Antibody blockade of the PSGL-1 immune checkpoint enhances T-cell responses to B-cell lymphoma | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Antibody blockade of the PSGL-1 immune checkpoint enhances T-cell responses to B-cell lymphoma João Pereira, Francisca Ferreira, Andreia Matos, Dulcineia Pereira, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4018077/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 25 Oct, 2024 Read the published version in Leukemia → Version 1 posted 10 You are reading this latest preprint version Abstract Despite advancements in cancer immunotherapy, most lymphomas remain unresponsive to checkpoint inhibitors. P-selectin glycoprotein ligand-1 (PSGL-1), recently identified as a promoter of T cell exhaustion in melanoma murine models, has emerged as a novel immune checkpoint protein and promising immunotherapeutic target. In this study, we investigated the potential of PSGL-1 antibody targeting in B-cell lymphoma. Using allogeneic coculture systems, we demonstrated that targeted antibody interventions against human PSGL-1 resulted in enhancement of T cell activation and effector cytokine production in response to lymphoma cells. Moreover, in vitro treatment of primary lymphoma cell suspensions with PSGL-1 antibody resulted in increased activation of autologous lymphoma-infiltrating T cells. Finally, using a syngeneic B-cell lymphoma mouse model, we found that PSGL-1 antibody treatment significantly slowed tumor development and reduced endpoint tumor burden. This anti-tumoral action was accompanied by augmented tumor infiltration with CD4 + and CD8 + T cells and reduced infiltration with regulatory T cells. These results demonstrate that PSGL-1 antibody blockade bolsters T-cell activity against B-cell lymphoma, suggesting a potential novel immunotherapeutic approach to treat these malignancies. Biological sciences/Cancer/Haematological cancer/Lymphoma/Non-hodgkin lymphoma/B-cell lymphoma Biological sciences/Cancer/Cancer therapy/Cancer immunotherapy Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Lymphomas are generally classified as Hodgkin (about 10% of cases) or non-Hodgkin lymphomas (NHL, about 90% of cases), with NHL comprehending several subtypes of B- (85–90%) and T-cell (10–15%) lymphomas [1,2]. Although treatment options for B-cell lymphomas are generally based on chemotherapy cycles and, in specific cases, radiotherapy [1–3], other strategies such as immunotherapy (e.g rituximab and brentuximab vedotin), stem cell transplants and chimeric antigen receptor (CAR)-T cell therapy have also been applied in the clinic [2,4,5]. Since the emergence of immune checkpoint blockade therapies, only Hodgkin lymphomas, which typically display an inflamed microenvironment and frequently express programmed-cell death protein 1 (PD-1) ligands were found to respond reasonably well [2,4,6,7]. In fact, clinical trials have demonstrated high response rates with nivolumab and pembrolizumab PD-1 inhibitors in relapsed or refractory Hodgkin lymphoma [5,8,9]. In contrast, NHL patients were generally unresponsive to immunotherapies [5,9], likely due to the fact that most of these malignancies are non-inflamed and show low expression of PD-1 ligands [5,7,10,11]. Therefore, alternative immunotherapeutic strategies are urgently needed for these malignancies. The P-selectin glycoprotein ligand-1 (PSGL-1), encoded by the SELPLG gene, has recently been identified as an immune response modulatory protein. Since first described in neutrophils as a ligand for P-selectin, PSGL-1 has been shown to interact with P-, E- and L- selectins and to be associated with distinct functions of lymphoid and myeloid cells, mainly related with cell migration and motility [12–19]. Early research showed that PSGL-1 negatively regulated T cell function. Indeed, PSGL-1-deficient T cells from Selplg knockout (KO) mice proliferated more vigorously than wild-type T cells upon CD3 plus CD28 antibody exposure or interleukin (IL)-2, IL-4, and IL-15 homeostatic cytokine stimulation [20,21]. More recently, PSGL-1 was shown to function as an immune checkpoint regulator by promoting mouse T cell exhaustion and restricting effector T cell responses and memory T cell development upon viral or tumoral challenges [22,23]. Even though the molecular mechanisms underlying these newly reported PSGL-1 functions remain largely undefined, it was shown that upon viral infection, Selplg -deficient ( Selplg −/− ) T cells had enhanced survival, reduced PD-1, CD160 and BTLA inhibitory receptor expression and increased effector cytokine production [22,23]. Moreover, Selplg −/− T cells were more reinvigorated by anti-PD-L1 in vivo treatment than wild-type T cells [24]. In this line, anti-PD-1 administration to melanoma tumor-bearing Selplg −/− mice promoted tumor regression [25]. Furthermore, targeting PSGL-1 with a monoclonal antibody, alone or with PD-1 antibody blockade, resulted in increased effector CD4 + and CD8 + tumor-infiltrating T cell responses, and reduced melanoma progression [25]. In addition to its role in regulating immune responses in T cells, recent evidence indicates that PSGL-1 also acts as an immunosuppressive checkpoint in tumor-associated macrophages [26]. In this study, we found that PSGL-1 blockade with specific antibodies boosted T cell activity against B-cell lymphoma. Treatment of human T cells with anti-PSGL-1 in vitro led to upregulation of activation markers and enhanced cytokine expression in response to allogeneic lymphoma cells. Furthermore, anti-PSGL-1 heightened T-cell activation against autologous patient lymphoma cells. Demonstrating the lymphoma therapeutic potential of PSGL-1 inhibition, we found in a B-cell lymphoma mouse model that PSGL-1 antibody blockade increased tumor infiltration by activated T cells and markedly reduced tumor growth. Our findings demonstrate that blocking PSGL-1 with antibodies can be an effective strategy for lymphoma treatment. Materials and Methods Cell lines and culture The T-cell acute lymphoblastic leukemia (T-ALL) Jurkat cell line (Jurkat E6.1 subline, authenticated by short tandem repeat genotyping in April 2022) was provided by Nuno L. Alves (i3S, Porto, Portugal). The Burkitt lymphoma Raji cell line was previously described [27]. The A20 mouse B lymphoma cell line (TIB-208) was acquired from American Tissue Culture Collection (ATCC, Manassas, VA, USA). Suspension cell lines were cultured in RPMI complete medium (RPMI 1640 medium (Gibco, Carlsbad, CA, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS; Gibco), 100 U/ml penicillin-streptomycin (Gibco) and 1 mM L-Glutamine (Gibco), maintaining a density between 1 × 10 5 and 1 × 10 6 cells/ml, in a 5% CO 2 humidified incubator at 37 ºC. The HEK293T cell line was cultured in DMEM medium (Cytiva, Marlborough, MA, USA) supplemented as described above. Absence of Mycoplasma was confirmed by 16S rRNA amplification with MGSO and GPO-1 primers [28]. For cell growth assays, cells were plated at 1 × 10 5 and counted in a Neubauer hemocytometer after 24 and 48 h. Generation of a PSGL-1-deficient Jurkat cell line Three target guide RNA (gRNA) sequences (#1, AATTACGCACGGGGTACAT; #2, GACAACTCGACTGACGGCCA; #3, TGGGGGAGTAATTACGCACGG) targeting the second exon of the SELPLG gene were designed in CRISPOR and Synthego software platforms [29,30] and selected for their high specificity, low off-targets, high activity and early coding region. The gRNAs were cloned into the lentiCRISPR v2 plasmid, a gift from Feng Zhang (Addgene, Watertown, MA, USA; plasmid #52961; http://n2t.net/addgene:52961 ; RRID: Addgene_52961), after digestion with Esp 3I restriction enzyme (cat. no. ER0451, Thermo Scientific, Waltham, MA). To produce lentiviral particles, each gRNA-bearing lentiCRISPR plasmid or empty plasmid together with pRRE, pRev, and pMD2.G (VSV-G envelope-expressing plasmid) packaging plasmids, all a gift from Didier Trono (Addgene plasmids #12251, #12253, #12259), and pCEP4-tat, gifted by Sergey Kasparov (Addgene plasmid # 22502), were transfected into HEK293T cells with Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA). After 72 h, supernatants from lentivirus-producing cells were collected, filtered through 0.22 µm filters (Cytiva) and added immediately to 1 × 10 6 Jurkat cells growing in complete RPMI medium without antibiotics. Two days later, the medium was changed and the transduced cells were selected by addition of 0.5 µg/ml puromycin. The puromycin concentration was increased to 1 µg/ml after two more days. The gRNA #2 showed increased efficacy in knocking-out SELPLG , as most Jurkat/ SELPLG KO #2 cells showed absence of PSGL-1 expression by flow cytometry. Puromycin-resistant Jurkat cells, infected with empty lentiCRISPR lentiviral particles (Jurkat/Mock), were obtained as controls. The Jurkat/SELPLG KO #2 PSGL-1 negative cells were isolated by flow cytometry sorting in a BD FACSAria II. After the Jurkat/ SELPLG KO cell line establishment, clones were isolated from the bulk population through serial dilution. Primary human T cell isolation Peripheral blood mononuclear cells (PBMCs) were obtained from buffy coats of adult healthy blood donors (aged 18–42 years; Supplementary Table 1) provided by the local hospital blood bank ( Serviço de Imunohemoterapia, Centro Hospitalar Universitário São João, Porto) after ethical approval (ref. no. 398/2020). PBMCs were isolated by density-gradient separation using Ficoll Paque Plus (Cytiva). The cell pellet was cleared of remaining erythrocytes by incubation in red blood cell lysis buffer (90% 160 mM NH 4 Cl, 10% 170 mM Tris-HCl) 5 min at 37 ºC, and then washed in phosphate-buffered saline (PBS). Untouched T cells were isolated by depleting CD3-negative cells using the MojoSort Human CD3 T Cell Isolation Kit (cat. no. 480021, Biolegend, San Diego, CA, USA) and EasySep Magnet (cat. no. #18000, StemCell Technologies, Vancouver, BC, Canada), according to the manufacturer’s instructions. In vitro human T cell activation Healthy donor T cells were stimulated with plate-bound anti-human CD3 (clone OKT3, cat. no. 317326, Biolegend) and soluble anti-human CD28 (clone CD28.2, cat. no. 302934, Biolegend), at concentrations of 0.5 and 2 µg/ml or 2 and 5 µg/ml of each antibody. Jurkat cells were stimulated with 0.1, 0.5 or 5 µg/ml of plate-bound anti-human CD3. Incubations were performed in RPMI complete medium for the duration indicated in the Results section. Allogeneic T-cell activation assays Pre-activated, primed, or in vitro exhausted healthy donor T cells were cocultured at a 2:1 ratio with irradiated Raji cells (150 Gy, Gammacell irradiator) in RPMI complete medium, in 96-well round bottom microplates (cat. no. 353077, Falcon) for 3, 5, or 7 days. Ten µg/ml of mouse IgG (cat. no. 015-000-003, Jackson ImmunoResearch, West Grove, PA) or anti-human PSGL-1 PL1 hybridoma (concentration of approximately 5–10 µg/ml) were added at the beginning of coculture. The PL1 hybridoma, developed by McEver, R.P., was obtained from the Developmental Studies Hybridoma Bank, created by the NICHD of NIH and maintained at the University of Iowa, Department of Biology, Iowa City, IA 52242, USA. For T-cell pre-activation, isolated healthy donor T cells were stimulated with plate-bound 0.5 µg/ml anti-CD3 (clone OKT3) and soluble 2 µg/ml anti-CD28 (clone CD28.2) for approximately 18–24 h in RPMI complete medium. For T-cell priming, isolated healthy donor T cells were cocultured for 7 days with irradiated Raji lymphoma cells at a 2:1 ratio in RPMI complete medium. For T-cell in vitro exhaustion, isolated healthy donor T cells were stimulated every 3 days for 9 days with plate-bound 1 µg/ml anti-CD3 and soluble 5 µg/ml anti-CD28, following reported methodology [31]. Regarding Jurkat cocultures, Raji cells were loaded with 2 µg/ml of the bacterial superantigen staphylococcal enterotoxin B (SEB) (cat. no. S4881, Sigma-Aldrich, St. Louis, MO, USA) for 1 h at 37 ºC. Afterwards, 6 × 10 5 SEB-loaded Raji cells were cocultured with 2 × 10 5 Jurkat/Mock cells (3:1) in 24-well plates (cat. no. 4430300, Orange Scientific, Braine-l’Alleud, Belgium) for 24 h at 37 ºC. Primary human lymphoma samples Lymph node biopsies collected between 2019 and 2023 from six B-cell lymphoma patients (Supplementary Table 2) were obtained at the Onco-Hematology Department of IPO-Porto after informed consent and ethical approval (ref. GOM_PI_2013.03). Research was conducted according to the principles of the Declaration of Helsinki. Lymph node biopsies were processed by cutting in small pieces with a scalpel in RPMI 1640 medium, and dissociated by gentle pressure against a 0.75 µm cell strainer. For autologous coculture experiments, lymph node suspensions were cultured in RPMI complete medium, with or without PL1 antibody (concentration of approximately 5–10 µg/ml) or mouse IgG (10 µg/ml, Jackson ImmunoResearch) for 3 days. In vivo studies BALB/c mice were bred and maintained at the i3S barrier animal facility under 12 h light:dark cycles with food and water ad libitum . All experimental procedures were approved by the i3S ethics committee (approval no. 15/CECRI/2020) and Portuguese authorities ( Direção-Geral de Agricultura e Veterinária ) and followed recommendations from the European Commission (Directive 2010/63/UE) and the local Portuguese authorities (decree laws no. 113/2013 and 1/2019). Five × 10 6 A20 cells were injected s.c. into 9-11-week-old BALB/c male mice. Mice were randomized into 2 groups, and treated i.p. in the late afternoon with three doses of 200 µg of either PSGL-1 monoclonal antibody (mAb; clone 4RA10, cat. no. BE0186, BioXcell, Lebanon, NH, USA) or control IgG (ChromPure rat IgG, cat. no. 012-000-003, Jackson ImmunoResearch) at 7, 10 and 13 days post-cell injection (dpi). Tumors were measured with calipers at 6, 8, 10, 13, 15, 17 and 20 dpi, and their volume (V) was calculated using the formula: V (mm 3 ) = (L × W 2 )/2, being L the larger and W the smaller of two perpendicular tumor axes. Mice were euthanized by CO 2 inhalation at 20 dpi. At experimental endpoint, spleens and tumors from mice were mechanically digested through a 70 µm cell strainer (cat. no. 352350, Corning, Glendale, AZ, USA) and cells were counted using Neubauer hemocytometer. Flow cytometry Cells were washed with FACS buffer (3% FBS and 10 mM NaN 3 in PBS), centrifuged at 300 g , and resuspended in FACS buffer containing fluorochrome-conjugated antibodies (listed in Supplementary Table 3). After incubation on ice for 45–60 min, cells were washed twice with FACS buffer and resuspended in 10 mM NaN 3 in PBS. For intracellular immunostaining, cells were first washed and stained for surface markers, as described above. Next, cells were fixed in paraformaldehyde with