REDD1/DDIT4 counteracts endoplasmic reticulum stress-induced apoptosis by controlling the expression of death receptor TRAILR2/DR5 in cancer cells

REDD1/DDIT4 counteracts endoplasmic reticulum stress-induced apoptosis by controlling the expression of death receptor TRAILR2/DR5 in cancer cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article REDD1/DDIT4 counteracts endoplasmic reticulum stress-induced apoptosis by controlling the expression of death receptor TRAILR2/DR5 in cancer cells Rocio Mora Molina, Younes El Yousfi, Cathrin Hagenlocher, F.Javier Fernández-Farrán, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6111887/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 28 Mar, 2026 Read the published version in Cell Death & Disease → Version 1 posted 9 You are reading this latest preprint version Abstract Regulated in development and DNA damage response-1 (REDD1/DDIT4) is induced in response to environmental stress to restrain the mechanistic target of rapamycin complex 1 (mTORC1) signaling as an adaptive strategy to restore cellular homeostasis. Interestingly, REDD1/DDIT4 expression is upregulated in several tumour types including colorectal cancer, suggesting it may have a role in tumourigenesis. Here, we report that activating transcription factor 4 (ATF4)-dependent REDD1/DDIT4 expression is required for survival of colon tumour cells undergoing endoplasmic reticulum (ER) stress through the modulation of TRAILR2/DR5 gene expression. Our findings further demonstrate that resistance to ER stress-induced apoptosis in multicellular tumour spheroids (MCTS) is associated with constitutive expression of REDD1/DDIT4 and diminished mTORC1 activity. CRISPR/Cas9-mediated deletion of REDD1/DDIT4 markedly increases TRAILR2/DR5 expression and enhances apoptosis in spheroids exposed to ER stress. Interestingly, RNA sequencing analysis reveals that the loss of the transcriptional regulator MECOM/EVI-1, a partner of the corepressor protein C-terminal Binding Protein (CtBP), in cells deficient in REDD1/DDIT4 amplifies the ER stress-induced upregulation of TRAILR2/DR5, leading to enhanced apoptosis. In summary, our findings underscore the crucial role of REDD1/DDIT4 in regulating TRAILR2/DR5-induced caspase-8 activation and apoptosis under chronic ER stress, by inhibiting mTORC1 activity and promoting MECOM/EVI-1-mediated suppression of TRAILR2/DR5 gene expression. Biological sciences/Biochemistry/Protein folding/Endoplasmic reticulum Health sciences/Diseases/Cancer/Gastrointestinal cancer/Colorectal cancer/Colon cancer Regulated in development and DNA damage response-1 mTORC1+ TNF-related apoptosis-inducing ligand receptor 2 endoplasmic reticulum stress apoptosis MDS1 and EVI1 Complex Locus Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction The tumour microenvironment is characterized by severe hypoxia, nutrient deprivation and acidosis that provoke the accumulation of unfolded and misfolded proteins in the endoplasmic reticulum (ER) 1 , 2 . This results in ER stress and the activation of an adaptive response to promote tumour survival and progression 1 , 3 . Protein sensors located in the luminal face of the ER membrane activate an intracellular signaling mechanism called the unfolded protein response (UPR) 4 . Activation of these signaling pathways leads to a reduction in the influx of proteins into the ER, triggers protein degradation pathways and increases the folding capacity of the ER 5 . However, above a certain threshold, unresolved ER stress results in cell death by apoptosis 6 . Up-regulation of pro-apoptotic proteins and down-regulation of anti-apoptotic proteins have been observed in cells undergoing apoptosis upon ER stress 7 , 8 , 9 , 10 , 11 , 12 , 13 . Up-regulation of TRAIL receptor 2/Death Receptor 5 (TRAILR2/DR5) expression and its intracellular activation in a TRAIL-independent manner mediates the execution of a caspase-8-dependent apoptotic pathway upon ER stress in both tumour and oncogenically transformed cells 8 , 9 , 11 , 13 . Moreover, it has been reported that misfolded proteins directly bind to and activate TRAILR2/DR5 in the ER-Golgi intermediate compartment to induce caspase-8 activation and apoptosis 14 . In response to ER stress, regulated in development and DNA damage response-1 (REDD1/DDIT4) protein is up-regulated, leading to the inhibition of the mammalian target of rapamycin complex 1 (mTORC1) in a tuberous sclerosis complex (TSC1/TSC2)-dependent manner) 15 . Furthermore, loss of the upstream regulators of the mTOR pathway TSC1 and TSC2 leads to constitutive activation of mTORC1 and tumour development 16 , 17 , 18 . Interestingly, tumour cells harbouring an activated mTOR pathway are more sensitive to ER stress-induced cell death 19 , 20 , although the molecular mechanism underlying this cell death process remains poorly understood. In addition to its role in controlling mTORC1 signaling, REDD1/DDIT4 also has mTORC1-independent functions. These include preventing mitochondrial ROS production and stabilising HIF1α 21 , inducing autophagy 22 , or activating proinflammatory signaling pathways 23 . Although a tumour suppressor role has been reported for REDD1/DDIT4 in some malignancies 24 , 25 , 26 , in colorectal cancer the elevated expression of REDD1/DDIT4 may have a pro-tumoural function promoting survival of stressed tumour cells 27 . Despite this observation, the way REDD1 modulates the response of colon tumour cells to ER stress remains poorly understood. EVI-1/MECOM is a zinc finger transcription factor commonly linked to oncogenesis and apoptosis 28 , 29 , 30 . Additionally, EVI-1/MECOM can interact with the corepressor proteins C-terminal Binding Protein (CtBP) via a repressive domain located between two zinc finger domains in its C-terminal region 31 , 32 , 33 . Notably, CtBPs are known to play a key role in repressing the expression of pro-apoptotic genes 34 , 35 , including TRAILR1/DR4 and TRAILR2/DR5 36 , in tumour cells. In this study, we show that REDD1/DDIT4 plays a critical role in preventing the activation of apoptosis in response to chronic ER stress in colon cancer cells. This is accomplished by inhibiting mTORC1 and regulating the expression of TRAILR2/DR5 via the EVI-1/MECOM-CtBP transcriptional repressor module. Our findings suggest that elevated REDD1/DDIT4 expression in colorectal cancer may provide a growth advantage in the hostile tumour microenvironment by inhibiting ER stress-induced upregulation of TRAILR2/DR5 and activation of the extrinsic apoptotic pathway, thus facilitating tumour growth and progression. Results ATF4-dependent REDD1/DDIT4 expression is required for survival of colon cancer cells undergoing ER stress Different stressful conditions of the tumour microenvironment cause ER stress and trigger the UPR 1 . Although a tumour-suppressor role has been proposed for REDD1/DDIT4 in some contexts 21 , 25 , in colorectal cancer REDD1/DDIT4 induction facilitates cellular adaptation in hypoxic conditions 27 , and promotes the tumour-supportive function of tumour-associated macrophages (TAMs) 37 . However, despite the observation that REDD1/DDIT4 is frequently up-regulated in colorectal cancer 27 , its function in the response of colon tumour cells to ER stress has not been elucidated. To investigate this issue, we first evaluated the expression of REDD1/DDIT4 in the HCT116 human colon cancer cell line following exposure to ER stress-inducing agents. Treatment with the ER stress inducer thapsigargin (TG) resulted in an upregulation of REDD1/DDIT4 protein expression, which was detectable as early as 3 hours after TG was added to HCT116 cell cultures (Fig. 1 A). The increase in REDD1/DDIT4 expression was associated with an inhibition of the kinase activity of the mTORC1 complex as determined by measuring 4EBP1 phosphorylation, a substrate of the mTORC1 kinase (Fig. 1 A). To further investigate the mechanism underlying the observed elevation of REDD1/DDIT4 levels upon ER stress we determined the role of the ATF4 transcription factor, a well-known mediator of the PERK branch of the UPR in the adaptive response to ER stress 38 . As shown in Fig. 1 B, knockdown of ATF4 expression by siRNA interference markedly inhibited REDD1/DDIT4 increase in HCT116 cells treated with TG, confirming data obtained in other cell types 39 , 40 , 41 . To elucidate the role of REDD1/DDIT4 in the apoptotic response of colon tumour cells to ER stress, we assessed the susceptibility of control and REDD1/DDIT4 knockdown HCT116 cells to the ER stress inducers TG and tunicamycin (TN). As shown in Fig. 1 C, REDD1/DDIT4 knockdown resulted in a significant increase in the apoptotic population following treatment with either TG (Fig. 1 C, left panel) or TN (Fig. 1 C, right panel), an effect that was substantially inhibited by co-treatment with the pan-caspase inhibitor Q-VD-Oph. To confirm these findings, we used two additional siRNA sequences targeting REDD1/DDIT4 prior to exposure to the ER stress inducers. All sequences significantly enhanced apoptosis following treatment with TG or TN (Fig. S1 A and B, respectively). Moreover, after ER stress induction, REDD1/DDIT4 knockdown cells exhibited sustained mTORC1 kinase activity, as demonstrated by the phosphorylation of its downstream targets, 4EBP1 and p70S6K (Fig. S1 A and B, respectively). To further validate the role of REDD1/DDIT4 in HCT116 colon cancer cells undergoing ER stress-induced apoptosis, REDD1/DDIT4 knockout (KO) cells were generated using CRISPR/Cas9 gene editing. As shown in Fig. 2 , REDD1/DDIT4 KO clones exhibited heightened sensitivity to TG treatment compared to parental cells or REDD1/DDIT4-expressing control clones (Fig. 2 A). Consistent with REDD1/DDIT4's canonical function in regulating mTORC1 activity by inhibiting Akt-mediated control of the TSC 15 , REDD1/DDIT4 KO cells exhibited enhanced mTORC1 activation, both under control and treatment conditions, as assessed by the phosphorylation of 4EBP1 and p70S6K (Fig. 2 B). To evaluate the role of mTOR in REDD1/DDIT4-mediated sensitization to ER stress, REDD1/DDIT4-expressing and REDD1/DDIT4 KO clones were pre-treated for 2 hours with the mTORC1/2 inhibitor Torin-1 before being treated with TG for an additional 24 hours. As shown in Fig. 2 C, Torin-1 markedly inhibited TG-induced apoptosis in REDD1/DDIT4-depleted cells. To confirm that the increased apoptosis observed upon ER stress in REDD1/DDIT4 knockout (KO) cells was specifically due to the loss of REDD1/DDIT4, we restored its expression by infecting these KO cells with retroviruses carrying the HA-REDD1/DDIT4 expression vector. Notably, the enhanced sensitivity to TG-induced apoptosis was significantly reduced in REDD1/DDIT4 KO clones ectopically expressing HA-REDD1/DDIT4. This resulted in apoptosis levels comparable to those observed in parental cells or in a REDD1/DDIT4-expressing control clone treated with TG (Fig. 2 D and E). REDD1/DDIT4 plays a key role in the control of ER stress-induced activation of TRAILR2/DR5-mediated apoptosis ER stress-induced activation of the unfolded protein response (UPR) triggers signaling pathways aimed at restoring ER proteostasis to promote cell survival 5 , 42 . However, unresolved ER stress shifts the cellular response from adaptation to apoptotic cell death, in which either the intrinsic 6 , 12 , 43 , extrinsic 8 , 9 , 14 , or both apoptotic pathways 7 have been implicated. In the HCT116 model, activation of the PERK/ATF4/CHOP branch of the UPR under chronic ER stress conditions results in upregulation of TRAILR2/DR5 expression, leading to the formation of an intracellular DISC and activation of the extrinsic apoptosis pathway, independent of the TRAIL ligand 8 , 14 . Given the role of the extrinsic apoptotic pathway triggered by TRAIL receptors in ER stress-induced cell death in HCT116 tumour cells 8 , 11 , we hypothesized that the increased susceptibility of REDD1/DDIT4-deficient tumour cells to ER stress could be attributed to enhanced activation of caspase-8, a key caspase in the execution of the extrinsic apoptotic pathway. To test this, we assessed caspase-8 activation by examining its protein processing following TG treatment. As shown in Fig. 3 A, both REDD1/DDIT4 KO clones exhibited significantly increased caspase-8 processing and subsequent activation compared to control cells. To further explore the involvement of the extrinsic apoptotic pathway in the heightened sensitivity of REDD1/DDIT4 KO cells to ER stress, we inhibited caspase-8 activation either by caspase-8 knockdown (Fig. 3 B) or by overexpressing cFLIP L (Fig. 3 C), which is known to prevent caspase-8 processing 11 , 44 , 45 . As shown in Figs. 3 B and 3 C, the increased susceptibility of REDD1/DDIT4 KO cells to TG treatment was significantly reduced in cells with caspase-8 knockdown or cFLIP L overexpression. We also explored the role of pro-apoptotic TRAIL receptors, TRAILR1/DR4 and TRAILR2/DR5 (Fig. 3 D), in the heightened susceptibility of REDD1/DDIT4-deficient cells to ER stress. Notably, only knockdown of TRAILR2/DR5 significantly inhibited ER stress-induced apoptosis in the absence of REDD1/DDIT4. Taken together, these results suggest that REDD1/DDIT4 plays a role in delaying excessive caspase-8 activation and apoptosis via the extrinsic pathway, thereby promoting cell adaptation rather than cell death. Multicellular tumour spheroids (MCTSs) derived from REDD1/DDIT4 knockout (KO) cells exhibit increased susceptibility to apoptosis induced by ER stress. MCTSs, greater than 500 µm in size, more accurately replicate the three-dimensional architecture of growing tumours compared to traditional 2D cell cultures 46 , 47 , 48 . Previously, we reported that 3D spheroids derived from HCT116 tumour cells display resistance to ER stress-induced apoptosis compared to their 2D counterparts 11 . Given that REDD1/DDIT4 is a stress-induced protein, and considering that oxygen and nutrient availability decline in the deeper layers of spheroids as they grow 49 , we hypothesized that REDD1/DDIT4 levels might be upregulated in spheroid cultures. Indeed, analysis of REDD1/DDIT4 protein expression in whole cell extracts revealed that its levels were significantly higher in spheroids than in 2D cultures of HCT116 cells (Fig. 4 A). Moreover, this upregulation of REDD1/DDIT4 was associated with reduced mTORC1 activity, as indicated by decreased phosphorylation of its downstream target 4EBP1 (Fig. 4 A). Next, we investigated whether depleting REDD1/DDIT4 in HCT116 cells would enhance the sensitivity of MCTSs to apoptosis induced by TG. Spheroids were generated from both control and REDD1/DDIT4 KO cells, and after confirming that the loss of REDD1/DDIT4 expression did not affect spheroid growth (Fig. 4 B), we assessed their response to ER stress-induced apoptosis. As shown in Fig. 4 C, spheroids lacking REDD1/DDIT4 were markedly more susceptible to TG-induced apoptosis compared to spheroids derived from either the parental cells or a control REDD1/DDIT4-expressing clone. Notably, the increased apoptosis observed in REDD1/DDIT4 KO spheroids was accompanied by elevated levels of TRAILR2/DR5 protein and caspase-8 activation following TG treatment (Fig. 4 D). Interestingly, despite TG treatment, the phosphorylation of 4EBP1—and thus mTORC1 activity—was significantly higher in REDD1/DDIT4 KO spheroids, confirming that REDD1/DDIT4 regulates mTORC1 activity in MCTSs (Fig. 4 D). In summary, these findings suggest that REDD1/DDIT4 plays a protective role in colon tumour cells under ER stress by delaying the upregulation of TRAILR2/DR5, thereby preventing premature activation of caspase-8 and the initiation of the extrinsic apoptotic pathway. REDD1/DDIT4 regulates TRAILR2/DR5 expression in colon cancer cells under ER stress In response to unresolved ER stress, the PERK branch of the UPR can activate the extrinsic apoptotic pathway by both downregulating FLIP levels 11 and upregulating TRAILR2/DR5 expression via CHOP induction 8 , 9 , 13 . Given the critical role of the PERK pathway in regulating TRAILR2/DR5 expression and, consequently, ER stress-induced apoptosis, we first investigated whether the loss of REDD1/DDIT4 would enhance PERK pathway activation. However, analysis of PERK pathway activation, assessed by measuring ATF4 and CHOP protein levels after TG treatment, revealed similar activation in both control and REDD1/DDIT4 KO cells (Fig. 5 A). Moreover, TG treatment resulted in similar downregulation of cFLIP in REDD1/DDIT4 KO cells and control cells expressing REDD1/DDIT4 (Fig. 5 B). Collectively, these results suggest that the activation of the PERK branch of the UPR was comparable between control and REDD1/DDIT4 KO cells. To further explore the mechanism underlying the increased sensitivity of REDD1/DDIT4 KO cells to ER stress, we assessed TRAILR2/DR5 protein levels in both control and REDD1/DDIT4 KO cells treated with TG. In contrast to the results for ATF4 and CHOP expression, we observed a marked increase in both TRAILR2/DR5 monomer and oligomer levels in REDD1/DDIT4-deficient cells compared to control cells upon ER stress induction (Fig. 5 C). To investigate the mechanism behind the elevated TRAILR2/DR5 expression in REDD1/DDIT4 KO cells under ER stress, we first measured TRAILR2/DR5 mRNA levels in both control and REDD1/DDIT4 KO cells treated with TG. Compared to control cells, REDD1/DDIT4 KO cells exhibited a significant upregulation of TRAILR2/DR5 mRNA upon TG treatment (Fig. 5 D). Notably, even without ER stress, REDD1/DDIT4 KO cells showed enhanced TRAILR2/DR5 mRNA expression (Fig. 5 D), suggesting that REDD1/DDIT4 plays a role in regulating TRAILR2/DR5 expression in tumour cells, independently of stress conditions. Although REDD1/DDIT4 expression did not affect CHOP protein levels in response to TG treatment, its essential role in TRAILR2/DR5 induction following ER stress prompted us to investigate whether CHOP was critical for sensitization after REDD1/DDIT4 depletion. CHOP was knocked down using RNA interference, and apoptosis was completely inhibited in both control and REDD1/DDIT4-depleted cells (Fig. 5 E). Interestingly, analysis of TRAILR2/DR5 expression revealed that CHOP knockdown led to a significant decrease in both TRAILR2/DR5 mRNA and protein levels in response to TG treatment. However, elevated TRAILR2/DR5 expression was still observed in REDD1/DDIT4 KO cells, regardless of CHOP expression (Fig. 5 F). This suggests that a CHOP-independent mechanism may be differentially active between control and REDD1/DDIT4 KO cells, with the latter maintaining higher levels of TRAILR2/DR5 compared to control cells. During the adaptive phase of the UPR, the IRE1 branch mediates the regulated IRE1α-dependent decay (RIDD) of TRAILR2/DR5 mRNA through its RNase activity, thereby promoting cell survival 8 , 50 . Under unresolved ER stress, IRE1 signaling is attenuated, and chronic activation of the PERK pathway ultimately drives apoptotic cell death 51 . We next investigated whether the increased TRAILR2/DR5 mRNA levels observed in REDD1/DDIT4 KO cells could result from impaired IRE1 signaling, which may allow for early upregulation of TRAILR2/DR5 mRNA. To test this, we analyzed IRE1-mediated XBP1 splicing in both control and REDD1/DDIT4 KO cells following TG treatment. As shown in Figure S2 A, no differences in XBP1 splicing were detected between control and REDD1/DDIT4-deficient cells, suggesting that IRE1 signaling is comparable regardless of REDD1/DDIT4 expression. Although both XBP1 splicing and RIDD are mediated by the IRE1 RNase domain, they are distinct processes 52 . To further explore the role of the IRE1 pathway in the upregulation of TRAILR2/DR5 mRNA in the absence of REDD1/DDIT4, we performed IRE1 knockdown prior to TG treatment and evaluated TRAILR2/DR5 upregulation in both control and REDD1/DDIT4 KO cells (Fig. S2 B). As shown in Figure S2 B, IRE1 knockdown, confirmed by western blotting and XBP1 splicing analysis (left panel), slightly facilitated TRAILR2/DR5 upregulation. However, this effect was independent of REDD1/DDIT4 expression (right panel). These findings suggest that differential IRE1 signaling is unlikely to explain the increased TRAILR2/DR5 expression observed in REDD1/DDIT4-deficient cells. ER stress also activates c-Jun N-terminal kinase 1 (JNK), which is implicated in apoptosis through the intrinsic pathway 53 , 54 . Additionally, REDD1 has been shown to inhibit apoptosis by suppressing JNK signaling in MEFs and retinal precursor cells 55 . Based on these findings, we hypothesized that enhanced JNK signaling might contribute to the increased apoptosis observed in