad et al. [ 28 ], showing that PER improved object recognition ability in male rats in a pilocarpine model of status epilepticus. In addition, Alqahtani, et al [ 23 ], evaluating the anti-inflammatory effect of the co-administration of PER and Ketamine in a model of acute brain trauma, described an improvement in the percentage of spontaneous alternation and a higher percentage of discrimination index in the object recognition test with the association of PER. In the same study, it was found that the combination of the two substances reduced the central and peripheral expression of NF-κB and iNOS, markers associated with conditions of oxidative stress, mitochondrial damage, and imbalances in CNS hyperexcitability. Mitochondrial failure, which can be caused by iron overload [ 29 ] has been linked to increased glutamate in the synaptic cleft, and consequent hyperexcitability. A study by da Silva and coworkers [ 31 ], has revealed that iron accumulation during the neonatal period leads to mitochondrial damages. They also established a correlation between iron overload and the expression of proteins involved in mitochondrial fusion and fission mechanisms, such as DNM1L and OPA1. In addition, previous research reported increased expression of caspase-3, and decreased expression of the synaptic marker synaptophysin in the hippocampus of iron-treated rats [ 13 ]. CNS hyperexcitability is known to be a consequence of Aß oligomer accumulation, a key aspect of AD pathophysiology. A study conducted by Bellingacci and coworkers [ 33 ] showed that administration of PER not only reversed neuronal Aß-induced hyperexcitability, but also improved cognitive deficits in Aβ oligomers-injected mice. PER also decreased the expression of proinflammatory cytokines, particularly TNF-α, IL-1ß, and IL-6. In addition, it has been demonstrated that PER increases anti-inflammatory cytokines such as IL-10 and TGF-β1 [ 32 ]. It's worth noting that iron overload in the CNS has been associated with increased levels of TNF-α and IL-1ß [ 34 ], and the elevation of these proinflammatory cytokines is also observed in animal models with impaired memory [ 35 ] and altered expression of AMPA receptors [ 36 ]. This correlation suggests a potential bidirectional influence between iron overload, inflammation, and AMPA receptor metabolism. As PER is a selective, non-competitive antagonist of the AMPA receptor, it has lower toxicity and greater reach, blocking receptors containing both GluA1 and GluA2 subunits, two subunits present in the different AMPA receptor assemblies [ 37 ]. This allows PER to interact in different conditions in which CNS injury alters the expression or transcription of any of the AMPAR subunits. Several studies have consistently linked the expression of different AMPAR subunits and their associated proteins to neuronal and behavioral disorders [ 38 , 39 ]. The structure of AMPAR has been well characterized and consists of combinations of the GluA1, GluA2, GluA3 and GluA4 subunits, which have approximately 70% homology in the peptide sequence [ 40 ]. However, understanding of the possible relationship between the assembly of distinct receptor subunits and neurodegenerative diseases is only just beginning to emerge [ 41 ]. The Ca2 + permeability of AMPAR (CP-AMPAR) varies depending on whether the GluA2 subunit is present in the tetramer. The insertion of AMPARs that are permeable to calcium ions and can thus promote neurotoxicity, results from a decreased expression of genes encoding the GluA2 subunit or increased expression of genes encoding the GluA1 subunit [ 42 ]. In our study, neonatal iron overload was able to increase the relative expression of the GRIA1 gene, which is responsible for the expression of the GluA1 subunit of the AMPA receptor, and decrease the relative expression of the DLG4 gene, which is responsible for the synthesis of the PSD-95 protein, a scaffolding protein of the AMPA receptor. This effect of iron on the expression of GluA1 has already been documented in a study evaluating the effect of a diet rich in iron on young rats, in which it was found that at the end of one month of iron supplementation, there was a 70% increase in the expression of GluA1 in the prefrontal cortex [ 43 ]. The correlation of the different AMPA subunits (GluA1 and GluA2) with the different scaffolding and cytoplasmic trafficking proteins has already been extensively studied, since a decrease in the expression of the AMPAR-GluA2 subunit in the hippocampus is accompanied by a decrease in PSD-95, while the levels of the transmembrane regulatory protein stargazin increase [ 44 ]. As shown in the present study, iron overload significantly decreased the expression of the DLG4 gene, the gene encoding PSD-95, while it increased, although not significantly, the expression of GRIA2 , the gene encoding the AMPAR-GluA2 subunit. Despite these findings, iron overload and the use of PER did not significantly affect the expression of the CAC gene, which encodes the stargazin protein. In addition to changes in the synthesis of the various proteins and structures that regulate the insertion and function of AMPA receptors, during the process of neuronal toxicity, neuroinflammation and neurodegeneration, the expression of the receptor subunits may be regulated by the administration of PER, as shown by Yang et al. [ 45 ], who demonstrated that the chronic use of PER can positively regulate the GluA2 subunit. However, in the present study, PER decreased, although not significantly, the expression of the gene encoding GluA2 and especially GluA1 in the groups exposed to iron overload. Consistent with the above, several studies have shown that increased gene expression of the GluA1 subunit, as well as the relatively higher GluA1:GluA2 ratio [ 45 ] found in the present study, results in the synaptic insertion of a greater number of CP-AMPARs (Ca2 + ion-permeable AMPA receptors) [ 47 ], demonstrating a unique relationship between receptor expression, trafficking, and insertion in a variety of animal models of neurodegenerative disease [ 48 ]. The fact that iron overload, in addition to increasing the expression of the GluA1 subunit, increased its phosphorylation, reinforces the hypothesis that the injury caused by the metal not only altered the Glua1/Glua2 ratio, but also altered the functional characteristics of the subunit. As demonstrated by western blot analyses, the injury caused by iron overload increased the phosphorylation of the GluA1 subunit, an effect reversed by the administration of PER. Despite the significant results, publications that studied the effect of PER on the phosphorylation of GluA1 receptors are scarce and inconclusive. A recent study by Zhai et al. (2023), evaluated the effect of the drug on the expression of PKC (protein that phosphorylates GluA1) and phosphorylation of GluA1, trying to explain the effect of PER on migraine, through the expression of PKC and other enzymes, without finding a clear correlation [ 49 ]. Kim et al. (2019), found that PER influences the phosphorylation of GluA1 depending on the exposure time, in the same way that it alters the expression of several enzymes that phosphorylate the GluA1 subunit, such as PKC and CAMKII [ 50 ]. Regarding the increase in GluA1 phosphorylation mediated by iron overload, we can suggest it causes an increase in the placement of the subunit in the plasma membrane through this process. Serine 845 phosphorylation decreases GluA1binding to the AP2 adapter protein, which internalizes the subunit and, with it, the AMPA receptor [ 51 ]. As is already known, the phosphorylation of the GluA1 and GluA2 subunits of AMPA receptors may be correlated with LTP, but probably not at serine 845, as demonstrated by Stafford and coworkers (2018) [ 52 ]. The phosphorylation of GluA1 serine 845 may be related to the expression of PKA [ 53 ], suggesting future studies that seek to correlate iron overload, the use of PER and the expression of enzymes that phosphorylate GluA1 subunits. Through our mRNA expression results and behavioral testing, we established a clear correlation between neonatal iron overload, the relative expression of genes responsible for encoding AMPA receptor subunits and scaffold proteins, and cognitive impairment. Evidently, exposure to iron overload during the neonatal period instigates a neurodegenerative condition, which is further exacerbated by the insertion of AMPA receptors permeable to calcium ions. This is facilitated by the increased relative expression of the GRIA1 gene, responsible for the GluA1 subunit, and its phosphorylation at serine 845. CP-AMPARs are not blocked by extracellular cations and allow Ca2 + entry at all levels of receptor activation. In fact, CP-AMPARs are significantly increased in disease states that can trigger mitochondrial dysfunction and cell death [ 54 ] acting synergistically with the degenerative effects of iron overload. This may explain why PER, a non-selective AMPA receptor antagonist, was able to reverse the cognitive deficit produced by iron overload. Conclusion In conclusion, the present study shows that the administration of PER was able to reverse, at least in part, the cognitive deficit caused by iron overload in the neonatal period. Furthermore, it was observed for the first time that iron overload in the neonatal period increased the relative expression of the GRIA1 gene, that codes the GluA1 subunit of the AMPA receptor and was able to increase the Glua1 phosphorylation of serine 845. Since the increase in GRIA1 expression and consequent increased calcium permeability have been consistently reported in disease context, this may be one of the mechanisms underlying iron neurotoxicity later in life. Further molecular analyses attempting to elucidate the molecular mechanisms relying PER neuroprotective effects are warranted, particularly analyzing the different protein kinases capable of phosphorylating different sites on the AMPA receptor subunits. Declarations Funding This work was supported by National Council for Scientific and Technological Development [CNPq; grant numbers 403154/2021-9 and 305656/2019-8 to N.S.]; the National Institute of Science and Technology for Translational Medicine [INCT-TM – grant number 465458/2014-9]; Rio Grande do Sul State Research Foundation (FAPERGS – grant number 22/2551-0000385-0); N.S is Research Career Awardee of the CNPq. The funding sources were not involved in the collection, analysis, and interpretation of data; in the writing of the report; and in the decision to submit the article for publication. Conflict of interest The authors have no relevant financial or non-financial interests to disclose. Author contributions Conceptualization: José Afonso Corrêa da Silva, Nadja Schroder; Methodology: José Afonso Corrêa da Silva, Nadja Schroder; Formal analysis and investigation: José Afonso Corrêa da Silva, Lariza Oliveira de Souza, Maria Paula Arakaki Severo, Sarah Luize Camargo Rodrigues, Patrícia Molz, Patrícia Schonhofen, Alice Laschuk Herlinger; Writing - original draft preparation: José Afonso Corrêa da Silva; Writing - review and editing: Nadja Schroder; Funding acquisition: Nadja Schroder; Resources: Maria Paula Arakaki Severo, Sarah Luize Camargo Rodrigues, Patrícia Molz; Supervision: Nadja Schroder Data availability The data used to support the findings of this study are available from the corresponding author upon request. Ethics approval This study was approved by the Institutional Ethics Committee for the Use of Animals of the Federal University of Rio Grande do Sul (CEUA , #35604) and all experimental procedures were performed in accordance with the Brazilian Guidelines for the Care and Use of Animals in Research and Teaching (DBCA, published by CONCEA, MCTI, Brazil). References Murphy RJ, Buenzli PR, Baker RE, Simpson MJ (2020) Mechanical Cell Competition in Heterogeneous Epithelial Tissues. Bull Math Biol 82(10):130. https://doi.org/10.1007/s11538-020-00807-x Lopez-Otin C, Blasco MA, Partridge L, Serrano M, Kroemer G (2013) The hallmarks of aging. Cell. https://doi.org/10.1016/j.cell.2013.05.039 . 