Fixation Buffer (cat. no. 420801, Biolegend) and permeabilized with True-Phos Perm Buffer (cat. no. 425401, Biolegend), following the manufacturer’s instructions. Next, cells were incubated on ice with fluorochrome-conjugated antibodies in FACS buffer for 30–45 min, and washed in FACS buffer, as described above. For in vitro T cell proliferation assays, T cells were first stained with 2 µM eFluor Dye 670 (cat. no. 65-0840-85, eBioscience, San Diego, CA, USA), according to the manufacturer’s instructions, and then cultured in RPMI complete medium. Cell fluorescence levels were acquired in BD Accuri C6 or BD FACSCanto II cell analyzers, and data analyzed through FlowJo software. ELISA assays Coculture supernatants were collected and stored at -80 ºC. Concentrations of IFN-γ and IL-2 were assessed by the ELISA MAX Deluxe Set Human IL-2 (cat. no. 431804, Biolegend) and IFN-γ (cat. no. 430104, Biolegend) kits, following the manufacturer’s instructions. Briefly, Nunc MaxiSorp ELISA uncoated plates (cat. no. 423501, Biolegend) were incubated at 4 ºC overnight with capture antibody and sealed with Plate Sealers (cat. no. 423601, Biolegend). Plate wells were washed with ELISA Wash Buffer (cat. no. 421601, Biolegend) and diluted supernatants and standards were added to the wells and incubated at room temperature. Plate wells were washed with ELISA Wash Buffer, the detection antibody was added, and plates were incubated at room temperature. After washing, avidin-horseradish peroxidase (HRP) reagent was added and incubated at room temperature. Plates were washed, 3,3',5,5'-tetramethylbenzidine (TMB) substrate was added, and plates were incubated in the dark at room temperature for 20 min. The TMB reaction was terminated with Stop Solution (cat. no. 423001, Biolegend). Absorbances at 450 nm and 570 nm were measured in a Biotek (Winooski, VT, USA) PowerWave XS Microplate Reader. Immunoblotting Whole cell lysates were prepared from 4 × 10 6 Jurkat cells after two rounds of ice-cold PBS washing and resuspension in ice-cold RIPA buffer (10 mM Tris pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% sodium docetyl sulfate (SDS)) with freshly added protease inhibitors (10 µg/ml aprotinin, 10 µg/ml leupeptin and 1 mM phenylmethylsulfonyl fluoride) and phosphatase inhibitors (10 mM p-nitrophenyl phosphate, 15 mM β-glycolphosphatase and 1 mM Na 3 VO 4 ) for 10 min. After 15 000 g centrifugation, the supernatants were denatured in SDS sample buffer (62.5 mM Tris pH 6.8, 20% glycerol, 2% SDS and 5% β-mercaptoethanol) by heating the samples for 5 min at 95 ºC. Samples were subjected to 10% SDS-polyacrylamide gel electrophoresis, together with PageRuler Plus prestained protein ladder (Thermo Fisher Scientific) and transferred to an immunoblot nitrocellulose membrane (Cytiva). Protein transfer efficiency was assessed by Ponceau staining (cat. no. P7170, Sigma-Aldrich). Membranes were blocked with 5% nonfat dried milk in PBS with 0.1% Tween 20 and then incubated with antibodies against human PSGL-1 (1:1000 dilution; KPL1, cat. no. 328802, Biolegend). Diluted 1:5000 HRP-conjugated goat anti-mouse IgG (cat no. A00160; GenScript, Piscataway, NJ, USA) was used as secondary antibody. Bound secondary antibodies were revealed by incubating the membrane with SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific) and luminescence captured by Amersham Hyperfilm (Cytiva) or ChemiDoc XRS+ (Bio-Rad, Hercules, CA, USA). Statistics Data plots and statistical analyses were performed with GraphPad Prism software. Statistical tests and sample numbers are indicated in figure legends. A P value below 0.05 was considered statistically significant. Results PSGL-1 genetic inactivation enhances T-cell receptor (TCR)-mediated human T cell activation Since Selplg −/− mouse T cells were reported to be more responsive to TCR/CD3 stimulation [20], we set out to assess the impact of PSGL-1 genetic inactivation in human T cell activation. To this end, we inactivated through CRISPR-Cas9 the SELPLG gene in the human Jurkat T cell line, which expresses high levels of PSGL-1 [32] and is a well-established cellular model to study regulation of TCR signaling [33]. By doing so, we obtained a cell line with no detectable PSGL-1 expression (Fig. 1 A, and S1A). Jurkat/ SELPLG KO cells were viable and divided normally. Next, we stimulated Jurkat/ SELPLG KO and Jurkat/Mock cells for 24 h with different concentrations of plate-bound anti-CD3 and assessed T-cell activation by detecting the CD69 activation marker. Jurkat/ SELPLG KO cells stimulated with lower concentrations of anti-CD3 (0.1 and 0.5 µg/ml) had increased levels of CD69 compared to Jurkat/Mock cells, whereas that difference was smaller with a concentration of 5 µg/ml (Fig. 1 B). Next, we explored whether PSGL-1-deficiency influenced the expression of other activation markers. By stimulating Jurkat/Mock and SELPLG KO cells for 24 h with 0.5 µg/ml anti-CD3, we found that CD69 and CD25 expression levels were upregulated in Jurkat/ SELPLG KO compared to Jurkat/Mock cells (Fig. 1 C). Similar results were obtained upon CD3 stimulation of a clonal Jurkat/ SELPLG KO cell line compared to Jurkat parental cells (Fig. S1 B). These findings indicate that PSGL-1 deficiency renders Jurkat T cells more sensitive to weaker TCR/CD3 stimulation, and thus show that, like in mice, PSGL-1 is a regulator of human T cell responses to antigenic stimulation. Antibody blockade of PSGL-1 enhances T cell activation against lymphoma cells Given that PSGL-1 genetic deficiency promoted Jurkat T-cell activation, we next sought to assess whether blocking PSGL-1 with specific antibodies could produce a similar outcome. By coculturing Jurkat cells with Raji lymphoma cells pre-loaded with SEB superantigen, in the presence or absence of the anti-PSGL-1 PL1 mAb, known to inhibit PSGL-1 activity by blocking its interactions with selectins [14], we found that the levels of CD69 on Jurkat cells increased upon PL1 treatment (Fig. S2 ). Furthermore, PSGL-1 surface expression in Jurkat cells, detected by an antibody recognizing a distinct epitope [34], also decreased upon activation, especially with PL1 treatment (Fig. S2 ). Given these results with a malignant T cell line, we next addressed the effect of the PL1 mAb in the proliferation of normal human T cells. Indeed, PL1 increased the percentage of proliferating CD3-stimulated human healthy T cells (Fig. S3A). To explore the dynamics of PSGL-1 expression upon TCR activation, we stimulated healthy donor T cells with anti-CD3/CD28 and found decreased expression of surface and total PSGL-1 in CD4 + and CD8 + T cells (Fig. S3B). Next, we performed cocultures of human healthy donor T cells with allogenic Raji antigen-presenting cells, in the presence or absence of PL1 mAb. To facilitate the activation of a polyclonal population of unrelated donor T cells in response to Raji cells, the former were pre-activated with CD3 and CD28 antibodies for 24 h (Fig. 2 A). As expected, this led to CD25 and CD69 upregulation (not shown). Next, pre-activated T cells were cultured with irradiated Raji lymphoma cells in the presence or absence of PL1 for 3, 5 and 7 days (Fig. 2 A). We noticed that PSGL-1 surface expression levels in CD4 + and CD8 + T cells after 3 days of coculture decreased with PL1 treatment (Fig. S4A). At all coculture timepoints analyzed, the percentage of CD69 + CD25 + activated T cells (following the gating strategy depicted in Fig. S4B) increased in the presence of PL1, as compared to the absence of antibody (Fig. 2 B, C and D), or to IgG control antibody (Fig. S4C). The CD4 + and CD8 + T cell activation-promoting effect of the PL1 antibody was most consistent, i.e. observed in all donor samples analyzed, at days 3 and 5 of coculture (Fig. 2 B, C and D). In addition, IL-2 secretion in the supernatant of CD3 + T cells cocultured with Raji cells increased by PL1 treatment (Fig. 2 E and S4D). Overall, these results showed that the PSGL-1 antibody enhanced T cell activation against Raji lymphoma cells. We next investigated the impact of PSGL-1 in T cells primed to recognize lymphoma antigens. Thus, healthy donor T cells were first cocultured with irradiated Raji lymphoma cells for 7 days to induce expansion of cells capable of recognizing Raji-specific antigens. This led to upregulation of CD69, CD25 or both activation markers in about 27% of the T cells (Fig. S4E). Next, Raji-primed T cells were challenged with a fresh batch of irradiated Raji cells in the presence or absence of PL1 for another 5 days (Fig. 3 A). This led to activation marker upregulation (Fig. 3 B). Although there was notable variability among individual donor samples, PSGL-1 antibody blockade led to higher percentages of CD69 + and/or CD25 + T cells compared to control samples that did not receive antibody treatment (Fig. 3 B). These results show that PSGL-1 antibody blockade can enhance tumor antigen-mediated activation of lymphoma-primed T cells. Antibody blockade of PSGL-1 enhances in vitro exhausted CD4 + T cell response to lymphoma cells In tumors, persistent antigenic stimulation of infiltrating T cells often leads to a hyporesponsive state, commonly defined as exhaustion [35]. Thus, we set out to assess whether PSGL-1 antibody blockade could enhance exhausted T cell responses against lymphoma antigens. To this end, we induced in vitro chronic activation of human healthy donor T cells by repeated stimulation with CD3/CD28 antibodies during 9 days (Fig. 4 A). This protocol resulted in increased expression of the PD-1, LAG-3 and TIM-3 exhaustion markers in CD4 + and CD8 + T cells (Fig. S5A), indicative of an exhausted-like phenotype [31]. Next, cells were cocultured for 5 days with irradiated Raji lymphoma cells in the presence or absence of PL1 antibody (Fig. 4 A). Remarkably, expression of CD69 in CD4 + , but not CD8 + T cells, was enhanced when PL1 was added to the coculture (Fig. 4 B). No significant changes in CD25 expression were observed (data not shown). No significant differences in PD-1, LAG-3 and TIM-3 expression levels were observed in Raji-cocultured T cells with PL1 versus no antibody (Fig. S5B), which suggests that PSGL-1 blockade did not promote CD4 + T-cell activation through downregulation of inhibitory receptors. Furthermore, there was an increased production of IL-2 and IFN-γ in cocultures treated with PL1 antibody (Fig. 4 C and S5C). Together, these results suggest that PSGL-1 blockade enhances the activation and effector function of exhausted CD4 + T cells in response to allogeneic lymphoma cells. Antibody blockade of PSGL-1 enhances activation of patient lymphoma-infiltrating T cells To assess whether PSGL-1 antibody blockade can enhance human T cell activation in response to autologous lymphoma antigens, patient-derived lymphoma cells cocultured with the respective infiltrating T cells were treated with the PL1 mAb, as previously. Unsorted single-cell suspensions, isolated from lymph node biopsies of six B-cell lymphoma patients of different subtypes (one MCL, SLL, and FL/DLBCL each, and three DLBCL), were cultured with PL1 mAb, IgG or no antibody for up to 3 days. Lymphoma and T cells comprised, respectively, about 50–80% and 10–20% of the total hematopoietic cell population in each biopsy (Fig. 5 A and S6A, and data not shown). Furthermore, we also observed that PSGL-1 was expressed by either malignant B cell lymphoma and infiltrating T cells, albeit with higher levels in the latter (Fig. S6B). T cell analysis, after 3 days of culture with PL1 antibody, revealed an increase in CD69 expression in both CD4 + and CD8 + T cells from three lymphoma patient samples, as compared to negative controls (Fig. 5 B). In contrast, CD25 expression in T cells was not significantly altered by PL1 treatment (data not shown). For three DLBCL biopsies, PL1 treatment had no significant impact on either CD69 or CD25 expression (data not shown). To assess whether lymphoma-infiltrating T cells displayed an exhaustion phenotype and whether PL1 reverted that phenotype, we assessed PD-1, TIM-3 and LAG-3 surface expression levels in T cells cultured with lymphoma cells for 3 days, in the presence of PL1 or IgG1 control. For the three cases where PL1 increased the percentage of CD69-expressing T cells, no reduction in exhaustion markers was observed (Fig. S6C), which indicates that PL1-mediated boosting of T-cell activation did not depend on inhibitory receptor downregulation. These data reinforce the notion that PSGL-1 antibody targeting can enhance T cell activation in response to human lymphoma antigens. PSGL-1 in vivo blockade increases effector immune cell infiltration of tumors and reduces murine lymphoma burden To demonstrate the in vivo potential of PSGL-1 targeting to enhance T cell responses to lymphoma, we resorted to a syngeneic mouse model generated by subcutaneous inoculation of the A20 B-cell lymphoma cell line. Tumor-infiltrating T cells expressed PSGL-1 (Fig. S7), making them amenable for anti-PSGL-1 targeting. At 7 dpi, when subcutaneous tumors were palpable, recipient mice were treated with either anti-PSGL-1 4RA10 mAb or control IgG (Fig. 6 A). Strikingly, tumor progression was significantly impaired by 4RA10 treatment (Fig. 6 B and S8A), resulting in smaller tumors at the experimental endpoint, compared with the control IgG group (Fig. 6 C). Although the A20 cell line also expressed surface PSGL-1 [32], 4RA10 did not induce A20 cell death in vitro (Fig. S8B), which argues against a direct effect of the antibody treatment on tumor cells. To determine whether the reduced tumor growth in anti-PSGL-1-treated mice was associated with an increased immune response, we characterized the tumor-infiltrating immune component using by flow cytometry to detect specific lineage markers (Fig. S9). Interestingly, the proportions of both CD4 + and CD8 + T cells were significantly increased in tumors from 4RA10-treated mice, as compared to tumors from IgG-treated mice (Fig. 6 D). Furthermore, 4RA10-treated mice displayed higher tumor infiltration by macrophages, dendritic cells and natural killer (NK) cells than the IgG-treated mice (Fig. 6 E). Characterization of the differentiation status of tumor-infiltrating CD4 + and CD8 + T cells by CD44 and CD62L expression, showed that T cells were predominantly effector memory (T EM , CD44 + CD62L − ) or central memory (T CM, CD44 + CD62L + ), with very few T naïve (T N , CD44 − CD62L + ) (Fig. S10A), indicating that tumor-infiltrating T cells had a history of antigenic stimulation. Although the 4RA10 treatment did not significantly alter the differentiation profile of tumor-infiltrating (Fig. S10A) and splenic T cells (Fig. S10B), we found that CD4 + and CD8 + T cells infiltrating smaller tumors (under 500 mg) displayed a higher T EM /T N ratio than those infiltrating larger ones (Fig. 6 F). This suggests that the increased presence of tumor-infiltrating T EM cells is associated with decreased tumor volume in 4RA10-treated mice. Considering these data and the perspective that PSGL-1 regulates T-cell activation, we reasoned that 4RA10 treatment could also increase the proportion of activated T cells. Indeed, the percentage of tumor-infiltrating CD8 + T cells expressing the CD69, CD25 and PD-1 activation markers was higher in tumors from 4RA10-treated mice than in those from IgG-treated mice (Fig. 6 G). This effect of the 4RA10 treatment was restricted to CD8 + T cells, since no major differences in the expression of activation markers were observed for tumor-infiltrating CD4 + T cells (Fig. S11A). Of note, splenic CD8 + T cell populations from 4RA10-treated tumor-bearing mice also showed increased percentage of CD69 and CD25 markers, as compared to those from IgG-treated mice (Fig. S11B). This suggests that the 4RA10 treatment also had systemic effects. Finally, although the frequency of CD4 + Foxp3 + regulatory T cells (Tregs) in spleens from tumor-bearing mice was not significantly impacted by the 4RA10 treatment (Fig. S11C), the percentage of Tregs infiltrating 4RA10-treated tumors was lower than in IgG-treated tumors (Fig. 6 H). Collectively, these results showed that PSGL-1 blockade increased tumor infiltration by activated CD8 + T cells while decreasing Treg infiltration. These effects together likely underlie the observed impairment in tumor progression in mice treated with anti-PSGL-1 highlighting a novel and promising therapeutic approach. Discussion In this study, we demonstrated the potential of PSGL-1 antibody targeting in enhancing T-cell responses against lymphoma. We cocultured both healthy donor T cells with allogeneic Raji B-cell lymphoma cells and tumor-infiltrating T cells with autologous patient lymphoma cells, and found that PSGL-1 antibody blockade boosted T cell activation in response to lymphoma cells. Furthermore, PSGL-1 targeting in a syngeneic B-cell lymphoma mouse model resulted in increased activation of tumor-infiltrating T cells, reduced infiltration of Tregs, and decreased tumor growth. Anti-PSGL-1 treatment of A20 lymphoma-bearing mice led to increased percentage of tumor-infiltrating immune cells (T, NK, and dendritic cells, and macrophages) and enhanced activation of both tumor-infiltrating and peripheral CD8 + T cells. Our results from 4RA10-treated mice parallel those reported for anti-PD-1-treated A20 lymphoma mice, in that, like 4RA10, anti-PD-1 hampered tumor growth and increased CD69 expression levels in tumor-infiltrating CD8 + T cells [36]. In addition, 4RA10 treatment of a syngeneic melanoma mouse model increased anti-tumor T-cell responses, slowed tumor growth, increased activation of CD4 + and CD8 + tumor-infiltrating T cells, and decreased Treg frequencies in tumors [25]. Of note, Hope et al. [37] reported that PSGL-1 blockade using recombinant soluble PSGL-1 protein also decreased tumor growth in a syngeneic melanoma model. Furthermore, it was reported that anti-PSGL-1 treatment of sarcoma, bladder and colon syngeneic mouse models resulted in decreased tumor growth, which could be further enhanced by anti-PD-1 combination [26]. Anti-PSGL-1 treatment of humanized mice bearing patient-derived melanoma xenografts also resulted in decreased tumor growth [26]. Our work in lymphoma, together with previous research in melanoma and other cancers, shows that disrupting PSGL-1 interactions, either by specific antibodies or recombinant PSGL-1, results in increased anti-tumor immune activity and reduced tumor growth, and that, like PD-1, PSGL-1 functions in T cells as a targetable immune checkpoint protein. Using different in vitro assays, we demonstrated that PSGL-1 antibody targeting boosted human T cell responses against lymphoma cells. Indeed, PL1 treatment of allogeneic human healthy donor T cell cocultures with Raji lymphoma cells resulted consistently in increased percentages of T cells expressing CD69 or CD25, while increasing IL-2 and IFN-γ secretion. The percentage of activated T cells in allogeneic cocultures, with or without PSGL-1 blockade, varied remarkably among donor samples. This variability can be due to interindividual HLA allelic variability, sex and age, or recent exposure to antigenic challenges. Consistent with earlier findings [38], PBMCs from different donors had different percentages of naïve, central memory, effector memory and terminal differentiated effector T cells (Fig. S12). This variability may also impact the proportion of T cells responding to Raji lymphoma antigens. In spite of the sample heterogeneity, our results support the notion that PSGL-1 is an inhibitory protein in human T cells and that antibodies targeting PSGL-1 extracellular domain can improve anti-tumor T cell responses, as previously reported for mouse PSGL-1 targeting [25]. Crucially, treatment of patient lymphoma-infiltrating T cells with PL1 resulted in increased activation of both CD4 + and CD8 + T cells in response to autologous lymphoma cells. While this effect was noted in only three out of six patient samples, it highlights the potential of PSGL-1 antibody targeting in the treatment of human lymphomas. The variation in response to anti-PSGL-1 therapy may depend on B-cell lymphoma subtypes or unique cellular and molecular features of the lymphoma in each individual, so further studies are needed to validate these findings and understand which patients might benefit from this therapeutic approach. Tumor-infiltrating T cells often exhibit an exhausted phenotype, characterized by the expression of Eomes, Tcf-1 and Tox transcription factors, high expression of specific surface markers, like PD-1, LAG-3, TIM-3, and CTLA-4, metabolic changes and reduced T cell effector function [22,24,35,37]. Since PSGL-1 genetic inactivation was shown to promote effector functions in exhausted T cells either alone [37] or in combination with PD-1 blockade [24], we investigated the effects of PSGL-1 blockade on in vitro -generated exhausted-like T cells. PL1 treatment improved mildly but in a statistically significant manner CD4 + T cell responses, as denoted by CD69 upregulation, and increased production of IL-2 and IFN-γ pro-inflammatory cytokines. These findings lend support to the concept that PSGL-1 blockade could render exhausted T cells more active in anti-tumor responses. However, further studies should investigate whether the combination of PSGL-1 blockade with that of other inhibitory receptors can more robustly promote the activation of human exhausted T cells. At present, the molecular mechanisms by which PSGL-1 negatively regulates T-cell activation remain ill-defined. By inactivating the SELPLG gene in Jurkat human T-cells, we found that these cells displayed higher expression levels of activation markers upon TCR/CD3 stimulation than control cells. This finding indicates that SELPLG deficiency renders human T cells more responsive to antigenic stimuli, and confirms recent mouse knockout studies that uncovered the regulatory function of PSGL-1 in T-cell responses towards viral or tumor antigens [22,24,25,37]. Given that PSGL-1 recruits and binds to ezrin/radixin/moesin (ERM) proteins [39,40], and that ezrin is required for proper ZAP70 recruitment to the immunological synapse [41], it is possible that absence or blockade of PSGL-1 may increase ezrin availability and, consequently, ZAP70 availability for TCR signaling [42]. Selplg -deficient mouse T cells exhibited increased levels of phosphorylated ERK, Zap70 and Akt kinases [37], so future studies should determine whether PSGL-1 regulates TCR signaling pathways in human T cells. Both genetic inactivation of PSGL-1 and PL1 treatment resulted in enhanced Jurkat activation upon TCR stimulation, indicating that, in this setting, the PL1 mAb inhibits PSGL-1 function. These findings suggest that PL1 blocks PSGL-1 interactions with ligands responsible for suppressing T cell activity. The PL1 antibody targets an N-terminal epitope crucial for selectin binding to PSGL-1 [14,43]. While selectins could act as ligands mediating suppression of T-cell activation, it was reported that the immune checkpoint function of PSGL-1 operates independently of P-, E- and L-selectin interactions [22]. Instead, PSGL-1 was found to interact under acidic conditions, with the V-domain immunoglobulin suppressor of T-cell activation (VISTA) protein, a known suppressor of T-cell activity [44,45]. Further studies are needed to determine whether PL1 blocks PSGL-1 binding to VISTA or other potential ligands responsible for suppressing T-cell activity. In summary, our findings demonstrate that PSGL-1 inactivation, through gene editing or blocking antibodies, enhances T cell activation in response to lymphoma cells. These results underscore the potential of targeting PSGL-1 as an immunotherapeutic strategy in treating this type of cancer. We recently reported that the PL1 antibody could induce apoptosis of T and B lymphoma cell lines expressing PSGL-1 [46]. This killing action was not universal in that not all B-cell lymphoma cell lines were vulnerable to PL1 targeting. Although in this report the A20 cell line and the six primary lymphoma cell samples did not undergo significant cell death upon incubation with anti-PSGL-1, our earlier and current findings indicate that targeting PSGL-1 could serve a dual purpose in lymphoma therapy: it may induce apoptosis of lymphoma cells [46] while simultaneously enhancing the effector function of T cells. Declarations Competing Interests We declare no competing financial interests in relation to the work described. Author Contributions JLP and NRS designed this research study. JCM and NRS supervised this study. JLP, AM, RFS and NRS were involved in designing the experiments. JLP, FF and AM performed the research. JLP, FF and NRS analyzed data. JLP, JCM and NRS interpreted the results. DP provided human lymphoma biopsies. AM and JLP processed the human lymphoma samples. DP, AMC, MJO and JCM provided multiple reagents. JLP and NRS wrote the manuscript and AMC, MJO and JCM edited the manuscript. All authors contributed to the preparation of the manuscript and approved the submitted version. Acknowledgements We thank members of the Intercellular Communication and Cancer Group (i3S, Porto) for fruitful discussions that contributed for this research. We thank Ivette Pacheco-Leyva and Liliana Oliveira (i3S, Porto) for technical expertise and Mário Sousa Pimenta (IPO-Porto, Porto) for providing insightful clinical knowledge. The authors acknowledge the support of the Animal Facility, Cell Culture and Genotyping, Translational Cytometry and Histology and Electron Microscopy (member of the national infrastructure PPBI - Portuguese Platform of Bioimaging; PPBI-POCI-01-0145-FEDER-022122) i3S Scientific Platforms. This work was supported by grants from Gilead Sciences Portugal ( Programa Gilead GÉNESE ref. no. PGG/038/2017), and Associação Portuguesa Contra a Leucemia (APCL) in partnership with Sociedade Portuguesa de Hematologia (SPH) and Gilead Sciences Portugal, by Fundação para a Ciência e a Tecnologia (FCT; Portugal), in the framework of the project Financiamento Plurianual de Unidades de I&D (UIBD/04293/2020), by Programa Operacional Regional do Norte by European Regional Development Fund (ERDF), under the project “The Porto Comprehensive Cancer Center”, with the reference NORTE-01-0145-FEDER-072678 - Consórcio PORTO.CCC – Porto.Comprehensive Cancer Center, and European Social Fund and ERDF (NORTE-01-0145-FEDER-000029 and POCI-01-0145-FEDER-007274). J.L.P. was supported by an FCT fellowship (SFRH/BD/147979/2019) and N.R.S. by an FCT CEEC contract (CEECINST/00091/2018/CP1500/CT0020). Data Availability Statement The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request. References Armitage JO, Gascoyne RD, Lunning MA, Cavalli F. Non-hodgkin lymphoma. Lancet 2017;390:298–310. https://doi.org/10.1093/oso/9780190238667.003.0040. Ansell SM. Hodgkin lymphoma: 2018 update on diagnosis, risk-stratification, and management. Am J Hematol 2018;93:704–15. https://doi.org/10.1002/ajh.25071. Michot JM, Lazarovici J, Ghez D, Danu A, Fermé C, Bigorgne A, et al. Challenges and perspectives in the immunotherapy of Hodgkin lymphoma. Eur J Cancer 2017;85:67–77. https://doi.org/10.1016/j.ejca.2017.08.014. Lulla P, Heslop HE. Checkpoint inhibition and cellular immunotherapy in lymphoma. Hematology 2016;2016:390–6. https://doi.org/10.1182/asheducation-2016.1.390. Merryman RW, Armand P, Wright KT, Rodig SJ. Checkpoint blockade in Hodgkin and non-Hodgkin lymphoma. Blood Adv 2017;1:2643–54. https://doi.org/10.1182/bloodadvances.2017012534. Matsuki E, Younes A. Checkpoint Inhibitors and Other Immune Therapies for Hodgkin and Non-Hodgkin Lymphoma. Curr Treat Options Oncol 2016;17. https://doi.org/10.1007/s11864-016-0401-9. Kline J, Godfrey J, Ansell SM. The immune landscape and response to immune checkpoint blockade therapy in lymphoma. Blood 2020;135:523–33. https://doi.org/10.1182/blood.2019000847. Tarekegn K, Ramosa AC, Singh B, Sequeira Grossa HG, Gupta S. Checkpoint Inhibitors in Relapsed/Refractory Classical Hodgkin Lymphoma. World J Oncol 2021;12:51–4. https://doi.org/10.14740/wjon1388. Xie W, Medeiros LJ, Li S, Yin CC, Khoury JD, Xu J. PD-1/PD-L1 Pathway and Its Blockade in Patients with Classic Hodgkin Lymphoma and Non-Hodgkin Large-Cell Lymphomas. Curr Hematol Malig Rep 2020;15:372–81. https://doi.org/10.1007/s11899-020-00589-y. Hawkes EA, Grigg A, Chong G. Programmed cell death-1 inhibition in lymphoma. Lancet Oncol 2015;16:e234–45. https://doi.org/10.1016/S1470-2045(15)70103-8. Andorsky DJ, Yamada RE, Said J, Pinkus GS, Betting DJ, Timmerman JM. Programmed death ligand 1 is expressed by non-Hodgkin lymphomas and inhibits the activity of tumor-associated T cells. Clinical Cancer Research 2011;17:4232–44. https://doi.org/10.1158/1078-0432.CCR-10-2660. Moore KL, Stults NL, Diaz S, Smith DF, Cummings RD, Varki A, et al. Identification of a specific glycoprotein ligand for P-selectin (CD62) on myeloid cells. Journal of Cell Biology 1992;118:445–56. https://doi.org/10.1083/jcb.118.2.445. Guyer DA, Moore KL, Lynam EB, Schammel CMG, Rogelj S, McEver RP, et al. P-selectin glycoprotein ligand-1 (PSGL-1) is a ligand for L-selectin in neutrophil aggregation. Blood 1996;88:2415–21. https://doi.org/10.1182/blood.v88.7.2415.bloodjournal8872415. Moore KL, Patel KD, Bruehl RE, Fugang L, Johnson DA, Lichenstein HS, et al. P-selectin glycoprotein ligand-1 mediates rolling of human neutrophils on P-selectin. Journal of Cell Biology 1995;128:661–71. https://doi.org/10.1083/jcb.128.4.661. Laszik