REDD1-deficient cells by promoting the upregulation of TRAILR2/DR5 expression. We confirmed that the loss of REDD1 leads to JNK activation, as evidenced by increased phosphorylation of its target c-Jun at Ser73 (Fig. S2 C, left panel). However, pharmacological inhibition of JNK did not restore TRAILR2/DR5 mRNA levels (Fig. S2 C, right panel), suggesting that JNK signaling does not directly mediate the upregulation of TRAILR2/DR5 in REDD1-deficient cells. Identification of the EVI-1/MECOM transcription factor as a potential regulator of ER stress-induced TRAILR2/DR5 upregulation and apoptosis in REDD1/DDIT4-deficient cells We hypothesized that the increased sensitivity to ER stress-induced apoptosis observed in the absence of REDD1/DDIT4 is due to elevated expression of TRAILR2/DR5 in these cells. To identify potential mediators of TRAILR2/DR5 expression in REDD1/DDIT4-deficient cells, we treated both REDD1/DDIT4-expressing and REDD1/DDIT4 KO cells with TG for 7 hours and performed RNA-seq analysis. Among the over 200 dysregulated genes in both REDD1/DDIT4 KO clones (under both control and TG-treated conditions), we identified the EVI-1/MECOM transcription factor (Fig. 6 A) 56 as a potential regulator of TRAILR2/DR5 expression 36 . In REDD1/DDIT4-depleted cells, EVI-1/MECOM transcript levels were significantly downregulated (Fig. 6 B). These findings were further confirmed by real time-qPCR (Fig. S2 D). To investigate whether the loss of EVI-1/MECOM enhances susceptibility to ER stress-induced apoptosis, we performed EVI-1/MECOM knockdown in HCT116 parental cells and the REDD1/DDIT4-expressing clone prior to TG treatment. As shown in Fig. 6 C, knockdown of EVI-1/MECOM notably increased the sensitivity of cells to TG-induced apoptosis compared to the scrambled RNA controls. Furthermore, similar to the sensitization observed with REDD1/DDIT4 loss, silencing EVI-1/MECOM expression enhanced TG-induced apoptosis in a caspase-8- and TRAILR2/DR5-dependent manner (Fig. 6 D), as this effect was abolished by knockdown of caspase-8 or TRAILR2/DR5. A hallmark of the increased susceptibility to ER stress in REDD1/DDIT4 KO cells was the elevated expression of TRAILR2/DR5 observed following treatment with the ER stress inducer. We then examined whether this effect was also observed in EVI-1/MECOM knockdown cells. As seen in Figs. 7 A and 7 B, silencing EVI-1/MECOM expression in REDD1/DDIT4-expressing cells was sufficient to promote TG-induced upregulation of both mRNA and protein levels of TRAILR2/DR5. Collectively, our findings suggest that the loss of EVI-1/MECOM observed in REDD1/DDIT4 KO cells plays a critical role in regulating TRAILR2/DR5 expression and mediating apoptosis in response to ER stress. The C-terminal binding protein (CtBP) family of transcriptional corepressors has been shown to cooperate with EVI-1/MECOM in transcriptional repression 31 and is highly expressed in aggressive tumours 36 . Although a direct link between EVI-1/MECOM and TRAILR2/DR5 regulation remains unestablished, CtBP proteins have been implicated as repressors of pro-apoptotic TRAIL receptor expression in tumour cells 36 . Consequently, we investigated the potential role of CtBP1/2 in modulating TRAILR2/DR5 expression and the apoptotic response to ER stress in HCT116 cells. As shown in Fig. 7 C, silencing CtBP1/2 with siRNA significantly sensitized tumour cells to TG-induced apoptosis. This increased sensitivity was associated with a pronounced upregulation of TRAILR2/DR5 at both the mRNA and protein levels (Fig. 7 D, 7 E). Overall, our data support the hypothesis that EVI-1/MECOM, in collaboration with proteins of the CTBP family, may function as a key repressor of the apoptotic response to chronic ER stress in HCT116 tumour cells, by counteracting the upregulation of TRAILR2/DR5 induced by the PERK-ATF4-CHOP signaling axis of the UPR. The loss of MECOM expression in REDD1 KO cells would result in impaired repression of TRAIL-R2/DR5 gene expression by CtBP family proteins, leading to an elevation of the levels of this pro-apoptotic receptor in these tumour cells and the activation of cell death via apoptosis. Discussion In a tumour, cancer cells face several insults, including nutrient starvation, hypoxia or ROS. Consequently, the function of protein folding machinery is impaired in cancer cells leading to the accumulation of unfolded and misfolded proteins and thus to ER stress 1 . Chronic or excessive ER stress switches UPR signaling from an adaptive response to trigger pro-apoptotic mechanisms 5 , 6 , 42 . In different cellular models, including HCT116 colorectal cancer cells, ER stress activates the extrinsic pathway of apoptosis through the axis PERK-P-eIF2α-ATF4-CHOP-TRAILR2/DR5 8, 9, 13 . An important issue that remains to be resolved is to understand the mechanisms that allow the survival of tumour cells in the stressful conditions of the tumour microenvironment. Although REDD1/DDIT4 was initially described as a hypoxia-induced protein 24 , other stress situations including ER stress result in REDD1/DDIT4 up-regulation 57 , 58 . REDD1/DDIT4 function in tumourigenesis is controversial since tumour suppressor 24 , 25 , 26 and pro-tumoural 27 , 37 , 59 roles have been associated with REDD1/DDIT4 induction. In this respect, elevated levels of REDD1/DDIT4 were significantly associated with a worse prognosis in several malignancies including colon cancer 60 , 61 . Our results in the colon cancer cell line HCT116 point to an adaptive function of REDD1/DDIT4 in colorectal cancer cells facing ER stress by repressing pro-apoptotic TRAILR2/DR5 receptor expression. REDD1/DDIT4 function has been mainly linked to the control of mTORC1 activity under stress through the TSC1/2 complex 15 , 24 , 27 , 39 . Our data point to a role of sustained mTORC1 activation in the increased sensitivity of REDD1-deficient tumour cells to ER stress. Constitutive mTORC1 activation by the loss of TSC1/2 signaling has been reported to induce apoptosis by stimulating the IRE1-ASK1-JNK pathway 62 . Although we cannot completely rule out the involvement of this signaling pathway in the sensitization of REDD1-deficient cells to apoptosis following ER stress 27 , our findings in IRE1 knockdown cells and with the JNK inhibitor SP600125 likely exclude the involvement of this pathway in the control of TRAILR2/DR5 levels by REDD1/DDIT4. Activation of the PERK branch of the UPR and the resulting TRAILR2/DR5 up-regulation and cFLIP down-regulation are key events for apoptosis induction in HCT116 tumour cells facing ER stress 8 , 11 . Thus, sensitization to ER stress-induced apoptosis in the absence of REDD1/DDIT4 described in this work might have occurred through enhancement of the PERK signaling pathway. Interestingly, our data show that REDD1/DDIT4 deficiency promoted a greater elevation of TRAILR2/DR5 expression levels through a CHOP-dependent mechanism. However, no significant differences were observed upon ER stress in the expression levels of ATF4 and CHOP transcription factors between REDD1/DDIT4-deficient cells and control cells. Likewise, in cells undergoing ER stress cFLIP loss was independent of REDD1/DDIT4 expression, suggesting that the enhanced caspase-8 activation and apoptosis observed in REDD1/DDIT4 deficient cells are probably not linked to faster down-regulation of FLIP levels upon ER stress. Overall, our findings suggest that REDD1/DDIT4 functions as a brake on the early upregulation of TRAILR2/DR5, thereby delaying caspase-8 activation and the induction of the apoptotic program in response to chronic ER stress, which in turn promotes the survival of cancer cells (Fig. 8 ). In this regard, our results represent the first identification of the transcriptional regulator EVI/MECOM and the co-repressor CtBP 31 , 32 , 33 as key players in the transcriptional regulation of the TRAILR2/DR5 gene by the PERK/ATF4/CHOP branch of the UPR. Notably, both EVI/MECOM and CtBP are often overexpressed in human colon cancer cells 63 , 64 . Further studies aimed at elucidating the molecular mechanism behind the regulation of EVI/MECOM expression in colon tumour cells by REDD1/DDIT4 will be crucial to gaining a broader understanding of the various mechanisms involved in tumour cell responses to ER stress. A deeper comprehension of how REDD1, in conjunction with the EVI/MECOM-CtBP repressor complex, contributes to the escape of tumour cells from apoptosis activation is a critical question that could uncover new therapeutic targets. Additionally, our data reinforce the role of REDD1/DDIT4 in cellular adaptation when colorectal cancer cells, organized in a 3D spatial configuration, face stress, suggesting that REDD1/DDIT4 may serve as a promising target to enhance the efficacy of therapies that aim to boost pro-apoptotic UPR signaling during ER stress. Materials and Methods Cell culture and reagents Human colorectal carcinoma cell line HCT116 (American Type Culture Collection) was kindly donated by Dr. J.A. Pintor-Toro (Andalusian Center for Molecular Biology and Regenerative Medicine-CABIMER, Seville, Spain). HCT116 cell cultures were maintained in McCoy's 5A modified medium with 2 mM L-glutamine, penicillin (50 U/ml), streptomycin (50 µg/ml) and 10% fetal bovine serum. HEK293T cells (a donation of Dr. A. Rodriguez (Autonomous University of Madrid, Spain) were maintained in DMEM medium supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, 50 U of penicillin/ml and 50 µg of streptomycin/ml. Cells were grown at 37ºC in a 5% CO 2 -humidified, 95% air incubator and regularly tested for mycoplasma contamination. The ER stress-inducers thapsigargin and tunicamycin, JNK pharmacological inhibitor SP600125, ethidium bromide, Ribonuclease A (RNase A) were purchased from Sigma. Q-VD-Oph (QVD) was obtained from Apexbio and Torin-1 was purchased from TOCRIS Bioscience. CRISPR/Cas9 editing REDD1/DDIT4 KO HCT116 cells were generated by CRISPR/Cas9-based gene targeting. Two different guide RNAs (gRNAs) were designed: one targeting exon 1, near the ATG initiator codon region, and the other targeting exon 2. Briefly, forward and reverse oligos for the gRNA against REDD1/DDTI4 were annealed and ligated into pSpCas9(BB)-2A-GFP (PX458) (#48138, Addgene). 48h post-transfection, GFP-positive cells were sorted using a BD FACSAria cell sorter (BD5 FACSAriaTM III, BD Biosciences, Heidelberg, Germany). Finally, REDD1 depletion of cultured clones was confirmed by western blotting. Name Sequence (5’ → 3’) REDD1-ATG-gRNA1 Fwd CACCGCGACGAGAAGCGGTCCCAA REDD1-ATG-gRNA1 Rev AAACTTGGGACCGCTTCTCGTCGC REDD1-Ex2-gRNA2 Fwd CACCGAGGCATCAGCAGGCGCGCA REDD1- Ex2-gRNA2 Rev AAACTGCGCGCCTGCTGATGCCTC Generation of HCT116 REDD1 KO-derived cell lines pBABE-puro-ø plasmid was kindly provided by Dr. Cristina Muñoz-Pinedo (IDIBELL, Barcelona), pBABE-FLIP L plasmid was produced in our lab 65 and pBABE-HA-REDD1 was purchased from Addgene (#133550). For stable knockdown experiments, shRNAs against caspase-8 or TRAILR2/DR5 in a pSUPER vector (OligoEngine) were digested and cloned between EcoR1 and Cla1 into an H1 promoter-driven GFP-encoding pLVTHM lentiviral vector 66 . Viral production was achieved by transfection of HEK293T cells using the calcium phosphate method. DNA was transfected in proportion 1:2:3 containing pCI-VSV-G:pVpack-GP-dl:transfer vector or pMD2.G:psPAX2:transfer vector, according to retroviral and lentiviral production, respectively. Retro- or lentiviruses-containing supernatants were collected 48 h after transfection and concentrated by ultracentrifugation at 22,000 rpm for 90 min at 4°C. Tumour cells were plated at 6 × 10 5 cells per 10-cm dish and infected with the viruses mentioned above 2 days later. Stable populations of tumour cells infected with retroviruses were obtained after selection in a culture medium containing puromycin (1.5 µg/ml) for at least 48 h. Lentiviral infection efficiency was assessed by GFP expression, which was examined by flow cytometry using a BD FACScalibur flow cytometer shRNA Sequence (3’→ 5’) shCaspase8#1 (shC8#1) 5’GATCCCC GGAGCTGCTCTTCCGAATT TTCAAGAGA AATTCGGAAGAGCAGCTCC TTTTTA3’ shScrambled (shScr) 5′GATCCCC CTTTGGGTGATCTACGTTA TTCAAGAGA TAACGTAGATCACCCAAAG TTTTTA3’ shTRAIL-R2#1 5′GATCCCC GACCCTTGTGCTCGTTGTC TTCAAGAGA GACAACGAGCACAAGGGTCT TTTTTA3′ Multicellular tumour spheroids (MCTs) MCTs were generated as described before 67 . For generation of HCT116-derived spheroids, cells were seeded into Terasaki multiwell plates (100 cells/well) (Greiner Bio-One, Frickenhausen, Germany) and placed in humid chambers in the incubator. After 3 days of cultivation, spheroids were transferred to agarose-coated 96-well plates (F-bottom, Greiner Bio-One, Frickenhausen, Germany). Medium was changed every second to third day until spheroids reached a diameter of approximately 500 µm. Then, spheroids were treated as indicated in figure legends. Monitoring of MCTSs growth To estimate the growth of the generated spheroids, transmitted light photos were taken daily with a Leica inverted digital microscope (Leica DFC500). Then, the areas of the spheroids were determined using the ImageJ software. It was assumed that the generated MCTSs are spheres and, therefore, their diameters could be calculated according to the following equation: $$\:d=2·\:\sqrt{\frac{A}{\pi\:}}$$ Where A is the measured area of the spheroid and d is the diameter. Treatment of MCTSs The day of treatment spheroids were transferred to a new F-bottom 96-well plate coated with agarose in a volume of 100 µL, using a yellow cut tip. Afterwards, 100 µL/well of fresh medium containing the appropriate drug (2X concentrated) were added. Analysis of hypodiploid apoptotic cells (SubG1 population) Cells (1.5 × 10 5 /well) were seeded into 6-well plates and two days later treated as indicated in the figure legends. After treatment, hypodiploid apoptotic cells were detected by flow cytometry according to published procedures 68 . Briefly, cells were detached and dissociated with trypsin/EDTA and washed with cold PBS, fixed in 70% cold ethanol, and then stained with propidium iodide (40 µg/mL) while treating with RNase (100 µg/mL) for 30 min in the dark. Quantitative analysis of the subG1 population was carried out in a FACSCalibur cytometer using the Cell Quest software (Becton Dickinson, Mountain View, CA, USA) or LSRFortessa X-20 cytometer using the BD FACSDiva™ Software (Becton Dickinson, Mountain View, CA, USA). Analysis of apoptosis by Annexin V-FITC/PI staining MTCs were washed with temperate PBS and dissociated using trypsin/EDTA. Single-cell suspensions were stained with Annexin V-FITC (Immunostep, Salamanca, Spain) and propidium iodide (20 µg/mL, Sigma-Aldrich, MO, USA) in Annexin V binding buffer (10 mM HEPES/NaOH (pH 7.4), 140 mM NaCl, 2.5 mM CaCl 2 ) for 15 min at room temperature in the dark. 400 µL of additional Annexin V binding buffer was added to each tube before analysis using a FACSCalibur cytometer (Becton Dickinson, Mountain View, CA, USA). Quantification of apoptotic cells was accomplished using Cell Quest software (Becton Dickinson, Mountain View, CA, USA). Immunoblot analysis of proteins Cells were washed with phosphate-buffered saline (PBS) and subsequently lysed in TR3 buffer (10 mM Na 2 HPO 4 , 10% glycerol, 3% SDS). Protein concentration was determined using the DC (detergent-compatible) protein assay reagent (Bio-Rad Laboratories, USA), following which loading buffer was added. Proteins were then separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) using mini-gels, and detection was carried out as previously described 65 . GAPDH, Hsp70, and α-Tubulin were used as loading controls for protein normalization. Antigen Dilution Provider Reference 4EBP1 1:1000 Cell Signaling Tech 9452 AKT 1:1000 Cell Signaling Tech 9272 ATF4 1:1000 Santa Cruz Biotech SC-200 ATF4 1:1000 Cell Signaling Tech 11815 Caspase-8 1:1000 Cell Signaling Tech 9746 CHOP 1:1000 Cell Signaling Tech 5554 FLIP (7F10) 1:1000 ENZO ALX-804-961 GAPDH 1:40000 Santa Cruz Biotech SC-47724 HRP-linked antibody 1:5000 DAKO P0448 HRP-linked antibody 1:5000 DAKO P0447 HRP-linked antibody 1:5000 DAKO P0449 IRE1α 1:1000 Cell Signaling Tech 3294 Hsp70 1:20000 Merck H5147 p70 S6K 1:1000 Cell Signaling Tech 9202S Phospho-4EBP1 (S65) 1:1000 Cell Signaling Tech 9451 Phospho-c-Jun (S73) 1:1000 Cell Signaling Tech 3270 Phospho-p70 S6K (T389) 1:1000 Cell Signaling Tech 9206S REDD1 1:2000 Proteintech 10638-1-AP TRAILR2/DR5 1:2000 R&D Systems AF631 α-tubulin 1:40000 Santa Cruz Biotech SC-23948 RNA interference siRNA-mediated knockdown was carried out with jetPRIME® transfection reagent (POLYplus transfection) using 50 nM of siRNA (Sigma) according to the manufacturer´s instructions. Generally, 1,5 x 10 5 cells/well were seeded into 6-well plates and transfected while in suspension. The following day, the medium was carefully replaced with fresh medium and cells were incubated for 24 h. Then, cells were treated as indicated in the figure legends. Knockdowns were confirmed by western blot or RT-qPCR, as indicated. siRNA Sequence 5’ → 3’ ATF4 GCCUAGGUCUCUUAGAUGA[dT][dT] Caspase-8#1 GGAGCUGCUCUUCCGAUU [dT][dT] CHOP POOL AGGGAGAACCAGGAAACGGAA[dT][dT] acggctcaagcaggaaatcga[dT][dT] aaggaagtgtatcttcataca[dT][dT] cagcttgtatatagagattgt[dT][dT] CTBP GGGAGGACCUGGAGAAGUU [dT] [dT] IRE1α GCGUCUUUUACUACGUAAU [dT] [dT] MECOM GAAUGAACACUCCAUAGAAAC[dT] [dT] REDD1#1 GUGGAGACUAGAGGCAGGAGC[dT][dT] REDD1#2 GAUACUCACUGUUCAUGAA [dT][dT] REDD1#3 ACGCAUGAAUGUAAGAGUA[dT][dT] Scrambled (Sc) UGGUUUACAUGUCGACUAA[dT] [dT] Scrambled#2 (Sc#2) CUUUGGGUGAUCUACGUUA[dT][dT] Scambled POOL (Sc PooL) UGGUUUACAUGUCGACUAA[dT][dT] UGGUUUACAUGUUGUGUGA[dT][dT] UGGUUUACAUGUUUUCUGA[dT][dT] UGGUUUACAUGUUUUCCUA[dT][dT] TRAILR1/siDR4#1 GGAACUUUCCGGAAUGACA[dT][dT] TRAILR2/siDR5#1 GACCCUUGUGCUCGUUGUC[dT][dT] RNA extraction RNA extraction was carried out with PRImeZOL reagent (Canvax Biotech), following the manufacturer’s instructions. The RNA pellet was resuspended in 20–60 µL of DEPC-treated H 2 O. After 5 min at RT, tubes were heated at 60°C for 10 min in a heat block. RNA samples were spun down, and placed on ice. RNA concentration was determined using a NanoDrop spectrophotometer ND-100 (Thermo Fisher). RT-PCR for analysis of XBP1 splicing 1 µg of total RNA was retrotranscribed using iScript cDNA Synthesis kit (BioRad, 1708891) according to the manufacturer´s instructions. Next, complementary DNA (cDNA) was amplified by PCR with specific primers obtained from Sigma. PCR products of XPB1 and β-actin fragments were visualized on 3% or 1% agarose gels, respectively, in 1X TAE buffer with 0.5 µg/mL of ethidium bromide. Primers Sequence 5’ → 3’ XBP1-forward TTACGGGAGAAAACTCACGGC XBP1-reverse GGGTCCAACTTGTCCAGAATGC β-actin-forward TGACGGGGTCACCCACACTGTGCCCATCTA β-actin-reverse CATGAAGCATTTGCGGTGGACGATGGAGGG Real time-qPCR Retrotranscription was performed as described in the previous section. RT-qPCR for TRAILR2/DR5 expression was carried out in triplicates for each sample with specific TaqMan probes and 2x FastStart Universal Probe Master (ROX) (Roche, 04913957001) following the manufacturer’s instructions. Taqman probe Reference HPRT Hs01003267_m1 TRAILR2/DR5 Hs00366278_m1 In case of MECOM and CtBP1/2 expression, cDNA and the corresponding primers were mixed with 2x iTaq™ Universal SYBR® Green Supermix (BioRad, 1725121 following the manufacturer’s instructions. Each sample was also run in triplicates. Primers Sequence 5’ → 3’ GAPDH-forward ATGGGGAAGGTGAAGGTCG GAPDH-reverse GGGTCATTGATGGCAACAATATC MECOM-forward AGTGCCCTGGAGATGAGTTG MECOM-reverse TTTGAGGCTATCTGTGAAGTGC CtBP1-forward GACAGCCTGAAGAACTGTGTC CtBP1-reverse TATAGGCAGCCCCATTGAGCT CtBP2-forward TTCAAGGCCCTGAGAGTGAT CtBP2-reverse GAGTCCGCTGTCTCTTCCAC DEPC-treated water instead of cDNA was run additionally to detect possible contaminations, and qPCR plates (Nerbeplus, 04-083-0150) were spun down before introducing them into devices. qPCRs were performed in 7500 Real-Time PCR System or QuantStudio™ 5 Real-Time PCR System (Applied Biosystems) according to comparative C T protocol. HPRT or GAPDH were used as internal controls and RNA expression levels were given as a fraction of RNA levels in control cells. RNA sequencing Total RNA was isolated using RNeasy Plus Mini Kit (QIAGEN, Hilden Germany), following the manufacturer’s instruction. The remaining DNA was further depleted by DNase treatment (TURBO DNase, Invitrogen). Libraries were prepared with the Illumina stranded Total RNA prep with Ribo Zero Plus (Illumina, San Diego, CA, USA) and sequencing was performed with a NovaSeq6000 SP system (Illumina) with 50 bp single-end reads with the Genomic Unit of CABIMER (Seville, Spain). Two biological replicates for each condition were sequenced. The downstream analysis was performed by Novogene (Cambridge, UK). Reads were aligned to human genomes (GRCh38.p12/hg38) using the HISAT2 alignment program 69 . Gene expression levels for each condition were estimated using the Fragments Per Kilobase of transcript sequence per Million base pairs sequenced (FPKM) method 70 . Finally, samples were normalized using the DESeq method, and gene expression differential analysis was conducted with the DESeq2 software 71 . Differentially expressed genes with p-values 1 (upregulated genes) or Log2FC < − 1 (downregulated genes) were selected for further analysis. Statistical analysis Statistical analysis was performed using GraphPad Prism 8 software (GraphPad Software Inc.). Quantitative data are presented as mean values ± standard deviation (SD) from at least three independent experiments. In cases where only two experiments were conducted, this is indicated in the figure legends, and data are presented as mean values ± standard error of the mean (SEM). Statistical significance between groups was assessed using the appropriate test specified in the figure legends. Significance levels are indicated by asterisks: ns = not statistically significant; * = p ≤ 0.05; ** = p ≤ 0.01; *** = p ≤ 0.001; **** = p ≤ 0.0001. Declarations Data availability All data generated or analysed during this study are included in the main text and the supplementary information files. The datasets generated and/or analysed during the current study are available from the corresponding author on reasonable request. Supplementary information is available at Cell Death Disease’s website. References Chen X & Cubillos-Ruiz JR. Endoplasmic reticulum stress signals in the tumour and its microenvironment. Nat Rev Cancer 21 , 71-88 (2021) Kozutsumi Y, Segal M, Normington K, Gething MJ & Sambrook J. The presence of malfolded proteins in the endoplasmic reticulum signals the induction of glucose-regulated proteins. Nature 332 , 462-464 (1988) Moenner M, Pluquet O, Bouchecareilh M & Chevet E. Integrated endoplasmic reticulum stress responses in cancer. Cancer Res 67 , 10631-10634 (2007) Ron D & Walter P. Signal integration in the endoplasmic reticulum unfolded protein response. Nat Rev Mol Cell Biol 8 , 519-529 (2007) Walter P & Ron D. The unfolded protein response: from stress pathway to homeostatic regulation. Science 334 , 1081-1086 (2011) Tabas I & Ron D. Integrating the mechanisms of apoptosis induced by endoplasmic reticulum stress. Nat Cell Biol 13 , 184-190 (2011) Cano-Gonzalez A, Mauro-Lizcano M, Iglesias-Serret D, Gil J & Lopez-Rivas A. Involvement of both caspase-8 and Noxa-activated pathways in endoplasmic reticulum stress-induced apoptosis in triple-negative breast tumor cells. Cell Death Dis 9 , 134 (2018) Lu M, Lawrence DA, Marsters S, Acosta-Alvear D, Kimmig P, Mendez AS , et al. Opposing unfolded-protein-response signals converge on death receptor 5 to control apoptosis. Science 345 , 98-101 (2014) Martin-Perez R, Palacios C, Yerbes R, Cano-Gonzalez A, Iglesias-Serret D, Gil J , et al. Activated ERBB2/HER2 licenses sensitivity to apoptosis upon endoplasmic reticulum stress through a PERK-dependent pathway. Cancer Res 74 , 1766-1777 (2014) McCullough KD, Martindale JL, Klotz LO, Aw TY & Holbrook NJ. Gadd153 sensitizes cells to endoplasmic reticulum stress by down-regulating Bcl2 and perturbing the cellular redox state. Mol Cell Biol 21 , 1249-1259 (2001) Mora-Molina R, Stohr D, Rehm M & Lopez-Rivas A. cFLIP downregulation is an early event required for endoplasmic reticulum stress-induced apoptosis in tumor cells. Cell Death Dis 13 , 111 (2022) Puthalakath H, O'Reilly LA, Gunn P, Lee L, Kelly PN, Huntington ND , et al. ER stress triggers apoptosis by activating BH3-only protein Bim. Cell 129 , 1337-1349 (2007) Yamaguchi H & Wang HG. CHOP is involved in endoplasmic reticulum stress-induced apoptosis by enhancing DR5 expression in human carcinoma cells. J Biol Chem 279 , 45495-45502 (2004) Lam M, Marsters SA, Ashkenazi A & Walter P. Misfolded proteins bind and activate death receptor 5 to trigger apoptosis during unresolved endoplasmic reticulum stress. Elife 9 , (2020) Dennis MD, Coleman CS, Berg A, Jefferson LS & Kimball SR. REDD1 enhances protein phosphatase 2A-mediated dephosphorylation of Akt to repress mTORC1 signaling. Sci Signal 7 , ra68 (2014) Gao X, Zhang Y, Arrazola P, Hino O, Kobayashi T, Yeung RS , et al. Tsc tumour suppressor proteins antagonize amino-acid-TOR signalling. Nat Cell Biol 4 , 699-704 (2002) Inoki K, Li Y, Zhu T, Wu J & Guan KL. TSC2 is phosphorylated and inhibited by Akt and suppresses mTOR signalling. Nat Cell Biol 4 , 648-657 (2002) Tee AR, Fingar DC, Manning BD, Kwiatkowski DJ, Cantley LC & Blenis J. Tuberous sclerosis complex-1 and -2 gene products function together to inhibit mammalian target of rapamycin (mTOR)-mediated downstream signaling. Proc Natl Acad Sci U S A 99 , 13571-13576 (2002) Inoki K, Zhu T & Guan KL. TSC2 mediates cellular energy response to control cell growth and survival. Cell 115 , 577-590 (2003) Ozcan U, Ozcan L, Yilmaz E, Duvel K, Sahin M, Manning BD , et al. Loss of the tuberous sclerosis complex tumor suppressors triggers the unfolded protein response to regulate insulin signaling and apoptosis. Mol Cell 29 , 541-551 (2008) Horak P, Crawford AR, Vadysirisack DD, Nash ZM, DeYoung MP, Sgroi D , et al. Negative feedback control of HIF-1 through REDD1-regulated ROS suppresses tumorigenesis. Proc Natl Acad Sci U S A 107 , 4675-4680 (2010) Qiao S, Dennis M, Song X, Vadysirisack DD, Salunke D, Nash Z , et al. A REDD1/TXNIP pro-oxidant complex regulates ATG4B activity to control stress-induced autophagy and sustain exercise capacity. Nat Commun 6 , 7014 (2015) Pastor F, Dumas K, Barthelemy MA, Regazzetti C, Druelle N, Peraldi P , et al. Implication of REDD1 in the activation of inflammatory pathways. Sci Rep 7 , 7023 (2017) Brugarolas J, Lei K, Hurley RL, Manning BD, Reiling JH, Hafen E , et al. Regulation of mTOR function in response to hypoxia by REDD1 and the TSC1/TSC2 tumor suppressor complex. Genes Dev 18 , 2893-2904 (2004) DeYoung MP, Horak P, Sofer A, Sgroi D & Ellisen LW. Hypoxia regulates TSC1/2-mTOR signaling and tumor suppression through REDD1-mediated 14-3-3 shuttling. Genes Dev 22 , 239-251 (2008) Qiao S, Koh SB, Vivekanandan V, Salunke D, Patra KC, Zaganjor E , et al. REDD1 loss reprograms lipid metabolism to drive progression of RAS mutant tumors. Genes Dev 34 , 751-766 (2020) Di Conza G, Trusso Cafarello S, Loroch S, Mennerich D, Deschoemaeker S, Di Matteo M , et al. The mTOR and PP2A Pathways Regulate PHD2 Phosphorylation to Fine-Tune HIF1alpha Levels and Colorectal Cancer Cell Survival under Hypoxia. Cell Rep 18 , 1699-1712 (2017) Backx E, Wauters E, Baldan J, Van Bulck M, Michiels E, Heremans Y , et al. MECOM permits pancreatic acinar cell dedifferentiation avoiding cell death under stress conditions. Cell Death Differ 28 , 2601-2615 (2021) Birdwell C, Fiskus W, Kadia TM, DiNardo CD, Mill CP & Bhalla KN. EVI1 dysregulation: impact on biology and therapy of myeloid malignancies. Blood Cancer J 11 , 64 (2021) Konantz M, Andre MC, Ebinger M, Grauer M, Wang H, Grzywna S , et al. EVI-1 modulates leukemogenic potential and apoptosis sensitivity in human acute lymphoblastic leukemia. Leukemia 27 , 56-65 (2013) Izutsu K, Kurokawa M, Imai Y, Maki K, Mitani K & Hirai H. The corepressor CtBP interacts with Evi-1 to repress transforming growth factor beta signaling. Blood 97 , 2815-2822 (2001) Palmer S, Brouillet JP, Kilbey A, Fulton R, Walker M, Crossley M , et al. Evi-1 transforming and repressor activities are mediated by CtBP co-repressor proteins. J Biol Chem 276 , 25834-25840 (2001) Turner J & Crossley M. Cloning and characterization of mCtBP2, a co-repressor that associates with basic Kruppel-like factor and other mammalian transcriptional regulators. EMBO J 17 , 5129-5140 (1998) Grooteclaes M, Deveraux Q, Hildebrand J, Zhang Q, Goodman RH & Frisch SM. C-terminal-binding protein corepresses epithelial and proapoptotic gene expression programs. Proc Natl Acad Sci U S A 100 , 4568-4573 (2003) Kovi RC, Paliwal S, Pande S & Grossman SR. An ARF/CtBP2 complex regulates BH3-only gene expression and p53-independent apoptosis. Cell Death Differ 17 , 513-521 (2010) Ding B, Yuan F, Damle PK, Litovchick L, Drapkin R & Grossman SR. CtBP determines ovarian cancer cell fate through repression of death receptors. Cell Death Dis 11 , 286 (2020) Wenes M, Shang M, Di Matteo M, Goveia J, Martin-Perez R, Serneels J , et al. Macrophage Metabolism Controls Tumor Blood Vessel Morphogenesis and Metastasis. Cell Metab 24 , 701-715 (2016) Harding HP, Novoa I, Zhang Y, Zeng H, Wek R, Schapira M , et al. Regulated translation initiation controls stress-induced gene expression in mammalian cells. Mol Cell 6 , 1099-1108 (2000) Jin HO, Seo SK, Woo SH, Kim ES, Lee HC, Yoo DH , et al. Activating transcription factor 4 and CCAAT/enhancer-binding protein-beta negatively regulate the mammalian target of rapamycin via Redd1 expression in response to oxidative and endoplasmic reticulum stress. Free Radic Biol Med 46 , 1158-1167 (2009) Kimball SR & Jefferson LS. Induction of REDD1 gene expression in the liver in response to endoplasmic reticulum stress is mediated through a PERK, eIF2alpha phosphorylation, ATF4-dependent cascade. Biochem Biophys Res Commun 427 , 485-489 (2012) Whitney ML, Jefferson LS & Kimball SR. ATF4 is necessary and sufficient for ER stress-induced upregulation of REDD1 expression. Biochem Biophys Res Commun 379 , 451-455 (2009) Wang M & Kaufman RJ. Protein misfolding in the endoplasmic reticulum as a conduit to human disease. Nature 529 , 326-335 (2016) Zong WX, Li C, Hatzivassiliou G, Lindsten T, Yu QC, Yuan J , et al. Bax and Bak can localize to the endoplasmic reticulum to initiate apoptosis. J Cell Biol 162 , 59-69 (2003) Hughes MA, Powley IR, Jukes-Jones R, Horn S, Feoktistova M, Fairall L , et al. Co-operative and Hierarchical Binding of c-FLIP and Caspase-8: A Unified Model Defines How c-FLIP Isoforms Differentially Control Cell Fate. Mol Cell 61 , 834-849 (2016) Humphreys LM, Fox JP, Higgins CA, Majkut J, Sessler T, McLaughlin K , et al. A revised model of TRAIL-R2 DISC assembly explains how FLIP(L) can inhibit or promote apoptosis. EMBO Rep 21 , e49254 (2020) Millard M, Yakavets I, Zorin V, Kulmukhamedova A, Marchal S & Bezdetnaya L. Drug delivery to solid tumors: the predictive value of the multicellular tumor spheroid model for nanomedicine screening. Int J Nanomedicine 12 , 7993-8007 (2017) Nath S & Devi GR. Three-dimensional culture systems in cancer research: Focus on tumor spheroid model. Pharmacol Ther 163 , 94-108 (2016) Pampaloni F, Reynaud EG & Stelzer EH. The third dimension bridges the gap between cell culture and live tissue. Nat Rev Mol Cell Biol 8 , 839-845 (2007) Sutherland RM. Cell and environment interactions in tumor microregions: the multicell spheroid model. Science 240 , 177-184 (1988) Chang TK, Lawrence DA, Lu M, Tan J, Harnoss JM, Marsters SA , et al. Coordination between Two Branches of the Unfolded Protein Response Determines Apoptotic Cell Fate. Mol Cell 71 , 629-636 e625 (2018) Lin JH, Li H, Yasumura D, Cohen HR, Zhang C, Panning B , et al. IRE1 signaling affects cell fate during the unfolded protein response. Science 318 , 944-949 (2007) Tam AB, Koong AC & Niwa M. Ire1 has distinct catalytic mechanisms for XBP1/HAC1 splicing and RIDD. Cell Rep 9 , 850-858 (2014) Urano F, Wang X, Bertolotti A, Zhang Y, Chung P, Harding HP , et al. Coupling of stress in the ER to activation of JNK protein kinases by transmembrane protein kinase IRE1. Science 287 , 664-666 (2000) Yang Q, Kim YS, Lin Y, Lewis J, Neckers L & Liu ZG. Tumour necrosis factor receptor 1 mediates endoplasmic reticulum stress-induced activation of the MAP kinase JNK. EMBO Rep 7 , 622-627 (2006) Dai W, Miller WP, Toro AL, Black AJ, Dierschke SK, Feehan RP , et al. Deletion of the stress-response protein REDD1 promotes ceramide-induced retinal cell death and JNK activation. FASEB J 32 , fj201800413RR (2018) Mucenski ML, Taylor BA, Ihle JN, Hartley JW, Morse HC, 3rd, Jenkins NA , et al. Identification of a common ecotropic viral integration site, Evi-1, in the DNA of AKXD murine myeloid tumors. Mol Cell Biol 8 , 301-308 (1988) Ellisen LW. Growth control under stress: mTOR regulation through the REDD1-TSC pathway. Cell Cycle 4 , 1500-1502 (2005) Kim JY, Kwon YG & Kim YM. The stress-responsive protein REDD1 and its pathophysiological functions. Exp Mol Med 55 , 1933-1944 (2023) Sinha I, Allen JE, Pinto JT & Sinha R. Methylseleninic acid elevates REDD1 and inhibits prostate cancer cell growth despite AKT activation and mTOR dysregulation in hypoxia. Cancer Med 3 , 252-264 (2014) Fattahi F, Saeednejad Zanjani L, Habibi Shams Z, Kiani J, Mehrazma M, Najafi M , et al. High expression of DNA damage-inducible transcript 4 (DDIT4) is associated with advanced pathological features in the patients with colorectal cancer. Sci Rep 11 , 13626 (2021) Pinto JA, Rolfo C, Raez LE, Prado A, Araujo JM, Bravo L , et al. In silico evaluation of DNA Damage Inducible Transcript 4 gene (DDIT4) as prognostic biomarker in several malignancies. Sci Rep 7 , 1526 (2017) Kato H, Nakajima S, Saito Y, Takahashi S, Katoh R & Kitamura M. mTORC1 serves ER stress-triggered apoptosis via selective activation of the IRE1-JNK pathway. Cell Death Differ 19 , 310-320 (2012) Deng X, Cao Y, Liu Y, Li F, Sambandam K, Rajaraman S , et al. Overexpression of Evi-1 oncoprotein represses TGF-beta signaling in colorectal cancer. Mol Carcinog 52 , 255-264 (2013) Pena C, Garcia JM, Garcia V, Silva J, Dominguez G, Rodriguez R , et al. The expression levels of the transcriptional regulators p300 and CtBP modulate the correlations between SNAIL, ZEB1, E-cadherin and vitamin D receptor in human colon carcinomas. Int J Cancer 119 , 2098-2104 (2006) Yerbes R, Palacios C, Reginato MJ & Lopez-Rivas A. Cellular FLIP(L) plays a survival role and regulates morphogenesis in breast epithelial cells. Biochim Biophys Acta 1813 , 168-178 (2011) Wiznerowicz M & Trono D. Conditional suppression of cellular genes: lentivirus vector-mediated drug-inducible RNA interference. J Virol 77 , 8957-8961 (2003) Stohr D, Schmid JO, Beigl TB, Mack A, Maichl DS, Cao K , et al. Stress-induced TRAILR2 expression overcomes TRAIL resistance in cancer cell spheroids. Cell Death Differ 27 , 3037-3052 (2020) Ruiz-Ruiz C & Lopez-Rivas A. Mitochondria-dependent and -independent mechanisms in tumour necrosis factor-related apoptosis-inducing ligand (TRAIL)-induced apoptosis are both regulated by interferon-gamma in human breast tumour cells. Biochem J 365 , 825-832 (2002) Mortazavi A, Williams BA, McCue K, Schaeffer L & Wold B. Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat Methods 5 , 621-628 (2008) Trapnell C, Williams BA, Pertea G, Mortazavi A, Kwan G, van Baren MJ , et al. Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nat Biotechnol 28 , 511-515 (2010) Love MI, Huber W & Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 15 , 550 (2014) Additional Declarations (Not answered) Supplementary Files FigureS1.jpg Supplementary figure 1 Supplementaryfigurelegends.docx Supplementary Figure legends FigureS2.jpg Supplementary Figure 2 Originalmaterial.pdf Original material Cite Share Download PDF Status: Published Journal Publication published 28 Mar, 2026 Read the published version in Cell Death & Disease → Version 1 posted Editorial decision: revise 12 Jun, 2025 Review # 2 received at journal 23 May, 2025 Review # 1 received at journal 21 Apr, 2025 Reviewer # 2 agreed at journal 16 Apr, 2025 Reviewer # 1 agreed at journal 01 Apr, 2025 Reviewers invited by journal 27 Mar, 2025 Submission checks completed at journal 27 Feb, 2025 Editor assigned by journal 26 Feb, 2025 First submitted to journal 26 Feb, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6111887","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":435066069,"identity":"80742f9f-8b37-455b-9c57-f23eddb438cc","order_by":0,"name":"Rocio Mora Molina","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABI0lEQVRIie2RMWuDQBiGPwmYRXA9ISS/oHAi6BTyV06EdlEoFFqHDgZBt3YV+icaAjdbDuxQ6RzQQQlkC9zkFEq1hbYkNunY4Z7p5Tsevnv5AASCf0r6lSoMoCKQfw7JcYW0ipb8Qfmme8arE4oVh3XKgY6t+MWuyGU5MYpws/Zvy8lZMKi5FJ3vK6M8w08JFMYo95aY4I1Oy8zS86wNqWwgKXL3FYRcYAoUdgIeRQQzia6IqQVyG1IwQYr83xV1+6HMlslFowVvbEbTYXNcQZ9b7Efkmto8YjZNlW7L4ceUrgsuDIS2XRfmJGV+o8/vmEOZcoXI60F9NAzXnPvFGKneouI7Nr1/iGkdNGxKn+MF59dO7zkA904HcPKQAoFAIOjnHVSKeMfGwU+OAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0001-7256-732X","institution":"The Babraham Institute","correspondingAuthor":true,"prefix":"","firstName":"Rocio","middleName":"Mora","lastName":"Molina","suffix":""},{"id":435066070,"identity":"bcc17005-76e5-4883-81ab-dd7c8371fee6","order_by":1,"name":"Younes El Yousfi","email":"","orcid":"https://orcid.org/0000-0002-2450-3337","institution":"Centro Andaluz de Biología Molecular y Medicina Regenerativa-CABIMER, CSIC-Universidad de Sevilla-Universidad Pablo de Olavide, 41092 Seville, Spain","correspondingAuthor":false,"prefix":"","firstName":"Younes","middleName":"El","lastName":"Yousfi","suffix":""},{"id":435066071,"identity":"454ebf45-fe84-411a-847e-02edb029ca7a","order_by":2,"name":"Cathrin Hagenlocher","email":"","orcid":"","institution":"University of Stuttgart, Stuttgart","correspondingAuthor":false,"prefix":"","firstName":"Cathrin","middleName":"","lastName":"Hagenlocher","suffix":""},{"id":435066072,"identity":"9b3d4b5a-2cd8-4648-8833-f7dcaf5aa762","order_by":3,"name":"F.Javier Fernández-Farrán","email":"","orcid":"","institution":"CABIMER, Consejo Superior de Investigaciones Científicas","correspondingAuthor":false,"prefix":"","firstName":"F.Javier","middleName":"","lastName":"Fernández-Farrán","suffix":""},{"id":435066073,"identity":"add2f91a-45c3-4057-a925-8e8469d1d6c1","order_by":4,"name":"Markus Rehm","email":"","orcid":"https://orcid.org/0000-0001-6149-9261","institution":"University of Stuttgart, Germany","correspondingAuthor":false,"prefix":"","firstName":"Markus","middleName":"","lastName":"Rehm","suffix":""},{"id":435066074,"identity":"9a1cb0f5-607e-45fb-ab53-7ffd5061ed38","order_by":5,"name":"Abelardo Lopez-Rivas","email":"","orcid":"https://orcid.org/0000-0002-9351-9690","institution":"CABIMER-Consejo Superior de Investigaciones Cientificas","correspondingAuthor":false,"prefix":"","firstName":"Abelardo","middleName":"","lastName":"Lopez-Rivas","suffix":""}],"badges":[],"createdAt":"2025-02-26 09:40:18","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6111887/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6111887/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41419-026-08648-7","type":"published","date":"2026-03-28T04:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":80716700,"identity":"61746527-435e-47a1-8bab-8edbf5fce8c4","added_by":"auto","created_at":"2025-04-16 10:05:55","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":900629,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eATF4-Induced REDD1 during ER Stress sensitizes HCT116 colon cancer cells to apoptosis.\u003c/strong\u003e \u003cstrong\u003e(A)\u003c/strong\u003e HCT116 cells were treated with thapsigargin (TG, 100 nM) for the indicated times. REDD1 and phosphorylation of 4EBP1, a downstream target of mTORC1, were assessed by western blotting. α-Tubulin and GAPDH served as loading controls. \u003cstrong\u003e(B)\u003c/strong\u003e HCT116 cells were transfected with either scrambled oligonucleotide (Sc) or ATF4 siRNA (siATF4) for 48 hours, followed by TG treatment (100 nM) for the indicated times. ATF4 knockdown and REDD1 induction were assessed in whole-cell extracts by western blotting. GAPDH was used as a loading control. \u003cstrong\u003e(C)\u003c/strong\u003e HCT116 cells were transfected with scrambled oligonucleotide (Sc) or REDD1 siRNA (siREDD1#1) for 48 hours, followed by treatment with or without TG (100 nM, left panel) or tunicamycin (TN, 1 μg/mL, right panel) for 24 or 48 hours, respectively, in the presence or absence of the pan-caspase inhibitor Q-VD-OPh (QVD, 20 μM). Apoptosis was quantified by subG1 analysis (ns = not statistically significant; ***p ≤ 0.001; ****p ≤ 0.0001; two-way ANOVA with Tukey’s multiple comparisons test). REDD1 knockdown was confirmed by western blotting in whole-cell extracts, with α-tubulin as a loading control.