153:1194 – 217 Kennedy BK, Berger SL, Brunet A, Campisi J, Cuervo AM, Epel ES et al (2014) Geroscience: linking aging to chronic disease. Cell 159:709–713. https://doi.org/10.1016/j.cell.2014.10.039 Ferreira B, Mendes F, Osorio N, Caseiro A, Gabriel A, Valado A (2013) Glutathione in multiple sclerosis. Br J Biomed Sci 70:75–79. https://doi.org/10.1080/09674845.2013.11669939 Zhu W, Xie W, Pan T, Xu P, Fridkin M, Zheng H et al (2007) Prevention and restoration of lactacystin-induced nigroestriatal dopamine neuron degeneration by novel brain-permeable iron chelators. FASEB J 21:3835–3844. https://doi.org/10.1096/fj.07-8386com Huat TJ, Camats-Perna J, Newcombe EA, Valmas N, Kitazawa M, Medeiros R (2019) Metal Toxicity Links to Alzheimer's Disease and Neuroinflammation. J Mol Biol 431(9):1843–1868. https://doi.org/10.1016/j.jmb.2019.01.018 Lan AP, Chen J, Chai ZF, Hu Y (2016) The neurotoxicity of iron, copper and cobalt in Parkinson's disease through ROS-mediated mechanisms. Biometals 29(4):665–678. https://doi.org/10.1007/s10534-016-9942-4 Peng Y, Chang X, Lang M (2021) Iron Homeostasis Disorder and Alzheimer's Disease. Int J Mol Sci 22(22):12442. https://doi.org/10.3390/ijms222212442 Schröder N, Fredriksson A, Vianna MR, Roesler R, Izquierdo I, Archer T (2001) Memory deficits in adult rats following postnatal iron administration. Behav Brain Res 124(1):77–85. https://doi.org/10.1016/s0166-4328(01)00236-4 Figueiredo LS, de Freitas BS, Garcia VA, Dargél VA, Köbe LM, Kist LW et al (2016) Iron loading selectively increases hippocampal levels of ubiquitinated proteins and impairs hippocampus-dependent memory. Mol Neurobiol 53:6228–6239. https://doi.org/10.1007/s12035-015-9514-6 de Lima MN, Polydoro M, Laranja DC, Bonatto F, Bromberg E, Moreira JC et al (2005) Recognition memory impairment and brain oxidative stress induced by postnatal iron administration. Eur J Neurosci 21:2521–2528. https://doi.org/10.1111/j.1460-9568.2005.04083.x Miwa CP, de Lima MN, Scalco F, Vedana G, Mattos R, Fernandez LL et al (2011) Neonatal iron treatment increases apoptotic markers in hippocampal and cortical areas of adult rats. Neurotox Res 19:527–535. https://doi.org/10.1007/s12640-010-9181-3 da Silva VK, de Freitas BS, da Silva DA, Nery LR, Falavigna L, Ferreira RD et al (2014) Cannabidiol normalizes caspase 3, synaptophysin, and mitochondrial fission protein DNM1L expression levels in rats with brain iron overload: implications for neuroprotection. Mol Neurobiol 49:222–233. https://doi.org/10.1007/s12035-013-8514-7 Uberti VH, de Freitas BS, Molz P, Bromberg E, Schröder N (2019) Iron Overload Impairs Autophagy: Effects of Rapamycin in Ameliorating Iron-Related Memory Deficits. Mol Neurobiol 57(2):1044–1054. https://doi.org/10.1007/s12035-019-01794-4 Mythri RB, Venkateshappa C, Harish G, Mahadevan A, Muthane UB, Yasha TC (2011) Evaluation of markers of oxidative stress, antioxidant function and astrocytic proliferation in the striatum and frontal cortex of Parkinson’s disease brains. Neurochem Res 36:1452–1463. https://doi.org/10.1007/s11064-011-0471-9 Castellani RJ, Siedlak SL, Perry G, Smith MA (2000) Sequestration of iron by Lewy bodies in Parkinson’s disease. Acta Neuropathol 100:111–114. https://doi.org/10.1007/s004010050001 Whitehead G, Regan P, Whitcomb DJ, Cho K (2017) Ca 2+- permeable AMPA receptor: A new perspective on amyloid-beta mediated pathophysiology of Alzheimer's disease. Neuropharmacology 112:221–227. https://doi.org/10.1016/j.neuropharm.2016.08.022 French JA, Krauss GL, Steinhoff BJ, SquillacoteD, YangH, Kumar D et al (2013) Evaluation of adjunctive perampanel in patients with refractory partial-onset seizures: results of randomized global phase III study 305. Epilepsia 54:1117–1125. https://doi.org/10.1111/j.1528-1167.2012.03638.x Krauss GL, Serratosa JM, Villanueva V, Endziniene M, Hong Z, French J (2012) Randomized phase III study 306: adjunctive perampanel for refractory partial-onset seizures. Neurology 78:1408–1415. https://doi.org/10.1212/WNL.0b013e318254473a Dohare P, Zia MT, Ahmed E, Asad A, Yadala V, Schober AL et al (2016) AMPA-Kainate Receptor Inhibition Promotes Neurologic Recovery in Premature Rabbits with Intraventricular Hemorrhage. J Neurosci 36:3363–3377. https://doi.org/10.1523/JNEUROSCI.4329-15.201 Wu T, Ido K, Osada Y, Kotani S, Tamaoka A, Hanada T (2017) The neuroprotective effect of perampanel in lithium-pilocarpine rat seizure model. Epilepsy Res 137:152–158. https://doi.org/10.1016/j.eplepsyres.2017.06.002 Zolkowska D, Dhir A, Rogawski MA (2021) Perampanel, a potent AMPA receptor antagonist, protects against tetramethylenedisulfotetramine-induced seizures and lethality in mice: comparison with diazepam. Arch Toxicol 95(7):2459–2468. https://doi.org/10.1016/j.eplepsyres.2017.06.002 Alqahtani F, Assiri MA, Mohany M, Imran I, Javaid S, Rasool MF et al (2020) Coadministration of Ketamine and Perampanel Improves Behavioral Function and Reduces Inflammation in Acute Traumatic Brain Injury Mouse Model. Biomed Res 10:20203193725. https://doi.org/10.1155/2020/3193725 de Lima MN, Luft T, Roesler R, Schröder N (2006) Temporary inactivation reveals an essential role of the dorsal hippocampus in consolidation of object recognition memory. Neurosci Lett 405(1–2):142–146. https://doi.org/10.1016/j.neulet.2006.06.044 Giacobbo BL, de Freitas BS, Vedovelli K, Schlemmer LM, Pires VN, Antoniazzi V et al (2019) Long-term environmental modifications affect BDNF concentrations in rat hippocampus, but not in serum. Behav Brain Res 372:111965. https://doi.org/10.1016/j.bbr.2019.111965 De Souza LO, Machado GDB, de Freitas BS, Rodrigues SLC, Severo MPA, Molz P et al (2021) The G protein-coupled estrogen receptor (GPER) regulates recognition and aversively-motivated memory in male rats. Neurobiol Learn Mem 184:107499. https://doi.org/10.1016/j.nlm.2021.107499 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254. https://doi.org/10.1006/abio.1976.9999 da Silva VK, de Freitas BS, Garcia RCL, Monteiro RT, Hallak JE, Zuardi AW et al (2018) Antiapoptotic effects of cannabidiol in an experimental model of cognitive decline induced by brain iron overload. Transl Psychiatry 8(1):176. https://doi.org/10.1038/s41398-018-0232-5 Molz P, de Freitas BS, Uberti VH, da Costa KM, Kist LW, Bogo MR et al (2021) Effects of lipoic acid supplementation on age- and iron-induced memory impairment, mitochondrial DNA damage and antioxidant responses. Eur J Nutr 60(7):3679–3690. https://doi.org/10.1007/s00394-021-02541-z Mohammad H, Sekar S, Wei Z, Moien-Afshari F, Taghibiglou C (2019) Perampanel but Not Amantadine Prevents Behavioral Alterations and Epileptogenesis in Pilocarpine Rat Model of Status Epilepticus. Mol Neurobiol 56(4):2508–2523. https://doi.org/10.1007/s12035-018-1230-6 Wang H, Liu C, Zhao Y, Gao G (2020) Mitochondria regulation in ferroptosis. Eur J Cell Biol 99(1):151058. https://doi.org/10.1016/j.ejcb.2019.151058 Bellingacci L, Tallarico M, Mancini A, Megaro A, De Caro C, Citraro R et al (2023) Non-competitive AMPA glutamate receptors antagonism by perampanel as a strategy to counteract hippocampal hyper-excitability and cognitive deficits in cerebral amyloidosis. Neuropharmacology 225:109373. https://doi.org/10.1016/j.neuropharm.2022.109373 Chen T, Dai SH, Jiang ZQ, Luo P, Jiang XF, Fei Z et al (2017) The AMPAR Antagonist Perampanel Attenuates Traumatic Brain Injury Through Anti-Oxidative and Anti-Inflammatory Activity. Cell Mol Neurobiol 37(1):43–52. https://doi.org/10.1007/s10571-016-0341-8 Carota G, Distefano A, Spampinato M, Giallongo C, Broggi G, Longhitano L et al (2022) Neuroprotective Role of α-Lipoic Acid in Iron-Overload-Mediated Toxicity and Inflammation in In Vitro and In Vivo Model. Antioxid (Basel) 11(8):1596. https://doi.org/10.3390/antiox11081596 Di Filippo M, Mancini A, Bellingacci L, Gaetani L, Mazzocchetti P, Zelante T et al (2021) Interleukin-17 affects synaptic plasticity and cognition in an experimental model of multiple sclerosis. Cell Rep 37(10):110094. https://doi.org/10.1016/j.celrep.2021.110094 Centonze D, Muzio L, Rossi S, Cavasinni F, De Chiara V, Bergami A et al (2009) Inflammation triggers synaptic alteration and degeneration in experimental autoimmune encephalomyelitis. J Neurosci 29:3442–3452. https://doi.org/10.1523/JNEUROSCI.5804-08.2009 Rogawski MA, Hanada T (2013) Preclinical pharmacology of perampanel, a selective non-competitive AMPA receptor antagonist. Acta Neurol Scand Suppl 19719–24. https://doi.org/10.1111/ane.12100 Takahashi T (2011) Mechanisms underlying contextual fear learning. Commun Integr Biol 4(6):726–727. https://doi.org/10.4161/cib.17505 Marcondes LA, Myskiw J, de Nachtigall C, Narvaes EG, Izquierdo RF, Furini I (2022) CRG PKMζ Maintains Remote Contextual Fear Memory by Inhibiting GluA2-Dependent AMPA Receptor Endocytosis in the Prelimbic Cortex. Neuroscience. 497:97–106. https://doi.org/j.neuroscience.2021.12.028 Collingridge GL, Olsen RW, Peters J, Spedding M (2009) A nomenclature for ligand-gated ion channels. Neuropharmacology 56:2–5. https://doi.org/10.1016/j.neuropharm.2008.06.063 Twomey EC, Yelshanskaya MV, Grassucci RA, Frank J, Sobolevsky AI (2017) Channel opening and gating mechanism in AMPA-subtype glutamate receptors. Nature 549(7670):60–65. https://doi.org/10.1038/nature23479 Wright A, Vissel B (2012) The essential role of AMPA receptor GluR2 subunit RNA editing in the normal and diseased brain. Front Mol Neurosci 5:34. https://doi.org/10.3389/fnmol.2012.00034 Han M, Kim J (2015) Effect of dietary iron loading on recognition memory in growing rats. PLoS ONE 10(3):e0120609. https://doi.org/10.1371/journal.pone.0120609 Brown JC, Higgins ES, George MS (2022) Synaptic Plasticity 101: The Story of the AMPA Receptor for the Brain Stimulation Practitioner. Neuromodulation 25(8):1289–1298. https://doi.org/10.1016/j.neurom.2021.09.003 Yang W, Ma L, Hai DM, Liu N, Yang JM, Lan XB et al (2022) Hippocampal Proteomic Analysis in Male Mice Following Aggressive Behavior Induced by Long-Term Administration of Perampanel. ACS Omega 7(23):19388–19400. https://doi.org/10.1021/acsomega.2c01008 Kondo M, Sumino R, Okado H (2000) Expression of AMPA receptors in rat superior colliculus and effect of orbital enucleation. Brain Res 883(2):238–242. https://doi.org/10.1016/s0006-8993(00)02879-1 Whitcomb DJ, Hogg EL, Regan P, Piers T, Narayan P, Whitehead G et al (2015) Intracellular oligomeric amyloid-beta rapidly regulates GluA1 subunit of AMPA receptor in the hippocampus. Sci Rep 5:10934. https://doi.org/10.1038/srep10934 Hoey SE, Buonocore F, Cox CJ, Hammond VJ, Perkinton MS, Williams RJ (2013) AMPA receptor activation promotes non-amyloidogenic amyloid precursor protein processing and suppresses neuronal amyloid-β production. PLoS ONE 8(10):e78155. https://doi.org/10.1371/journal.pone.0078155 Zhai Q, Wang K, Zhang D, Chen J, Dong X, Pan Y (2023) Perampanel ameliorates nitroglycerin-induced migraine through inhibition of the cAMP/PKA/CREB signaling pathway in the trigeminal ganglion in rats. Korean J Pain 36(3):335–346. https://doi.org/doi: 10.3344/kjp.23039 Kim JE, Choi HC, Song HK, Kang TC (2019) Perampanel Affects Up-Stream Regulatory Signaling Pathways of GluA1 Phosphorylation in Normal and Epileptic Rats. Front Cell Neurosci 13:80. https://doi.org/10.3389/fncel.2019.00080 Sathler MF, Khatri L, Roberts JP, Schmidt IG, Zaytseva A, Kubrusly RCC et al (2021) Phosphorylation of the AMPA receptor subunit GluA1 regulates clathrin-mediated receptor internalization. J Cell Sci 134(17):jcs257972. https://doi.org/10.1242/jcs.257972 Stafford J, Brownlow ML, Qualley A, Jankord R (2018) AMPA receptor translocation and phosphorylation are induced by transcranial direct current stimulation in rats. Neurobiol Learn Mem 150:36–41. https://doi.org/10.1016/j.nlm.2017.11.002 Wild AR, Dell'Acqua ML (2018) Potential for therapeutic targeting of AKAP signaling complexes in nervous system disorders. Pharmacol Ther 185:99–121. https://doi.org/10.1016/j.pharmthera.2017.12.004 Ji SG, Weiss JH (2018) Zn2+-induced disruption of neuronal mitochondrial function: Synergism with Ca2+, critical dependence upon cytosolic Zn2 + buffering, and contributions to neuronal injury. Exp Neurol 302:181–195. https://doi.org/10.1016/j.expneurol.2018.01.012 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 02 May, 2024 Read the published version in Molecular Neurobiology → Version 1 posted Editorial decision: Revision requested 12 Feb, 2024 Reviews received at journal 17 Jan, 2024 Reviewers agreed at journal 10 Jan, 2024 Reviewers invited by journal 10 Jan, 2024 Editor assigned by journal 10 Jan, 2024 Submission checks completed at journal 10 Jan, 2024 First submitted to journal 26 Dec, 2023 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3809589","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":266498292,"identity":"2c902d84-1f14-453a-8545-261dc4754175","order_by":0,"name":"José Afonso Corrêa Silva","email":"","orcid":"","institution":"Federal University of Rio Grande do Sul","correspondingAuthor":false,"prefix":"","firstName":"José","middleName":"Afonso Corrêa","lastName":"Silva","suffix":""},{"id":266498293,"identity":"0bd1bf22-fea3-4990-9f03-7fe16fbe03c8","order_by":1,"name":"Lariza Oliveira Souza","email":"","orcid":"","institution":"Federal University of Rio Grande do Sul","correspondingAuthor":false,"prefix":"","firstName":"Lariza","middleName":"Oliveira","lastName":"Souza","suffix":""},{"id":266498294,"identity":"4d860a37-8e4d-48f4-b95b-17964ff1fd45","order_by":2,"name":"Maria Paula Arakaki Severo","email":"","orcid":"","institution":"Federal University of Rio Grande do Sul","correspondingAuthor":false,"prefix":"","firstName":"Maria","middleName":"Paula Arakaki","lastName":"Severo","suffix":""},{"id":266498295,"identity":"b15c512d-adc1-4228-84c7-9842a3b52704","order_by":3,"name":"Sarah Luize Camargo Rodrigues","email":"","orcid":"","institution":"Federal University of Rio Grande do Sul","correspondingAuthor":false,"prefix":"","firstName":"Sarah","middleName":"Luize Camargo","lastName":"Rodrigues","suffix":""},{"id":266498296,"identity":"b9871211-583a-44d9-8273-97a3c743c918","order_by":4,"name":"Patrícia Molz","email":"","orcid":"","institution":"Federal University of Rio Grande do Sul","correspondingAuthor":false,"prefix":"","firstName":"Patrícia","middleName":"","lastName":"Molz","suffix":""},{"id":266498297,"identity":"55773178-f3c5-489a-a6de-e14157ec7730","order_by":5,"name":"Patrícia Schonhofen","email":"","orcid":"","institution":"Federal University of Rio Grande do Sul","correspondingAuthor":false,"prefix":"","firstName":"Patrícia","middleName":"","lastName":"Schonhofen","suffix":""},{"id":266498298,"identity":"fb7a70cb-80b7-42b9-9b8c-e53cfdcc0b36","order_by":6,"name":"Alice Laschuk Herlinger","email":"","orcid":"","institution":"Federal University of Rio Grande do Sul","correspondingAuthor":false,"prefix":"","firstName":"Alice","middleName":"Laschuk","lastName":"Herlinger","suffix":""},{"id":266498299,"identity":"1fb65f81-3b9d-4827-a956-e5b4aeca0057","order_by":7,"name":"Nadja Schröder","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2UlEQVRIiWNgGAWjYHACAwMgIYckwEOcFmMkdURoARGJPURrMWc/vKHgB0Nd+n723mcffjDYyek28B77gE+LZU9agWEPw+HcHp7jxjN7GJKNzQ7wJc/A66oDOQYGPAwHcnsk0piBTjqQuO0AjzF+j5x/Y2D4B+gwHvlnzIx/iNJyI8cAGFrMCTwSbMzMxNly41mBsQzDYcOeM2nMzDIGQL8c5ksm4LDkbYZvGOrk2duPMTO+qbCTMzveexivFiBgM2D8BzcBiJkJaQAqeUBYzSgYBaNgFIxoAADjNj6hvRDP/QAAAABJRU5ErkJggg==","orcid":"","institution":"Federal University of Rio Grande do Sul","correspondingAuthor":true,"prefix":"","firstName":"Nadja","middleName":"","lastName":"Schröder","suffix":""}],"badges":[],"createdAt":"2023-12-26 21:14:37","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3809589/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3809589/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s12035-024-04180-x","type":"published","date":"2024-05-02T19:58:31+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":49540635,"identity":"8d7c8a77-9a3e-4c07-89c8-940597c91490","added_by":"auto","created_at":"2024-01-12 17:20:10","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":141457,"visible":true,"origin":"","legend":"\u003cp\u003eExperimental design. Groups of rats were treated with vehicle or iron (orally, 30 mg/kg) in the neonatal period at postnatal days 12th to 14th. In adulthood (3 months of age), they received gavage of Perampanel (2.0 mg/kg) or vehicle for 21 days. After 14 days of Perampanel treatment, rats were tested in the novel object recognition task and open field. Seven days later, they were submitted to inhibitory avoidance memory task. Twenty-four hours after the completion of behavioral testing, animals were euthanized by decapitation, and their hippocampi were quickly isolated and stored in − 80 °C for RT-PCR and Western blot analysis\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3809589/v1/0fffcd97486b84f847bcf55b.jpeg"},{"id":49540631,"identity":"1329b7cf-b9e8-4f9d-a89a-2ad72e2d4541","added_by":"auto","created_at":"2024-01-12 17:20:10","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":6087,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of PER on object recognition in rats treated neonatally with iron.