Z, Jansen P, Cummings R, Tedder T, McEver R, Moore K. P-selectin glycoprotein ligand-1 is broadly expressed in cells of myeloid, lymphoid, and dendritic lineage and in some nonhematopoietic cells. Blood 1996;88:3010–21. https://doi.org/10.1182/blood.V88.8.3010.bloodjournal8883010. Wilkins PP, Moore KL, McEver RP, Cummings RD. Tyrosine sulfation of P-selectin glycoprotein ligand-1 is required for high affinity binding to P-selectin. Journal of Biological Chemistry 1995;270:22677–80. https://doi.org/10.1074/jbc.270.39.22677. Walcheck B, Moore KL, McEver RP, Kishimoto TK. Neutrophil-neutrophil interactions under hydrodynamic shear stress involve L-selectin and PSGL-1: A mechanism that amplifies initial leukocyte accumulation on P-selectin in vitro. Journal of Clinical Investigation 1996;98:1081–7. https://doi.org/10.1172/JCI118888. Borges E, Pendl G, Eytner R, Steegmaier M, Zöllner O, Vestweber D. The binding of T cell-expressed P-selectin glycoprotein ligand-1 to E- and P-selectin is differentially regulated. Journal of Biological Chemistry 1997;272:28786–92. https://doi.org/10.1074/jbc.272.45.28786. Martinez M, Joffraud M, Giraud S, Baïsse B, Bernimoulin MP, Schapira M, et al. Regulation of PSGL-1 interactions with L-selectin, P-selectin, and E-selectin: Role of human fucosyltransferase-IV and -VII. Journal of Biological Chemistry 2005;280:5378–90. https://doi.org/10.1074/jbc.M410899200. Matsumoto M, Miyasaka M, Hirata T. P-Selectin Glycoprotein Ligand-1 Negatively Regulates T-Cell Immune Responses. The Journal of Immunology 2009;183:7204–11. https://doi.org/10.4049/jimmunol.0902173. Veerman KM, Carlow DA, Shanina I, Priatel JJ, Horwitz MS, Ziltener HJ. PSGL-1 Regulates the Migration and Proliferation of CD8+ T Cells under Homeostatic Conditions. The Journal of Immunology 2012;188:1638–46. https://doi.org/10.4049/jimmunol.1103026. Tinoco R, Carrette F, Barraza ML, Otero DC, Magaña J, Bosenberg MW, et al. PSGL-1 is an immune checkpoint regulator that promotes T cell exhaustion. Immunity 2016;44:1190–203. https://doi.org/10.1016/j.immuni.2016.04.015.PSGL-1. Tinoco R, Neubert EN, Stairiker CJ, Henriquez ML, Bradley LM. PSGL-1 Is a T Cell Intrinsic Inhibitor That Regulates Effector and Memory Differentiation and Responses During Viral Infection. Front Immunol 2021;12:1–13. https://doi.org/10.3389/fimmu.2021.677824. Viramontes KM, Neubert EN, DeRogatis JM, Tinoco R. PD-1 Immune Checkpoint Blockade and PSGL-1 Inhibition Synergize to Reinvigorate Exhausted T Cells. Front Immunol 2022;13. https://doi.org/10.3389/fimmu.2022.869768. DeRogatis JM, Viramontes KM, Neubert EN, Henriquez ML, Guerrero-Juarez CF, Tinoco R. Targeting the PSGL-1 Immune Checkpoint Promotes Immunity to PD-1–Resistant Melanoma. Cancer Immunol Res 2022:OF1–14. https://doi.org/10.1158/2326-6066.cir-21-0690. Kauffman K, Manfra D, Nowakowska D, Zafari M, Nguyen PA, Phennicie R, et al. PSGL-1 Blockade Induces Classical Activation of Human Tumor-Associated Macrophages. Cancer Research Communications 2023. https://doi.org/10.1158/2767-9764. Cardoso MS, Santos RF, Almeida S, Sá M, Pérez-Cabezas B, Oliveira L, et al. Physical Interactions With Bacteria and Protozoan Parasites Establish the Scavenger Receptor SSC4D as a Broad-Spectrum Pattern Recognition Receptor. Front Immunol 2021;12. https://doi.org/10.3389/fimmu.2021.760770. van Kuppeveld FJ, van der Logt JT, Angulo AF, van Zoest MJ, Quint WG, Niesters HG, et al. Genus- and species-specific identification of mycoplasmas by 16S rRNA amplification. Appl Environ Microbiol 1992;58:2606–15. https://doi.org/10.1128/aem.58.8.2606-2615.1992. Concordet JP, Haeussler M. CRISPOR: Intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens. Nucleic Acids Res 2018;46:W242–5. https://doi.org/10.1093/nar/gky354. Yang J, Hirata T, Croce K, Merrill-Skoloff G, Tchernychev B, Williams E, et al. Targeted gene disruption demonstrates that P-selectin glycoprotein ligand 1 (PSGL-1) is required for P-selectin-mediated but not E-selectin-mediated neutrophil rolling and migration. J Exp Med 1999;190:1769–82. https://doi.org/10.1084/jem.190.12.1769. Lynne S. Dunsford, Rosie H. Thoirs, Emma Rathbone, Agapitos Patakas. A Human In Vitro T Cell Exhaustion Model for Assessing Immuno-Oncology Therapies. In: Seng-Lai Tan, editor. Methods in Pharmacology and Toxicology, vol. Immuno-Oncology, New York: Humana; 2020, p. 91–2. Pereira JL, Cavaco P, da Silva RC, Pacheco-Leyva I, Mereiter S, Pinto R, et al. P-selectin glycoprotein ligand 1 promotes T cell lymphoma development and dissemination. Transl Oncol 2021;14:101125. https://doi.org/10.1016/j.tranon.2021.101125. Abraham RT, Weiss A. Jurkat T cells and development of the T-cell receptor signalling paradigm. Nat Rev Immunol 2004;4:301–8. https://doi.org/10.1038/nri1330. Thatte A, Ficarro S, Snapp KR, Wild MK, Vestweber D, Hunt DF, et al. Binding of function-blocking mAbs to mouse and human P-selectin glycoprotein ligand-1 peptides with and without tyrosine sulfation. J Leukoc Biol 2002;72:470–7. https://doi.org/10.1189/jlb.72.3.470. McLane LM, Abdel-Hakeem MS, Wherry EJ. CD8 T Cell Exhaustion During Chronic Viral Infection and Cancer. Annu Rev Immunol 2019;37:457–95. https://doi.org/10.1146/annurev-immunol-041015-055318. Bezman NA, Jhatakia A, Kearney AY, Brender T, Maurer M, Henning K, et al. PD-1 blockade enhances elotuzumab efficacy in mouse tumor models. Blood Adv 2017;1:753–65. https://doi.org/10.1182/bloodadvances.2017004382. Hope JL, Otero DC, Bae EA, Stairiker CJ, Palete AB, Faso HA, et al. PSGL-1 attenuates early TCR signaling to suppress CD8+ T cell progenitor differentiation and elicit terminal CD8+ T cell exhaustion. Cell Rep 2023;42. https://doi.org/10.1016/j.celrep.2023.112436. Saule P, Trauet J, Dutriez V, Lekeux V, Dessaint JP, Labalette M. Accumulation of memory T cells from childhood to old age: Central and effector memory cells in CD4+ versus effector memory and terminally differentiated memory cells in CD8+ compartment. Mech Ageing Dev 2006;127:274–81. https://doi.org/10.1016/j.mad.2005.11.001. Urzainqui A, Serrador JM, Viedma F, Yáñez-Mó M, Rodrı́guez A, Corbı́ AL, et al. ITAM-Based Interaction of ERM Proteins with Syk Mediates Signaling by the Leukocyte Adhesion Receptor PSGL-1. Immunity 2002;17:401–12. https://doi.org/10.1016/S1074-7613(02)00420-X. Serrador JM, Urzainqui A, Alonso-Lebrero JL, Cabrero JR, Montoya MC, Vicente-Manzanares M, et al. A juxta-membrane amino acid sequence of P-selectin glycoprotein ligand-1 is involved in moesin binding and ezrin/radixin/moesin-directed targeting at the trailing edge of migrating lymphocytes. Eur J Immunol 2002;32:1560–6. https://doi.org/10.1002/1521-4141(200206)32:63.0.CO;2-U. Ilani T, Khanna C, Zhou M, Veenstra TD, Bretscher A. Immune synapse formation requires ZAP-70 recruitment by ezrin and CD43 removal by moesin. J Cell Biol 2007;179:733–46. https://doi.org/10.1083/jcb.200707199. Tinoco R, Otero DC, Takahashi AA, Bradley LM. PSGL-1: A New Player in the Immune Checkpoint Landscape. Trends Immunol 2017;38:323–35. https://doi.org/10.1016/j.it.2017.02.002. Li F, Erickson HP, James JA, Moore KL, Cummings RD, McEver RP. Visualization of P-selectin glycoprotein ligand-1 as a highly extended molecule and mapping of protein epitopes for monoclonal antibodies. J Biol Chem 1996;271:6342–8. https://doi.org/10.1074/jbc.271.11.6342. Johnston RJ, Su LJ, Pinckney J, Critton D, Boyer E, Krishnakumar A, et al. VISTA is an acidic pH-selective ligand for PSGL-1. Nature 2019;574:565–70. https://doi.org/10.1038/s41586-019-1674-5. Yuan D, Zhang Y, Liu W, He X, Chen W, Liu L, et al. Transcriptome profiling reveals transcriptional regulation of VISTA in T cell activation. Mol Immunol 2023;157:101–11. https://doi.org/10.1016/j.molimm.2023.03.021. Pereira JL, Ferreira F, dos Santos NR. Antibody targeting of surface P‐selectin glycoprotein ligand 1 leads to lymphoma apoptosis and tumorigenesis inhibition. Hematol Oncol 2024;42. https://doi.org/10.1002/hon.3257. Additional Declarations There is NO conflict of interest to disclose. Supplementary Files AntiPSGL1papersupplementarytablesv5.pdf FiguresantiPSGL1papersuplementarv15.pdf Cite Share Download PDF Status: Published Journal Publication published 25 Oct, 2024 Read the published version in Leukemia → Version 1 posted Editorial decision: revise 20 May, 2024 Review # 3 received at journal 19 May, 2024 Reviewer # 3 agreed at journal 19 May, 2024 Review # 2 received at journal 18 May, 2024 Reviewer # 2 agreed at journal 22 Mar, 2024 Reviewer # 1 agreed at journal 15 Mar, 2024 Reviewers invited by journal 07 Mar, 2024 Editor assigned by journal 06 Mar, 2024 Submission checks completed at journal 06 Mar, 2024 First submitted to journal 05 Mar, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4018077","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":276963625,"identity":"e3eaa766-20fb-4322-9a57-d063c5e786a2","order_by":0,"name":"João Pereira","email":"","orcid":"https://orcid.org/0000-0002-8625-5420","institution":"i3S - Instituto de Investigação e Inovação em Saúde, Universidade do Porto","correspondingAuthor":false,"prefix":"","firstName":"João","middleName":"","lastName":"Pereira","suffix":""},{"id":276963626,"identity":"8a2b91d3-1c48-476b-b3c3-7beb9da9e9b6","order_by":1,"name":"Francisca Ferreira","email":"","orcid":"","institution":"i3S - Instituto de Investigação e Inovação em Saúde, Universidade do Porto","correspondingAuthor":false,"prefix":"","firstName":"Francisca","middleName":"","lastName":"Ferreira","suffix":""},{"id":276963627,"identity":"8313c146-40cf-4891-8524-34809b387e08","order_by":2,"name":"Andreia Matos","email":"","orcid":"","institution":"i3S - Instituto de Investigação e Inovação em Saúde, Universidade do Porto","correspondingAuthor":false,"prefix":"","firstName":"Andreia","middleName":"","lastName":"Matos","suffix":""},{"id":276963628,"identity":"1a1a4625-f044-4162-8ca1-47c1bf6fa3d9","order_by":3,"name":"Dulcineia Pereira","email":"","orcid":"","institution":"Department of Onco-Hematology, Portuguese Oncology Institute of Porto","correspondingAuthor":false,"prefix":"","firstName":"Dulcineia","middleName":"","lastName":"Pereira","suffix":""},{"id":276963629,"identity":"093e3dd9-4f4d-4736-96ed-c8082f65bb2c","order_by":4,"name":"Rita Santos","email":"","orcid":"","institution":"i3S - Instituto de Investigação e Inovação em Saúde, Universidade do Porto","correspondingAuthor":false,"prefix":"","firstName":"Rita","middleName":"","lastName":"Santos","suffix":""},{"id":276963630,"identity":"0e1973da-5df7-4182-a556-820e088e1111","order_by":5,"name":"Alexandre Carmo","email":"","orcid":"","institution":"i3S - Instituto de Investigação e Inovação em Saúde, Universidade do Porto","correspondingAuthor":false,"prefix":"","firstName":"Alexandre","middleName":"","lastName":"Carmo","suffix":""},{"id":276963631,"identity":"d8f75c76-3d31-4f7e-aa13-a2dd5c0739d8","order_by":6,"name":"Maria Oliveira","email":"","orcid":"","institution":"i3S - Instituto de Investigação e Inovação em Saúde, Universidade do Porto","correspondingAuthor":false,"prefix":"","firstName":"Maria","middleName":"","lastName":"Oliveira","suffix":""},{"id":276963632,"identity":"d77ad9fb-0b99-4967-a47e-ea4bb854b6f5","order_by":7,"name":"José Carlos Machado","email":"","orcid":"","institution":"i3S - Instituto de Investigação e Inovação em Saúde, Universidade do Porto","correspondingAuthor":false,"prefix":"","firstName":"José","middleName":"Carlos","lastName":"Machado","suffix":""},{"id":276963624,"identity":"221912a4-e730-4985-96c3-9d46546de73c","order_by":8,"name":"Nuno Rodrigues dos Santos","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAsElEQVRIiWNgGAWjYNCCCgk7UrWckUiGsgyI1MHYxsDYQLQWc4ncgw9/zrNglm/gMXvAuOMPYS2WM/KSjXm3SfAZHOAxN2A8Q4QtBjdyzKQZt0kwGzDwmEkwthGpRfLnHAnG+Q2kaJHgbZBgbDhAtJYzb4yNeY5JJBscZis3SDxjTISW4zmGD3/U1NnJtzdve/BxhxxhLQjAzMDGkNhAig4gYINH6CgYBaNgFIwCZAAAGDQvq/n4hksAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0001-7347-2592","institution":"i3S - Instituto de Investigação e Inovação em Saúde, Universidade do Porto","correspondingAuthor":true,"prefix":"","firstName":"Nuno","middleName":"Rodrigues dos","lastName":"Santos","suffix":""}],"badges":[],"createdAt":"2024-03-05 16:51:46","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4018077/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4018077/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41375-024-02446-w","type":"published","date":"2024-10-25T04:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":52409311,"identity":"fa3eb8f3-9c99-4b9f-81ad-b8f7eb9ff346","added_by":"auto","created_at":"2024-03-11 09:42:44","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":377819,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePSGL-1 genetic inactivation enhances TCR/CD3-mediated T cell activation.\u003c/strong\u003e A) Flow cytometry detection of PSGL-1 surface expression in Jurkat/Mock and Jurkat/\u003cem\u003eSELPLG\u003c/em\u003e KO cells. Unstained Jurkat/Mock cells are shown as a negative control. B) CD69 surface expression levels of Jurkat/Mock and \u003cem\u003eSELPLG\u003c/em\u003eKO cells upon 24 h of anti-CD3 stimulation (basal levels and 0.1, 0.5 and 5 µg/ml of anti-CD3). Representative of two independent experiments C) Histograms and mean fluorescence index (MFI) ratio between CD3-stimulated (0.5 µg/ml, 24 h) and unstimulated Jurkat/Mock and \u003cem\u003eSELPLG\u003c/em\u003e KO cells. Five independent CD3 stimulation experiments are represented in the graphs. \u003cem\u003eP \u003c/em\u003evalues obtained from unpaired \u003cem\u003et\u003c/em\u003e-tests are shown.\u003c/p\u003e","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-4018077/v1/4ae5fe9bd45a251fe1b68c24.png"},{"id":52409473,"identity":"e4650a76-db06-4061-b476-4b23d9e4aeaf","added_by":"auto","created_at":"2024-03-11 09:50:44","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1181748,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAnti-PSGL-1 enhances T cell activation in response to Raji lymphoma cells.\u003c/strong\u003e A) Schematic overview of the pre-activated T cell coculture with irradiated Raji lymphoma cells. B, C) Representative flow cytometry dot plots regarding the expression of CD25 and CD69 activation markers, highlighting the percentages of CD4\u003csup\u003e+\u003c/sup\u003e-gated (B) and CD8\u003csup\u003e+\u003c/sup\u003e-gated (C) CD69\u003csup\u003e+\u003c/sup\u003eCD25\u003csup\u003e+\u003c/sup\u003e double-positive T cells after 3, 5 or 7 days of coculture. Right panels show plotted data from 9 independent healthy donors. D) Percentage of CD69\u003csup\u003e+\u003c/sup\u003eCD25\u003csup\u003e+\u003c/sup\u003e CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e healthy donor T cells after 3, 5 and 7 days of coculture with irradiated Raji lymphoma cells, with or without PL1 antibody. Represented as Mean ± SEM. P values from paired t tests * \u0026lt; 0.05, ** \u0026lt; 0.01, *** \u0026lt; 0.001. E) Fold change differences of IL-2 production determined by ELISA between no antibody and PL1-treated cocultures with T cells from five cocultures healthy donors. All P values were determined by paired t tests.