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-6111887/v1/64755d4f4ba82e1147773872.png"},{"id":80718002,"identity":"eeb3a085-4ddf-4b8c-aaba-17745784dc51","added_by":"auto","created_at":"2025-04-16 10:21:55","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1400749,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eREDD1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e knockout on ER stress-induced apoptosis and mTORC1 activity.\u003c/strong\u003e \u003cstrong\u003e(A)\u003c/strong\u003e HCT116 WT cells, ø#1 and ø#2 clones, as control cells, and \u003cem\u003eREDD1 KO\u003c/em\u003e A1#5 and E2#1 clones were treated or not with TG (100 nM) for 24 h. Apoptosis was determined after treatment by subG1 analysis (****p ≤ 0.0001. Two-way ANOVA. Tukey’s multiple comparisons test). \u003cstrong\u003e(B)\u003c/strong\u003e HCT116 WT, ø#2, \u003cem\u003eREDD1\u003c/em\u003eKO A1#5 and \u003cem\u003eREDD1\u003c/em\u003e KO E2#1 were treated or not with TG (100 nM) for 24 h. REDD1 and phosphorylation of 4EBP1 and p70S6K were determined in whole-cell extracts by western blotting. GAPDH was used as protein-loading control. \u003cstrong\u003e(C)\u003c/strong\u003eHCT116 ø#2 control clone and \u003cem\u003eREDD1\u003c/em\u003e KO A1#5 and E2#1 clones were treated with or without Torin-1 (250 nM) for 2 h, followed by the addition of TG (100 nM) for a further 24 h-period. After treatment, apoptosis was assessed by subG1 analysis (****p ≤ 0.0001; Two-way ANOVA. Tukey’s multiple comparisons test). REDD1 levels and 4EBP1 phosphorylation were determined in whole-cell extracts by western blotting. GAPDH was used as protein-loading control. \u003cstrong\u003e(D, E)\u003c/strong\u003e HCT116 WT cells and ø#2 clone, as control cells, and \u003cem\u003eREDD1 KO\u003c/em\u003e A1#5 \u003cstrong\u003e(D)\u003c/strong\u003e and E2#1\u003cstrong\u003e (E)\u003c/strong\u003e clones carrying pBABE-ø or pBABE-HA-REDD1 vectors were treated or not with TG (100 nM) for 24 h. Apoptosis was determined after treatment by subG1 analysis (***p ≤ 0.001; ****p ≤ 0.0001. Two-way ANOVA. Tukey’s multiple comparisons test). REDD1 levels were assessed in whole-cell extracts by western blotting. α–tubulin was used as protein-loading control.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-6111887/v1/583a4fc33d72a15f1bc8d2a2.png"},{"id":80718608,"identity":"84f36a18-34bc-43f8-b8c1-7a99f96910d9","added_by":"auto","created_at":"2025-04-16 10:29:55","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1389659,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe extrinsic apoptotic pathway drives ER stress-induced apoptosis in REDD1 knockout cells\u003c/strong\u003e. (A) HCT116 WT, ø#2, \u003cem\u003eREDD1\u003c/em\u003e KO A1#5 and \u003cem\u003eREDD1\u003c/em\u003e KO E2#1 cells were treated or not with TG (100 nM) for 24 h. REDD1, procaspase-8 (ProC8) and cleaved caspase-8 (cC8) levels were determined in whole-cell extracts by western blotting. GAPDH was used as protein-loading control. \u003cstrong\u003e(B, C) \u003c/strong\u003eHCT116 \u003cem\u003eREDD1\u003c/em\u003e KO A1#5 sh_Scrambled (sh_Scr), sh_Caspase-8#1 (sh_C8#1) cells \u003cstrong\u003e(B)\u003c/strong\u003e or HCT116 \u003cem\u003eREDD1\u003c/em\u003e KO A1#5 pBABE ø or pBABE FLIP\u003csub\u003eL\u003c/sub\u003e cells \u003cstrong\u003e(C)\u003c/strong\u003e were treated or not with TG (100 nM) for 24 h. Apoptosis was determined after treatment by subG1 analysis (ns = not statistically significant; *p ≤ 0.05. Multiple unpaired t test). Caspase-8 knockdown and FLIP\u003csub\u003eL\u003c/sub\u003e overexpression were determined in whole-cell extracts by western blotting. GAPDH was used as protein-loading control. \u003cstrong\u003e(D)\u003c/strong\u003e HCT116 \u003cem\u003eREDD1\u003c/em\u003e KO A1#5 cells were transfected with scrambled oligonucleotide#2 (Sc#2), siTRAILR1/DR4#1, and/or siTRAILR2/DR5#1, as indicated in the figure. After 48 hours, the cells were treated with TG (100 nM) for an additional 24h period. In parallel, HCT116 ø#2 cells were transfected with scrambled oligonucleotide#2 (Sc#2) or siTRAILR2/DR5#1 to serve as a control for the role of TRAILR2 in apoptosis induction in REDD1-expressing cells during ER stress. Apoptosis was determined after treatment by subG1 analysis (ns = not statistically significant; *p ≤ 0.05.; Two-way ANOVA. Tukey’s multiple comparisons test). TRAILR1/DR4 and TRAILR2/DR5 knockdown were confirmed by western blot analysis. Hsp70 and α-tubulin were used as loading controls for protein normalization.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-6111887/v1/e997b64f58728aa2c7755236.png"},{"id":80717618,"identity":"3c821a3d-6bef-4711-a3c6-90fd8f0bebef","added_by":"auto","created_at":"2025-04-16 10:13:55","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1804805,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEnhanced upregulation of TRAILR2/DR5 and increased sensitivity to apoptosis under ER stress in multicellular tumour spheroids derived from REDD1/DDIT4 knockout cells. \u003c/strong\u003e(A) REDD1 levels and 4EBP1 phosphorylation in cultures of HCT116 cells growing in 2D or as spheroids (3D) for 10 days. REDD1 levels and 4EBP1 phosphorylation were analyzed in whole-cell extracts by western blotting. Levels of REDD1 were quantified with Image LabTM 6.0 software using α-tubulin as protein-loading control and referred to 2D condition. \u003cstrong\u003e(B)\u003c/strong\u003e MCTSs were cultivated in agarose-coated 96-well plates with the media changed every third day. Images were captured using a Leica inverted digital microscope, and the diameter was measured with ImageJ software as described in the Materials and Methods. Graph represents mean values ± SEM (dashed lines) of one experiment (6 spheroids per cell line). Pictures are representative of the experiment. Scale bars = 200 μm. \u003cstrong\u003e(C, D) \u003c/strong\u003e10-day-old spheroids of HCT116 WT cells, ø#2 and \u003cem\u003eREDD1\u003c/em\u003eKO A1#5 clones were treated with TG (100 nM) for 3 days \u003cstrong\u003e(C)\u003c/strong\u003e or 1 day \u003cstrong\u003e(D)\u003c/strong\u003e. \u003cstrong\u003e(C) \u003c/strong\u003eCell viability was analyzed by flow cytometry after staining with Annexin V-FITC and propidium iodide (PI) (****p ≤ 0.0001; Two-way ANOVA. Tukey’s multiple comparisons test). \u003cstrong\u003e(D)\u003c/strong\u003e REDD1 deletion, mTORC1-mediated phosphorylation of 4EBP1, ProCaspase-8 (ProC8), cleaved caspase-8 (cC8), TRAILR2/DR5 and FLIP levels were assessed in whole-cell extracts by western blotting using GAPDH or α-tubulin as protein-loading controls.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-6111887/v1/12666f7337334fa615e824d9.png"},{"id":80717621,"identity":"e237e308-1a22-40d5-8c2f-1444d0379ada","added_by":"auto","created_at":"2025-04-16 10:13:55","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1843101,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSimilar activation of the PERK pathway and differential upregulation of TRAILR2/DR5 in response to ER stress between control and REDD1 knockout cells. \u003c/strong\u003eHCT116 control clone (ø#2) and \u003cem\u003eREDD1\u003c/em\u003e KO clones (A1#5 and E2#1) were treated with TG (100 nM) for the indicated times \u003cstrong\u003e(A-D)\u003c/strong\u003e. \u003cstrong\u003e(A)\u003c/strong\u003e Induction of ATF4 and CHOP proteins and REDD1 deletion were determined in whole-cell extracts by western blotting \u003cstrong\u003e(B)\u003c/strong\u003e cFLIP protein levels in control and \u003cem\u003eREDD1\u003c/em\u003e KO clones were assessed in whole-cell extracts by western blotting. GAPDH was used as protein-loading control. \u003cstrong\u003e(C) \u003c/strong\u003eTRAILR2/DR5 protein levels in control and \u003cem\u003eREDD1\u003c/em\u003e KO clones were determined in whole-cell extracts by western blotting. \u003cstrong\u003e(D)\u003c/strong\u003e Control and \u003cem\u003eREDD1\u003c/em\u003e KO clones were treated with TG for 7 h. \u003cem\u003eTRAILR2/DR5\u003c/em\u003e mRNA relative levels in control and \u003cem\u003eREDD1\u003c/em\u003e KO clones were examined by RT-qPCR. \u003cem\u003eTRAILR2/DR5\u003c/em\u003e mRNA relative levels were referred to ø#2 clone without treatment (*p≤ 0.05; Multiple unpaired t test). \u003cstrong\u003e(E-F)\u003c/strong\u003e Cells from HCT116 control clone ø#2 and \u003cem\u003eREDD1\u003c/em\u003e KO clones (A1#5 and E2#1) were transfected with a pool of scrambled oligonucleotides (Sc\u003csub\u003ePOOL\u003c/sub\u003e) or CHOP (CHOP\u003csub\u003ePOOL)\u003c/sub\u003e, as indicated in the figure, for 48 h prior to TG (100 nM) treatment. \u003cstrong\u003e(E)\u003c/strong\u003e Apoptosis was determined after 24 h of TG treatment by subG1 analysis (ns = not statistically significant; ****p ≤ 0.0001; *p ≤ 0.05.; Two-way ANOVA. Tukey’s multiple comparisons test). \u003cstrong\u003e(F)\u003c/strong\u003e TRAILR2/DR5 expression was assessed by western blotting (right panel) or RT-qPCR (left panel) after 16 h of treatment with TG. CHOP, REDD1 and TRAILR2/DR5 protein levels were determined in whole-cell extracts. Relative levels of \u003cem\u003eTRAILR2/DR5\u003c/em\u003e mRNA were referred to ø#2 clone without treatment (ns = not statistically significant; ****p ≤ 0.0001; *p≤ 0.05; Two-way ANOVA. Tukey’s multiple comparisons test).\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-6111887/v1/d60b1dca27714d38f743d5d8.png"},{"id":80716707,"identity":"8b2efe16-0db2-44f9-8e44-253295f47aeb","added_by":"auto","created_at":"2025-04-16 10:05:55","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":2116179,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEVI-1/MECOM knockdown reproduces the REDD1 deletion phenotype. (A) \u003c/strong\u003eVenn diagram showing the intersection of dysregulated genes in\u003cem\u003e REDD1/DDIT4\u003c/em\u003e KO clones versus the REDD1-expressing clone Ø#2, treated without (left panel) or with TG (100 nM) (right panel) for 7h. \u003cstrong\u003e(B)\u003c/strong\u003eVolcano plot for differentially expressed genes in \u003cem\u003eREDD1 \u003c/em\u003eKO A1#5 or E2#1 clones, as indicated in the figure, versus the REDD1-expressing clone Ø#2. Downregulated and upregulated genes with more than 1-fold change with a P-value \u0026lt; 0.01 are depicted in blue and green, respectively. MECOM downregulation is depicted in red.\u003cstrong\u003e (C) \u003c/strong\u003eHCT116 WT cells were transfected with a scrambled oligonucleotide#2 (Sc#2) or EVI-1/MECOM siRNA (siMECOM) for 48 h before TG (100 nM) treatment. Apoptosis was determined after 24h treatment by subG1 analysis (*p ≤ 0.05.; Multiple unpaired t test). EVI-1/MECOM knockdown was assessed by RT-qPCR. For each cell line, RNA relative levels of \u003cem\u003eEVI-1/MECOM\u003c/em\u003ewere referred to Sc#2 without treatment. \u003cstrong\u003e(D) \u003c/strong\u003eHCT116 WT (left panel) and HCT116 ø#2 (right panel) cells were transfected with scrambled oligonucleotide#2 (Sc#2), EVI-1/MECOM (siMECOM), Caspase-8 (siC8#1) and/or TRAILR2/DR5#1 (siTRAILR2/DR5#1) siRNA, as indicated in the figure, for 48 h before TG (100 nM) treatment for 24h. Apoptosis was determined after treatment by subG1 analysis (****p ≤ 0.0001; **p ≤ 0.01.; Two-way ANOVA. Tukey’s multiple comparisons test). Caspas-8 (C8) and TRAILR2/DR5#1 knockdowns were confirmed in whole-cell extracts by western blotting. GAPDH and Hsp70 were used as protein-loading controls. EVI-1/MECOM knockdown was assessed by RT-qPCR (lower panels). For each cell line, mRNA relative levels of \u003cem\u003eEVI-1/MECOM\u003c/em\u003e were referred to Sc#2 without treatment.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-6111887/v1/6e7317f40ab193c64dcfbdff.png"},{"id":80718004,"identity":"ec42a44b-d3bd-4234-beba-c8878452c343","added_by":"auto","created_at":"2025-04-16 10:21:55","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1229292,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEVI-1/MECOM-CtBP transcriptional module regulates TRAILR2/DR5 expression in HCT116 cells under ER stress. (A-B) \u003c/strong\u003eHCT116 WT cells were transfected with scrambled oligonucleotide#2 (Sc#2) or EVI-1/MECOM siRNA (siMECOM) for 48 h prior to treatment with TG (100 nM) for a further 7 h period. \u003cstrong\u003e(A)\u003c/strong\u003e TRAILR2/DR5 expression was assessed by RT-qPCR and mRNA relative levels of \u003cem\u003eTRAILR2/DR5\u003c/em\u003e were referred to Sc#2 without treatment (ns = not statistically significant; **p ≤ 0.01; Multiple unpaired t test). \u003cstrong\u003e(B) \u003c/strong\u003eTRAILR2/DR5 protein levels were determined in whole cell extracts by western blotting. Hsp70 was used as protein-loading control. \u003cstrong\u003e(C-E) \u003c/strong\u003eHCT116 WT cells were transfected with scrambled oligonucleotide#2 (Sc#2) or CtBP siRNA (siCtBP) for 48 h before TG (100 nM) treatment. In \u003cstrong\u003e(C)\u003c/strong\u003e Apoptosis was determined after 24h treatment by subG1 analysis (*** = p ≤ 0.001; Multiple upaired t test). CtBP knockdown was assessed by RT-qPCR. \u003cstrong\u003e(D)\u003c/strong\u003e TRAILR2/DR5 expression was assessed by RT-qPCR and mRNA relative levels of \u003cem\u003eTRAILR2/DR5\u003c/em\u003ewere referred to Sc#2 without treatment (ns = not statistically significant; **p≤ 0.01; Multiple unpaired t test). \u003cstrong\u003e(E) \u003c/strong\u003eTRAILR2/DR5 protein levels and CtBP knockdown were determined in whole-cell extracts by western blotting. Hsp70 was used as a protein-loading control.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-6111887/v1/58f43fbc094cf92cf37ef5fb.png"},{"id":80717623,"identity":"d354c449-7451-446a-a3fa-af70afc182e8","added_by":"auto","created_at":"2025-04-16 10:13:55","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":4572927,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSchematic representation of the proposed mechanism through which REDD1/DDIT4 regulates ER stress-induced upregulation of TRAILR2/DR5 expression and apoptosis in HCT116 tumour cells.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe figure illustrates the critical role of REDD1/DDIT4 in regulating TRAILR2/DR5-induced caspase-8 activation and apoptosis under chronic ER stress, by inhibiting mTORC1 activity and promoting MECOM/EVI-1-mediated repression of TRAILR2/DR5 gene expression. Created with BioRender.\u003c/p\u003e","description":"","filename":"Figure8graphicalabstract.tif.png","url":"https://assets-eu.researchsquare.com/files/rs-6111887/v1/db2f81e2fe7d40fb4cdd865a.png"},{"id":108669199,"identity":"37355a3e-abb1-42ff-8a0b-164250cc0331","added_by":"auto","created_at":"2026-05-07 07:13:13","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":16019336,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6111887/v1/fbc90dfd-7bf3-4e8f-9cf5-338b3f1ad9d8.pdf"},{"id":80716703,"identity":"b67a1e4f-447d-405b-90fb-6caf97af1021","added_by":"auto","created_at":"2025-04-16 10:05:55","extension":"jpg","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":361399,"visible":true,"origin":"","legend":"Supplementary figure 1","description":"","filename":"FigureS1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6111887/v1/c8390a6a1a0d60c04cfcd5af.jpg"},{"id":80717615,"identity":"08b3062b-94ed-47d7-a541-5c19b0b35962","added_by":"auto","created_at":"2025-04-16 10:13:55","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":13854,"visible":true,"origin":"","legend":"Supplementary Figure legends","description":"","filename":"Supplementaryfigurelegends.docx","url":"https://assets-eu.researchsquare.com/files/rs-6111887/v1/cb19d3d8ccce4874eee22447.docx"},{"id":80716722,"identity":"df39b5d6-d233-47bf-b190-2e79fe4ebc64","added_by":"auto","created_at":"2025-04-16 10:05:55","extension":"jpg","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":898857,"visible":true,"origin":"","legend":"Supplementary Figure 2","description":"","filename":"FigureS2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-6111887/v1/56b99684138001ca36121dca.jpg"},{"id":80716739,"identity":"2cd32413-143d-4fdc-8683-06036c50173f","added_by":"auto","created_at":"2025-04-16 10:05:56","extension":"pdf","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":11732472,"visible":true,"origin":"","legend":"Original material","description":"","filename":"Originalmaterial.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6111887/v1/8db22258d65c9e309fc3a3a1.pdf"}],"financialInterests":"(Not answered)","formattedTitle":"REDD1/DDIT4 counteracts endoplasmic reticulum stress-induced apoptosis by controlling the expression of death receptor TRAILR2/DR5 in cancer cells","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe tumour microenvironment is characterized by severe hypoxia, nutrient deprivation and acidosis that provoke the accumulation of unfolded and misfolded proteins in the endoplasmic reticulum (ER) \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. This results in ER stress and the activation of an adaptive response to promote tumour survival and progression \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. Protein sensors located in the luminal face of the ER membrane activate an intracellular signaling mechanism called the unfolded protein response (UPR) \u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. Activation of these signaling pathways leads to a reduction in the influx of proteins into the ER, triggers protein degradation pathways and increases the folding capacity of the ER \u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. However, above a certain threshold, unresolved ER stress results in cell death by apoptosis \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Up-regulation of pro-apoptotic proteins and down-regulation of anti-apoptotic proteins have been observed in cells undergoing apoptosis upon ER stress \u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. Up-regulation of TRAIL receptor 2/Death Receptor 5 (TRAILR2/DR5) expression and its intracellular activation in a TRAIL-independent manner mediates the execution of a caspase-8-dependent apoptotic pathway upon ER stress in both tumour and oncogenically transformed cells \u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. Moreover, it has been reported that misfolded proteins directly bind to and activate TRAILR2/DR5 in the ER-Golgi intermediate compartment to induce caspase-8 activation and apoptosis \u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn response to ER stress, regulated in development and DNA damage response-1 (REDD1/DDIT4) protein is up-regulated, leading to the inhibition of the mammalian target of rapamycin complex 1 (mTORC1) in a tuberous sclerosis complex (TSC1/TSC2)-dependent manner) \u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. Furthermore, loss of the upstream regulators of the mTOR pathway TSC1 and TSC2 leads to constitutive activation of mTORC1 and tumour development \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. Interestingly, tumour cells harbouring an activated mTOR pathway are more sensitive to ER stress-induced cell death \u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e, although the molecular mechanism underlying this cell death process remains poorly understood. In addition to its role in controlling mTORC1 signaling, REDD1/DDIT4 also has mTORC1-independent functions. These include preventing mitochondrial ROS production and stabilising HIF1α \u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e, inducing autophagy \u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e, or activating proinflammatory signaling pathways \u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. Although a tumour suppressor role has been reported for REDD1/DDIT4 in some malignancies \u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e, in colorectal cancer the elevated expression of REDD1/DDIT4 may have a pro-tumoural function promoting survival of stressed tumour cells \u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. Despite this observation, the way REDD1 modulates the response of colon tumour cells to ER stress remains poorly understood.\u003c/p\u003e \u003cp\u003eEVI-1/MECOM is a zinc finger transcription factor commonly linked to oncogenesis and apoptosis \u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e. Additionally, EVI-1/MECOM can interact with the corepressor proteins C-terminal Binding Protein (CtBP) via a repressive domain located between two zinc finger domains in its C-terminal region \u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. Notably, CtBPs are known to play a key role in repressing the expression of pro-apoptotic genes \u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e, including TRAILR1/DR4 and TRAILR2/DR5 \u003csup\u003e36\u003c/sup\u003e, in tumour cells. In this study, we show that REDD1/DDIT4 plays a critical role in preventing the activation of apoptosis in response to chronic ER stress in colon cancer cells. This is accomplished by inhibiting mTORC1 and regulating the expression of TRAILR2/DR5 via the EVI-1/MECOM-CtBP transcriptional repressor module. Our findings suggest that elevated REDD1/DDIT4 expression in colorectal cancer may provide a growth advantage in the hostile tumour microenvironment by inhibiting ER stress-induced upregulation of TRAILR2/DR5 and activation of the extrinsic apoptotic pathway, thus facilitating tumour growth and progression.