\u003c/strong\u003e Novel object recognition task was performed in rats treated neonatally with vehicle (Sorbitol, Sorb) or iron (Fe, 30 mg/kg of Fe2+) and given vehicle (Veh) or PER (2.0 mg/kg) in adulthood (3 months of age) for 14 days. Sorb-Veh N = 12, Sorb-PER N = 9, Iron-Veh N = 11, Iron-PER N = 10. Data expressed as mean ± S.E.M. Statistical analysis was performed using two-way ANOVA, with neonatal treatment (vehicle or iron) and adult treatment (vehicle or PER) as fixed factors. ** indicates a significant main effect of iron (p = 0.005) in the retention test\u003c/p\u003e","description":"","filename":"OnlineDaSilvaetalFig2.png","url":"https://assets-eu.researchsquare.com/files/rs-3809589/v1/2f5386664d672ae276d720ed.png"},{"id":49540632,"identity":"c934eae0-881c-419d-a429-d48eef642ff5","added_by":"auto","created_at":"2024-01-12 17:20:10","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":5647,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of PER on inhibitory avoidance memory in rats treated neonatally with iron\u003c/strong\u003e. Inhibitory avoidance task was performed in rats treated neonatally with vehicle (Sorbitol, Sorb) or iron (30 mg/kg of Fe2+) and given vehicle (Veh) or PER (2.0 mg/kg) in adulthood (3 months of age) for 21 days. Sorb-Veh N = 16, Sorb-PER N = 14, Iron-Veh N = 14, Iron-PER N = 13. Data expressed as mean ± S.E.M. Statistical analysis was performed using two-way ANOVA, with neonatal treatment (vehicle or iron) and adult treatment (vehicle or PER) as fixed factors. ** indicates a significant main effect of iron (p = 0.001); # indicates a significant interaction between iron x PER (p = 0.021)\u003c/p\u003e","description":"","filename":"OnlineDaSilvaetalFig3.png","url":"https://assets-eu.researchsquare.com/files/rs-3809589/v1/89627ba4a97daa5a56d04fbf.png"},{"id":49540634,"identity":"c003235b-aa6d-452b-a55c-c5586a36c9e3","added_by":"auto","created_at":"2024-01-12 17:20:10","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":334321,"visible":true,"origin":"","legend":"\u003cp\u003eWestern blot of phosphorylated form (S845) pGLUA1 AMPA receptor subunit (\u003cstrong\u003ea\u003c/strong\u003e) and its total levels GLUA1 (\u003cstrong\u003ea\u003c/strong\u003e) in the hippocampus of rats treated with vehicle (Sorbitol, Sorb) or iron (Fe) neonatally and treated with vehicle (Veh) or Perampanel (PER) for 21 days in the adulthood (3 months of age). Twenty-five μg of protein, normalized to β-actin, were separated on SDS-PAGE and probed with specific antibodies. Representative Western blots for GLUA1, pGLUA1, and β-actin are in the top panel. Statistical analysis was performed using two-way ANOVA, and Tukey’s multiple comparison test. Data expressed as mean ± S..EM. pGLUA1 - Sorb-Veh N = 5, Sorb-PER N = 3, Fe-Veh N = 7, Fe-PER N = 5; GLUA1 – Sorb-Veh N = 4, Sorb-PER N = 3, Fe-Veh N = 5, Fe-PER N = 6; pGLUA2 - Sorb-Veh N = 4, Sorb-PER N = 3, Fe-Veh N = 7, Fe-PER N = 6; GLUA2 - Sorb-Veh N = 4, Veh-PER N = 3, Fe-Veh N = 5, Fe-PER N = 6. * Indicates significant differences between Sorb-Veh vs Fe-Veh vs Fe-PER (p\u0026lt;0.05)\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-3809589/v1/74e5125985e947f68bd5dc7e.jpeg"},{"id":49540633,"identity":"aa05bada-6e28-45ec-a366-14268d0d11ae","added_by":"auto","created_at":"2024-01-12 17:20:10","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":9231,"visible":true,"origin":"","legend":"\u003cp\u003emRNA expression of \u003cem\u003eGRIA1\u003c/em\u003e, \u003cem\u003eGRIA2\u003c/em\u003e, \u003cem\u003eDLG4\u003c/em\u003e, and \u003cem\u003eCAC\u003c/em\u003e in the hippocampus of adult rats treated neonatally with vehicle (Sorbitol, Sorb) or iron (30 mg/kg of Fe) and given vehicle (Veh) or PER (2.0 mg/kg) at adulthood (3 months of age). \u003cem\u003e\u003cstrong\u003eGRIA1\u003c/strong\u003e\u003c/em\u003e - Sorb-Veh N = 3, Sorb-PER N = 3, Fe-Veh N = 6, Fe-PER N = 5; \u003cem\u003e\u003cstrong\u003eGRIA2\u003c/strong\u003e\u003c/em\u003e - Sorb-Veh N = 4, Sorb-PER N = 4, Fe-Veh N = 7, Fe-PER N = 8\u003cstrong\u003e; \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eDLG4\u003c/strong\u003e\u003c/em\u003e - Sorb-Veh N = 3, Sorb-PER N = 4, Fe-Veh N = 5, Fe-PER N = 6; \u003cem\u003e\u003cstrong\u003eCAC\u003c/strong\u003e\u003c/em\u003e - Sorb-Veh N = 4, Sorb-PER N = 4, Fe-Veh N = 5, Fe-PER N = 5. Data expressed as mean ± S.E.M. Statistical analysis was performed using two-way ANOVA * Indicates significant main effects of neonatal iron treatment, \u003cem\u003eGRIA1\u003c/em\u003e (p = 0.035); \u003cem\u003eDLG4\u003c/em\u003e (p = 0.030)\u003c/p\u003e","description":"","filename":"OnlineDaSilvaetalFig5.png","url":"https://assets-eu.researchsquare.com/files/rs-3809589/v1/860fd2841c14325c13786a15.png"},{"id":56043089,"identity":"1de1cafb-5c45-4526-84d1-56a075a4eecb","added_by":"auto","created_at":"2024-05-07 20:10:13","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":802335,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3809589/v1/95152bc9-7a63-4ea4-ac02-1617834d1bbf.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Effects of the AMPAr antagonist, Perampanel, on Cognitive Function in Rats Exposed to Neonatal Iron Overload","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eAging is a stochastic phenomenon that progressively and irreversibly affects all living organisms. It is characterized by a precise mosaic of cellular and tissue changes that gradually reduce the organism's adaptability to its environment [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. This decline in the body's biochemical and physiological functions is the result of the interplay between genetic factors, the environment, lifestyle, and the extent to which these components can cause DNA damage and hinder its repair [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Morphofunctional, histologic, and chemical disturbances also manifest within this system, primarily due to elevated levels of free radicals (FRs), resulting in oxidative stress [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe progression of degenerative damage may be exacerbated by elevated levels of certain metals such as iron, that when present in excess, can increase the permeability of the blood-brain barrier, leading to internal inflammation and neuronal toxicity. This association is well established in neurodegenerative diseases, where high iron levels have been identified in key pathological features, including neurofibrillary tangles in Alzheimer's disease (AD) [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e] and protein misfolding and aggregation in mitochondrial dysfunction [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eDespite the large amount of evidence in the literature that correlates iron accumulation in the Central Nervous System (CNS) and neurodegenerative diseases [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e] further investigations are still needed to elucidate more clearly the mechanisms underlying iron neurotoxicity. In previous studies, our research group established an animal model of iron administration in the neonatal period, when maximum iron absorption into the CNS occurs, and described that the insult caused in the process generated behavioral and cognitive impairments [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], damaging recognition and emotional memory [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Furthermore, it was found that iron administration in the neonatal period led to oxidative damage [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], increased expression of apoptosis markers [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], changes in mitochondrial function [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], impaired autophagy [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e] and induced the accumulation of ubiquitinated proteins [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn addition, several studies have reported profound changes in brains of patients affected by Parkinson\u0026rsquo;s disease (PD), including significant depletion of the antioxidant glutathione (GSH), reduced mitochondrial complex I activity, DNA oxidation, and elevated levels of free iron [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. These findings are consistent with the work of Zhu et al. [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], who observed elevated iron levels in degenerating dopaminergic neurons, and the research of Castellani et al. [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], who identified iron-reactive Lewy bodies along with aggregated proteins such as α-synuclein.\u003c/p\u003e \u003cp\u003eWhen generated in sufficient quantities, FRs can suppress defense mechanisms against oxidative stress, leading to metabolic and cellular perturbations, including DNA strand breaks and changes in intracellular Ca\u0026sup2;+ levels. These changes result from increased permeability of calcium channels, including AMPA-type glutamatergic receptors (AMPARs). Importantly, there is growing evidence that Ca\u0026sup2;+ permeability in AMPARs directly influences synaptic plasticity and contributes to the pathophysiology of various neuronal disorders [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe development of novel drugs targeting AMPA receptor antagonism is a growing field that aims to mitigate the harmful effects of calcium ion accumulation and provide neuroprotection [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Perampanel (PER) represents the first of a novel class of antiepileptic drugs that utilize non-competitive AMPAR antagonism. It has demonstrated efficacy and clinical tolerability in patients 12 years of age and older [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Notably, this drug was recently approved in the U.S.A. for the treatment of epilepsy, including partial-onset seizures and primary tonic-clonic seizures, and as adjunctive therapy in the treatment of Lafora disease and Lance-Adams syndrome. It has also shown promise in reducing myoclonic seizures and providing neuroprotection [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eGiven the clinical importance of understanding the mechanisms of action of new drugs in the field of neuroprotection, this study sought to investigate the neuroprotective capabilities of PER, and the involvement of AMPAR in iron-induced neurotoxicity. Specifically, neonatal Wistar rats were exposed to elevated iron levels and the effect of iron accumulation on the expression of different subunits of the AMPA receptor was evaluated. We also aimed at evaluating whether PER would be able to attenuate iron-induced memory impairments.\u003c/p\u003e \u003cp\u003eThe study encompassed behavioral assessments of cognition in the animals, as well as an examination of the hippocampus to provide cellular insights into the mechanisms of neuroprotection and associated pathways. The study evaluated the expression and phosphorylation levels of AMPA receptor subunits, GluA2 and GluA1, and assessed the mRNA expression of proteins such as PSD-95, a scaffolding protein for the AMPA receptor, and stargazer transmembrane interaction protein, a transmembrane protein responsible for anchoring and stabilizing AMPA receptors in the plasma membrane.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Animals\u003c/h2\u003e \u003cp\u003eTwenty-three pregnant Wistar rats were obtained from the Centro de Reprodu\u0026ccedil;\u0026atilde;o e Experimenta\u0026ccedil;\u0026atilde;o em Animais de Laborat\u0026oacute;rio (CREAL), Federal University of Rio Grande do Sul, Porto Alegre, RS, Brazil, where the pharmacological treatments and behavioral experiments were conducted. After birth, each litter was adjusted within 48h to contain eight rat pups including offspring of both genders. Each pup was kept together with its mother in a plastic cage with sawdust bedding in a room temperature of 21\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C and a 12/12 h light/dark cycle. At the age of 3 weeks, pups were weaned, and the males were selected and maintained in groups of three to five in individually ventilated cages with sawdust bedding. For postnatal treatments, animals were given standardized pellet food and tap water ad libitum. All behavioral experiments were performed at light phase between 09:00 a.m and 4:30 p.m. All experimental procedures were performed in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals (8th Edition 2011) and the Brazilian Guidelines for the Care and Use of Animals in Research and Teaching (DBCA, published by CONCEA, MCTI, Brazil). All procedures performed in studies involving animals were in accordance with the ethical standards of the institution at which the studies were conducted and approved by the Institutional Ethics Committee of the Federal University of Rio Grande do Sul (permit number: 35604). All efforts were made to minimize the number of animals and their suffering. We used the ARRIVE guidelines 2.0 for reporting animal research.