\u003c/p\u003e","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-4018077/v1/baf2c68f2dd246e71090914b.png"},{"id":52409314,"identity":"606ea10d-02e2-49e5-b2bf-c231ebd1a9f2","added_by":"auto","created_at":"2024-03-11 09:42:44","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":510847,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAnti-PSGL-1 enhances primed T cell activation in response to Raji lymphoma cells.\u003c/strong\u003e A) Schematic overview of the generation of primed T cells and co-culture settings with irradiated Raji lymphoma cells. B) Representative flow cytometry dot plots and percentages of CD4\u003csup\u003e+\u003c/sup\u003e-gated and CD8\u003csup\u003e+\u003c/sup\u003e-gated healthy donor T cells positive for CD69 and/or CD25 after Raji re-challenge in the absence or presence of the PL1 mAb. The indicated \u003cem\u003eP \u003c/em\u003evalues were obtained from paired\u003cem\u003e t\u003c/em\u003e tests. The bottom panels show plotted data from 10 independent healthy donors.\u003c/p\u003e","description":"","filename":"Fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-4018077/v1/da199a01ff8f1dd8a9a009cc.png"},{"id":52409313,"identity":"80c627c2-70c4-4810-b633-e38b55717920","added_by":"auto","created_at":"2024-03-11 09:42:44","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":234705,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAnti-PSGL-1 enhances exhausted-like CD4\u003c/strong\u003e\u003csup\u003e\u003cstrong\u003e+\u003c/strong\u003e\u003c/sup\u003e\u003cstrong\u003e T cell response to Raji lymphoma cells.\u003c/strong\u003e A) Schematic overview of the induction of T cell exhaustion on healthy donor T cells for 9 days followed by 5-day coculture with irradiated Raji lymphoma cells. B) Representative flow cytometry histograms showing the percentage of CD4\u003csup\u003e+\u003c/sup\u003e- and CD8\u003csup\u003e+\u003c/sup\u003e-gated T cells expressing CD69 at day 5 of coculture. The bottom panels show plotted data from 5 independent healthy donors. The indicated \u003cem\u003eP\u003c/em\u003e values were obtained from paired \u003cem\u003et \u003c/em\u003etests. C) Fold change differences of IL-2 and IFN-γ production determined by ELISA between no antibody and PL1-treated cocultures with T cells from five cocultures healthy donors. All \u003cem\u003eP \u003c/em\u003evalues were determined by paired \u003cem\u003et\u003c/em\u003e tests.\u003c/p\u003e","description":"","filename":"Fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-4018077/v1/0046dabc503452cc9db02d81.png"},{"id":52409316,"identity":"56a396af-51d7-44f0-86b3-a438e25b030f","added_by":"auto","created_at":"2024-03-11 09:42:44","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":722004,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePSGL-1 antibody blockade enhances lymphoma patient T cell activation.\u003c/strong\u003e A) Flow cytometry characterization of T and B lineage populations in lymph node (LN) biopsies from three B-cell lymphoma patients of the indicated subtypes. B) Flow cytometry detection and MFI levels of CD69 in LN-derived CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e T cells upon 3-day culture with IgG or PL1 antibodies. MCL. mantle cell lymphoma; SLBCL. small lymphocytic B-cell lymphoma; FL/DLBCL. diffuse large B-cell lymphoma transformed from a follicular lymphoma.\u003c/p\u003e","description":"","filename":"Fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-4018077/v1/e500f4fd4e1238fdc7a25846.png"},{"id":52409475,"identity":"11e2ec58-5dd2-4161-a017-d7ef1a8b914f","added_by":"auto","created_at":"2024-03-11 09:50:44","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":681312,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eAnti-PSGL-1 \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003ein vivo\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e administration resulted in decrease tumor burden and increased infiltration of tumors with immune cells, including activated T cells.\u003c/strong\u003e A) Schematic overview of the syngeneic lymphoma mouse model experimental setting. B) Tumor volume of rat IgG- and 4RA10-treated mice. Data points and error bars represent mean ± standard error of the mean (SEM) of IgG-treated and 4RA10-treated mice (n=5 for each group). * \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, ** \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; unpaired \u003cem\u003et\u003c/em\u003e tests. C) Tumor weight (n=5 for each group) and photograph of tumors at day 20. Columns and error bars represent mean ± SEM. D) Percentages of tumor-infiltrating CD3\u003csup\u003e+\u003c/sup\u003e, CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e T cells E) Percentage of tumor-infiltrating macrophages (F4/80\u003csup\u003e+\u003c/sup\u003e), dendritic cells (CD11c\u003csup\u003e+\u003c/sup\u003e) and NK cells (NK1.1\u003csup\u003e+\u003c/sup\u003e). F) Left plots, T\u003csub\u003eEM\u003c/sub\u003e/T\u003csub\u003eN\u003c/sub\u003e ratio of CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e tumor-infiltrating T cells in tumors subdivided according to weight. Right plots, correlation between T\u003csub\u003eEM\u003c/sub\u003e/T\u003csub\u003eN\u003c/sub\u003e ratios and tumor weights. \u003cem\u003eP\u003c/em\u003e value obtained from simple linear regression test. G) Upper panels, representative cytometry histograms showing expression of the CD69, CD25 and PD-1 activation markers in tumor-infiltrating CD8\u003csup\u003e+\u003c/sup\u003e T cells. Lower panels, percentage of tumor-infiltrating CD8\u003csup\u003e+\u003c/sup\u003e T cells expressing CD69, CD25 and PD-1. H) Left panels, representative cytometry plots showing the percentage of Foxp3\u003csup\u003e+\u003c/sup\u003e tumor-infiltrating Tregs within the CD4\u003csup\u003e+\u003c/sup\u003e population. Right panel, percentage of tumor-infiltrating Tregs (CD4\u003csup\u003e+\u003c/sup\u003e Foxp3\u003csup\u003e+\u003c/sup\u003e). For panels C, D, E, F (left plots), G and H, the indicated \u003cem\u003eP\u003c/em\u003e values were obtained by unpaired \u003cem\u003et\u003c/em\u003e tests. For panels D-H, n=5 for IgG group (blue squares) and n=4 for 4RA10 group (red circles).\u003c/p\u003e","description":"","filename":"Fig6.png","url":"https://assets-eu.researchsquare.com/files/rs-4018077/v1/bb0b718695c776bcaa0e8117.png"},{"id":67530090,"identity":"7a6fd4f9-51b2-48c7-b858-ed878c169160","added_by":"auto","created_at":"2024-10-26 07:05:30","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4733324,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4018077/v1/d3c18966-28c6-4014-9b64-dcec4feea616.pdf"},{"id":52409474,"identity":"c85de896-a070-4c1e-b584-f9f8b00e3f11","added_by":"auto","created_at":"2024-03-11 09:50:44","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":197106,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"AntiPSGL1papersupplementarytablesv5.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4018077/v1/95590b9248b8e0f69aaf85f9.pdf"},{"id":52409318,"identity":"780c3fb7-30dc-41ca-a1b1-0a40f378221e","added_by":"auto","created_at":"2024-03-11 09:42:44","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":1320925,"visible":true,"origin":"","legend":"","description":"","filename":"FiguresantiPSGL1papersuplementarv15.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4018077/v1/b957415edc6a21edfbb9470e.pdf"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e conflict of interest to disclose.","formattedTitle":"Antibody blockade of the PSGL-1 immune checkpoint enhances T-cell responses to B-cell lymphoma","fulltext":[{"header":"Introduction","content":"\u003cp\u003eLymphomas are generally classified as Hodgkin (about 10% of cases) or non-Hodgkin lymphomas (NHL, about 90% of cases), with NHL comprehending several subtypes of B- (85\u0026ndash;90%) and T-cell (10\u0026ndash;15%) lymphomas [1,2]. Although treatment options for B-cell lymphomas are generally based on chemotherapy cycles and, in specific cases, radiotherapy [1\u0026ndash;3], other strategies such as immunotherapy (e.g rituximab and brentuximab vedotin), stem cell transplants and chimeric antigen receptor (CAR)-T cell therapy have also been applied in the clinic [2,4,5]. Since the emergence of immune checkpoint blockade therapies, only Hodgkin lymphomas, which typically display an inflamed microenvironment and frequently express programmed-cell death protein 1 (PD-1) ligands were found to respond reasonably well [2,4,6,7]. In fact, clinical trials have demonstrated high response rates with nivolumab and pembrolizumab PD-1 inhibitors in relapsed or refractory Hodgkin lymphoma [5,8,9]. In contrast, NHL patients were generally unresponsive to immunotherapies [5,9], likely due to the fact that most of these malignancies are non-inflamed and show low expression of PD-1 ligands [5,7,10,11]. Therefore, alternative immunotherapeutic strategies are urgently needed for these malignancies.\u003c/p\u003e \u003cp\u003eThe P-selectin glycoprotein ligand-1 (PSGL-1), encoded by the \u003cem\u003eSELPLG\u003c/em\u003e gene, has recently been identified as an immune response modulatory protein. Since first described in neutrophils as a ligand for P-selectin, PSGL-1 has been shown to interact with P-, E- and L- selectins and to be associated with distinct functions of lymphoid and myeloid cells, mainly related with cell migration and motility [12\u0026ndash;19]. Early research showed that PSGL-1 negatively regulated T cell function. Indeed, PSGL-1-deficient T cells from \u003cem\u003eSelplg\u003c/em\u003e knockout (KO) mice proliferated more vigorously than wild-type T cells upon CD3 plus CD28 antibody exposure or interleukin (IL)-2, IL-4, and IL-15 homeostatic cytokine stimulation [20,21]. More recently, PSGL-1 was shown to function as an immune checkpoint regulator by promoting mouse T cell exhaustion and restricting effector T cell responses and memory T cell development upon viral or tumoral challenges [22,23]. Even though the molecular mechanisms underlying these newly reported PSGL-1 functions remain largely undefined, it was shown that upon viral infection, \u003cem\u003eSelplg\u003c/em\u003e-deficient (\u003cem\u003eSelplg\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e) T cells had enhanced survival, reduced PD-1, CD160 and BTLA inhibitory receptor expression and increased effector cytokine production [22,23]. Moreover, \u003cem\u003eSelplg\u003c/em\u003e\u003csup\u003e\u003cem\u003e\u0026minus;/\u0026minus;\u003c/em\u003e\u003c/sup\u003e T cells were more reinvigorated by anti-PD-L1 \u003cem\u003ein vivo\u003c/em\u003e treatment than wild-type T cells [24]. In this line, anti-PD-1 administration to melanoma tumor-bearing \u003cem\u003eSelplg\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice promoted tumor regression [25]. Furthermore, targeting PSGL-1 with a monoclonal antibody, alone or with PD-1 antibody blockade, resulted in increased effector CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e tumor-infiltrating T cell responses, and reduced melanoma progression [25]. In addition to its role in regulating immune responses in T cells, recent evidence indicates that PSGL-1 also acts as an immunosuppressive checkpoint in tumor-associated macrophages [26].\u003c/p\u003e \u003cp\u003eIn this study, we found that PSGL-1 blockade with specific antibodies boosted T cell activity against B-cell lymphoma. Treatment of human T cells with anti-PSGL-1 \u003cem\u003ein vitro\u003c/em\u003e led to upregulation of activation markers and enhanced cytokine expression in response to allogeneic lymphoma cells. Furthermore, anti-PSGL-1 heightened T-cell activation against autologous patient lymphoma cells. Demonstrating the lymphoma therapeutic potential of PSGL-1 inhibition, we found in a B-cell lymphoma mouse model that PSGL-1 antibody blockade increased tumor infiltration by activated T cells and markedly reduced tumor growth. Our findings demonstrate that blocking PSGL-1 with antibodies can be an effective strategy for lymphoma treatment.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell lines and culture\u003c/h2\u003e \u003cp\u003eThe T-cell acute lymphoblastic leukemia (T-ALL) Jurkat cell line (Jurkat E6.1 subline, authenticated by short tandem repeat genotyping in April 2022) was provided by Nuno L. Alves (i3S, Porto, Portugal). The Burkitt lymphoma Raji cell line was previously described [27]. The A20 mouse B lymphoma cell line (TIB-208) was acquired from American Tissue Culture Collection (ATCC, Manassas, VA, USA). Suspension cell lines were cultured in RPMI complete medium (RPMI 1640 medium (Gibco, Carlsbad, CA, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS; Gibco), 100 U/ml penicillin-streptomycin (Gibco) and 1 mM L-Glutamine (Gibco), maintaining a density between 1 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e and 1 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e cells/ml, in a 5% CO\u003csub\u003e2\u003c/sub\u003e humidified incubator at 37 \u0026ordm;C. The HEK293T cell line was cultured in DMEM medium (Cytiva, Marlborough, MA, USA) supplemented as described above. Absence of \u003cem\u003eMycoplasma\u003c/em\u003e was confirmed by 16S rRNA amplification with MGSO and GPO-1 primers [28]. For cell growth assays, cells were plated at 1 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e and counted in a Neubauer hemocytometer after 24 and 48 h.