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eATF4-dependent REDD1/DDIT4 expression is required for survival of colon cancer cells undergoing ER stress\u003c/h2\u003e \u003cp\u003eDifferent stressful conditions of the tumour microenvironment cause ER stress and trigger the UPR \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. Although a tumour-suppressor role has been proposed for REDD1/DDIT4 in some contexts \u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e, in colorectal cancer REDD1/DDIT4 induction facilitates cellular adaptation in hypoxic conditions \u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e, and promotes the tumour-supportive function of tumour-associated macrophages (TAMs) \u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. However, despite the observation that REDD1/DDIT4 is frequently up-regulated in colorectal cancer \u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e, its function in the response of colon tumour cells to ER stress has not been elucidated.\u003c/p\u003e \u003cp\u003eTo investigate this issue, we first evaluated the expression of REDD1/DDIT4 in the HCT116 human colon cancer cell line following exposure to ER stress-inducing agents. Treatment with the ER stress inducer thapsigargin (TG) resulted in an upregulation of REDD1/DDIT4 protein expression, which was detectable as early as 3 hours after TG was added to HCT116 cell cultures (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). The increase in REDD1/DDIT4 expression was associated with an inhibition of the kinase activity of the mTORC1 complex as determined by measuring 4EBP1 phosphorylation, a substrate of the mTORC1 kinase (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). To further investigate the mechanism underlying the observed elevation of REDD1/DDIT4 levels upon ER stress we determined the role of the ATF4 transcription factor, a well-known mediator of the PERK branch of the UPR in the adaptive response to ER stress \u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, knockdown of ATF4 expression by siRNA interference markedly inhibited REDD1/DDIT4 increase in HCT116 cells treated with TG, confirming data obtained in other cell types \u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo elucidate the role of REDD1/DDIT4 in the apoptotic response of colon tumour cells to ER stress, we assessed the susceptibility of control and REDD1/DDIT4 knockdown HCT116 cells to the ER stress inducers TG and tunicamycin (TN). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, REDD1/DDIT4 knockdown resulted in a significant increase in the apoptotic population following treatment with either TG (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, left panel) or TN (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, right panel), an effect that was substantially inhibited by co-treatment with the pan-caspase inhibitor Q-VD-Oph. To confirm these findings, we used two additional siRNA sequences targeting REDD1/DDIT4 prior to exposure to the ER stress inducers. All sequences significantly enhanced apoptosis following treatment with TG or TN (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA and B, respectively). Moreover, after ER stress induction, REDD1/DDIT4 knockdown cells exhibited sustained mTORC1 kinase activity, as demonstrated by the phosphorylation of its downstream targets, 4EBP1 and p70S6K (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA and B, respectively). To further validate the role of REDD1/DDIT4 in HCT116 colon cancer cells undergoing ER stress-induced apoptosis, REDD1/DDIT4 knockout (KO) cells were generated using CRISPR/Cas9 gene editing. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, \u003cem\u003eREDD1/DDIT4\u003c/em\u003e KO clones exhibited heightened sensitivity to TG treatment compared to parental cells or REDD1/DDIT4-expressing control clones (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Consistent with REDD1/DDIT4's canonical function in regulating mTORC1 activity by inhibiting Akt-mediated control of the TSC \u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e, \u003cem\u003eREDD1/DDIT4\u003c/em\u003e KO cells exhibited enhanced mTORC1 activation, both under control and treatment conditions, as assessed by the phosphorylation of 4EBP1 and p70S6K (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). To evaluate the role of mTOR in REDD1/DDIT4-mediated sensitization to ER stress, REDD1/DDIT4-expressing and \u003cem\u003eREDD1/DDIT4\u003c/em\u003e KO clones were pre-treated for 2 hours with the mTORC1/2 inhibitor Torin-1 before being treated with TG for an additional 24 hours. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC, Torin-1 markedly inhibited TG-induced apoptosis in REDD1/DDIT4-depleted cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo confirm that the increased apoptosis observed upon ER stress in REDD1/DDIT4 knockout (KO) cells was specifically due to the loss of REDD1/DDIT4, we restored its expression by infecting these KO cells with retroviruses carrying the HA-REDD1/DDIT4 expression vector. Notably, the enhanced sensitivity to TG-induced apoptosis was significantly reduced in \u003cem\u003eREDD1/DDIT4\u003c/em\u003e KO clones ectopically expressing HA-REDD1/DDIT4. This resulted in apoptosis levels comparable to those observed in parental cells or in a REDD1/DDIT4-expressing control clone treated with TG (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD and E).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eREDD1/DDIT4 plays a key role in the control of ER stress-induced activation of TRAILR2/DR5-mediated apoptosis\u003c/h3\u003e\n\u003cp\u003eER stress-induced activation of the unfolded protein response (UPR) triggers signaling pathways aimed at restoring ER proteostasis to promote cell survival \u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. However, unresolved ER stress shifts the cellular response from adaptation to apoptotic cell death, in which either the intrinsic \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e, extrinsic \u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e, or both apoptotic pathways \u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e have been implicated. In the HCT116 model, activation of the PERK/ATF4/CHOP branch of the UPR under chronic ER stress conditions results in upregulation of TRAILR2/DR5 expression, leading to the formation of an intracellular DISC and activation of the extrinsic apoptosis pathway, independent of the TRAIL ligand \u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eGiven the role of the extrinsic apoptotic pathway triggered by TRAIL receptors in ER stress-induced cell death in HCT116 tumour cells \u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e, we hypothesized that the increased susceptibility of REDD1/DDIT4-deficient tumour cells to ER stress could be attributed to enhanced activation of caspase-8, a key caspase in the execution of the extrinsic apoptotic pathway. To test this, we assessed caspase-8 activation by examining its protein processing following TG treatment. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, both \u003cem\u003eREDD1/DDIT4\u003c/em\u003e KO clones exhibited significantly increased caspase-8 processing and subsequent activation compared to control cells. To further explore the involvement of the extrinsic apoptotic pathway in the heightened sensitivity of \u003cem\u003eREDD1/DDIT4\u003c/em\u003e KO cells to ER stress, we inhibited caspase-8 activation either by caspase-8 knockdown (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB) or by overexpressing cFLIP\u003csub\u003eL\u003c/sub\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC), which is known to prevent caspase-8 processing \u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e. As shown in Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC, the increased susceptibility of \u003cem\u003eREDD1/DDIT4\u003c/em\u003e KO cells to TG treatment was significantly reduced in cells with caspase-8 knockdown or cFLIP\u003csub\u003eL\u003c/sub\u003e overexpression. We also explored the role of pro-apoptotic TRAIL receptors, TRAILR1/DR4 and TRAILR2/DR5 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD), in the heightened susceptibility of REDD1/DDIT4-deficient cells to ER stress. Notably, only knockdown of TRAILR2/DR5 significantly inhibited ER stress-induced apoptosis in the absence of REDD1/DDIT4. Taken together, these results suggest that REDD1/DDIT4 plays a role in delaying excessive caspase-8 activation and apoptosis via the extrinsic pathway, thereby promoting cell adaptation rather than cell death.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eMulticellular tumour spheroids (MCTSs) derived from REDD1/DDIT4 knockout (KO) cells exhibit increased susceptibility to apoptosis induced by ER stress.\u003c/em\u003e \u003c/p\u003e \u003cp\u003eMCTSs, greater than 500 \u0026micro;m in size, more accurately replicate the three-dimensional architecture of growing tumours compared to traditional 2D cell cultures \u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e. Previously, we reported that 3D spheroids derived from HCT116 tumour cells display resistance to ER stress-induced apoptosis compared to their 2D counterparts \u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. Given that REDD1/DDIT4 is a stress-induced protein, and considering that oxygen and nutrient availability decline in the deeper layers of spheroids as they grow \u003csup\u003e\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u003c/sup\u003e, we hypothesized that REDD1/DDIT4 levels might be upregulated in spheroid cultures. Indeed, analysis of REDD1/DDIT4 protein expression in whole cell extracts revealed that its levels were significantly higher in spheroids than in 2D cultures of HCT116 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Moreover, this upregulation of REDD1/DDIT4 was associated with reduced mTORC1 activity, as indicated by decreased phosphorylation of its downstream target 4EBP1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eNext, we investigated whether depleting REDD1/DDIT4 in HCT116 cells would enhance the sensitivity of MCTSs to apoptosis induced by TG. Spheroids were generated from both control and \u003cem\u003eREDD1/DDIT4\u003c/em\u003e KO cells, and after confirming that the loss of REDD1/DDIT4 expression did not affect spheroid growth (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB), we assessed their response to ER stress-induced apoptosis. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC, spheroids lacking REDD1/DDIT4 were markedly more susceptible to TG-induced apoptosis compared to spheroids derived from either the parental cells or a control REDD1/DDIT4-expressing clone. Notably, the increased apoptosis observed in \u003cem\u003eREDD1/DDIT4\u003c/em\u003e KO spheroids was accompanied by elevated levels of TRAILR2/DR5 protein and caspase-8 activation following TG treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). Interestingly, despite TG treatment, the phosphorylation of 4EBP1\u0026mdash;and thus mTORC1 activity\u0026mdash;was significantly higher in REDD1/DDIT4 KO spheroids, confirming that REDD1/DDIT4 regulates mTORC1 activity in MCTSs (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). In summary, these findings suggest that REDD1/DDIT4 plays a protective role in colon tumour cells under ER stress by delaying the upregulation of TRAILR2/DR5, thereby preventing premature activation of caspase-8 and the initiation of the extrinsic apoptotic pathway.\u003c/p\u003e\n\u003ch3\u003eREDD1/DDIT4 regulates TRAILR2/DR5 expression in colon cancer cells under ER stress\u003c/h3\u003e\n\u003cp\u003eIn response to unresolved ER stress, the PERK branch of the UPR can activate the extrinsic apoptotic pathway by both downregulating FLIP levels \u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e and upregulating TRAILR2/DR5 expression via CHOP induction \u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. Given the critical role of the PERK pathway in regulating TRAILR2/DR5 expression and, consequently, ER stress-induced apoptosis, we first investigated whether the loss of REDD1/DDIT4 would enhance PERK pathway activation. However, analysis of PERK pathway activation, assessed by measuring ATF4 and CHOP protein levels after TG treatment, revealed similar activation in both control and \u003cem\u003eREDD1/DDIT4\u003c/em\u003e KO cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Moreover, TG treatment resulted in similar downregulation of cFLIP in \u003cem\u003eREDD1/DDIT4\u003c/em\u003e KO cells and control cells expressing REDD1/DDIT4 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Collectively, these results suggest that the activation of the PERK branch of the UPR was comparable between control and \u003cem\u003eREDD1/DDIT4\u003c/em\u003e KO cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo further explore the mechanism underlying the increased sensitivity of \u003cem\u003eREDD1/DDIT4\u003c/em\u003e KO cells to ER stress, we assessed TRAILR2/DR5 protein levels in both control and \u003cem\u003eREDD1/DDIT4\u003c/em\u003e KO cells treated with TG. In contrast to the results for ATF4 and CHOP expression, we observed a marked increase in both TRAILR2/DR5 monomer and oligomer levels in REDD1/DDIT4-deficient cells compared to control cells upon ER stress induction (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). To investigate the mechanism behind the elevated TRAILR2/DR5 expression in \u003cem\u003eREDD1/DDIT4\u003c/em\u003e KO cells under ER stress, we first measured \u003cem\u003eTRAILR2/DR5\u003c/em\u003e mRNA levels in both control and \u003cem\u003eREDD1/DDIT4\u003c/em\u003e KO cells treated with TG. Compared to control cells, \u003cem\u003eREDD1/DDIT4\u003c/em\u003e KO cells exhibited a significant upregulation of \u003cem\u003eTRAILR2/DR5\u003c/em\u003e mRNA upon TG treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). Notably, even without ER stress, \u003cem\u003eREDD1/DDIT4\u003c/em\u003e KO cells showed enhanced TRAILR2/DR5 mRNA expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD), suggesting that REDD1/DDIT4 plays a role in regulating TRAILR2/DR5 expression in tumour cells, independently of stress conditions.\u003c/p\u003e \u003cp\u003eAlthough REDD1/DDIT4 expression did not affect CHOP protein levels in response to TG treatment, its essential role in TRAILR2/DR5 induction following ER stress prompted us to investigate whether CHOP was critical for sensitization after REDD1/DDIT4 depletion. CHOP was knocked down using RNA interference, and apoptosis was completely inhibited in both control and REDD1/DDIT4-depleted cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). Interestingly, analysis of TRAILR2/DR5 expression revealed that CHOP knockdown led to a significant decrease in both \u003cem\u003eTRAILR2/DR5\u003c/em\u003e mRNA and protein levels in response to TG treatment. However, elevated TRAILR2/DR5 expression was still observed in \u003cem\u003eREDD1/DDIT4\u003c/em\u003e KO cells, regardless of CHOP expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF). This suggests that a CHOP-independent mechanism may be differentially active between control and \u003cem\u003eREDD1/DDIT4\u003c/em\u003e KO cells, with the latter maintaining higher levels of TRAILR2/DR5 compared to control cells.\u003c/p\u003e \u003cp\u003eDuring the adaptive phase of the UPR, the IRE1 branch mediates the regulated IRE1α-dependent decay (RIDD) of TRAILR2/DR5 mRNA through its RNase activity, thereby promoting cell survival \u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e\u003c/sup\u003e. Under unresolved ER stress, IRE1 signaling is attenuated, and chronic activation of the PERK pathway ultimately drives apoptotic cell death \u003csup\u003e\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u003c/sup\u003e. We next investigated whether the increased \u003cem\u003eTRAILR2/DR5\u003c/em\u003e mRNA levels observed in \u003cem\u003eREDD1/DDIT4\u003c/em\u003e KO cells could result from impaired IRE1 signaling, which may allow for early upregulation of \u003cem\u003eTRAILR2/DR5\u003c/em\u003e mRNA. To test this, we analyzed IRE1-mediated XBP1 splicing in both control and \u003cem\u003eREDD1/DDIT4\u003c/em\u003e KO cells following TG treatment. As shown in Figure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eA, no differences in XBP1 splicing were detected between control and REDD1/DDIT4-deficient cells, suggesting that IRE1 signaling is comparable regardless of REDD1/DDIT4 expression. Although both XBP1 splicing and RIDD are mediated by the IRE1 RNase domain, they are distinct processes \u003csup\u003e\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u003c/sup\u003e. To further explore the role of the IRE1 pathway in the upregulation of \u003cem\u003eTRAILR2/DR5\u003c/em\u003e mRNA in the absence of REDD1/DDIT4, we performed IRE1 knockdown prior to TG treatment and evaluated TRAILR2/DR5 upregulation in both control and \u003cem\u003eREDD1/DDIT4\u003c/em\u003e KO cells (Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eB). As shown in Figure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eB, IRE1 knockdown, confirmed by western blotting and XBP1 splicing analysis (left panel), slightly facilitated TRAILR2/DR5 upregulation. However, this effect was independent of REDD1/DDIT4 expression (right panel). These findings suggest that differential IRE1 signaling is unlikely to explain the increased TRAILR2/DR5 expression observed in REDD1/DDIT4-deficient cells.\u003c/p\u003e \u003cp\u003eER stress also activates c-Jun N-terminal kinase 1 (JNK), which is implicated in apoptosis through the intrinsic pathway \u003csup\u003e\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e\u003c/sup\u003e. Additionally, REDD1 has been shown to inhibit apoptosis by suppressing JNK signaling in MEFs and retinal precursor cells \u003csup\u003e\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e\u003c/sup\u003e. Based on these findings, we hypothesized that enhanced JNK signaling might contribute to the increased apoptosis observed in REDD1-deficient cells by promoting the upregulation of TRAILR2/DR5 expression. We confirmed that the loss of REDD1 leads to JNK activation, as evidenced by increased phosphorylation of its target c-Jun at Ser73 (Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eC, left panel). However, pharmacological inhibition of JNK did not restore TRAILR2/DR5 mRNA levels (Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eC, right panel), suggesting that JNK signaling does not directly mediate the upregulation of TRAILR2/DR5 in REDD1-deficient cells.\u003c/p\u003e \u003cp\u003e \u003cem\u003eIdentification of the EVI-1/MECOM transcription factor as a potential regulator of ER stress-induced TRAILR2/DR5 upregulation and apoptosis in REDD1/DDIT4-deficient cells\u003c/em\u003e \u003c/p\u003e \u003cp\u003eWe hypothesized that the increased sensitivity to ER stress-induced apoptosis observed in the absence of REDD1/DDIT4 is due to elevated expression of TRAILR2/DR5 in these cells. To identify potential mediators of TRAILR2/DR5 expression in REDD1/DDIT4-deficient cells, we treated both REDD1/DDIT4-expressing and \u003cem\u003eREDD1/DDIT4\u003c/em\u003e KO cells with TG for 7 hours and performed RNA-seq analysis. Among the over 200 dysregulated genes in both \u003cem\u003eREDD1/DDIT4\u003c/em\u003e KO clones (under both control and TG-treated conditions), we identified the EVI-1/MECOM transcription factor (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA) \u003csup\u003e\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e\u003c/sup\u003e as a potential regulator of TRAILR2/DR5 expression \u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. In REDD1/DDIT4-depleted cells, EVI-1/MECOM transcript levels were significantly downregulated (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). These findings were further confirmed by real time-qPCR (Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo investigate whether the loss of EVI-1/MECOM enhances susceptibility to ER stress-induced apoptosis, we performed EVI-1/MECOM knockdown in HCT116 parental cells and the REDD1/DDIT4-expressing clone prior to TG treatment. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC, knockdown of EVI-1/MECOM notably increased the sensitivity of cells to TG-induced apoptosis compared to the scrambled RNA controls. Furthermore, similar to the sensitization observed with REDD1/DDIT4 loss, silencing EVI-1/MECOM expression enhanced TG-induced apoptosis in a caspase-8- and TRAILR2/DR5-dependent manner (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD), as this effect was abolished by knockdown of caspase-8 or TRAILR2/DR5. A hallmark of the increased susceptibility to ER stress in \u003cem\u003eREDD1/DDIT4\u003c/em\u003e KO cells was the elevated expression of TRAILR2/DR5 observed following treatment with the ER stress inducer. We then examined whether this effect was also observed in EVI-1/MECOM knockdown cells. As seen in Figs.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA and \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB, silencing EVI-1/MECOM expression in REDD1/DDIT4-expressing cells was sufficient to promote TG-induced upregulation of both mRNA and protein levels of TRAILR2/DR5. Collectively, our findings suggest that the loss of EVI-1/MECOM observed in \u003cem\u003eREDD1/DDIT4\u003c/em\u003e KO cells plays a critical role in regulating TRAILR2/DR5 expression and mediating apoptosis in response to ER stress.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe C-terminal binding protein (CtBP) family of transcriptional corepressors has been shown to cooperate with EVI-1/MECOM in transcriptional repression \u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e and is highly expressed in aggressive tumours \u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. Although a direct link between EVI-1/MECOM and TRAILR2/DR5 regulation remains unestablished, CtBP proteins have been implicated as repressors of pro-apoptotic TRAIL receptor expression in tumour cells \u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. Consequently, we investigated the potential role of CtBP1/2 in modulating TRAILR2/DR5 expression and the apoptotic response to ER stress in HCT116 cells. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC, silencing CtBP1/2 with siRNA significantly sensitized tumour cells to TG-induced apoptosis. This increased sensitivity was associated with a pronounced upregulation of TRAILR2/DR5 at both the mRNA and protein levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD, \u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eE). Overall, our data support the hypothesis that EVI-1/MECOM, in collaboration with proteins of the CTBP family, may function as a key repressor of the apoptotic response to chronic ER stress in HCT116 tumour cells, by counteracting the upregulation of TRAILR2/DR5 induced by the PERK-ATF4-CHOP signaling axis of the UPR. The loss of MECOM expression in REDD1 KO cells would result in impaired repression of TRAIL-R2/DR5 gene expression by CtBP family proteins, leading to an elevation of the levels of this pro-apoptotic receptor in these tumour cells and the activation of cell death via apoptosis.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn a tumour, cancer cells face several insults, including nutrient starvation, hypoxia or ROS. Consequently, the function of protein folding machinery is impaired in cancer cells leading to the accumulation of unfolded and misfolded proteins and thus to ER stress \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. Chronic or excessive ER stress switches UPR signaling from an adaptive response to trigger pro-apoptotic mechanisms \u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. In different cellular models, including HCT116 colorectal cancer cells, ER stress activates the extrinsic pathway of apoptosis through the axis PERK-P-eIF2α-ATF4-CHOP-TRAILR2/DR5 \u003csup\u003e8, 9, 13\u003c/sup\u003e. An important issue that remains to be resolved is to understand the mechanisms that allow the survival of tumour cells in the stressful conditions of the tumour microenvironment.\u003c/p\u003e \u003cp\u003eAlthough REDD1/DDIT4 was initially described as a hypoxia-induced protein \u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e, other stress situations including ER stress result in REDD1/DDIT4 up-regulation \u003csup\u003e\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e, \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e\u003c/sup\u003e. REDD1/DDIT4 function in tumourigenesis is controversial since tumour suppressor \u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e and pro-tumoural \u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e\u003c/sup\u003e roles have been associated with REDD1/DDIT4 induction. In this respect, elevated levels of REDD1/DDIT4 were significantly associated with a worse prognosis in several malignancies including colon cancer \u003csup\u003e\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e, \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e\u003c/sup\u003e. Our results in the colon cancer cell line HCT116 point to an adaptive function of REDD1/DDIT4 in colorectal cancer cells facing ER stress by repressing pro-apoptotic TRAILR2/DR5 receptor expression. REDD1/DDIT4 function has been mainly linked to the control of mTORC1 activity under stress through the TSC1/2 complex \u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. Our data point to a role of sustained mTORC1 activation in the increased sensitivity of REDD1-deficient tumour cells to ER stress. Constitutive mTORC1 activation by the loss of TSC1/2 signaling has been reported to induce apoptosis by stimulating the IRE1-ASK1-JNK pathway \u003csup\u003e\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e\u003c/sup\u003e. Although we cannot completely rule out the involvement of this signaling pathway in the sensitization of REDD1-deficient cells to apoptosis following ER stress \u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e, our findings in IRE1 knockdown cells and with the JNK inhibitor SP600125 likely exclude the involvement of this pathway in the control of TRAILR2/DR5 levels by REDD1/DDIT4. Activation of the PERK branch of the UPR and the resulting TRAILR2/DR5 up-regulation and cFLIP down-regulation are key events for apoptosis induction in HCT116 tumour cells facing ER stress \u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. Thus, sensitization to ER stress-induced apoptosis in the absence of REDD1/DDIT4 described in this work might have occurred through enhancement of the PERK signaling pathway. Interestingly, our data show that REDD1/DDIT4 deficiency promoted a greater elevation of TRAILR2/DR5 expression levels through a CHOP-dependent mechanism. However, no significant differences were observed upon ER stress in the expression levels of ATF4 and CHOP transcription factors between REDD1/DDIT4-deficient cells and control cells. Likewise, in cells undergoing ER stress cFLIP loss was independent of REDD1/DDIT4 expression, suggesting that the enhanced caspase-8 activation and apoptosis observed in REDD1/DDIT4 deficient cells are probably not linked to faster down-regulation of FLIP levels upon ER stress.\u003c/p\u003e \u003cp\u003eOverall, our findings suggest that REDD1/DDIT4 functions as a brake on the early upregulation of TRAILR2/DR5, thereby delaying caspase-8 activation and the induction of the apoptotic program in response to chronic ER stress, which in turn promotes the survival of cancer cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). In this regard, our results represent the first identification of the transcriptional regulator EVI/MECOM and the co-repressor CtBP \u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e as key players in the transcriptional regulation of the TRAILR2/DR5 gene by the PERK/ATF4/CHOP branch of the UPR. Notably, both EVI/MECOM and CtBP are often overexpressed in human colon cancer cells \u003csup\u003e\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e, \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e\u003c/sup\u003e. Further studies aimed at elucidating the molecular mechanism behind the regulation of EVI/MECOM expression in colon tumour cells by REDD1/DDIT4 will be crucial to gaining a broader understanding of the various mechanisms involved in tumour cell responses to ER stress. A deeper comprehension of how REDD1, in conjunction with the EVI/MECOM-CtBP repressor complex, contributes to the escape of tumour cells from apoptosis activation is a critical question that could uncover new therapeutic targets. Additionally, our data reinforce the role of REDD1/DDIT4 in cellular adaptation when colorectal cancer cells, organized in a 3D spatial configuration, face stress, suggesting that REDD1/DDIT4 may serve as a promising target to enhance the efficacy of therapies that aim to boost pro-apoptotic UPR signaling during ER stress.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n \u003ch2\u003eCell culture and reagents\u003c/h2\u003e\n \u003cp\u003eHuman colorectal carcinoma cell line HCT116 (American Type Culture Collection) was kindly donated by Dr. J.A. Pintor-Toro (Andalusian Center for Molecular Biology and Regenerative Medicine-CABIMER, Seville, Spain). HCT116 cell cultures were maintained in McCoy\u0026apos;s 5A modified medium with 2 mM L-glutamine, penicillin (50 U/ml), streptomycin (50 \u0026micro;g/ml) and 10% fetal bovine serum. HEK293T cells (a donation of Dr. A. Rodriguez (Autonomous University of Madrid, Spain) were maintained in DMEM medium supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, 50 U of penicillin/ml and 50 \u0026micro;g of streptomycin/ml. Cells were grown at 37\u0026ordm;C in a 5% CO\u003csub\u003e2\u003c/sub\u003e-humidified, 95% air incubator and regularly tested for mycoplasma contamination.\u003c/p\u003e\n \u003cp\u003eThe ER stress-inducers thapsigargin and tunicamycin, JNK pharmacological inhibitor SP600125, ethidium bromide, Ribonuclease A (RNase A) were purchased from Sigma. Q-VD-Oph (QVD) was obtained from Apexbio and Torin-1 was purchased from TOCRIS Bioscience.\u003c/p\u003e\n\u003c/div\u003e\n\u003ch3\u003eCRISPR/Cas9 editing\u003c/h3\u003e\n\u003cp\u003e\u003cem\u003eREDD1/DDIT4\u003c/em\u003e KO HCT116 cells were generated by CRISPR/Cas9-based gene targeting. Two different guide RNAs (gRNAs) were designed: one targeting exon 1, near the ATG initiator codon region, and the other targeting exon 2. Briefly, forward and reverse oligos for the gRNA against REDD1/DDTI4 were annealed and ligated into pSpCas9(BB)-2A-GFP (PX458) (#48138, Addgene). 48h post-transfection, GFP-positive cells were sorted using a BD FACSAria cell sorter (BD5 FACSAriaTM III, BD Biosciences, Heidelberg, Germany). Finally, REDD1 depletion of cultured clones was confirmed by western blotting.\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Taba\" border=\"1\"\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eName\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSequence (5\u0026rsquo; \u0026rarr; 3\u0026rsquo;)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eREDD1-ATG-gRNA1 Fwd\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCACCGCGACGAGAAGCGGTCCCAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eREDD1-ATG-gRNA1 Rev\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAAACTTGGGACCGCTTCTCGTCGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eREDD1-Ex2-gRNA2 Fwd\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCACCGAGGCATCAGCAGGCGCGCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eREDD1- Ex2-gRNA2 Rev\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAAACTGCGCGCCTGCTGATGCCTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003ch3\u003eGeneration of HCT116 REDD1 KO-derived cell lines\u003c/h3\u003e\n\u003cp\u003epBABE-puro-\u0026oslash; plasmid was kindly provided by Dr. Cristina Mu\u0026ntilde;oz-Pinedo (IDIBELL, Barcelona), pBABE-FLIP\u003csub\u003eL\u003c/sub\u003e plasmid was produced in our lab \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e65\u003c/span\u003e\u003c/sup\u003e and pBABE-HA-REDD1 was purchased from Addgene (#133550). For stable knockdown experiments, shRNAs against caspase-8 or TRAILR2/DR5 in a pSUPER vector (OligoEngine) were digested and cloned between \u003cem\u003eEcoR1 and Cla1\u003c/em\u003e into an H1 promoter-driven GFP-encoding pLVTHM lentiviral vector \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e66\u003c/span\u003e\u003c/sup\u003e. Viral production was achieved by transfection of HEK293T cells using the calcium phosphate method. DNA was transfected in proportion 1:2:3 containing pCI-VSV-G:pVpack-GP-dl:transfer vector or pMD2.G:psPAX2:transfer vector, according to retroviral and lentiviral production, respectively. Retro- or lentiviruses-containing supernatants were collected 48 h after transfection and concentrated by ultracentrifugation at 22,000 rpm for 90 min at 4\u0026deg;C. Tumour cells were plated at 6 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells per 10-cm dish and infected with the viruses mentioned above 2 days later. Stable populations of tumour cells infected with retroviruses were obtained after selection in a culture medium containing puromycin (1.5 \u0026micro;g/ml) for at least 48 h. Lentiviral infection efficiency was assessed by GFP expression, which was examined by flow cytometry using a BD FACScalibur flow cytometer\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tabb\" border=\"1\"\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eshRNA\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSequence (3\u0026rsquo;\u0026rarr; 5\u0026rsquo;)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eshCaspase8#1 (shC8#1)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026rsquo;GATCCCC\u003cstrong\u003eGGAGCTGCTCTTCCGAATT\u003c/strong\u003eTTCAAGAGA\u003cstrong\u003eAATTCGGAAGAGCAGCTCC\u003c/strong\u003eTTTTTA3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eshScrambled (shScr)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026prime;GATCCCC\u003cstrong\u003eCTTTGGGTGATCTACGTTA\u003c/strong\u003eTTCAAGAGA\u003cstrong\u003eTAACGTAGATCACCCAAAG\u003c/strong\u003eTTTTTA3\u0026rsquo;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eshTRAIL-R2#1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5\u0026prime;GATCCCC\u003cstrong\u003eGACCCTTGTGCTCGTTGTC\u003c/strong\u003eTTCAAGAGA\u003cstrong\u003eGACAACGAGCACAAGGGTCT\u003c/strong\u003eTTTTTA3\u0026prime;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003eMulticellular tumour spheroids (MCTs)\u003c/h2\u003e\n \u003cp\u003eMCTs were generated as described before \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e67\u003c/span\u003e\u003c/sup\u003e. For generation of HCT116-derived spheroids, cells were seeded into Terasaki multiwell plates (100 cells/well) (Greiner Bio-One, Frickenhausen, Germany) and placed in humid chambers in the incubator. After 3 days of cultivation, spheroids were transferred to agarose-coated 96-well plates (F-bottom, Greiner Bio-One, Frickenhausen, Germany). Medium was changed every second to third day until spheroids reached a diameter of approximately 500 \u0026micro;m. Then, spheroids were treated as indicated in figure legends.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003eMonitoring of MCTSs growth\u003c/h2\u003e\n \u003cp\u003eTo estimate the growth of the generated spheroids, transmitted light photos were taken daily with a Leica inverted digital microscope (Leica DFC500). Then, the areas of the spheroids were determined using the ImageJ software. It was assumed that the generated MCTSs are spheres and, therefore, their diameters could be calculated according to the following equation:\u003c/p\u003e\n \u003cdiv id=\"Equa\" class=\"Equation\"\u003e\n \u003cdiv class=\"mathdisplay\" id=\"FileID_Equa\" name=\"EquationSource\"\u003e$$\\:d=2\u0026middot;\\:\\sqrt{\\frac{A}{\\pi\\:}}$$\u003c/div\u003e\n \u003c/div\u003e\n \u003cp\u003eWhere A is the measured area of the spheroid and d is the diameter.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n \u003ch2\u003eTreatment of MCTSs\u003c/h2\u003e\n \u003cp\u003eThe day of treatment spheroids were transferred to a new F-bottom 96-well plate coated with agarose in a volume of 100 \u0026micro;L, using a yellow cut tip. Afterwards, 100 \u0026micro;L/well of fresh medium containing the appropriate drug (2X concentrated) were added.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n \u003ch2\u003eAnalysis of hypodiploid apoptotic cells (SubG1 population)\u003c/h2\u003e\n \u003cp\u003eCells (1.5 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e/well) were seeded into 6-well plates and two days later treated as indicated in the figure legends. After treatment, hypodiploid apoptotic cells were detected by flow cytometry according to published procedures \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e68\u003c/span\u003e\u003c/sup\u003e. Briefly, cells were detached and dissociated with trypsin/EDTA and washed with cold PBS, fixed in 70% cold ethanol, and then stained with propidium iodide (40 \u0026micro;g/mL) while treating with RNase (100 \u0026micro;g/mL) for 30 min in the dark. Quantitative analysis of the subG1 population was carried out in a FACSCalibur cytometer using the Cell Quest software (Becton Dickinson, Mountain View, CA, USA) or LSRFortessa X-20 cytometer using the BD FACSDiva\u0026trade; Software (Becton Dickinson, Mountain View, CA, USA).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n \u003ch2\u003eAnalysis of apoptosis by Annexin V-FITC/PI staining\u003c/h2\u003e\n \u003cp\u003eMTCs were washed with temperate PBS and dissociated using trypsin/EDTA. Single-cell suspensions were stained with Annexin V-FITC (Immunostep, Salamanca, Spain) and propidium iodide (20 \u0026micro;g/mL, Sigma-Aldrich, MO, USA) in Annexin V binding buffer (10 mM HEPES/NaOH (pH 7.4), 140 mM NaCl, 2.5 mM CaCl\u003csub\u003e2\u003c/sub\u003e) for 15 min at room temperature in the dark. 400 \u0026micro;L of additional Annexin V binding buffer was added to each tube before analysis using a FACSCalibur cytometer (Becton Dickinson, Mountain View, CA, USA). Quantification of apoptotic cells was accomplished using Cell Quest software (Becton Dickinson, Mountain View, CA, USA).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n \u003ch2\u003eImmunoblot analysis of proteins\u003c/h2\u003e\n \u003cp\u003eCells were washed with phosphate-buffered saline (PBS) and subsequently lysed in TR3 buffer (10 mM Na\u003csub\u003e2\u003c/sub\u003eHPO\u003csub\u003e4\u003c/sub\u003e, 10% glycerol, 3% SDS). Protein concentration was determined using the DC (detergent-compatible) protein assay reagent (Bio-Rad Laboratories, USA), following which loading buffer was added. Proteins were then separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) using mini-gels, and detection was carried out as previously described \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e65\u003c/span\u003e\u003c/sup\u003e. GAPDH, Hsp70, and \u0026alpha;-Tubulin were used as loading controls for protein normalization.