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Experimental Design\u003c/h2\u003e \u003cp\u003eWith the aim of evaluating the effects of iron overload on the expression of AMPA receptor (AMPAR) subunits and proteins related to AMPAR functionality and investigating the effects of subchronic use of PER, a non-competitive AMPAR antagonist, on the cognitive deficit of animals, litters were randomly assigned (simple randomization) to receive either iron carbonyl (N\u0026thinsp;=\u0026thinsp;27) or vehicle solution (N\u0026thinsp;=\u0026thinsp;30). Only male pups from each litter received the treatment from postnatal days 12th to 14th, and each single animal represented an experimental unit. All litters (those that received iron and those that received vehicle) were kept in the same room with their respective mothers under the same environmental conditions. Subsequently, at the age of 3 months, the two groups were further semi-randomly divided into four groups, resulting in four experimental groups: Veh-Veh (N\u0026thinsp;=\u0026thinsp;16, control group), Veh-Perampanel (N\u0026thinsp;=\u0026thinsp;14), Iron-Veh (N\u0026thinsp;=\u0026thinsp;14), and Iron-Perampanel (N\u0026thinsp;=\u0026thinsp;13). During treatments, all groups of rats were kept in the same room under the same environmental conditions. Although no significant stress or suffering were expected from the treatments with iron or PER, animals were daily inspected for signals of distress, suffering and unexpected health issues. None of the animals had to be withdrawn from the study due to health issues. After 14 days of PER treatment, rats were tested in the novel object recognition task and open field. Seven days later, they were submitted to inhibitory avoidance memory task. Twenty-four hours after the completion of behavioral task, all rats were euthanized by decapitation, and their hippocampi were quickly removed and stored in \u0026minus;\u0026thinsp;80\u0026deg;C freezer for posterior RT-PCR or western blot analysis. Experimental design is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSample size was estimated based on previous studies published from our research group and others. Usually, behavioral tasks, such as those used in the present study, require a sample size between 12\u0026ndash;15 animals in each group. The use of this sample size allows consistent and reproducible results for behavioral analysis [\u003cspan additionalcitationids=\"CR10\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Based on previously published research by our group, for biochemical analysis, including blood tests, gene expression, and protein analysis using western blot, we used a sample size varying from 3 to 6 animals in each group [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. No inclusion or exclusion criteria were established \u003cem\u003ea priori\u003c/em\u003e. No exclusions of animals or data points were performed.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Pharmacological Treatments\u003c/h2\u003e \u003cdiv id=\"Sec6\" class=\"Section3\"\u003e \u003ch2\u003e2.3.1 Neonatal Iron Treatment\u003c/h2\u003e \u003cp\u003eThe neonatal iron treatment was performed as previously described [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Briefly, 12-day-old rat pups from randomly assigned litters (simple randomization) received a single oral daily dose (10 ml/kg solution volume) of vehicle (5% sorbitol in water, control group) or 30 mg/kg of body weight of Fe2+ (iron carbonyl, Sigma-Aldrich, S\u0026atilde;o Paulo, Brazil) via a metallic gastric tube (gavage), over 3 days (postnatal days 12\u0026ndash;14). Rats in each group (vehicle or iron) were derived from 5 to 6 different litters, to avoid a possible litter effect.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section3\"\u003e \u003ch2\u003e2.3.2 Perampanel\u003c/h2\u003e \u003cp\u003eAdult (3-month-old) rats, treated neonatally with vehicle or iron, as described above, received a daily gavage of vehicle (Tween 80 \u0026ndash; saline solution 1:16 v/v) or Perampanel (PER) (2 mg/kg, Fycompa\u0026reg;) for 21 consecutive days. Drug solutions were freshly prepared immediately prior to administration, with dissolving the tablet and calculating the dose. Rats were euthanized by decapitation at 24h after the last injection of PER treatment. Brains were quickly dissected and hippocampi were isolated and stored at -80\u0026ordm;C for subsequent RT-qPCR. The dose of PER was chosen based on previous animal studies [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e Potential confounders, such as the type of treatments or animal/cage location, were avoided throughout the experiment by marking animals with a color/number code on the tail, the identification of cages by number and treatment and the organization of cages according to their treatment/number, always on the same rack. Identifications of animals and cages were routinely checked and renewed whenever necessary. All research team members were aware of the allocation of animals during the treatments, except for the person that performed the behavioral testing.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Behavioral analysis\u003c/h2\u003e \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e \u003ch2\u003e2.4.1 Open field\u003c/h2\u003e \u003cp\u003eOpen field exploratory activity was analyzed 24 h before object recognition training session. This behavioral session was also used as habituation to the field. An open field arena (40 cm \u0026times; 45 cm \u0026times; 60 cm), made of plywood with a front glass wall and floor divided into 12 equal squares by black lines, was used. The animals were placed in the lower left corner to then explore freely for 5 minutes. The experimental session was videotaped and subsequently analyzed by an experimenter blinded to the animals\u0026rsquo; experimental condition The latency to start locomotion, line crossings, number of rearings, and the number of fecal pellets were counted using a stopwatch and two manual counters during the experimental sessions. The evaluated parameters are indicative of the animals\u0026rsquo; locomotion and anxiety [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section3\"\u003e \u003ch2\u003e2.4.2 Novel Object Recognition Test\u003c/h2\u003e \u003cp\u003eAnimals were habituated to the empty open field, 24 h before the training session, as described above. In the training session, rats were placed in the same open rectangular field (45 \u0026times; 40 \u0026times; 60 cm), with sawdust covering its floor, in which they were exposed to two identical objects (A1 and A2), for 5 minutes. To evaluate the long-term memory retention (LTM), 24 h after the training session, the rats were allowed to explore the open field for 5 minutes in the presence of two objects: the familiar object (A) and a new object (B). These objects were placed in the same locations as in the training session. All objects used had similar textures, colors and sizes, but different shapes. The objects were positioned in two adjacent corners, 9 cm from the walls and between trials, the objects were washed with 10% ethanol [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAll experimental sessions were videotaped and subsequently analyzed by an experimenter blinded to the animals\u0026rsquo; experimental condition. Exploration of the objects was measured using two stopwatches to record the time spent exploring them during the experimental sessions. Exploration was defined as: smelling or touching the object with the nose or the forepaws. The recognition index was expressed by the equation TB/(TA\u0026thinsp;+\u0026thinsp;TB), where: TA\u0026thinsp;=\u0026thinsp;time spent exploring the familiar object (A) and TB\u0026thinsp;=\u0026thinsp;time spent exploring the new object [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section3\"\u003e \u003ch2\u003e2.4.3 Inhibitory Avoidance Task\u003c/h2\u003e \u003cp\u003eWe used the single-trial, step-down inhibitory avoidance (IA) conditioning as an established model of fear-motivated memory. In IA training, animals learn to associate a location in the training apparatus with an aversive stimulus (footshock). The IA behavioral training and retention test procedures were described in previous reports [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. The IA apparatus was a 50 \u0026times; 25 \u0026times; 25-cm3 acrylic box (Albarsh, Porto Alegre, Brazil) whose floor consisted of parallel stainless-steel bars (1-mm diameter) spaced 1 cm apart. A 7-cm wide, 2.5-cm high platform was placed on the floor of the box against the left wall. On the training trial, rats were placed on the platform, and their latency to step-down on the grid with all four paws was measured with an automatic device. Immediately after stepping down on the grid, rats received a mild footshock (0.4 mA) and were removed from the apparatus immediately afterwards. A retention test trial was carried out 24 h after the training trial. The retention test trial was procedurally identical to training, except that no footshock was presented. Step-down latencies (in seconds) on the retention test trial (maximum 180 s) were used as a measure of IA retention. Behavioral procedures were performed by an experimenter blinded to animals\u0026rsquo; experimental condition.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Preparation of Samples for Molecular Analysis\u003c/h2\u003e \u003cp\u003eTwenty-four hours after the completion of inhibitory avoidance testing, rats were euthanized by decapitation and hippocampi were rapidly dissected. For organization purposes, and to ensure that the rapidly dissected hippocampal samples were immediately placed in the adequate solutions (RNA-later for RT-qPCR and protease inhibitor for WB) and snap-frozen, we used a procedure in which the left hemisphere was placed in a refrigerated RNA-later solution (Sigma-Aldrich, S\u0026atilde;o Paulo, Brazil) for RT-qPCR assays and the right hemisphere was placed in a protease inhibitor solution (Complete Mini, Roche Applied Science, Mannheim, Germany) also refrigerated for the Western blot tests. Samples were stored at -80\u0026deg;C for subsequent analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Western Blot Analysis\u003c/h2\u003e \u003cp\u003eProteins were extracted in 1X RIPA buffer (Thermo Fisher Scientific, Waltham, USA) containing protease inhibitor cocktail and sodium orthovanadate (1mM). After 10 min in ice, samples were centrifuged at 13,500 rpm for 10 min. The supernatant was collected, and the protein content was determined using Bradford assay [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Aliquots were stored at \u0026minus;\u0026thinsp;80\u0026deg;C. Twenty-five micrograms of protein were separated on a 9% SDS polyacrylamide gel and transferred electrophoretically to a PVDF membrane (Immobilon-P, Millipore, Burlington, USA). Membranes were blocked with 5% nonfat dry milk in TBS containing 0.1% Triton X-100 and were incubated overnight with one of the following antibodies: anti-β-actin (cat. # ab6276, Abcam, Cambridge, UK) at 1:5,000, anti-phospho GluA1 (S845) (cat. # ab7632, Abcam, Cambridge, UK) at 1:1,000, anti-phospho GuA2 (S880) (cat. # ab52180) Abcam, Cambridge, UK) at 1:500, anti-GluA1 (cat. # ab31232, Abcam, Cambridge, UK) at 1:1,000, and anti-GluA2 (cat. # ab133477, Abcam, Cambridge, UK) at 1:1,000. Goat polyclonal anti-mouse IgG (cat. # A4416) at 1:10,000, and goat polyclonal anti-rabbit IgG (cat. # A0545) at 1:80,000 (both from Sigma-Aldrich, St. Louis, USA) secondary antibodies were used and detected using Millipore Immobilon Western Chemiluminescent HRP Substrate (Millipore, Burlington, USA). Prestained molecular weight protein markers (Precision Plus Protein\u0026trade; Kaleidoscope\u0026trade; Prestained Protein Standards, Bio-Rad Laboratories, Hercules, USA) were used to determine the detected bands' molecular weight and confirm target specificity of antibodies. Images were obtained using an ImageQuant LAS 500 (GE Healthcare, Chicago, USA). The densitometry quantification was performed by an experimenter blinded to groups\u0026rsquo; experimental condition, using ImageJ software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://rsb.info.nih.gov/ij/\u003c/span\u003e\u003cspan address=\"http://rsb.info.nih.gov/ij/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Phosphorylation levels were normalized by the respective total protein levels. Total blotting protein levels of samples were normalized according to each sample\u0026rsquo;s β-actin protein levels [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.7 RT-PCR\u003c/h2\u003e \u003cp\u003eTRIZOL (Life Techonologies, Carlsbad, USA) was used to extract and isolate total RNA according to the manufacturer's instructions. Total RNA quantity and quality were determined spectrophotometrically using a BioPhotometer Plus (Eppendorf, Germany). Complementary DNA (cDNA) was synthesized from 2\u0026micro;g of total RNA using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems\u0026trade;, Foster City, USA). The cDNA from each sample was used as a template for gene expression analysis through real-time quantitative polymerase chain reaction (RT-qPCR) using GoTaq\u0026reg; Probe qPCR Master Mix (Promega, Madison, USA) and specific primers for each gene: the transmembrane interacting proteins stargazer (\u003cem\u003eCAC\u003c/em\u003e gene) and scaffold PSD-95 (\u003cem\u003eDLG4\u003c/em\u003e gene), GluA1 (\u003cem\u003eGRIA1\u003c/em\u003e gene) and GluA2 (\u003cem\u003eGRIA2\u003c/em\u003e gene) and the constitutive genes Gadp and Rpl13. Primers' sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. RTqPCR conditions were optimized to yield an amplification efficiency of 95% -105%. Products were run on an agarose gel to verify the correct amplification length. The specificity of the amplified products was confirmed by analyzing the dissociation (melt) curves at the end of each reaction. The relative expression of the genes analyzed was calculated for each sample by the relative comparative (ΔΔCT) method. All samples were run in triplicates.