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eGeneration of a PSGL-1-deficient Jurkat cell line\u003c/h2\u003e \u003cp\u003eThree target guide RNA (gRNA) sequences (#1, AATTACGCACGGGGTACAT; #2, GACAACTCGACTGACGGCCA; #3, TGGGGGAGTAATTACGCACGG) targeting the second exon of the \u003cem\u003eSELPLG\u003c/em\u003e gene were designed in CRISPOR and Synthego software platforms [29,30] and selected for their high specificity, low off-targets, high activity and early coding region. The gRNAs were cloned into the lentiCRISPR v2 plasmid, a gift from Feng Zhang (Addgene, Watertown, MA, USA; plasmid #52961; \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://n2t.net/addgene:52961\u003c/span\u003e\u003cspan address=\"http://n2t.net/addgene:52961\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e; RRID: Addgene_52961), after digestion with \u003cem\u003eEsp\u003c/em\u003e3I restriction enzyme (cat. no. ER0451, Thermo Scientific, Waltham, MA). To produce lentiviral particles, each gRNA-bearing lentiCRISPR plasmid or empty plasmid together with pRRE, pRev, and pMD2.G (VSV-G envelope-expressing plasmid) packaging plasmids, all a gift from Didier Trono (Addgene plasmids #12251, #12253, #12259), and pCEP4-tat, gifted by Sergey Kasparov (Addgene plasmid # 22502), were transfected into HEK293T cells with Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA). After 72 h, supernatants from lentivirus-producing cells were collected, filtered through 0.22 \u0026micro;m filters (Cytiva) and added immediately to 1 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e Jurkat cells growing in complete RPMI medium without antibiotics. Two days later, the medium was changed and the transduced cells were selected by addition of 0.5 \u0026micro;g/ml puromycin. The puromycin concentration was increased to 1 \u0026micro;g/ml after two more days. The gRNA #2 showed increased efficacy in knocking-out \u003cem\u003eSELPLG\u003c/em\u003e, as most Jurkat/\u003cem\u003eSELPLG\u003c/em\u003e KO #2 cells showed absence of PSGL-1 expression by flow cytometry. Puromycin-resistant Jurkat cells, infected with empty lentiCRISPR lentiviral particles (Jurkat/Mock), were obtained as controls. The Jurkat/SELPLG KO #2 PSGL-1 negative cells were isolated by flow cytometry sorting in a BD FACSAria II. After the Jurkat/\u003cem\u003eSELPLG\u003c/em\u003e KO cell line establishment, clones were isolated from the bulk population through serial dilution.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003ePrimary human T cell isolation\u003c/h2\u003e \u003cp\u003ePeripheral blood mononuclear cells (PBMCs) were obtained from buffy coats of adult healthy blood donors (aged 18\u0026ndash;42 years; Supplementary Table\u0026nbsp;1) provided by the local hospital blood bank (\u003cem\u003eServi\u0026ccedil;o de Imunohemoterapia, Centro Hospitalar Universit\u0026aacute;rio S\u0026atilde;o Jo\u0026atilde;o, Porto)\u003c/em\u003e after ethical approval (ref. no. 398/2020). PBMCs were isolated by density-gradient separation using Ficoll Paque Plus (Cytiva). The cell pellet was cleared of remaining erythrocytes by incubation in red blood cell lysis buffer (90% 160 mM NH\u003csub\u003e4\u003c/sub\u003eCl, 10% 170 mM Tris-HCl) 5 min at 37 \u0026ordm;C, and then washed in phosphate-buffered saline (PBS). Untouched T cells were isolated by depleting CD3-negative cells using the MojoSort Human CD3 T Cell Isolation Kit (cat. no. 480021, Biolegend, San Diego, CA, USA) and EasySep Magnet (cat. no. #18000, StemCell Technologies, Vancouver, BC, Canada), according to the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003cp\u003e \u003cb\u003eIn vitro\u003c/b\u003e \u003cb\u003ehuman T cell activation\u003c/b\u003e\u003c/p\u003e \u003cp\u003eHealthy donor T cells were stimulated with plate-bound anti-human CD3 (clone OKT3, cat. no. 317326, Biolegend) and soluble anti-human CD28 (clone CD28.2, cat. no. 302934, Biolegend), at concentrations of 0.5 and 2 \u0026micro;g/ml or 2 and 5 \u0026micro;g/ml of each antibody. Jurkat cells were stimulated with 0.1, 0.5 or 5 \u0026micro;g/ml of plate-bound anti-human CD3. Incubations were performed in RPMI complete medium for the duration indicated in the \u003cspan refid=\"Sec12\" class=\"InternalRef\"\u003eResults\u003c/span\u003e section.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eAllogeneic T-cell activation assays\u003c/h2\u003e \u003cp\u003ePre-activated, primed, or \u003cem\u003ein vitro\u003c/em\u003e exhausted healthy donor T cells were cocultured at a 2:1 ratio with irradiated Raji cells (150 Gy, Gammacell irradiator) in RPMI complete medium, in 96-well round bottom microplates (cat. no. 353077, Falcon) for 3, 5, or 7 days. Ten \u0026micro;g/ml of mouse IgG (cat. no. 015-000-003, Jackson ImmunoResearch, West Grove, PA) or anti-human PSGL-1 PL1 hybridoma (concentration of approximately 5\u0026ndash;10 \u0026micro;g/ml) were added at the beginning of coculture. The PL1 hybridoma, developed by McEver, R.P., was obtained from the Developmental Studies Hybridoma Bank, created by the NICHD of NIH and maintained at the University of Iowa, Department of Biology, Iowa City, IA 52242, USA. For T-cell pre-activation, isolated healthy donor T cells were stimulated with plate-bound 0.5 \u0026micro;g/ml anti-CD3 (clone OKT3) and soluble 2 \u0026micro;g/ml anti-CD28 (clone CD28.2) for approximately 18\u0026ndash;24 h in RPMI complete medium. For T-cell priming, isolated healthy donor T cells were cocultured for 7 days with irradiated Raji lymphoma cells at a 2:1 ratio in RPMI complete medium. For T-cell \u003cem\u003ein vitro\u003c/em\u003e exhaustion, isolated healthy donor T cells were stimulated every 3 days for 9 days with plate-bound 1 \u0026micro;g/ml anti-CD3 and soluble 5 \u0026micro;g/ml anti-CD28, following reported methodology [31]. Regarding Jurkat cocultures, Raji cells were loaded with 2 \u0026micro;g/ml of the bacterial superantigen staphylococcal enterotoxin B (SEB) (cat. no. S4881, Sigma-Aldrich, St. Louis, MO, USA) for 1 h at 37 \u0026ordm;C. Afterwards, 6 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e SEB-loaded Raji cells were cocultured with 2 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e Jurkat/Mock cells (3:1) in 24-well plates (cat. no. 4430300, Orange Scientific, Braine-l\u0026rsquo;Alleud, Belgium) for 24 h at 37 \u0026ordm;C.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003ePrimary human lymphoma samples\u003c/h2\u003e \u003cp\u003eLymph node biopsies collected between 2019 and 2023 from six B-cell lymphoma patients (Supplementary Table\u0026nbsp;2) were obtained at the Onco-Hematology Department of IPO-Porto after informed consent and ethical approval (ref. GOM_PI_2013.03). Research was conducted according to the principles of the Declaration of Helsinki. Lymph node biopsies were processed by cutting in small pieces with a scalpel in RPMI 1640 medium, and dissociated by gentle pressure against a 0.75 \u0026micro;m cell strainer. For autologous coculture experiments, lymph node suspensions were cultured in RPMI complete medium, with or without PL1 antibody (concentration of approximately 5\u0026ndash;10 \u0026micro;g/ml) or mouse IgG (10 \u0026micro;g/ml, Jackson ImmunoResearch) for 3 days.\u003c/p\u003e \u003cp\u003e \u003cb\u003eIn vivo\u003c/b\u003e \u003cb\u003estudies\u003c/b\u003e\u003c/p\u003e \u003cp\u003eBALB/c mice were bred and maintained at the i3S barrier animal facility under 12 h light:dark cycles with food and water \u003cem\u003ead libitum\u003c/em\u003e. All experimental procedures were approved by the i3S ethics committee (approval no. 15/CECRI/2020) and Portuguese authorities (\u003cem\u003eDire\u0026ccedil;\u0026atilde;o-Geral de Agricultura e Veterin\u0026aacute;ria\u003c/em\u003e) and followed recommendations from the European Commission (Directive 2010/63/UE) and the local Portuguese authorities (decree laws no. 113/2013 and 1/2019). Five \u0026times; 10\u003csup\u003e6\u003c/sup\u003e A20 cells were injected s.c. into 9-11-week-old BALB/c male mice. Mice were randomized into 2 groups, and treated i.p. in the late afternoon with three doses of 200 \u0026micro;g of either PSGL-1 monoclonal antibody (mAb; clone 4RA10, cat. no. BE0186, BioXcell, Lebanon, NH, USA) or control IgG (ChromPure rat IgG, cat. no. 012-000-003, Jackson ImmunoResearch) at 7, 10 and 13 days post-cell injection (dpi). Tumors were measured with calipers at 6, 8, 10, 13, 15, 17 and 20 dpi, and their volume (V) was calculated using the formula: V (mm\u003csup\u003e3\u003c/sup\u003e) = (L \u0026times; W\u003csup\u003e2\u003c/sup\u003e)/2, being L the larger and W the smaller of two perpendicular tumor axes. Mice were euthanized by CO\u003csub\u003e2\u003c/sub\u003e inhalation at 20 dpi. At experimental endpoint, spleens and tumors from mice were mechanically digested through a 70 \u0026micro;m cell strainer (cat. no. 352350, Corning, Glendale, AZ, USA) and cells were counted using Neubauer hemocytometer.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eFlow cytometry\u003c/h2\u003e \u003cp\u003eCells were washed with FACS buffer (3% FBS and 10 mM NaN\u003csub\u003e3\u003c/sub\u003e in PBS), centrifuged at 300 \u003cem\u003eg\u003c/em\u003e, and resuspended in FACS buffer containing fluorochrome-conjugated antibodies (listed in Supplementary Table\u0026nbsp;3). After incubation on ice for 45\u0026ndash;60 min, cells were washed twice with FACS buffer and resuspended in 10 mM NaN\u003csub\u003e3\u003c/sub\u003e in PBS. For intracellular immunostaining, cells were first washed and stained for surface markers, as described above. Next, cells were fixed in paraformaldehyde with Fixation Buffer (cat. no. 420801, Biolegend) and permeabilized with True-Phos Perm Buffer (cat. no. 425401, Biolegend), following the manufacturer\u0026rsquo;s instructions. Next, cells were incubated on ice with fluorochrome-conjugated antibodies in FACS buffer for 30\u0026ndash;45 min, and washed in FACS buffer, as described above. For \u003cem\u003ein vitro\u003c/em\u003e T cell proliferation assays, T cells were first stained with 2 \u0026micro;M eFluor Dye 670 (cat. no. 65-0840-85, eBioscience, San Diego, CA, USA), according to the manufacturer\u0026rsquo;s instructions, and then cultured in RPMI complete medium. Cell fluorescence levels were acquired in BD Accuri C6 or BD FACSCanto II cell analyzers, and data analyzed through FlowJo software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eELISA assays\u003c/h2\u003e \u003cp\u003eCoculture supernatants were collected and stored at -80 \u0026ordm;C. Concentrations of IFN-γ and IL-2 were assessed by the ELISA MAX Deluxe Set Human IL-2 (cat. no. 431804, Biolegend) and IFN-γ (cat. no. 430104, Biolegend) kits, following the manufacturer\u0026rsquo;s instructions. Briefly, Nunc MaxiSorp ELISA uncoated plates (cat. no. 423501, Biolegend) were incubated at 4 \u0026ordm;C overnight with capture antibody and sealed with Plate Sealers (cat. no. 423601, Biolegend). Plate wells were washed with ELISA Wash Buffer (cat. no. 421601, Biolegend) and diluted supernatants and standards were added to the wells and incubated at room temperature. Plate wells were washed with ELISA Wash Buffer, the detection antibody was added, and plates were incubated at room temperature. After washing, avidin-horseradish peroxidase (HRP) reagent was added and incubated at room temperature. Plates were washed, 3,3',5,5'-tetramethylbenzidine (TMB) substrate was added, and plates were incubated in the dark at room temperature for 20 min. The TMB reaction was terminated with Stop Solution (cat. no. 423001, Biolegend). Absorbances at 450 nm and 570 nm were measured in a Biotek (Winooski, VT, USA) PowerWave XS Microplate Reader.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eImmunoblotting\u003c/h2\u003e \u003cp\u003eWhole cell lysates were prepared from 4 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e Jurkat cells after two rounds of ice-cold PBS washing and resuspension in ice-cold RIPA buffer (10 mM Tris pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% sodium docetyl sulfate (SDS)) with freshly added protease inhibitors (10 \u0026micro;g/ml aprotinin, 10 \u0026micro;g/ml leupeptin and 1 mM phenylmethylsulfonyl fluoride) and phosphatase inhibitors (10 mM p-nitrophenyl phosphate, 15 mM β-glycolphosphatase and 1 mM Na\u003csub\u003e3\u003c/sub\u003eVO\u003csub\u003e4\u003c/sub\u003e) for 10 min. After 15 000 \u003cem\u003eg\u003c/em\u003e centrifugation, the supernatants were denatured in SDS sample buffer (62.5 mM Tris pH 6.8, 20% glycerol, 2% SDS and 5% β-mercaptoethanol) by heating the samples for 5 min at 95 \u0026ordm;C. Samples were subjected to 10% SDS-polyacrylamide gel electrophoresis, together with PageRuler Plus prestained protein ladder (Thermo Fisher Scientific) and transferred to an immunoblot nitrocellulose membrane (Cytiva). Protein transfer efficiency was assessed by Ponceau staining (cat. no. P7170, Sigma-Aldrich). Membranes were blocked with 5% nonfat dried milk in PBS with 0.1% Tween 20 and then incubated with antibodies against human PSGL-1 (1:1000 dilution; KPL1, cat. no. 328802, Biolegend). Diluted 1:5000 HRP-conjugated goat anti-mouse IgG (cat no. A00160; GenScript, Piscataway, NJ, USA) was used as secondary antibody. Bound secondary antibodies were revealed by incubating the membrane with SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific) and luminescence captured by Amersham Hyperfilm (Cytiva) or ChemiDoc XRS+ (Bio-Rad, Hercules, CA, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eStatistics\u003c/h2\u003e \u003cp\u003eData plots and statistical analyses were performed with GraphPad Prism software. Statistical tests and sample numbers are indicated in figure legends. A \u003cem\u003eP\u003c/em\u003e value below 0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003ePSGL-1 genetic inactivation enhances T-cell receptor (TCR)-mediated human T cell activation\u003c/h2\u003e \u003cp\u003eSince \u003cem\u003eSelplg\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mouse T cells were reported to be more responsive to TCR/CD3 stimulation [20], we set out to assess the impact of PSGL-1 genetic inactivation in human T cell activation. To this end, we inactivated through CRISPR-Cas9 the \u003cem\u003eSELPLG\u003c/em\u003e gene in the human Jurkat T cell line, which expresses high levels of PSGL-1 [32] and is a well-established cellular model to study regulation of TCR signaling [33]. By doing so, we obtained a cell line with no detectable PSGL-1 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, and S1A). Jurkat/\u003cem\u003eSELPLG\u003c/em\u003e KO cells were viable and divided normally. Next, we stimulated Jurkat/\u003cem\u003eSELPLG\u003c/em\u003e KO and Jurkat/Mock cells for 24 h with different concentrations of plate-bound anti-CD3 and assessed T-cell activation by detecting the CD69 activation marker. Jurkat/\u003cem\u003eSELPLG\u003c/em\u003e KO cells stimulated with lower concentrations of anti-CD3 (0.1 and 0.5 \u0026micro;g/ml) had increased levels of CD69 compared to Jurkat/Mock cells, whereas that difference was smaller with a concentration of 5 \u0026micro;g/ml (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Next, we explored whether PSGL-1-deficiency influenced the expression of other activation markers. By stimulating Jurkat/Mock and \u003cem\u003eSELPLG\u003c/em\u003e KO cells for 24 h with 0.5 \u0026micro;g/ml anti-CD3, we found that CD69 and CD25 expression levels were upregulated in Jurkat/\u003cem\u003eSELPLG\u003c/em\u003e KO compared to Jurkat/Mock cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Similar results were obtained upon CD3 stimulation of a clonal Jurkat/\u003cem\u003eSELPLG\u003c/em\u003e KO cell line compared to Jurkat parental cells (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eB). These findings indicate that PSGL-1 deficiency renders Jurkat T cells more sensitive to weaker TCR/CD3 stimulation, and thus show that, like in mice, PSGL-1 is a regulator of human T cell responses to antigenic stimulation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eAntibody blockade of PSGL-1 enhances T cell activation against lymphoma cells\u003c/h2\u003e \u003cp\u003eGiven that PSGL-1 genetic deficiency promoted Jurkat T-cell activation, we next sought to assess whether blocking PSGL-1 with specific antibodies could produce a similar outcome. By coculturing Jurkat cells with Raji lymphoma cells pre-loaded with SEB superantigen, in the presence or absence of the anti-PSGL-1 PL1 mAb, known to inhibit PSGL-1 activity by blocking its interactions with selectins [14], we found that the levels of CD69 on Jurkat cells increased upon PL1 treatment (Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e). Furthermore, PSGL-1 surface expression in Jurkat cells, detected by an antibody recognizing a distinct epitope [34], also decreased upon activation, especially with PL1 treatment (Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e). Given these results with a malignant T cell line, we next addressed the effect of the PL1 mAb in the proliferation of normal human T cells. Indeed, PL1 increased the percentage of proliferating CD3-stimulated human healthy T cells (Fig. S3A). To explore the dynamics of PSGL-1 expression upon TCR activation, we stimulated healthy donor T cells with anti-CD3/CD28 and found decreased expression of surface and total PSGL-1 in CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e T cells (Fig. S3B).