\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tabc\" border=\"1\"\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eAntigen\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eDilution\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eProvider\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eReference\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e4EBP1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCell Signaling Tech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9452\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eAKT\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCell Signaling Tech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9272\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eATF4\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSanta Cruz Biotech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSC-200\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eATF4\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCell Signaling Tech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e11815\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eCaspase-8\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCell Signaling Tech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9746\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eCHOP\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCell Signaling Tech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5554\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eFLIP (7F10)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eENZO\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eALX-804-961\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eGAPDH\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:40000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSanta Cruz Biotech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSC-47724\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eHRP-linked antibody\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:5000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDAKO\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eP0448\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eHRP-linked antibody\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:5000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDAKO\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eP0447\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eHRP-linked antibody\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:5000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDAKO\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eP0449\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eIRE1\u0026alpha;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCell Signaling Tech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3294\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eHsp70\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:20000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eMerck\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eH5147\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003ep70 S6K\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCell Signaling Tech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9202S\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003ePhospho-4EBP1 (S65)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCell Signaling Tech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9451\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003ePhospho-c-Jun (S73)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCell Signaling Tech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3270\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003ePhospho-p70 S6K (T389)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:1000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCell Signaling Tech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e9206S\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eREDD1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:2000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eProteintech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10638-1-AP\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eTRAILR2/DR5\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:2000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eR\u0026amp;D Systems\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAF631\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026alpha;-tubulin\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1:40000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSanta Cruz Biotech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSC-23948\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\n \u003ch2\u003eRNA interference\u003c/h2\u003e\n \u003cp\u003esiRNA-mediated knockdown was carried out with jetPRIME\u0026reg; transfection reagent (POLYplus transfection) using 50 nM of siRNA (Sigma) according to the manufacturer\u0026acute;s instructions. Generally, 1,5 x 10\u003csup\u003e5\u003c/sup\u003e cells/well were seeded into 6-well plates and transfected while in suspension. The following day, the medium was carefully replaced with fresh medium and cells were incubated for 24 h. Then, cells were treated as indicated in the figure legends. Knockdowns were confirmed by western blot or RT-qPCR, as indicated.\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tabd\" border=\"1\"\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003esiRNA\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSequence 5\u0026rsquo; \u0026rarr; 3\u0026rsquo;\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eATF4\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCCUAGGUCUCUUAGAUGA[dT][dT]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eCaspase-8#1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGAGCUGCUCUUCCGAUU [dT][dT]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eCHOP\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003ePOOL\u003c/strong\u003e\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAGGGAGAACCAGGAAACGGAA[dT][dT]\u003c/p\u003e\n \u003cp\u003eacggctcaagcaggaaatcga[dT][dT]\u003c/p\u003e\n \u003cp\u003eaaggaagtgtatcttcataca[dT][dT]\u003c/p\u003e\n \u003cp\u003ecagcttgtatatagagattgt[dT][dT]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eCTBP\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGGAGGACCUGGAGAAGUU [dT] [dT]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eIRE1\u0026alpha;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCGUCUUUUACUACGUAAU [dT] [dT]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eMECOM\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGAAUGAACACUCCAUAGAAAC[dT] [dT]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eREDD1#1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGUGGAGACUAGAGGCAGGAGC[dT][dT]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eREDD1#2\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGAUACUCACUGUUCAUGAA [dT][dT]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eREDD1#3\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eACGCAUGAAUGUAAGAGUA[dT][dT]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eScrambled (Sc)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eUGGUUUACAUGUCGACUAA[dT] [dT]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eScrambled#2 (Sc#2)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCUUUGGGUGAUCUACGUUA[dT][dT]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eScambled\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003ePOOL\u003c/strong\u003e\u003c/sub\u003e \u003cstrong\u003e(Sc\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003ePooL)\u003c/strong\u003e\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eUGGUUUACAUGUCGACUAA[dT][dT]\u003c/p\u003e\n \u003cp\u003eUGGUUUACAUGUUGUGUGA[dT][dT]\u003c/p\u003e\n \u003cp\u003eUGGUUUACAUGUUUUCUGA[dT][dT]\u003c/p\u003e\n \u003cp\u003eUGGUUUACAUGUUUUCCUA[dT][dT]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eTRAILR1/siDR4#1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGAACUUUCCGGAAUGACA[dT][dT]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eTRAILR2/siDR5#1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGACCCUUGUGCUCGUUGUC[dT][dT]\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\n \u003ch2\u003eRNA extraction\u003c/h2\u003e\n \u003cp\u003eRNA extraction was carried out with PRImeZOL reagent (Canvax Biotech), following the manufacturer\u0026rsquo;s instructions. The RNA pellet was resuspended in 20\u0026ndash;60 \u0026micro;L of DEPC-treated H\u003csub\u003e2\u003c/sub\u003eO. After 5 min at RT, tubes were heated at 60\u0026deg;C for 10 min in a heat block. RNA samples were spun down, and placed on ice. RNA concentration was determined using a NanoDrop spectrophotometer ND-100 (Thermo Fisher).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\n \u003ch2\u003eRT-PCR for analysis of XBP1 splicing\u003c/h2\u003e\n \u003cp\u003e1 \u0026micro;g of total RNA was retrotranscribed using iScript cDNA Synthesis kit (BioRad, 1708891) according to the manufacturer\u0026acute;s instructions. Next, complementary DNA (cDNA) was amplified by PCR with specific primers obtained from Sigma. PCR products of XPB1 and \u0026beta;-actin fragments were visualized on 3% or 1% agarose gels, respectively, in 1X TAE buffer with 0.5 \u0026micro;g/mL of ethidium bromide.\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\n \u003cdiv align=\"left\" class=\"colspec\"\u003e\u003cbr\u003e\u003c/div\u003e\u0026nbsp;\u003ctable id=\"Tabe\" border=\"1\"\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePrimers\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSequence 5\u0026rsquo; \u0026rarr; 3\u0026rsquo;\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eXBP1-forward\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTTACGGGAGAAAACTCACGGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eXBP1-reverse\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGGTCCAACTTGTCCAGAATGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026beta;-actin-forward\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTGACGGGGTCACCCACACTGTGCCCATCTA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026beta;-actin-reverse\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCATGAAGCATTTGCGGTGGACGATGGAGGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\n \u003ch2\u003eReal time-qPCR\u003c/h2\u003e\n \u003cp\u003eRetrotranscription was performed as described in the previous section. RT-qPCR for TRAILR2/DR5 expression was carried out in triplicates for each sample with specific TaqMan probes and 2x FastStart Universal Probe Master (ROX) (Roche, 04913957001) following the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tabf\" border=\"1\"\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eTaqman probe\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eReference\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eHPRT\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHs01003267_m1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eTRAILR2/DR5\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHs00366278_m1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cp\u003eIn case of MECOM and CtBP1/2 expression, cDNA and the corresponding primers were mixed with 2x iTaq\u0026trade; Universal SYBR\u0026reg; Green Supermix (BioRad, 1725121 following the manufacturer\u0026rsquo;s instructions. Each sample was also run in triplicates.\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tabg\" border=\"1\"\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePrimers\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSequence 5\u0026rsquo; \u0026rarr; 3\u0026rsquo;\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eGAPDH-forward\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eATGGGGAAGGTGAAGGTCG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eGAPDH-reverse\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGGTCATTGATGGCAACAATATC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eMECOM-forward\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAGTGCCCTGGAGATGAGTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eMECOM-reverse\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTTTGAGGCTATCTGTGAAGTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eCtBP1-forward\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGACAGCCTGAAGAACTGTGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eCtBP1-reverse\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTATAGGCAGCCCCATTGAGCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eCtBP2-forward\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTTCAAGGCCCTGAGAGTGAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eCtBP2-reverse\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGAGTCCGCTGTCTCTTCCAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cp\u003eDEPC-treated water instead of cDNA was run additionally to detect possible contaminations, and qPCR plates (Nerbeplus, 04-083-0150) were spun down before introducing them into devices. qPCRs were performed in 7500 Real-Time PCR System or QuantStudio\u0026trade; 5 Real-Time PCR System (Applied Biosystems) according to comparative C\u003csub\u003eT\u003c/sub\u003e protocol. HPRT or GAPDH were used as internal controls and RNA expression levels were given as a fraction of RNA levels in control cells.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\n \u003ch2\u003eRNA sequencing\u003c/h2\u003e\n \u003cp\u003eTotal RNA was isolated using RNeasy Plus Mini Kit (QIAGEN, Hilden Germany), following the manufacturer\u0026rsquo;s instruction. The remaining DNA was further depleted by DNase treatment (TURBO DNase, Invitrogen). Libraries were prepared with the Illumina stranded Total RNA prep with Ribo Zero Plus (Illumina, San Diego, CA, USA) and sequencing was performed with a NovaSeq6000 SP system (Illumina) with 50 bp single-end reads with the Genomic Unit of CABIMER (Seville, Spain). Two biological replicates for each condition were sequenced. The downstream analysis was performed by Novogene (Cambridge, UK). Reads were aligned to human genomes (GRCh38.p12/hg38) using the HISAT2 alignment program \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e69\u003c/span\u003e\u003c/sup\u003e. Gene expression levels for each condition were estimated using the Fragments Per Kilobase of transcript sequence per Million base pairs sequenced (FPKM) method \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e70\u003c/span\u003e\u003c/sup\u003e. Finally, samples were normalized using the DESeq method, and gene expression differential analysis was conducted with the DESeq2 software \u003csup\u003e\u003cspan class=\"CitationRef\"\u003e71\u003c/span\u003e\u003c/sup\u003e. Differentially expressed genes with p-values\u0026thinsp;\u0026lt;\u0026thinsp;0.01 and Log2FC\u0026thinsp;\u0026gt;\u0026thinsp;1 (upregulated genes) or Log2FC\u0026thinsp;\u0026lt;\u0026thinsp;\u0026minus;\u0026thinsp;1 (downregulated genes) were selected for further analysis.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\n \u003ch2\u003eStatistical analysis\u003c/h2\u003e\n \u003cp\u003eStatistical analysis was performed using GraphPad Prism 8 software (GraphPad Software Inc.). Quantitative data are presented as mean values\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD) from at least three independent experiments. In cases where only two experiments were conducted, this is indicated in the figure legends, and data are presented as mean values\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean (SEM). Statistical significance between groups was assessed using the appropriate test specified in the figure legends. Significance levels are indicated by asterisks: ns\u0026thinsp;=\u0026thinsp;not statistically significant; * = p\u0026thinsp;\u0026le;\u0026thinsp;0.05; ** = p\u0026thinsp;\u0026le;\u0026thinsp;0.01; *** = p\u0026thinsp;\u0026le;\u0026thinsp;0.001; **** = p\u0026thinsp;\u0026le;\u0026thinsp;0.0001.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analysed during this study are included in the main text and the supplementary information files.\u003c/p\u003e\n\u003cp\u003eThe datasets generated and/or analysed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSupplementary information is available at Cell Death Disease’s website.\u003c/strong\u003e\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eChen X \u0026amp; Cubillos-Ruiz JR. Endoplasmic reticulum stress signals in the tumour and its microenvironment. \u003cem\u003eNat Rev Cancer\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e, 71-88 (2021)\u003c/li\u003e\n\u003cli\u003eKozutsumi Y, Segal M, Normington K, Gething MJ \u0026amp; Sambrook J. The presence of malfolded proteins in the endoplasmic reticulum signals the induction of glucose-regulated proteins. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e332\u003c/strong\u003e, 462-464 (1988)\u003c/li\u003e\n\u003cli\u003eMoenner M, Pluquet O, Bouchecareilh M \u0026amp; Chevet E. Integrated endoplasmic reticulum stress responses in cancer. \u003cem\u003eCancer Res\u003c/em\u003e \u003cstrong\u003e67\u003c/strong\u003e, 10631-10634 (2007)\u003c/li\u003e\n\u003cli\u003eRon D \u0026amp; Walter P. Signal integration in the endoplasmic reticulum unfolded protein response. \u003cem\u003eNat Rev Mol Cell Biol\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 519-529 (2007)\u003c/li\u003e\n\u003cli\u003eWalter P \u0026amp; Ron D. The unfolded protein response: from stress pathway to homeostatic regulation. \u003cem\u003eScience\u003c/em\u003e \u003cstrong\u003e334\u003c/strong\u003e, 1081-1086 (2011)\u003c/li\u003e\n\u003cli\u003eTabas I \u0026amp; Ron D. Integrating the mechanisms of apoptosis induced by endoplasmic reticulum stress. \u003cem\u003eNat Cell Biol\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 184-190 (2011)\u003c/li\u003e\n\u003cli\u003eCano-Gonzalez A, Mauro-Lizcano M, Iglesias-Serret D, Gil J \u0026amp; Lopez-Rivas A. Involvement of both caspase-8 and Noxa-activated pathways in endoplasmic reticulum stress-induced apoptosis in triple-negative breast tumor cells. \u003cem\u003eCell Death Dis\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 134 (2018)\u003c/li\u003e\n\u003cli\u003eLu M, Lawrence DA, Marsters S, Acosta-Alvear D, Kimmig P, Mendez AS\u003cem\u003e, et al.\u003c/em\u003e Opposing unfolded-protein-response signals converge on death receptor 5 to control apoptosis. \u003cem\u003eScience\u003c/em\u003e \u003cstrong\u003e345\u003c/strong\u003e, 98-101 (2014)\u003c/li\u003e\n\u003cli\u003eMartin-Perez R, Palacios C, Yerbes R, Cano-Gonzalez A, Iglesias-Serret D, Gil J\u003cem\u003e, et al.\u003c/em\u003e Activated ERBB2/HER2 licenses sensitivity to apoptosis upon endoplasmic reticulum stress through a PERK-dependent pathway. \u003cem\u003eCancer Res\u003c/em\u003e \u003cstrong\u003e74\u003c/strong\u003e, 1766-1777 (2014)\u003c/li\u003e\n\u003cli\u003eMcCullough KD, Martindale JL, Klotz LO, Aw TY \u0026amp; Holbrook NJ. Gadd153 sensitizes cells to endoplasmic reticulum stress by down-regulating Bcl2 and perturbing the cellular redox state. \u003cem\u003eMol Cell Biol\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e, 1249-1259 (2001)\u003c/li\u003e\n\u003cli\u003eMora-Molina R, Stohr D, Rehm M \u0026amp; Lopez-Rivas A. cFLIP downregulation is an early event required for endoplasmic reticulum stress-induced apoptosis in tumor cells. \u003cem\u003eCell Death Dis\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 111 (2022)\u003c/li\u003e\n\u003cli\u003ePuthalakath H, O\u0026apos;Reilly LA, Gunn P, Lee L, Kelly PN, Huntington ND\u003cem\u003e, et al.\u003c/em\u003e ER stress triggers apoptosis by activating BH3-only protein Bim. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e129\u003c/strong\u003e, 1337-1349 (2007)\u003c/li\u003e\n\u003cli\u003eYamaguchi H \u0026amp; Wang HG. CHOP is involved in endoplasmic reticulum stress-induced apoptosis by enhancing DR5 expression in human carcinoma cells. \u003cem\u003eJ Biol Chem\u003c/em\u003e \u003cstrong\u003e279\u003c/strong\u003e, 45495-45502 (2004)\u003c/li\u003e\n\u003cli\u003eLam M, Marsters SA, Ashkenazi A \u0026amp; Walter P. Misfolded proteins bind and activate death receptor 5 to trigger apoptosis during unresolved endoplasmic reticulum stress. \u003cem\u003eElife\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, (2020)\u003c/li\u003e\n\u003cli\u003eDennis MD, Coleman CS, Berg A, Jefferson LS \u0026amp; Kimball SR. REDD1 enhances protein phosphatase 2A-mediated dephosphorylation of Akt to repress mTORC1 signaling. \u003cem\u003eSci Signal\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, ra68 (2014)\u003c/li\u003e\n\u003cli\u003eGao X, Zhang Y, Arrazola P, Hino O, Kobayashi T, Yeung RS\u003cem\u003e, et al.\u003c/em\u003e Tsc tumour suppressor proteins antagonize amino-acid-TOR signalling. \u003cem\u003eNat Cell Biol\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, 699-704 (2002)\u003c/li\u003e\n\u003cli\u003eInoki K, Li Y, Zhu T, Wu J \u0026amp; Guan KL. TSC2 is phosphorylated and inhibited by Akt and suppresses mTOR signalling. \u003cem\u003eNat Cell Biol\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, 648-657 (2002)\u003c/li\u003e\n\u003cli\u003eTee AR, Fingar DC, Manning BD, Kwiatkowski DJ, Cantley LC \u0026amp; Blenis J. Tuberous sclerosis complex-1 and -2 gene products function together to inhibit mammalian target of rapamycin (mTOR)-mediated downstream signaling. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e \u003cstrong\u003e99\u003c/strong\u003e, 13571-13576 (2002)\u003c/li\u003e\n\u003cli\u003eInoki K, Zhu T \u0026amp; Guan KL. TSC2 mediates cellular energy response to control cell growth and survival. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e115\u003c/strong\u003e, 577-590 (2003)\u003c/li\u003e\n\u003cli\u003eOzcan U, Ozcan L, Yilmaz E, Duvel K, Sahin M, Manning BD\u003cem\u003e, et al.\u003c/em\u003e Loss of the tuberous sclerosis complex tumor suppressors triggers the unfolded protein response to regulate insulin signaling and apoptosis. \u003cem\u003eMol Cell\u003c/em\u003e \u003cstrong\u003e29\u003c/strong\u003e, 541-551 (2008)\u003c/li\u003e\n\u003cli\u003eHorak P, Crawford AR, Vadysirisack DD, Nash ZM, DeYoung MP, Sgroi D\u003cem\u003e, et al.\u003c/em\u003e Negative feedback control of HIF-1 through REDD1-regulated ROS suppresses tumorigenesis. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e \u003cstrong\u003e107\u003c/strong\u003e, 4675-4680 (2010)\u003c/li\u003e\n\u003cli\u003eQiao S, Dennis M, Song X, Vadysirisack DD, Salunke D, Nash Z\u003cem\u003e, et al.\u003c/em\u003e A REDD1/TXNIP pro-oxidant complex regulates ATG4B activity to control stress-induced autophagy and sustain exercise capacity. \u003cem\u003eNat Commun\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 7014 (2015)\u003c/li\u003e\n\u003cli\u003ePastor F, Dumas K, Barthelemy MA, Regazzetti C, Druelle N, Peraldi P\u003cem\u003e, et al.\u003c/em\u003e Implication of REDD1 in the activation of inflammatory pathways. \u003cem\u003eSci Rep\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 7023 (2017)\u003c/li\u003e\n\u003cli\u003eBrugarolas J, Lei K, Hurley RL, Manning BD, Reiling JH, Hafen E\u003cem\u003e, et al.\u003c/em\u003e Regulation of mTOR function in response to hypoxia by REDD1 and the TSC1/TSC2 tumor suppressor complex. \u003cem\u003eGenes Dev\u003c/em\u003e \u003cstrong\u003e18\u003c/strong\u003e, 2893-2904 (2004)\u003c/li\u003e\n\u003cli\u003eDeYoung MP, Horak P, Sofer A, Sgroi D \u0026amp; Ellisen LW. Hypoxia regulates TSC1/2-mTOR signaling and tumor suppression through REDD1-mediated 14-3-3 shuttling. \u003cem\u003eGenes Dev\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e, 239-251 (2008)\u003c/li\u003e\n\u003cli\u003eQiao S, Koh SB, Vivekanandan V, Salunke D, Patra KC, Zaganjor E\u003cem\u003e, et al.\u003c/em\u003e REDD1 loss reprograms lipid metabolism to drive progression of RAS mutant tumors. \u003cem\u003eGenes Dev\u003c/em\u003e \u003cstrong\u003e34\u003c/strong\u003e, 751-766 (2020)\u003c/li\u003e\n\u003cli\u003eDi Conza G, Trusso Cafarello S, Loroch S, Mennerich D, Deschoemaeker S, Di Matteo M\u003cem\u003e, et al.\u003c/em\u003e The mTOR and PP2A Pathways Regulate PHD2 Phosphorylation to Fine-Tune HIF1alpha Levels and Colorectal Cancer Cell Survival under Hypoxia. \u003cem\u003eCell Rep\u003c/em\u003e \u003cstrong\u003e18\u003c/strong\u003e, 1699-1712 (2017)\u003c/li\u003e\n\u003cli\u003eBackx E, Wauters E, Baldan J, Van Bulck M, Michiels E, Heremans Y\u003cem\u003e, et al.\u003c/em\u003e MECOM permits pancreatic acinar cell dedifferentiation avoiding cell death under stress conditions. \u003cem\u003eCell Death Differ\u003c/em\u003e \u003cstrong\u003e28\u003c/strong\u003e, 2601-2615 (2021)\u003c/li\u003e\n\u003cli\u003eBirdwell C, Fiskus W, Kadia TM, DiNardo CD, Mill CP \u0026amp; Bhalla KN. EVI1 dysregulation: impact on biology and therapy of myeloid malignancies. \u003cem\u003eBlood Cancer J\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 64 (2021)\u003c/li\u003e\n\u003cli\u003eKonantz M, Andre MC, Ebinger M, Grauer M, Wang H, Grzywna S\u003cem\u003e, et al.\u003c/em\u003e EVI-1 modulates leukemogenic potential and apoptosis sensitivity in human acute lymphoblastic leukemia. \u003cem\u003eLeukemia\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 56-65 (2013)\u003c/li\u003e\n\u003cli\u003eIzutsu K, Kurokawa M, Imai Y, Maki K, Mitani K \u0026amp; Hirai H. The corepressor CtBP interacts with Evi-1 to repress transforming growth factor beta signaling. \u003cem\u003eBlood\u003c/em\u003e \u003cstrong\u003e97\u003c/strong\u003e, 2815-2822 (2001)\u003c/li\u003e\n\u003cli\u003ePalmer S, Brouillet JP, Kilbey A, Fulton R, Walker M, Crossley M\u003cem\u003e, et al.\u003c/em\u003e Evi-1 transforming and repressor activities are mediated by CtBP co-repressor proteins. \u003cem\u003eJ Biol Chem\u003c/em\u003e \u003cstrong\u003e276\u003c/strong\u003e, 25834-25840 (2001)\u003c/li\u003e\n\u003cli\u003eTurner J \u0026amp; Crossley M. Cloning and characterization of mCtBP2, a co-repressor that associates with basic Kruppel-like factor and other mammalian transcriptional regulators. \u003cem\u003eEMBO J\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 5129-5140 (1998)\u003c/li\u003e\n\u003cli\u003eGrooteclaes M, Deveraux Q, Hildebrand J, Zhang Q, Goodman RH \u0026amp; Frisch SM. C-terminal-binding protein corepresses epithelial and proapoptotic gene expression programs. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e \u003cstrong\u003e100\u003c/strong\u003e, 4568-4573 (2003)\u003c/li\u003e\n\u003cli\u003eKovi RC, Paliwal S, Pande S \u0026amp; Grossman SR. An ARF/CtBP2 complex regulates BH3-only gene expression and p53-independent apoptosis. \u003cem\u003eCell Death Differ\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 513-521 (2010)\u003c/li\u003e\n\u003cli\u003eDing B, Yuan F, Damle PK, Litovchick L, Drapkin R \u0026amp; Grossman SR. CtBP determines ovarian cancer cell fate through repression of death receptors. \u003cem\u003eCell Death Dis\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 286 (2020)\u003c/li\u003e\n\u003cli\u003eWenes M, Shang M, Di Matteo M, Goveia J, Martin-Perez R, Serneels J\u003cem\u003e, et al.\u003c/em\u003e Macrophage Metabolism Controls Tumor Blood Vessel Morphogenesis and Metastasis. \u003cem\u003eCell Metab\u003c/em\u003e \u003cstrong\u003e24\u003c/strong\u003e, 701-715 (2016)\u003c/li\u003e\n\u003cli\u003eHarding HP, Novoa I, Zhang Y, Zeng H, Wek R, Schapira M\u003cem\u003e, et al.\u003c/em\u003e Regulated translation initiation controls stress-induced gene expression in mammalian cells. \u003cem\u003eMol Cell\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 1099-1108 (2000)\u003c/li\u003e\n\u003cli\u003eJin HO, Seo SK, Woo SH, Kim ES, Lee HC, Yoo DH\u003cem\u003e, et al.\u003c/em\u003e Activating transcription factor 4 and CCAAT/enhancer-binding protein-beta negatively regulate the mammalian target of rapamycin via Redd1 expression in response to oxidative and endoplasmic reticulum stress. \u003cem\u003eFree Radic Biol Med\u003c/em\u003e \u003cstrong\u003e46\u003c/strong\u003e, 1158-1167 (2009)\u003c/li\u003e\n\u003cli\u003eKimball SR \u0026amp; Jefferson LS. Induction of REDD1 gene expression in the liver in response to endoplasmic reticulum stress is mediated through a PERK, eIF2alpha phosphorylation, ATF4-dependent cascade. \u003cem\u003eBiochem Biophys Res Commun\u003c/em\u003e \u003cstrong\u003e427\u003c/strong\u003e, 485-489 (2012)\u003c/li\u003e\n\u003cli\u003eWhitney ML, Jefferson LS \u0026amp; Kimball SR. ATF4 is necessary and sufficient for ER stress-induced upregulation of REDD1 expression. \u003cem\u003eBiochem Biophys Res Commun\u003c/em\u003e \u003cstrong\u003e379\u003c/strong\u003e, 451-455 (2009)\u003c/li\u003e\n\u003cli\u003eWang M \u0026amp; Kaufman RJ. Protein misfolding in the endoplasmic reticulum as a conduit to human disease. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e529\u003c/strong\u003e, 326-335 (2016)\u003c/li\u003e\n\u003cli\u003eZong WX, Li C, Hatzivassiliou G, Lindsten T, Yu QC, Yuan J\u003cem\u003e, et al.\u003c/em\u003e Bax and Bak can localize to the endoplasmic reticulum to initiate apoptosis. \u003cem\u003eJ Cell Biol\u003c/em\u003e \u003cstrong\u003e162\u003c/strong\u003e, 59-69 (2003)\u003c/li\u003e\n\u003cli\u003eHughes MA, Powley IR, Jukes-Jones R, Horn S, Feoktistova M, Fairall L\u003cem\u003e, et al.\u003c/em\u003e Co-operative and Hierarchical Binding of c-FLIP and Caspase-8: A Unified Model Defines How c-FLIP Isoforms Differentially Control Cell Fate. \u003cem\u003eMol Cell\u003c/em\u003e \u003cstrong\u003e61\u003c/strong\u003e, 834-849 (2016)\u003c/li\u003e\n\u003cli\u003eHumphreys LM, Fox JP, Higgins CA, Majkut J, Sessler T, McLaughlin K\u003cem\u003e, et al.\u003c/em\u003e A revised model of TRAIL-R2 DISC assembly explains how FLIP(L) can inhibit or promote apoptosis. \u003cem\u003eEMBO Rep\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e, e49254 (2020)\u003c/li\u003e\n\u003cli\u003eMillard M, Yakavets I, Zorin V, Kulmukhamedova A, Marchal S \u0026amp; Bezdetnaya L. Drug delivery to solid tumors: the predictive value of the multicellular tumor spheroid model for nanomedicine screening. \u003cem\u003eInt J Nanomedicine\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 7993-8007 (2017)\u003c/li\u003e\n\u003cli\u003eNath S \u0026amp; Devi GR. Three-dimensional culture systems in cancer research: Focus on tumor spheroid model. \u003cem\u003ePharmacol Ther\u003c/em\u003e \u003cstrong\u003e163\u003c/strong\u003e, 94-108 (2016)\u003c/li\u003e\n\u003cli\u003ePampaloni F, Reynaud EG \u0026amp; Stelzer EH. The third dimension bridges the gap between cell culture and live tissue. \u003cem\u003eNat Rev Mol Cell Biol\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 839-845 (2007)\u003c/li\u003e\n\u003cli\u003eSutherland RM. Cell and environment interactions in tumor microregions: the multicell spheroid model. \u003cem\u003eScience\u003c/em\u003e \u003cstrong\u003e240\u003c/strong\u003e, 177-184 (1988)\u003c/li\u003e\n\u003cli\u003eChang TK, Lawrence DA, Lu M, Tan J, Harnoss JM, Marsters SA\u003cem\u003e, et al.\u003c/em\u003e Coordination between Two Branches of the Unfolded Protein Response Determines Apoptotic Cell Fate. \u003cem\u003eMol Cell\u003c/em\u003e \u003cstrong\u003e71\u003c/strong\u003e, 629-636 e625 (2018)\u003c/li\u003e\n\u003cli\u003eLin JH, Li H, Yasumura D, Cohen HR, Zhang C, Panning B\u003cem\u003e, et al.\u003c/em\u003e IRE1 signaling affects cell fate during the unfolded protein response. \u003cem\u003eScience\u003c/em\u003e \u003cstrong\u003e318\u003c/strong\u003e, 944-949 (2007)\u003c/li\u003e\n\u003cli\u003eTam AB, Koong AC \u0026amp; Niwa M. Ire1 has distinct catalytic mechanisms for XBP1/HAC1 splicing and RIDD. \u003cem\u003eCell Rep\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 850-858 (2014)\u003c/li\u003e\n\u003cli\u003eUrano F, Wang X, Bertolotti A, Zhang Y, Chung P, Harding HP\u003cem\u003e, et al.\u003c/em\u003e Coupling of stress in the ER to activation of JNK protein kinases by transmembrane protein kinase IRE1. \u003cem\u003eScience\u003c/em\u003e \u003cstrong\u003e287\u003c/strong\u003e, 664-666 (2000)\u003c/li\u003e\n\u003cli\u003eYang Q, Kim YS, Lin Y, Lewis J, Neckers L \u0026amp; Liu ZG. Tumour necrosis factor receptor 1 mediates endoplasmic reticulum stress-induced activation of the MAP kinase JNK. \u003cem\u003eEMBO Rep\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 622-627 (2006)\u003c/li\u003e\n\u003cli\u003eDai W, Miller WP, Toro AL, Black AJ, Dierschke SK, Feehan RP\u003cem\u003e, et al.\u003c/em\u003e Deletion of the stress-response protein REDD1 promotes ceramide-induced retinal cell death and JNK activation. \u003cem\u003eFASEB J\u003c/em\u003e \u003cstrong\u003e32\u003c/strong\u003e, fj201800413RR (2018)\u003c/li\u003e\n\u003cli\u003eMucenski ML, Taylor BA, Ihle JN, Hartley JW, Morse HC, 3rd, Jenkins NA\u003cem\u003e, et al.\u003c/em\u003e Identification of a common ecotropic viral integration site, Evi-1, in the DNA of AKXD murine myeloid tumors. \u003cem\u003eMol Cell Biol\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 301-308 (1988)\u003c/li\u003e\n\u003cli\u003eEllisen LW. Growth control under stress: mTOR regulation through the REDD1-TSC pathway. \u003cem\u003eCell Cycle\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, 1500-1502 (2005)\u003c/li\u003e\n\u003cli\u003eKim JY, Kwon YG \u0026amp; Kim YM. The stress-responsive protein REDD1 and its pathophysiological functions. \u003cem\u003eExp Mol Med\u003c/em\u003e \u003cstrong\u003e55\u003c/strong\u003e, 1933-1944 (2023)\u003c/li\u003e\n\u003cli\u003eSinha I, Allen JE, Pinto JT \u0026amp; Sinha R. Methylseleninic acid elevates REDD1 and inhibits prostate cancer cell growth despite AKT activation and mTOR dysregulation in hypoxia. \u003cem\u003eCancer Med\u003c/em\u003e \u003cstrong\u003e3\u003c/strong\u003e, 252-264 (2014)\u003c/li\u003e\n\u003cli\u003eFattahi F, Saeednejad Zanjani L, Habibi Shams Z, Kiani J, Mehrazma M, Najafi M\u003cem\u003e, et al.\u003c/em\u003e High expression of DNA damage-inducible transcript 4 (DDIT4) is associated with advanced pathological features in the patients with colorectal cancer. \u003cem\u003eSci Rep\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 13626 (2021)\u003c/li\u003e\n\u003cli\u003ePinto JA, Rolfo C, Raez LE, Prado A, Araujo JM, Bravo L\u003cem\u003e, et al.\u003c/em\u003e In silico evaluation of DNA Damage Inducible Transcript 4 gene (DDIT4) as prognostic biomarker in several malignancies. \u003cem\u003eSci Rep\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e, 1526 (2017)\u003c/li\u003e\n\u003cli\u003eKato H, Nakajima S, Saito Y, Takahashi S, Katoh R \u0026amp; Kitamura M. mTORC1 serves ER stress-triggered apoptosis via selective activation of the IRE1-JNK pathway. \u003cem\u003eCell Death Differ\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e, 310-320 (2012)\u003c/li\u003e\n\u003cli\u003eDeng X, Cao Y, Liu Y, Li F, Sambandam K, Rajaraman S\u003cem\u003e, et al.\u003c/em\u003e Overexpression of Evi-1 oncoprotein represses TGF-beta signaling in colorectal cancer. \u003cem\u003eMol Carcinog\u003c/em\u003e \u003cstrong\u003e52\u003c/strong\u003e, 255-264 (2013)\u003c/li\u003e\n\u003cli\u003ePena C, Garcia JM, Garcia V, Silva J, Dominguez G, Rodriguez R\u003cem\u003e, et al.\u003c/em\u003e The expression levels of the transcriptional regulators p300 and CtBP modulate the correlations between SNAIL, ZEB1, E-cadherin and vitamin D receptor in human colon carcinomas. \u003cem\u003eInt J Cancer\u003c/em\u003e \u003cstrong\u003e119\u003c/strong\u003e, 2098-2104 (2006)\u003c/li\u003e\n\u003cli\u003eYerbes R, Palacios C, Reginato MJ \u0026amp; Lopez-Rivas A. Cellular FLIP(L) plays a survival role and regulates morphogenesis in breast epithelial cells. \u003cem\u003eBiochim Biophys Acta\u003c/em\u003e \u003cstrong\u003e1813\u003c/strong\u003e, 168-178 (2011)\u003c/li\u003e\n\u003cli\u003eWiznerowicz M \u0026amp; Trono D. Conditional suppression of cellular genes: lentivirus vector-mediated drug-inducible RNA interference. \u003cem\u003eJ Virol\u003c/em\u003e \u003cstrong\u003e77\u003c/strong\u003e, 8957-8961 (2003)\u003c/li\u003e\n\u003cli\u003eStohr D, Schmid JO, Beigl TB, Mack A, Maichl DS, Cao K\u003cem\u003e, et al.\u003c/em\u003e Stress-induced TRAILR2 expression overcomes TRAIL resistance in cancer cell spheroids. \u003cem\u003eCell Death Differ\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 3037-3052 (2020)\u003c/li\u003e\n\u003cli\u003eRuiz-Ruiz C \u0026amp; Lopez-Rivas A. Mitochondria-dependent and -independent mechanisms in tumour necrosis factor-related apoptosis-inducing ligand (TRAIL)-induced apoptosis are both regulated by interferon-gamma in human breast tumour cells. \u003cem\u003eBiochem J\u003c/em\u003e \u003cstrong\u003e365\u003c/strong\u003e, 825-832 (2002)\u003c/li\u003e\n\u003cli\u003eMortazavi A, Williams BA, McCue K, Schaeffer L \u0026amp; Wold B. Mapping and quantifying mammalian transcriptomes by RNA-Seq. \u003cem\u003eNat Methods\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e, 621-628 (2008)\u003c/li\u003e\n\u003cli\u003eTrapnell C, Williams BA, Pertea G, Mortazavi A, Kwan G, van Baren MJ\u003cem\u003e, et al.\u003c/em\u003e Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. \u003cem\u003eNat Biotechnol\u003c/em\u003e \u003cstrong\u003e28\u003c/strong\u003e, 511-515 (2010)\u003c/li\u003e\n\u003cli\u003eLove MI, Huber W \u0026amp; Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. \u003cem\u003eGenome Biol\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 550 (2014)\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"cell-death-and-disease","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cddis","sideBox":"Learn more about [Cell Death \u0026 Disease](http://www.nature.com/cddis/)","snPcode":"41419","submissionUrl":"https://mts-cddis.nature.com/cgi-bin/main.plex","title":"Cell Death \u0026 Disease","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Regulated in development and DNA damage response-1, mTORC1+, TNF-related apoptosis-inducing ligand receptor 2, endoplasmic reticulum stress, apoptosis, MDS1 and EVI1 Complex Locus","lastPublishedDoi":"10.21203/rs.3.rs-6111887/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6111887/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eRegulated in development and DNA damage response-1 (REDD1/DDIT4) is induced in response to environmental stress to restrain the mechanistic target of rapamycin complex 1 (mTORC1) signaling as an adaptive strategy to restore cellular homeostasis. Interestingly, REDD1/DDIT4 expression is upregulated in several tumour types including colorectal cancer, suggesting it may have a role in tumourigenesis. Here, we report that activating transcription factor 4 (ATF4)-dependent REDD1/DDIT4 expression is required for survival of colon tumour cells undergoing endoplasmic reticulum (ER) stress through the modulation of TRAILR2/DR5 gene expression. Our findings further demonstrate that resistance to ER stress-induced apoptosis in multicellular tumour spheroids (MCTS) is associated with constitutive expression of REDD1/DDIT4 and diminished mTORC1 activity. CRISPR/Cas9-mediated deletion of REDD1/DDIT4 markedly increases TRAILR2/DR5 expression and enhances apoptosis in spheroids exposed to ER stress. Interestingly, RNA sequencing analysis reveals that the loss of the transcriptional regulator MECOM/EVI-1, a partner of the corepressor protein C-terminal Binding Protein (CtBP), in cells deficient in REDD1/DDIT4 amplifies the ER stress-induced upregulation of TRAILR2/DR5, leading to enhanced apoptosis. In summary, our findings underscore the crucial role of REDD1/DDIT4 in regulating TRAILR2/DR5-induced caspase-8 activation and apoptosis under chronic ER stress, by inhibiting mTORC1 activity and promoting MECOM/EVI-1-mediated suppression of TRAILR2/DR5 gene expression.\u003c/p\u003e","manuscriptTitle":"REDD1/DDIT4 counteracts endoplasmic reticulum stress-induced apoptosis by controlling the expression of death receptor TRAILR2/DR5 in cancer cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-16 10:05:50","doi":"10.21203/rs.3.rs-6111887/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2025-06-12T13:49:53+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2025-05-23T06:22:49+00:00","index":2,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2025-04-21T18:56:02+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2025-04-16T22:18:10+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2025-04-01T12:57:58+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2025-03-28T00:24:47+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-02-27T11:30:29+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-02-26T09:36:05+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cell Death \u0026 Disease","date":"2025-02-26T09:36:04+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"cell-death-and-disease","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cddis","sideBox":"Learn more about [Cell Death \u0026 Disease](http://www.nature.com/cddis/)","snPcode":"41419","submissionUrl":"https://mts-cddis.nature.com/cgi-bin/main.plex","title":"Cell Death \u0026 Disease","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"f5cb4751-551f-4773-a20f-126da819c0cd","owner":[],"postedDate":"April 16th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":46328280,"name":"Biological sciences/Biochemistry/Protein folding/Endoplasmic reticulum"},{"id":46328281,"name":"Health sciences/Diseases/Cancer/Gastrointestinal cancer/Colorectal cancer/Colon cancer"}],"tags":[],"updatedAt":"2026-05-07T07:12:52+00:00","versionOfRecord":{"articleIdentity":"rs-6111887","link":"https://doi.org/10.1038/s41419-026-08648-7","journal":{"identity":"cell-death-and-disease","isVorOnly":false,"title":"Cell Death \u0026 Disease"},"publishedOn":"2026-03-28 04:00:00","publishedOnDateReadable":"March 28th, 2026"},"versionCreatedAt":"2025-04-16 10:05:50","video":"","vorDoi":"10.1038/s41419-026-08648-7","vorDoiUrl":"https://doi.org/10.1038/s41419-026-08648-7","workflowStages":[]},"version":"v1","identity":"rs-6111887","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6111887","identity":"rs-6111887","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}