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used in RT-qPCR analysis\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequences\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCACNG2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTTCAAAGGTCTGTGCAAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAAGCAGGATCACACTCAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDLG4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAGTGCTTCTCAGCCATCGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTAGGGGCCTGAGAGGTCTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGRIA1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGAAGCGGATGAAGGGTTTCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGATTGCATGGACTTGGGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGRIA2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGGGAGGTGATTCCAAGGAAAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACCAGCATTGCCAAACCAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTCTCCTCTGACTTCAACAGCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACCACCCTGTTGCTGTAGCCAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRPL13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCAAGGTGTTTGACGGCATCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTACTTCCAGCCAACCTCGTGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eStatistical Analysis\u003c/b\u003e \u003c/p\u003e \u003cp\u003eData were tabulated and analyzed using SPSS v software. 26.0 (IBM, Armonk, NY, USA). The assumptions of normality and homogeneity of variances were assessed with the Shapiro-Wilk test and Levene\u0026rsquo;s test, respectively. Behavioral parameters evaluated in the open field, recognition indexes, latencies to step-down and data from Western blot and RT-PCR experiments are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error (S.E.). Statistical comparisons were performed using two-way analysis of variance (2-way ANOVA), with neonatal treatment (vehicle or iron) and adult treatment (vehicle or perampanel) as fixed factors, to identify possible interaction effects of iron treatment and PER. One-way ANOVA, followed by Tukey\u0026rsquo;s post hoc test, was used to test differences between the experimental groups. Effect sizes of the results obtained for 2-way ANOVA were analyzed with Partial Eta Squared (ηρ2) test. In all comparisons, p values less than 0.05 were considered to indicate statistical significance.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cp\u003eWe aimed at investigating whether PER could recover memory deficits induced by iron overload. Firstly, animals were tested in the object recognition task. The comparison of recognition indexes using 2-way ANOVA indicated that the experimental groups did not show significant differences in the training session. No significant main effect of iron treatment (F\u003csub\u003e(1,38)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.03, ηρ2\u0026thinsp;=\u0026thinsp;0.001, p\u0026thinsp;=\u0026thinsp;0.864), PER (F\u003csub\u003e(1,38)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.00, ηρ2\u0026thinsp;\u0026lt;\u0026thinsp;0.0001, p\u0026thinsp;=\u0026thinsp;0.994), nor interactions were observed (F\u003csub\u003e(1,38)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.177, ηρ2\u0026thinsp;=\u0026thinsp;0.005, p\u0026thinsp;=\u0026thinsp;0.677, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). However, when we compared the recognition indices in the long-term memory test session, we noticed a significant main effect of iron treatment in the neonatal period (F\u003csub\u003e(1,38)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;8.68, ηρ2\u0026thinsp;=\u0026thinsp;0.186, p\u0026thinsp;=\u0026thinsp;0.005), revealed by a significantly lower recognition index in these groups, indicating that iron causes recognition memory impairments, according to previous results from our research group. No significant main effect of PER in the adulthood was found (F\u003csub\u003e(1,38)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.012, ηρ2\u0026thinsp;\u0026gt;\u0026thinsp;0.0001, p\u0026thinsp;=\u0026thinsp;0.912). Although the recognition index of the iron-treated group that received PER (Fe-PER) in the adulthood was higher than the Fe-Veh group, interaction between iron and PER felt short of significance (F\u003csub\u003e(1,38)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;3.75, ηρ2\u0026thinsp;=\u0026thinsp;0.090, p\u0026thinsp;=\u0026thinsp;0.060, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). However, multiple comparisons of retention test recognition indexes indicated that the iron-treated group that received PER in adulthood (Fe-PER), showed no difference in comparison to the control group (Sorb-Veh; p\u0026thinsp;=\u0026thinsp;0.137), suggesting that treatment with PER in adulthood was capable of improving, at least in part, the memory of animals treated with iron in the neonatal period (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eNext, we decided to test the animals in the inhibitory avoidance task, a type of emotionally regulated memory task. The comparison of latencies using 2-way ANOVA indicated that the experimental groups did not show significant differences in the training session. We observed no significant main effects of iron (F\u003csub\u003e(1,53)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.43, ηρ2\u0026thinsp;=\u0026thinsp;0.008, p\u0026thinsp;=\u0026thinsp;0.515), PER (F\u003csub\u003e(1,53)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;1.13, ηρ2\u0026thinsp;=\u0026thinsp;0.021, p\u0026thinsp;=\u0026thinsp;0.293), nor interaction (F\u003csub\u003e(1,53)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.59, ηρ2\u0026thinsp;=\u0026thinsp;0.011, p\u0026thinsp;=\u0026thinsp;0.445). However, when we compared the latencies in the long-term memory test session, we noticed a significant main effect of iron (F\u003csub\u003e(1,53)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;13.72, ηρ2\u0026thinsp;=\u0026thinsp;0.206, p\u0026thinsp;=\u0026thinsp;0.001), indicating that iron causes emotional memory impairment, confirming previous results from our research group. No significant main effect of PER in the adulthood (F\u003csub\u003e(1,53)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.79, ηρ2\u0026thinsp;=\u0026thinsp;0.015, p\u0026thinsp;=\u0026thinsp;0.379). However, 2-way ANOVA revealed a significant interaction between iron and PER (F\u003csub\u003e(1,53)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;5.70, ηρ2\u0026thinsp;=\u0026thinsp;0.097, p\u0026thinsp;=\u0026thinsp;0.021, Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e), Moreover, multiple comparisons indicated that the iron-treated group that received PER in adulthood (Fe-PER) showed no difference compared to the control group (Sorb-Veh; p\u0026thinsp;=\u0026thinsp;0.200). These findings suggest that treatment with PER in the adulthood was able to reverse the emotional memory impairment induced by iron in the neonatal period (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo control for possible motor, exploratory, or motivational alterations induced by iron treatment or PER we analyzed behavior in an open field. Multiple comparisons of the parameters analyzed in the open field showed no statistically significant differences among the groups in the latency to start locomotion (F\u003csub\u003e(3,38)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;2.25, p\u0026thinsp;=\u0026thinsp;0.099), number of crossings (F\u003csub\u003e(3,38)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;1.71, p\u0026thinsp;=\u0026thinsp;0.182), number of rearings (F\u003csub\u003e(3,38)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;2.68, p\u0026thinsp;=\u0026thinsp;0.061), and number of fecal pellets produced during the session (F\u003csub\u003e(3,38)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;2.13, p\u0026thinsp;=\u0026thinsp;0.112) (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eOpen field behavior\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGroup\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLatency to start locomotion (s)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNumber of line crossings\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNumber of rearings\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNumber of fecal pellets\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eN\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSorb-Veh\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e9.72\u0026thinsp;\u0026plusmn;\u0026thinsp;1.27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e100.00\u0026thinsp;\u0026plusmn;\u0026thinsp;2.94\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e31.75\u0026thinsp;\u0026plusmn;\u0026thinsp;1.52\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e1.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.43\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSorb-PER\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e7.31\u0026thinsp;\u0026plusmn;\u0026thinsp;1.47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e104.56\u0026thinsp;\u0026plusmn;\u0026thinsp;6.82\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e31.56\u0026thinsp;\u0026plusmn;\u0026thinsp;2.26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e2.78\u0026thinsp;\u0026plusmn;\u0026thinsp;0.68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIron-Veh\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e12.12\u0026thinsp;\u0026plusmn;\u0026thinsp;1.26.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e89.73\u0026thinsp;\u0026plusmn;\u0026thinsp;3.70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e37.27\u0026thinsp;\u0026plusmn;\u0026thinsp;0.98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e1.54\u0026thinsp;\u0026plusmn;\u0026thinsp;0.51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIron-PER\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e8.58\u0026thinsp;\u0026plusmn;\u0026thinsp;1.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e104.10\u0026thinsp;\u0026plusmn;\u0026thinsp;7.51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e31.40\u0026thinsp;\u0026plusmn;\u0026thinsp;2.28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e3.30\u0026thinsp;\u0026plusmn;\u0026thinsp;0.97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eOpen-field behavior was analyzed during the habituation session for the object recognition task. Data are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. Multiple comparisons indicated no significant differences when the latency to start locomotion, number of crossings, number of rearings, and fecal pellets produced during the session were compared\u003c/p\u003e \u003cp\u003eTo gain a better understanding on the mechanisms involved with the deleterious effects of iron excess on cognition and possible reversion effects of PER, we next decided to examine the levels of GLUA1 and GLUA2 AMPAR subunits and their phosphorylated forms. Two-way ANOVA showed no significant main effects of iron (F\u003csub\u003e(1,14)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.31, ηρ2\u0026thinsp;=\u0026thinsp;0.022, p\u0026thinsp;=\u0026thinsp;0.585), PER (F\u003csub\u003e(1,14)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.14, ηρ2\u0026thinsp;=\u0026thinsp;0.010, p\u0026thinsp;=\u0026thinsp;0.711), nor interactions (F\u003csub\u003e(1,14)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.024, ηρ2\u0026thinsp;=\u0026thinsp;0.002, p\u0026thinsp;=\u0026thinsp;0.880) when analyzing total GLUA1 levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb). However, when comparing pGLUA1 levels, a significant interaction (F\u003csub\u003e(1,16)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;6.99, ηρ2\u0026thinsp;=\u0026thinsp;0.304, p\u0026thinsp;=\u0026thinsp;0.0177) between iron and PER treatments was revealed (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). Although no main effect of iron (F\u003csub\u003e(1,16)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;1.93, ηρ2\u0026thinsp;=\u0026thinsp;0.107 p\u0026thinsp;=\u0026thinsp;0.184) or PER (F\u003csub\u003e(1,16)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;1.12, ηρ2\u0026thinsp;=\u0026thinsp;0.065, p\u0026thinsp;=\u0026thinsp;0.306) were observed, multiple comparisons of groups showed a significant difference between the group treated with iron in the neonatal period (Fe-Veh) and the control group (Sorb-Veh, p\u0026thinsp;=\u0026thinsp;0.024, Tukey\u0026rsquo;s multiple comparison test), and a significant difference between the iron-treated group that received Vehicle (Fe-Veh) and the iron-treated group that received PER in the adulthood (Fe-PER, p\u0026thinsp;=\u0026thinsp;0.041, Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). These findings suggest that iron increased pGLUA1 and PER was able to reverse this effect.\u003c/p\u003e \u003cp\u003eIn relation to GLUA2, neither total GLUA2 levels nor p-GLUA2 were affected by iron or PER. Two way ANOVA analysis of total GLUA2 levels indicated no main effect of iron (F\u003csub\u003e(1,14)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.21, ηρ2\u0026thinsp;=\u0026thinsp;0.015, p\u0026thinsp;=\u0026thinsp;0.653), PER (F\u003csub\u003e(1,14)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.57, ηρ2\u0026thinsp;=\u0026thinsp;0.039, p\u0026thinsp;=\u0026thinsp;0.463), nor interaction (F\u003csub\u003e(1,14)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.45, ηρ2\u0026thinsp;=\u0026thinsp;0.031, p\u0026thinsp;=\u0026thinsp;0.513, Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed). Likewise, no significant main effect of iron (F\u003csub\u003e(1,16)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;1.20, ηρ2\u0026thinsp;=\u0026thinsp;0.070, p\u0026thinsp;=\u0026thinsp;0.289), PER (F\u003csub\u003e(1,16)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.40, ηρ2\u0026thinsp;=\u0026thinsp;0.024, p\u0026thinsp;=\u0026thinsp;0.536), nor interaction (F\u003csub\u003e(1,16)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.92, ηρ2\u0026thinsp;=\u0026thinsp;0.054, p\u0026thinsp;=\u0026thinsp;0.352) were revealed when analyzing p-GLUA2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec). Also, multiple comparison test revealed no significant differences among the groups.