\u003c/p\u003e \u003cp\u003eNext, we performed cocultures of human healthy donor T cells with allogenic Raji antigen-presenting cells, in the presence or absence of PL1 mAb. To facilitate the activation of a polyclonal population of unrelated donor T cells in response to Raji cells, the former were pre-activated with CD3 and CD28 antibodies for 24 h (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). As expected, this led to CD25 and CD69 upregulation (not shown). Next, pre-activated T cells were cultured with irradiated Raji lymphoma cells in the presence or absence of PL1 for 3, 5 and 7 days (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). We noticed that PSGL-1 surface expression levels in CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e T cells after 3 days of coculture decreased with PL1 treatment (Fig. S4A). At all coculture timepoints analyzed, the percentage of CD69\u003csup\u003e+\u003c/sup\u003eCD25\u003csup\u003e+\u003c/sup\u003e activated T cells (following the gating strategy depicted in Fig. S4B) increased in the presence of PL1, as compared to the absence of antibody (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB, C and D), or to IgG control antibody (Fig. S4C). The CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e T cell activation-promoting effect of the PL1 antibody was most consistent, i.e. observed in all donor samples analyzed, at days 3 and 5 of coculture (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB, C and D). In addition, IL-2 secretion in the supernatant of CD3\u003csup\u003e+\u003c/sup\u003e T cells cocultured with Raji cells increased by PL1 treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE and S4D). Overall, these results showed that the PSGL-1 antibody enhanced T cell activation against Raji lymphoma cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe next investigated the impact of PSGL-1 in T cells primed to recognize lymphoma antigens. Thus, healthy donor T cells were first cocultured with irradiated Raji lymphoma cells for 7 days to induce expansion of cells capable of recognizing Raji-specific antigens. This led to upregulation of CD69, CD25 or both activation markers in about 27% of the T cells (Fig. S4E). Next, Raji-primed T cells were challenged with a fresh batch of irradiated Raji cells in the presence or absence of PL1 for another 5 days (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). This led to activation marker upregulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Although there was notable variability among individual donor samples, PSGL-1 antibody blockade led to higher percentages of CD69\u003csup\u003e+\u003c/sup\u003e and/or CD25\u003csup\u003e+\u003c/sup\u003e T cells compared to control samples that did not receive antibody treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). These results show that PSGL-1 antibody blockade can enhance tumor antigen-mediated activation of lymphoma-primed T cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eAntibody blockade of PSGL-1 enhances\u003c/b\u003e \u003cb\u003ein vitro\u003c/b\u003e \u003cb\u003eexhausted CD4\u003c/b\u003e\u003csup\u003e\u003cb\u003e+\u003c/b\u003e\u003c/sup\u003e \u003cb\u003eT cell response to lymphoma cells\u003c/b\u003e\u003c/p\u003e \u003cp\u003eIn tumors, persistent antigenic stimulation of infiltrating T cells often leads to a hyporesponsive state, commonly defined as exhaustion [35]. Thus, we set out to assess whether PSGL-1 antibody blockade could enhance exhausted T cell responses against lymphoma antigens. To this end, we induced \u003cem\u003ein vitro\u003c/em\u003e chronic activation of human healthy donor T cells by repeated stimulation with CD3/CD28 antibodies during 9 days (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). This protocol resulted in increased expression of the PD-1, LAG-3 and TIM-3 exhaustion markers in CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e T cells (Fig. S5A), indicative of an exhausted-like phenotype [31]. Next, cells were cocultured for 5 days with irradiated Raji lymphoma cells in the presence or absence of PL1 antibody (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Remarkably, expression of CD69 in CD4\u003csup\u003e+\u003c/sup\u003e, but not CD8\u003csup\u003e+\u003c/sup\u003e T cells, was enhanced when PL1 was added to the coculture (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). No significant changes in CD25 expression were observed (data not shown). No significant differences in PD-1, LAG-3 and TIM-3 expression levels were observed in Raji-cocultured T cells with PL1 versus no antibody (Fig. S5B), which suggests that PSGL-1 blockade did not promote CD4\u003csup\u003e+\u003c/sup\u003e T-cell activation through downregulation of inhibitory receptors. Furthermore, there was an increased production of IL-2 and IFN-γ in cocultures treated with PL1 antibody (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC and S5C). Together, these results suggest that PSGL-1 blockade enhances the activation and effector function of exhausted CD4\u003csup\u003e+\u003c/sup\u003e T cells in response to allogeneic lymphoma cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eAntibody blockade of PSGL-1 enhances activation of patient lymphoma-infiltrating T cells\u003c/h2\u003e \u003cp\u003eTo assess whether PSGL-1 antibody blockade can enhance human T cell activation in response to autologous lymphoma antigens, patient-derived lymphoma cells cocultured with the respective infiltrating T cells were treated with the PL1 mAb, as previously. Unsorted single-cell suspensions, isolated from lymph node biopsies of six B-cell lymphoma patients of different subtypes (one MCL, SLL, and FL/DLBCL each, and three DLBCL), were cultured with PL1 mAb, IgG or no antibody for up to 3 days. Lymphoma and T cells comprised, respectively, about 50\u0026ndash;80% and 10\u0026ndash;20% of the total hematopoietic cell population in each biopsy (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA and S6A, and data not shown). Furthermore, we also observed that PSGL-1 was expressed by either malignant B cell lymphoma and infiltrating T cells, albeit with higher levels in the latter (Fig. S6B). T cell analysis, after 3 days of culture with PL1 antibody, revealed an increase in CD69 expression in both CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e T cells from three lymphoma patient samples, as compared to negative controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). In contrast, CD25 expression in T cells was not significantly altered by PL1 treatment (data not shown). For three DLBCL biopsies, PL1 treatment had no significant impact on either CD69 or CD25 expression (data not shown). To assess whether lymphoma-infiltrating T cells displayed an exhaustion phenotype and whether PL1 reverted that phenotype, we assessed PD-1, TIM-3 and LAG-3 surface expression levels in T cells cultured with lymphoma cells for 3 days, in the presence of PL1 or IgG1 control. For the three cases where PL1 increased the percentage of CD69-expressing T cells, no reduction in exhaustion markers was observed (Fig. S6C), which indicates that PL1-mediated boosting of T-cell activation did not depend on inhibitory receptor downregulation. These data reinforce the notion that PSGL-1 antibody targeting can enhance T cell activation in response to human lymphoma antigens.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003ePSGL-1\u003c/b\u003e \u003cb\u003ein vivo\u003c/b\u003e \u003cb\u003eblockade increases effector immune cell infiltration of tumors and reduces murine lymphoma burden\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo demonstrate the \u003cem\u003ein vivo\u003c/em\u003e potential of PSGL-1 targeting to enhance T cell responses to lymphoma, we resorted to a syngeneic mouse model generated by subcutaneous inoculation of the A20 B-cell lymphoma cell line. Tumor-infiltrating T cells expressed PSGL-1 (Fig. S7), making them amenable for anti-PSGL-1 targeting. At 7 dpi, when subcutaneous tumors were palpable, recipient mice were treated with either anti-PSGL-1 4RA10 mAb or control IgG (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). Strikingly, tumor progression was significantly impaired by 4RA10 treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB and S8A), resulting in smaller tumors at the experimental endpoint, compared with the control IgG group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). Although the A20 cell line also expressed surface PSGL-1 [32], 4RA10 did not induce A20 cell death \u003cem\u003ein vitro\u003c/em\u003e (Fig. S8B), which argues against a direct effect of the antibody treatment on tumor cells. To determine whether the reduced tumor growth in anti-PSGL-1-treated mice was associated with an increased immune response, we characterized the tumor-infiltrating immune component using by flow cytometry to detect specific lineage markers (Fig. S9). Interestingly, the proportions of both CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e T cells were significantly increased in tumors from 4RA10-treated mice, as compared to tumors from IgG-treated mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD). Furthermore, 4RA10-treated mice displayed higher tumor infiltration by macrophages, dendritic cells and natural killer (NK) cells than the IgG-treated mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eCharacterization of the differentiation status of tumor-infiltrating CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e T cells by CD44 and CD62L expression, showed that T cells were predominantly effector memory (T\u003csub\u003eEM\u003c/sub\u003e, CD44\u003csup\u003e+\u003c/sup\u003eCD62L\u003csup\u003e\u0026minus;\u003c/sup\u003e) or central memory (T\u003csub\u003eCM,\u003c/sub\u003e CD44\u003csup\u003e+\u003c/sup\u003eCD62L\u003csup\u003e+\u003c/sup\u003e), with very few T na\u0026iuml;ve (T\u003csub\u003eN\u003c/sub\u003e, CD44\u003csup\u003e\u0026minus;\u003c/sup\u003eCD62L\u003csup\u003e+\u003c/sup\u003e) (Fig. S10A), indicating that tumor-infiltrating T cells had a history of antigenic stimulation. Although the 4RA10 treatment did not significantly alter the differentiation profile of tumor-infiltrating (Fig. S10A) and splenic T cells (Fig. S10B), we found that CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e T cells infiltrating smaller tumors (under 500 mg) displayed a higher T\u003csub\u003eEM\u003c/sub\u003e/T\u003csub\u003eN\u003c/sub\u003e ratio than those infiltrating larger ones (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF). This suggests that the increased presence of tumor-infiltrating T\u003csub\u003eEM\u003c/sub\u003e cells is associated with decreased tumor volume in 4RA10-treated mice. Considering these data and the perspective that PSGL-1 regulates T-cell activation, we reasoned that 4RA10 treatment could also increase the proportion of activated T cells. Indeed, the percentage of tumor-infiltrating CD8\u003csup\u003e+\u003c/sup\u003e T cells expressing the CD69, CD25 and PD-1 activation markers was higher in tumors from 4RA10-treated mice than in those from IgG-treated mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG). This effect of the 4RA10 treatment was restricted to CD8\u003csup\u003e+\u003c/sup\u003e T cells, since no major differences in the expression of activation markers were observed for tumor-infiltrating CD4\u003csup\u003e+\u003c/sup\u003e T cells (Fig. S11A). Of note, splenic CD8\u003csup\u003e+\u003c/sup\u003e T cell populations from 4RA10-treated tumor-bearing mice also showed increased percentage of CD69 and CD25 markers, as compared to those from IgG-treated mice (Fig. S11B). This suggests that the 4RA10 treatment also had systemic effects. Finally, although the frequency of CD4\u003csup\u003e+\u003c/sup\u003e Foxp3\u003csup\u003e+\u003c/sup\u003e regulatory T cells (Tregs) in spleens from tumor-bearing mice was not significantly impacted by the 4RA10 treatment (Fig. S11C), the percentage of Tregs infiltrating 4RA10-treated tumors was lower than in IgG-treated tumors (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eH).\u003c/p\u003e \u003cp\u003eCollectively, these results showed that PSGL-1 blockade increased tumor infiltration by activated CD8\u003csup\u003e+\u003c/sup\u003e T cells while decreasing Treg infiltration. These effects together likely underlie the observed impairment in tumor progression in mice treated with anti-PSGL-1 highlighting a novel and promising therapeutic approach.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we demonstrated the potential of PSGL-1 antibody targeting in enhancing T-cell responses against lymphoma. We cocultured both healthy donor T cells with allogeneic Raji B-cell lymphoma cells and tumor-infiltrating T cells with autologous patient lymphoma cells, and found that PSGL-1 antibody blockade boosted T cell activation in response to lymphoma cells. Furthermore, PSGL-1 targeting in a syngeneic B-cell lymphoma mouse model resulted in increased activation of tumor-infiltrating T cells, reduced infiltration of Tregs, and decreased tumor growth.