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe also sought to analyze mRNA expression of AMPAR subunits, GLUA1 and GLUA2, and scaffolding proteins related to AMPAR anchoring in the membrane, stargazin and PSD-95. As can be seen in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e, the analysis of \u003cem\u003eGRIA1\u003c/em\u003e gene expression, indicated a significant main effect of iron treatment (F\u003csub\u003e(1,13)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;5.52, ηρ2\u0026thinsp;=\u0026thinsp;0.298, p\u0026thinsp;=\u0026thinsp;0.035), which increased GRIA1 expression. No significant main effect of PER (F\u003csub\u003e(1,13)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;2.33, ηρ2\u0026thinsp;=\u0026thinsp;0,152, p\u0026thinsp;=\u0026thinsp;0.151) nor interaction was observed (F\u003csub\u003e(1,13)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;1.48, ηρ2\u0026thinsp;=\u0026thinsp;0.103, p\u0026thinsp;=\u0026thinsp;0.245). On the other hand, \u003cem\u003eGRIA2\u003c/em\u003e mRNA expression was not affected by iron treatment (F\u003csub\u003e(1,19)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;2.48, ηρ2\u0026thinsp;=\u0026thinsp;0.115, p\u0026thinsp;=\u0026thinsp;0.132). No significant main effect of PER (F\u003csub\u003e(1,19)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;1.07, ηρ2\u0026thinsp;=\u0026thinsp;0.053, p\u0026thinsp;=\u0026thinsp;0.314) nor significant interaction was observed when analyzing \u003cem\u003eGRIA2\u003c/em\u003e mRNA expression (F\u003csub\u003e(1,19)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.59, ηρ2\u0026thinsp;=\u0026thinsp;0.030, p\u0026thinsp;=\u0026thinsp;0.453).\u003c/p\u003e \u003cp\u003eAdditionally, we found a significant main effect of iron on the mRNA expression of the \u003cem\u003eDLG4\u003c/em\u003e gene (F\u003csub\u003e(1,14)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;13.44, ηρ2\u0026thinsp;=\u0026thinsp;0.490, p\u0026thinsp;=\u0026thinsp;0.03), in which iron treatment decreased the expression of this gene, that codes for the PSD-95 protein. No significant main effect of PER (F\u003csub\u003e(1,14)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;3.61, ηρ2\u0026thinsp;=\u0026thinsp;0.205, p\u0026thinsp;=\u0026thinsp;0.078) nor interaction was found (F\u003csub\u003e(1,14)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.74, ηρ2\u0026thinsp;=\u0026thinsp;0.050, p\u0026thinsp;=\u0026thinsp;0.403). The analysis of mRNA expression of \u003cem\u003eCAC\u003c/em\u003e revealed no significant main effects of iron (F\u003csub\u003e(1,14)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.64, ηρ2\u0026thinsp;=\u0026thinsp;0.044, p\u0026thinsp;=\u0026thinsp;0.437), PER (F\u003csub\u003e(1,14)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.03, ηρ2\u0026thinsp;=\u0026thinsp;0.002, p\u0026thinsp;=\u0026thinsp;0.866), nor interaction (F\u003csub\u003e(1,14)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.06, ηρ2\u0026thinsp;=\u0026thinsp;0.005, p\u0026thinsp;=\u0026thinsp;0.804).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eThe present findings show that iron overload in the neonatal period resulted in cognitive impairment in both behavioral tests, as previously demonstrated by our research group [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Our results also showed that subchronic treatment with Perampanel (PER) in the adulthood was able to reverse the memory impairments induced by iron overload. No motor or exploratory alterations that could interfere with memory acquisition, following iron or PER treatments were observed when open field results were analyzed.\u003c/p\u003e \u003cp\u003eThe effect of PER on recognition memory corroborates the findings of Mohammad et al. [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], showing that PER improved object recognition ability in male rats in a pilocarpine model of status epilepticus. In addition, Alqahtani, et al [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], evaluating the anti-inflammatory effect of the co-administration of PER and Ketamine in a model of acute brain trauma, described an improvement in the percentage of spontaneous alternation and a higher percentage of discrimination index in the object recognition test with the association of PER. In the same study, it was found that the combination of the two substances reduced the central and peripheral expression of NF-κB and iNOS, markers associated with conditions of oxidative stress, mitochondrial damage, and imbalances in CNS hyperexcitability. Mitochondrial failure, which can be caused by iron overload [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e] has been linked to increased glutamate in the synaptic cleft, and consequent hyperexcitability.\u003c/p\u003e \u003cp\u003eA study by da Silva and coworkers [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], has revealed that iron accumulation during the neonatal period leads to mitochondrial damages. They also established a correlation between iron overload and the expression of proteins involved in mitochondrial fusion and fission mechanisms, such as DNM1L and OPA1. In addition, previous research reported increased expression of caspase-3, and decreased expression of the synaptic marker synaptophysin in the hippocampus of iron-treated rats [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eCNS hyperexcitability is known to be a consequence of Aß oligomer accumulation, a key aspect of AD pathophysiology. A study conducted by Bellingacci and coworkers [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e] showed that administration of PER not only reversed neuronal Aß-induced hyperexcitability, but also improved cognitive deficits in Aβ oligomers-injected mice. PER also decreased the expression of proinflammatory cytokines, particularly TNF-α, IL-1ß, and IL-6. In addition, it has been demonstrated that PER increases anti-inflammatory cytokines such as IL-10 and TGF-β1 [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. It's worth noting that iron overload in the CNS has been associated with increased levels of TNF-α and IL-1ß [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e], and the elevation of these proinflammatory cytokines is also observed in animal models with impaired memory [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e] and altered expression of AMPA receptors [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. This correlation suggests a potential bidirectional influence between iron overload, inflammation, and AMPA receptor metabolism.\u003c/p\u003e \u003cp\u003eAs PER is a selective, non-competitive antagonist of the AMPA receptor, it has lower toxicity and greater reach, blocking receptors containing both GluA1 and GluA2 subunits, two subunits present in the different AMPA receptor assemblies [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. This allows PER to interact in different conditions in which CNS injury alters the expression or transcription of any of the AMPAR subunits.\u003c/p\u003e \u003cp\u003eSeveral studies have consistently linked the expression of different AMPAR subunits and their associated proteins to neuronal and behavioral disorders [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. The structure of AMPAR has been well characterized and consists of combinations of the GluA1, GluA2, GluA3 and GluA4 subunits, which have approximately 70% homology in the peptide sequence [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. However, understanding of the possible relationship between the assembly of distinct receptor subunits and neurodegenerative diseases is only just beginning to emerge [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe Ca2 + permeability of AMPAR (CP-AMPAR) varies depending on whether the GluA2 subunit is present in the tetramer. The insertion of AMPARs that are permeable to calcium ions and can thus promote neurotoxicity, results from a decreased expression of genes encoding the GluA2 subunit or increased expression of genes encoding the GluA1 subunit [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. In our study, neonatal iron overload was able to increase the relative expression of the \u003cem\u003eGRIA1\u003c/em\u003e gene, which is responsible for the expression of the GluA1 subunit of the AMPA receptor, and decrease the relative expression of the \u003cem\u003eDLG4\u003c/em\u003e gene, which is responsible for the synthesis of the PSD-95 protein, a scaffolding protein of the AMPA receptor. This effect of iron on the expression of GluA1 has already been documented in a study evaluating the effect of a diet rich in iron on young rats, in which it was found that at the end of one month of iron supplementation, there was a 70% increase in the expression of GluA1 in the prefrontal cortex [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe correlation of the different AMPA subunits (GluA1 and GluA2) with the different scaffolding and cytoplasmic trafficking proteins has already been extensively studied, since a decrease in the expression of the AMPAR-GluA2 subunit in the hippocampus is accompanied by a decrease in PSD-95, while the levels of the transmembrane regulatory protein stargazin increase [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. As shown in the present study, iron overload significantly decreased the expression of the \u003cem\u003eDLG4\u003c/em\u003e gene, the gene encoding PSD-95, while it increased, although not significantly, the expression of \u003cem\u003eGRIA2\u003c/em\u003e, the gene encoding the AMPAR-GluA2 subunit. Despite these findings, iron overload and the use of PER did not significantly affect the expression of the \u003cem\u003eCAC\u003c/em\u003e gene, which encodes the stargazin protein.\u003c/p\u003e \u003cp\u003eIn addition to changes in the synthesis of the various proteins and structures that regulate the insertion and function of AMPA receptors, during the process of neuronal toxicity, neuroinflammation and neurodegeneration, the expression of the receptor subunits may be regulated by the administration of PER, as shown by Yang et al. [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e], who demonstrated that the chronic use of PER can positively regulate the GluA2 subunit. However, in the present study, PER decreased, although not significantly, the expression of the gene encoding GluA2 and especially GluA1 in the groups exposed to iron overload.\u003c/p\u003e \u003cp\u003eConsistent with the above, several studies have shown that increased gene expression of the GluA1 subunit, as well as the relatively higher GluA1:GluA2 ratio [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e] found in the present study, results in the synaptic insertion of a greater number of CP-AMPARs (Ca2 + ion-permeable AMPA receptors) [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e], demonstrating a unique relationship between receptor expression, trafficking, and insertion in a variety of animal models of neurodegenerative disease [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe fact that iron overload, in addition to increasing the expression of the GluA1 subunit, increased its phosphorylation, reinforces the hypothesis that the injury caused by the metal not only altered the Glua1/Glua2 ratio, but also altered the functional characteristics of the subunit.\u003c/p\u003e \u003cp\u003eAs demonstrated by western blot analyses, the injury caused by iron overload increased the phosphorylation of the GluA1 subunit, an effect reversed by the administration of PER. Despite the significant results, publications that studied the effect of PER on the phosphorylation of GluA1 receptors are scarce and inconclusive. A recent study by Zhai et al. (2023), evaluated the effect of the drug on the expression of PKC (protein that phosphorylates GluA1) and phosphorylation of GluA1, trying to explain the effect of PER on migraine, through the expression of PKC and other enzymes, without finding a clear correlation [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Kim et al. (2019), found that PER influences the phosphorylation of GluA1 depending on the exposure time, in the same way that it alters the expression of several enzymes that phosphorylate the GluA1 subunit, such as PKC and CAMKII [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eRegarding the increase in GluA1 phosphorylation mediated by iron overload, we can suggest it causes an increase in the placement of the subunit in the plasma membrane through this process. Serine 845 phosphorylation decreases GluA1binding to the AP2 adapter protein, which internalizes the subunit and, with it, the AMPA receptor [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAs is already known, the phosphorylation of the GluA1 and GluA2 subunits of AMPA receptors may be correlated with LTP, but probably not at serine 845, as demonstrated by Stafford and coworkers (2018) [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. The phosphorylation of GluA1 serine 845 may be related to the expression of PKA [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e], suggesting future studies that seek to correlate iron overload, the use of PER and the expression of enzymes that phosphorylate GluA1 subunits.\u003c/p\u003e \u003cp\u003eThrough our mRNA expression results and behavioral testing, we established a clear correlation between neonatal iron overload, the relative expression of genes responsible for encoding AMPA receptor subunits and scaffold proteins, and cognitive impairment.\u003c/p\u003e \u003cp\u003eEvidently, exposure to iron overload during the neonatal period instigates a neurodegenerative condition, which is further exacerbated by the insertion of AMPA receptors permeable to calcium ions. This is facilitated by the increased relative expression of the GRIA1 gene, responsible for the GluA1 subunit, and its phosphorylation at serine 845.\u003c/p\u003e \u003cp\u003eCP-AMPARs are not blocked by extracellular cations and allow Ca2 + entry at all levels of receptor activation. In fact, CP-AMPARs are significantly increased in disease states that can trigger mitochondrial dysfunction and cell death [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e] acting synergistically with the degenerative effects of iron overload. This may explain why PER, a non-selective AMPA receptor antagonist, was able to reverse the cognitive deficit produced by iron overload.\u003c/p\u003e "},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, the present study shows that the administration of PER was able to reverse, at least in part, the cognitive deficit caused by iron overload in the neonatal period. Furthermore, it was observed for the first time that iron overload in the neonatal period increased the relative expression of the \u003cem\u003eGRIA1\u003c/em\u003e gene, that codes the GluA1 subunit of the AMPA receptor and was able to increase the Glua1 phosphorylation of serine 845. Since the increase in \u003cem\u003eGRIA1\u003c/em\u003e expression and consequent increased calcium permeability have been consistently reported in disease context, this may be one of the mechanisms underlying iron neurotoxicity later in life. Further molecular analyses attempting to elucidate the molecular mechanisms relying PER neuroprotective effects are warranted, particularly analyzing the different protein kinases capable of phosphorylating different sites on the AMPA receptor subunits.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by National Council for Scientific and Technological Development [CNPq; grant numbers 403154/2021-9 and 305656/2019-8 to N.S.]; the National Institute of Science and Technology for Translational Medicine [INCT-TM \u0026ndash; grant number 465458/2014-9]; Rio Grande do Sul State Research Foundation (FAPERGS \u0026ndash; grant number 22/2551-0000385-0); N.S is Research Career Awardee of the CNPq.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;The funding sources were not involved in the collection, analysis, and interpretation of data; in the writing of the report; and in the decision to submit the article for publication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization: Jos\u0026eacute; Afonso Corr\u0026ecirc;a da Silva, Nadja Schroder; Methodology: Jos\u0026eacute; Afonso Corr\u0026ecirc;a da Silva, Nadja Schroder; Formal analysis and investigation: Jos\u0026eacute; Afonso Corr\u0026ecirc;a da Silva, Lariza Oliveira de Souza, Maria Paula Arakaki Severo, Sarah Luize Camargo Rodrigues, Patr\u0026iacute;cia Molz, Patr\u0026iacute;cia Schonhofen, Alice Laschuk Herlinger; Writing - original draft preparation: Jos\u0026eacute; Afonso Corr\u0026ecirc;a da Silva; Writing - review and editing: Nadja Schroder; Funding acquisition: Nadja Schroder; Resources: Maria Paula Arakaki Severo, Sarah Luize Camargo Rodrigues, Patr\u0026iacute;cia Molz; \u0026nbsp;Supervision: Nadja Schroder\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data used to support the findings of this study are available from the corresponding author upon request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was approved by the Institutional Ethics Committee for the Use of Animals of the Federal University of Rio Grande do Sul (CEUA , #35604) and all experimental procedures were performed in accordance with the Brazilian Guidelines for the Care and Use of Animals in Research and Teaching (DBCA, published by CONCEA, MCTI, Brazil).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eMurphy RJ, Buenzli PR, Baker RE, Simpson MJ (2020) Mechanical Cell Competition in Heterogeneous Epithelial Tissues. Bull Math Biol 82(10):130. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11538-020-00807-x\u003c/span\u003e\u003cspan address=\"10.1007/s11538-020-00807-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLopez-Otin C, Blasco MA, Partridge L, Serrano M, Kroemer G (2013) The hallmarks of aging. Cell. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cell.2013.05.039\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2013.05.039\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. 153:1194\u0026thinsp;\u0026ndash;\u0026thinsp;217\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKennedy BK, Berger SL, Brunet A, Campisi J, Cuervo AM, Epel ES et al (2014) Geroscience: linking aging to chronic disease. Cell 159:709\u0026ndash;713. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cell.2014.10.039\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2014.10.039\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFerreira B, Mendes F, Osorio N, Caseiro A, Gabriel A, Valado A (2013) Glutathione in multiple sclerosis. Br J Biomed Sci 70:75\u0026ndash;79. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/09674845.2013.11669939\u003c/span\u003e\u003cspan address=\"10.1080/09674845.2013.11669939\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu W, Xie W, Pan T, Xu P, Fridkin M, Zheng H et al (2007) Prevention and restoration of lactacystin-induced nigroestriatal dopamine neuron degeneration by novel brain-permeable iron chelators. FASEB J 21:3835\u0026ndash;3844. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1096/fj.07-8386com\u003c/span\u003e\u003cspan address=\"10.1096/fj.07-8386com\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuat TJ, Camats-Perna J, Newcombe EA, Valmas N, Kitazawa M, Medeiros R (2019) Metal Toxicity Links to Alzheimer's Disease and Neuroinflammation. J Mol Biol 431(9):1843\u0026ndash;1868. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jmb.2019.01.018\u003c/span\u003e\u003cspan address=\"10.1016/j.jmb.2019.01.018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLan AP, Chen J, Chai ZF, Hu Y (2016) The neurotoxicity of iron, copper and cobalt in Parkinson's disease through ROS-mediated mechanisms. Biometals 29(4):665\u0026ndash;678. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10534-016-9942-4\u003c/span\u003e\u003cspan address=\"10.1007/s10534-016-9942-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeng Y, Chang X, Lang M (2021) Iron Homeostasis Disorder and Alzheimer's Disease. Int J Mol Sci 22(22):12442. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms222212442\u003c/span\u003e\u003cspan address=\"10.3390/ijms222212442\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchr\u0026ouml;der N, Fredriksson A, Vianna MR, Roesler R, Izquierdo I, Archer T (2001) Memory deficits in adult rats following postnatal iron administration. Behav Brain Res 124(1):77\u0026ndash;85. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/s0166-4328(01)00236-4\u003c/span\u003e\u003cspan address=\"10.1016/s0166-4328(01)00236-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFigueiredo LS, de Freitas BS, Garcia VA, Darg\u0026eacute;l VA, K\u0026ouml;be LM, Kist LW et al (2016) Iron loading selectively increases hippocampal levels of ubiquitinated proteins and impairs hippocampus-dependent memory. Mol Neurobiol 53:6228\u0026ndash;6239. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12035-015-9514-6\u003c/span\u003e\u003cspan address=\"10.1007/s12035-015-9514-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ede Lima MN, Polydoro M, Laranja DC, Bonatto F, Bromberg E, Moreira JC et al (2005) Recognition memory impairment and brain oxidative stress induced by postnatal iron administration. Eur J Neurosci 21:2521\u0026ndash;2528. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1460-9568.2005.04083.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1460-9568.2005.04083.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMiwa CP, de Lima MN, Scalco F, Vedana G, Mattos R, Fernandez LL et al (2011) Neonatal iron treatment increases apoptotic markers in hippocampal and cortical areas of adult rats. Neurotox Res 19:527\u0026ndash;535. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12640-010-9181-3\u003c/span\u003e\u003cspan address=\"10.1007/s12640-010-9181-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eda Silva VK, de Freitas BS, da Silva DA, Nery LR, Falavigna L, Ferreira RD et al (2014) Cannabidiol normalizes caspase 3, synaptophysin, and mitochondrial fission protein DNM1L expression levels in rats with brain iron overload: implications for neuroprotection. Mol Neurobiol 49:222\u0026ndash;233. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12035-013-8514-7\u003c/span\u003e\u003cspan address=\"10.1007/s12035-013-8514-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUberti VH, de Freitas BS, Molz P, Bromberg E, Schr\u0026ouml;der N (2019) Iron Overload Impairs Autophagy: Effects of Rapamycin in Ameliorating Iron-Related Memory Deficits. Mol Neurobiol 57(2):1044\u0026ndash;1054. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12035-019-01794-4\u003c/span\u003e\u003cspan address=\"10.1007/s12035-019-01794-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMythri RB, Venkateshappa C, Harish G, Mahadevan A, Muthane UB, Yasha TC (2011) Evaluation of markers of oxidative stress, antioxidant function and astrocytic proliferation in the striatum and frontal cortex of Parkinson\u0026rsquo;s disease brains. Neurochem Res 36:1452\u0026ndash;1463. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11064-011-0471-9\u003c/span\u003e\u003cspan address=\"10.1007/s11064-011-0471-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCastellani RJ, Siedlak SL, Perry G, Smith MA (2000) Sequestration of iron by Lewy bodies in Parkinson\u0026rsquo;s disease. Acta Neuropathol 100:111\u0026ndash;114. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s004010050001\u003c/span\u003e\u003cspan address=\"10.1007/s004010050001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWhitehead G, Regan P, Whitcomb DJ, Cho K (2017) Ca\u003csup\u003e2+-\u003c/sup\u003epermeable AMPA receptor: A new perspective on amyloid-beta mediated pathophysiology of Alzheimer's disease. Neuropharmacology 112:221\u0026ndash;227. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.neuropharm.2016.08.022\u003c/span\u003e\u003cspan address=\"10.1016/j.neuropharm.2016.08.022\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFrench JA, Krauss GL, Steinhoff BJ, SquillacoteD, YangH, Kumar D et al (2013) Evaluation of adjunctive perampanel in patients with refractory partial-onset seizures: results of randomized global phase III study 305. Epilepsia 54:1117\u0026ndash;1125. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1528-1167.2012.03638.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1528-1167.2012.03638.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKrauss GL, Serratosa JM, Villanueva V, Endziniene M, Hong Z, French J (2012) Randomized phase III study 306: adjunctive perampanel for refractory partial-onset seizures. Neurology 78:1408\u0026ndash;1415. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1212/WNL.0b013e318254473a\u003c/span\u003e\u003cspan address=\"10.1212/WNL.0b013e318254473a\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDohare P, Zia MT, Ahmed E, Asad A, Yadala V, Schober AL et al (2016) AMPA-Kainate Receptor Inhibition Promotes Neurologic Recovery in Premature Rabbits with Intraventricular Hemorrhage. J Neurosci 36:3363\u0026ndash;3377. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1523/JNEUROSCI.4329-15.201\u003c/span\u003e\u003cspan address=\"10.1523/JNEUROSCI.4329-15.201\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu T, Ido K, Osada Y, Kotani S, Tamaoka A, Hanada T (2017) The neuroprotective effect of perampanel in lithium-pilocarpine rat seizure model. Epilepsy Res 137:152\u0026ndash;158. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.eplepsyres.2017.06.002\u003c/span\u003e\u003cspan address=\"10.1016/j.eplepsyres.2017.06.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZolkowska D, Dhir A, Rogawski MA (2021) Perampanel, a potent AMPA receptor antagonist, protects against tetramethylenedisulfotetramine-induced seizures and lethality in mice: comparison with diazepam. Arch Toxicol 95(7):2459\u0026ndash;2468. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.eplepsyres.2017.06.002\u003c/span\u003e\u003cspan address=\"10.1016/j.eplepsyres.2017.06.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlqahtani F, Assiri MA, Mohany M, Imran I, Javaid S, Rasool MF et al (2020) Coadministration of Ketamine and Perampanel Improves Behavioral Function and Reduces Inflammation in Acute Traumatic Brain Injury Mouse Model. Biomed Res 10:20203193725. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1155/2020/3193725\u003c/span\u003e\u003cspan address=\"10.1155/2020/3193725\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ede Lima MN, Luft T, Roesler R, Schr\u0026ouml;der N (2006) Temporary inactivation reveals an essential role of the dorsal hippocampus in consolidation of object recognition memory. Neurosci Lett 405(1\u0026ndash;2):142\u0026ndash;146. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.neulet.2006.06.044\u003c/span\u003e\u003cspan address=\"10.1016/j.neulet.2006.06.044\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGiacobbo BL, de Freitas BS, Vedovelli K, Schlemmer LM, Pires VN, Antoniazzi V et al (2019) Long-term environmental modifications affect BDNF concentrations in rat hippocampus, but not in serum. Behav Brain Res 372:111965. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbr.2019.111965\u003c/span\u003e\u003cspan address=\"10.1016/j.bbr.2019.111965\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe Souza LO, Machado GDB, de Freitas BS, Rodrigues SLC, Severo MPA, Molz P et al (2021) The G protein-coupled estrogen receptor (GPER) regulates recognition and aversively-motivated memory in male rats. Neurobiol Learn Mem 184:107499. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.nlm.2021.107499\u003c/span\u003e\u003cspan address=\"10.1016/j.nlm.2021.107499\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248\u0026ndash;254. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1006/abio.1976.9999\u003c/span\u003e\u003cspan address=\"10.1006/abio.1976.9999\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eda Silva VK, de Freitas BS, Garcia RCL, Monteiro RT, Hallak JE, Zuardi AW et al (2018) Antiapoptotic effects of cannabidiol in an experimental model of cognitive decline induced by brain iron overload. Transl Psychiatry 8(1):176. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41398-018-0232-5\u003c/span\u003e\u003cspan address=\"10.1038/s41398-018-0232-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMolz P, de Freitas BS, Uberti VH, da Costa KM, Kist LW, Bogo MR et al (2021) Effects of lipoic acid supplementation on age- and iron-induced memory impairment, mitochondrial DNA damage and antioxidant responses. Eur J Nutr 60(7):3679\u0026ndash;3690. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00394-021-02541-z\u003c/span\u003e\u003cspan address=\"10.1007/s00394-021-02541-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMohammad H, Sekar S, Wei Z, Moien-Afshari F, Taghibiglou C (2019) Perampanel but Not Amantadine Prevents Behavioral Alterations and Epileptogenesis in Pilocarpine Rat Model of Status Epilepticus. Mol Neurobiol 56(4):2508\u0026ndash;2523. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12035-018-1230-6\u003c/span\u003e\u003cspan address=\"10.1007/s12035-018-1230-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang H, Liu C, Zhao Y, Gao G (2020) Mitochondria regulation in ferroptosis. Eur J Cell Biol 99(1):151058. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ejcb.2019.151058\u003c/span\u003e\u003cspan address=\"10.1016/j.ejcb.2019.151058\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBellingacci L, Tallarico M, Mancini A, Megaro A, De Caro C, Citraro R et al (2023) Non-competitive AMPA glutamate receptors antagonism by perampanel as a strategy to counteract hippocampal hyper-excitability and cognitive deficits in cerebral amyloidosis. Neuropharmacology 225:109373. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.neuropharm.2022.109373\u003c/span\u003e\u003cspan address=\"10.1016/j.neuropharm.2022.109373\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen T, Dai SH, Jiang ZQ, Luo P, Jiang XF, Fei Z et al (2017) The AMPAR Antagonist Perampanel Attenuates Traumatic Brain Injury Through Anti-Oxidative and Anti-Inflammatory Activity. Cell Mol Neurobiol 37(1):43\u0026ndash;52. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10571-016-0341-8\u003c/span\u003e\u003cspan address=\"10.1007/s10571-016-0341-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarota G, Distefano A, Spampinato M, Giallongo C, Broggi G, Longhitano L et al (2022) Neuroprotective Role of α-Lipoic Acid in Iron-Overload-Mediated Toxicity and Inflammation in In Vitro and In Vivo Model. Antioxid (Basel) 11(8):1596. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/antiox11081596\u003c/span\u003e\u003cspan address=\"10.3390/antiox11081596\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDi Filippo M, Mancini A, Bellingacci L, Gaetani L, Mazzocchetti P, Zelante T et al (2021) Interleukin-17 affects synaptic plasticity and cognition in an experimental model of multiple sclerosis. Cell Rep 37(10):110094. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.celrep.2021.110094\u003c/span\u003e\u003cspan address=\"10.1016/j.celrep.2021.110094\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCentonze D, Muzio L, Rossi S, Cavasinni F, De Chiara V, Bergami A et al (2009) Inflammation triggers synaptic alteration and degeneration in experimental autoimmune encephalomyelitis. J Neurosci 29:3442\u0026ndash;3452. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1523/JNEUROSCI.5804-08.2009\u003c/span\u003e\u003cspan address=\"10.1523/JNEUROSCI.5804-08.2009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRogawski MA, Hanada T (2013) Preclinical pharmacology of perampanel, a selective non-competitive AMPA receptor antagonist. Acta Neurol Scand Suppl 19719\u0026ndash;24. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/ane.12100\u003c/span\u003e\u003cspan address=\"10.1111/ane.12100\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTakahashi T (2011) Mechanisms underlying contextual fear learning. Commun Integr Biol 4(6):726\u0026ndash;727. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4161/cib.17505\u003c/span\u003e\u003cspan address=\"10.4161/cib.17505\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarcondes LA, Myskiw J, de Nachtigall C, Narvaes EG, Izquierdo RF, Furini I (2022) CRG PKMζ Maintains Remote Contextual Fear Memory by Inhibiting GluA2-Dependent AMPA Receptor Endocytosis in the Prelimbic Cortex. Neuroscience. 497:97\u0026ndash;106. https://doi.org/j.neuroscience.2021.12.028\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCollingridge GL, Olsen RW, Peters J, Spedding M (2009) A nomenclature for ligand-gated ion channels. Neuropharmacology 56:2\u0026ndash;5. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.neuropharm.2008.06.063\u003c/span\u003e\u003cspan address=\"10.1016/j.neuropharm.2008.06.063\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTwomey EC, Yelshanskaya MV, Grassucci RA, Frank J, Sobolevsky AI (2017) Channel opening and gating mechanism in AMPA-subtype glutamate receptors. Nature 549(7670):60\u0026ndash;65. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nature23479\u003c/span\u003e\u003cspan address=\"10.1038/nature23479\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWright A, Vissel B (2012) The essential role of AMPA receptor GluR2 subunit RNA editing in the normal and diseased brain. Front Mol Neurosci 5:34. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fnmol.2012.00034\u003c/span\u003e\u003cspan address=\"10.3389/fnmol.2012.00034\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan M, Kim J (2015) Effect of dietary iron loading on recognition memory in growing rats. PLoS ONE 10(3):e0120609. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0120609\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0120609\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrown JC, Higgins ES, George MS (2022) Synaptic Plasticity 101: The Story of the AMPA Receptor for the Brain Stimulation Practitioner. Neuromodulation 25(8):1289\u0026ndash;1298. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.neurom.2021.09.003\u003c/span\u003e\u003cspan address=\"10.1016/j.neurom.2021.09.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang W, Ma L, Hai DM, Liu N, Yang JM, Lan XB et al (2022) Hippocampal Proteomic Analysis in Male Mice Following Aggressive Behavior Induced by Long-Term Administration of Perampanel. ACS Omega 7(23):19388\u0026ndash;19400. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1021/acsomega.2c01008\u003c/span\u003e\u003cspan address=\"10.1021/acsomega.2c01008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKondo M, Sumino R, Okado H (2000) Expression of AMPA receptors in rat superior colliculus and effect of orbital enucleation. Brain Res 883(2):238\u0026ndash;242. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/s0006-8993(00)02879-1\u003c/span\u003e\u003cspan address=\"10.1016/s0006-8993(00)02879-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWhitcomb DJ, Hogg EL, Regan P, Piers T, Narayan P, Whitehead G et al (2015) Intracellular oligomeric amyloid-beta rapidly regulates GluA1 subunit of AMPA receptor in the hippocampus. Sci Rep 5:10934. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/srep10934\u003c/span\u003e\u003cspan address=\"10.1038/srep10934\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHoey SE, Buonocore F, Cox CJ, Hammond VJ, Perkinton MS, Williams RJ (2013) AMPA receptor activation promotes non-amyloidogenic amyloid precursor protein processing and suppresses neuronal amyloid-β production. PLoS ONE 8(10):e78155. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0078155\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0078155\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhai Q, Wang K, Zhang D, Chen J, Dong X, Pan Y (2023) Perampanel ameliorates nitroglycerin-induced migraine through inhibition of the cAMP/PKA/CREB signaling pathway in the trigeminal ganglion in rats. Korean J Pain 36(3):335\u0026ndash;346. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/doi: 10.3344/kjp.23039\u003c/span\u003e\u003cspan address=\"doi: 10.3344/kjp.23039\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim JE, Choi HC, Song HK, Kang TC (2019) Perampanel Affects Up-Stream Regulatory Signaling Pathways of GluA1 Phosphorylation in Normal and Epileptic Rats. Front Cell Neurosci 13:80. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fncel.2019.00080\u003c/span\u003e\u003cspan address=\"10.3389/fncel.2019.00080\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSathler MF, Khatri L, Roberts JP, Schmidt IG, Zaytseva A, Kubrusly RCC et al (2021) Phosphorylation of the AMPA receptor subunit GluA1 regulates clathrin-mediated receptor internalization. J Cell Sci 134(17):jcs257972. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1242/jcs.257972\u003c/span\u003e\u003cspan address=\"10.1242/jcs.257972\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStafford J, Brownlow ML, Qualley A, Jankord R (2018) AMPA receptor translocation and phosphorylation are induced by transcranial direct current stimulation in rats. Neurobiol Learn Mem 150:36\u0026ndash;41. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.nlm.2017.11.002\u003c/span\u003e\u003cspan address=\"10.1016/j.nlm.2017.11.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWild AR, Dell'Acqua ML (2018) Potential for therapeutic targeting of AKAP signaling complexes in nervous system disorders. Pharmacol Ther 185:99\u0026ndash;121. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.pharmthera.2017.12.004\u003c/span\u003e\u003cspan address=\"10.1016/j.pharmthera.2017.12.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJi SG, Weiss JH (2018) Zn2+-induced disruption of neuronal mitochondrial function: Synergism with Ca2+, critical dependence upon cytosolic Zn2\u0026thinsp;+\u0026thinsp;buffering, and contributions to neuronal injury. Exp Neurol 302:181\u0026ndash;195. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.expneurol.2018.01.012\u003c/span\u003e\u003cspan address=\"10.1016/j.expneurol.2018.01.012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"molecular-neurobiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"moln","sideBox":"Learn more about [Molecular Neurobiology](https://www.springer.com/journal/12035)","snPcode":"12035","submissionUrl":"https://submission.nature.com/new-submission/12035/3","title":"Molecular Neurobiology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"AMPA receptors, Iron overload, Memory, Neurotoxicity, Perampanel","lastPublishedDoi":"10.21203/rs.3.rs-3809589/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3809589/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eIron accumulation has been associated with the pathogenesis of neurodegenerative diseases and memory decline. As previously described by our research group, iron overload in the neonatal period induces persistent memory deficits, increases oxidative stress, and apoptotic markers. The neuronal insult caused by iron excess generates an energetic imbalance that can alter glutamate concentrations and thus trigger excitotoxicity. Drugs that block glutamatergic receptor, eligibly mitigate neurotoxicity; among them, Perampanel (PER), a reversible AMPA receptor (AMPAR) antagonist. In the present study, we sought to investigate the neuroprotective effects of PER in rats subjected to iron overload in the neonatal period. Recognition and aversive memory were evaluated, AMPAR subunit phosphorylation, as well as the relative expression of genes such as \u003cem\u003eGRIA1, GRIA2, DGL4\u003c/em\u003e, and \u003cem\u003eCAC\u003c/em\u003e, which code proteins involved in AMPAR anchoring. Male rats received vehicle or carbonyl iron (30 mg/kg) from the 12th to the 14th postnatal day and were treated with vehicle or PER (2 mg/kg) for 21 days in adulthood. The excess of iron caused recognition memory deficits and impaired emotional memory, and PER was able to improve the rodents' memory. Furthermore, iron overload increased the expression of the \u003cem\u003eGRIA1\u003c/em\u003e gene and decreased the expression of the \u003cem\u003eDGL4\u003c/em\u003e gene, demonstrating the influence of metal accumulation on the metabolism of AMPAR. These results suggest that iron can trigger changes in the expression of genes important for the assembly and anchoring of AMPAR and that blocking AMPAR with PER is capable of partially reversing the cognitive deficits caused by iron overload.\u003c/p\u003e","manuscriptTitle":"Effects of the AMPAr antagonist, Perampanel, on Cognitive Function in Rats Exposed to Neonatal Iron Overload","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-12 17:20:05","doi":"10.21203/rs.3.rs-3809589/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-02-13T04:04:45+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-01-18T03:24:43+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"90959772-f7d3-4b2e-8ede-203debbec4ad","date":"2024-01-10T19:00:39+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-01-10T18:57:30+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-01-10T13:00:17+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-01-10T13:00:17+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular Neurobiology","date":"2023-12-26T21:02:42+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"molecular-neurobiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"moln","sideBox":"Learn more about [Molecular Neurobiology](https://www.springer.com/journal/12035)","snPcode":"12035","submissionUrl":"https://submission.nature.com/new-submission/12035/3","title":"Molecular Neurobiology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"a332e010-eeda-4508-802b-070ac887232c","owner":[],"postedDate":"January 12th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-05-07T20:07:32+00:00","versionOfRecord":{"articleIdentity":"rs-3809589","link":"https://doi.org/10.1007/s12035-024-04180-x","journal":{"identity":"molecular-neurobiology","isVorOnly":false,"title":"Molecular Neurobiology"},"publishedOn":"2024-05-02 19:58:31","publishedOnDateReadable":"May 2nd, 2024"},"versionCreatedAt":"2024-01-12 17:20:05","video":"","vorDoi":"10.1007/s12035-024-04180-x","vorDoiUrl":"https://doi.org/10.1007/s12035-024-04180-x","workflowStages":[]},"version":"v1","identity":"rs-3809589","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3809589","identity":"rs-3809589","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}