\u003c/p\u003e \u003cp\u003eAnti-PSGL-1 treatment of A20 lymphoma-bearing mice led to increased percentage of tumor-infiltrating immune cells (T, NK, and dendritic cells, and macrophages) and enhanced activation of both tumor-infiltrating and peripheral CD8\u003csup\u003e+\u003c/sup\u003e T cells. Our results from 4RA10-treated mice parallel those reported for anti-PD-1-treated A20 lymphoma mice, in that, like 4RA10, anti-PD-1 hampered tumor growth and increased CD69 expression levels in tumor-infiltrating CD8\u003csup\u003e+\u003c/sup\u003e T cells [36]. In addition, 4RA10 treatment of a syngeneic melanoma mouse model increased anti-tumor T-cell responses, slowed tumor growth, increased activation of CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e tumor-infiltrating T cells, and decreased Treg frequencies in tumors [25]. Of note, Hope \u003cem\u003eet al.\u003c/em\u003e[37] reported that PSGL-1 blockade using recombinant soluble PSGL-1 protein also decreased tumor growth in a syngeneic melanoma model. Furthermore, it was reported that anti-PSGL-1 treatment of sarcoma, bladder and colon syngeneic mouse models resulted in decreased tumor growth, which could be further enhanced by anti-PD-1 combination [26]. Anti-PSGL-1 treatment of humanized mice bearing patient-derived melanoma xenografts also resulted in decreased tumor growth [26]. Our work in lymphoma, together with previous research in melanoma and other cancers, shows that disrupting PSGL-1 interactions, either by specific antibodies or recombinant PSGL-1, results in increased anti-tumor immune activity and reduced tumor growth, and that, like PD-1, PSGL-1 functions in T cells as a targetable immune checkpoint protein.\u003c/p\u003e \u003cp\u003eUsing different \u003cem\u003ein vitro\u003c/em\u003e assays, we demonstrated that PSGL-1 antibody targeting boosted human T cell responses against lymphoma cells. Indeed, PL1 treatment of allogeneic human healthy donor T cell cocultures with Raji lymphoma cells resulted consistently in increased percentages of T cells expressing CD69 or CD25, while increasing IL-2 and IFN-γ secretion. The percentage of activated T cells in allogeneic cocultures, with or without PSGL-1 blockade, varied remarkably among donor samples. This variability can be due to interindividual HLA allelic variability, sex and age, or recent exposure to antigenic challenges. Consistent with earlier findings [38], PBMCs from different donors had different percentages of na\u0026iuml;ve, central memory, effector memory and terminal differentiated effector T cells (Fig. S12). This variability may also impact the proportion of T cells responding to Raji lymphoma antigens. In spite of the sample heterogeneity, our results support the notion that PSGL-1 is an inhibitory protein in human T cells and that antibodies targeting PSGL-1 extracellular domain can improve anti-tumor T cell responses, as previously reported for mouse PSGL-1 targeting [25]. Crucially, treatment of patient lymphoma-infiltrating T cells with PL1 resulted in increased activation of both CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e T cells in response to autologous lymphoma cells. While this effect was noted in only three out of six patient samples, it highlights the potential of PSGL-1 antibody targeting in the treatment of human lymphomas. The variation in response to anti-PSGL-1 therapy may depend on B-cell lymphoma subtypes or unique cellular and molecular features of the lymphoma in each individual, so further studies are needed to validate these findings and understand which patients might benefit from this therapeutic approach.\u003c/p\u003e \u003cp\u003eTumor-infiltrating T cells often exhibit an exhausted phenotype, characterized by the expression of Eomes, Tcf-1 and Tox transcription factors, high expression of specific surface markers, like PD-1, LAG-3, TIM-3, and CTLA-4, metabolic changes and reduced T cell effector function [22,24,35,37]. Since PSGL-1 genetic inactivation was shown to promote effector functions in exhausted T cells either alone [37] or in combination with PD-1 blockade [24], we investigated the effects of PSGL-1 blockade on \u003cem\u003ein vitro\u003c/em\u003e-generated exhausted-like T cells. PL1 treatment improved mildly but in a statistically significant manner CD4\u003csup\u003e+\u003c/sup\u003e T cell responses, as denoted by CD69 upregulation, and increased production of IL-2 and IFN-γ pro-inflammatory cytokines. These findings lend support to the concept that PSGL-1 blockade could render exhausted T cells more active in anti-tumor responses. However, further studies should investigate whether the combination of PSGL-1 blockade with that of other inhibitory receptors can more robustly promote the activation of human exhausted T cells.\u003c/p\u003e \u003cp\u003eAt present, the molecular mechanisms by which PSGL-1 negatively regulates T-cell activation remain ill-defined. By inactivating the \u003cem\u003eSELPLG\u003c/em\u003e gene in Jurkat human T-cells, we found that these cells displayed higher expression levels of activation markers upon TCR/CD3 stimulation than control cells. This finding indicates that SELPLG deficiency renders human T cells more responsive to antigenic stimuli, and confirms recent mouse knockout studies that uncovered the regulatory function of PSGL-1 in T-cell responses towards viral or tumor antigens [22,24,25,37]. Given that PSGL-1 recruits and binds to ezrin/radixin/moesin (ERM) proteins [39,40], and that ezrin is required for proper ZAP70 recruitment to the immunological synapse [41], it is possible that absence or blockade of PSGL-1 may increase ezrin availability and, consequently, ZAP70 availability for TCR signaling [42]. \u003cem\u003eSelplg\u003c/em\u003e-deficient mouse T cells exhibited increased levels of phosphorylated ERK, Zap70 and Akt kinases [37], so future studies should determine whether PSGL-1 regulates TCR signaling pathways in human T cells.\u003c/p\u003e \u003cp\u003eBoth genetic inactivation of PSGL-1 and PL1 treatment resulted in enhanced Jurkat activation upon TCR stimulation, indicating that, in this setting, the PL1 mAb inhibits PSGL-1 function. These findings suggest that PL1 blocks PSGL-1 interactions with ligands responsible for suppressing T cell activity. The PL1 antibody targets an N-terminal epitope crucial for selectin binding to PSGL-1 [14,43]. While selectins could act as ligands mediating suppression of T-cell activation, it was reported that the immune checkpoint function of PSGL-1 operates independently of P-, E- and L-selectin interactions [22]. Instead, PSGL-1 was found to interact under acidic conditions, with the V-domain immunoglobulin suppressor of T-cell activation (VISTA) protein, a known suppressor of T-cell activity [44,45]. Further studies are needed to determine whether PL1 blocks PSGL-1 binding to VISTA or other potential ligands responsible for suppressing T-cell activity.\u003c/p\u003e \u003cp\u003eIn summary, our findings demonstrate that PSGL-1 inactivation, through gene editing or blocking antibodies, enhances T cell activation in response to lymphoma cells. These results underscore the potential of targeting PSGL-1 as an immunotherapeutic strategy in treating this type of cancer. We recently reported that the PL1 antibody could induce apoptosis of T and B lymphoma cell lines expressing PSGL-1 [46]. This killing action was not universal in that not all B-cell lymphoma cell lines were vulnerable to PL1 targeting. Although in this report the A20 cell line and the six primary lymphoma cell samples did not undergo significant cell death upon incubation with anti-PSGL-1, our earlier and current findings indicate that targeting PSGL-1 could serve a dual purpose in lymphoma therapy: it may induce apoptosis of lymphoma cells [46] while simultaneously enhancing the effector function of T cells.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eCompeting Interests\u003c/h2\u003e \u003cp\u003eWe declare no competing financial interests in relation to the work described.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAuthor Contributions\u003c/h2\u003e \u003cp\u003eJLP and NRS designed this research study. JCM and NRS supervised this study. JLP, AM, RFS and NRS were involved in designing the experiments. JLP, FF and AM performed the research. JLP, FF and NRS analyzed data. JLP, JCM and NRS interpreted the results. DP provided human lymphoma biopsies. AM and JLP processed the human lymphoma samples. DP, AMC, MJO and JCM provided multiple reagents. JLP and NRS wrote the manuscript and AMC, MJO and JCM edited the manuscript. All authors contributed to the preparation of the manuscript and approved the submitted version.\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e \u003cp\u003eWe thank members of the Intercellular Communication and Cancer Group (i3S, Porto) for fruitful discussions that contributed for this research. We thank Ivette Pacheco-Leyva and Liliana Oliveira (i3S, Porto) for technical expertise and M\u0026aacute;rio Sousa Pimenta (IPO-Porto, Porto) for providing insightful clinical knowledge. The authors acknowledge the support of the Animal Facility, Cell Culture and Genotyping, Translational Cytometry and Histology and Electron Microscopy (member of the national infrastructure PPBI - Portuguese Platform of Bioimaging; PPBI-POCI-01-0145-FEDER-022122) i3S Scientific Platforms. This work was supported by grants from Gilead Sciences Portugal (\u003cem\u003ePrograma Gilead G\u0026Eacute;NESE\u003c/em\u003e ref. no. PGG/038/2017), and \u003cem\u003eAssocia\u0026ccedil;\u0026atilde;o Portuguesa Contra a Leucemia\u003c/em\u003e (APCL) in partnership with Sociedade Portuguesa de Hematologia (SPH) and Gilead Sciences Portugal, by \u003cem\u003eFunda\u0026ccedil;\u0026atilde;o para a Ci\u0026ecirc;ncia e a Tecnologia\u003c/em\u003e (FCT; Portugal), in the framework of the project \u003cem\u003eFinanciamento Plurianual de Unidades de I\u0026amp;D\u003c/em\u003e (UIBD/04293/2020), by \u003cem\u003ePrograma Operacional Regional do Norte by European Regional Development Fund\u003c/em\u003e (ERDF), under the project \u0026ldquo;The Porto Comprehensive Cancer Center\u0026rdquo;, with the reference NORTE-01-0145-FEDER-072678 - Cons\u0026oacute;rcio PORTO.CCC \u0026ndash; Porto.Comprehensive Cancer Center, and European Social Fund and ERDF (NORTE-01-0145-FEDER-000029 and POCI-01-0145-FEDER-007274). J.L.P. was supported by an FCT fellowship (SFRH/BD/147979/2019) and N.R.S. by an FCT CEEC contract (CEECINST/00091/2018/CP1500/CT0020).\u003c/p\u003e\u003ch2\u003eData Availability Statement\u003c/h2\u003e \u003cp\u003eThe datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eArmitage JO, Gascoyne RD, Lunning MA, Cavalli F. Non-hodgkin lymphoma. Lancet 2017;390:298\u0026ndash;310. https://doi.org/10.1093/oso/9780190238667.003.0040.\u003c/li\u003e\n\u003cli\u003eAnsell SM. Hodgkin lymphoma: 2018 update on diagnosis, risk-stratification, and management. Am J Hematol 2018;93:704\u0026ndash;15. https://doi.org/10.1002/ajh.25071.\u003c/li\u003e\n\u003cli\u003eMichot JM, Lazarovici J, Ghez D, Danu A, Ferm\u0026eacute; C, Bigorgne A, et al. Challenges and perspectives in the immunotherapy of Hodgkin lymphoma. Eur J Cancer 2017;85:67\u0026ndash;77. https://doi.org/10.1016/j.ejca.2017.08.014.\u003c/li\u003e\n\u003cli\u003eLulla P, Heslop HE. Checkpoint inhibition and cellular immunotherapy in lymphoma. Hematology 2016;2016:390\u0026ndash;6. https://doi.org/10.1182/asheducation-2016.1.390.\u003c/li\u003e\n\u003cli\u003eMerryman RW, Armand P, Wright KT, Rodig SJ. Checkpoint blockade in Hodgkin and non-Hodgkin lymphoma. Blood Adv 2017;1:2643\u0026ndash;54. https://doi.org/10.1182/bloodadvances.2017012534.\u003c/li\u003e\n\u003cli\u003eMatsuki E, Younes A. Checkpoint Inhibitors and Other Immune Therapies for Hodgkin and Non-Hodgkin Lymphoma. Curr Treat Options Oncol 2016;17. https://doi.org/10.1007/s11864-016-0401-9.\u003c/li\u003e\n\u003cli\u003eKline J, Godfrey J, Ansell SM. The immune landscape and response to immune checkpoint blockade therapy in lymphoma. Blood 2020;135:523\u0026ndash;33. https://doi.org/10.1182/blood.2019000847.\u003c/li\u003e\n\u003cli\u003eTarekegn K, Ramosa AC, Singh B, Sequeira Grossa HG, Gupta S. Checkpoint Inhibitors in Relapsed/Refractory Classical Hodgkin Lymphoma. World J Oncol 2021;12:51\u0026ndash;4. https://doi.org/10.14740/wjon1388.\u003c/li\u003e\n\u003cli\u003eXie W, Medeiros LJ, Li S, Yin CC, Khoury JD, Xu J. PD-1/PD-L1 Pathway and Its Blockade in Patients with Classic Hodgkin Lymphoma and Non-Hodgkin Large-Cell Lymphomas. Curr Hematol Malig Rep 2020;15:372\u0026ndash;81. https://doi.org/10.1007/s11899-020-00589-y.\u003c/li\u003e\n\u003cli\u003eHawkes EA, Grigg A, Chong G. Programmed cell death-1 inhibition in lymphoma. Lancet Oncol 2015;16:e234\u0026ndash;45. https://doi.org/10.1016/S1470-2045(15)70103-8.\u003c/li\u003e\n\u003cli\u003eAndorsky DJ, Yamada RE, Said J, Pinkus GS, Betting DJ, Timmerman JM. Programmed death ligand 1 is expressed by non-Hodgkin lymphomas and inhibits the activity of tumor-associated T cells. Clinical Cancer Research 2011;17:4232\u0026ndash;44. https://doi.org/10.1158/1078-0432.CCR-10-2660.\u003c/li\u003e\n\u003cli\u003eMoore KL, Stults NL, Diaz S, Smith DF, Cummings RD, Varki A, et al. Identification of a specific glycoprotein ligand for P-selectin (CD62) on myeloid cells. Journal of Cell Biology 1992;118:445\u0026ndash;56. https://doi.org/10.1083/jcb.118.2.445.\u003c/li\u003e\n\u003cli\u003eGuyer DA, Moore KL, Lynam EB, Schammel CMG, Rogelj S, McEver RP, et al. P-selectin glycoprotein ligand-1 (PSGL-1) is a ligand for L-selectin in neutrophil aggregation. Blood 1996;88:2415\u0026ndash;21. https://doi.org/10.1182/blood.v88.7.2415.bloodjournal8872415.\u003c/li\u003e\n\u003cli\u003eMoore KL, Patel KD, Bruehl RE, Fugang L, Johnson DA, Lichenstein HS, et al. P-selectin glycoprotein ligand-1 mediates rolling of human neutrophils on P-selectin. Journal of Cell Biology 1995;128:661\u0026ndash;71. https://doi.org/10.1083/jcb.128.4.661.\u003c/li\u003e\n\u003cli\u003eLaszik Z, Jansen P, Cummings R, Tedder T, McEver R, Moore K. P-selectin glycoprotein ligand-1 is broadly expressed in cells of myeloid, lymphoid, and dendritic lineage and in some nonhematopoietic cells. Blood 1996;88:3010\u0026ndash;21. https://doi.org/10.1182/blood.V88.8.3010.bloodjournal8883010.\u003c/li\u003e\n\u003cli\u003eWilkins PP, Moore KL, McEver RP, Cummings RD. Tyrosine sulfation of P-selectin glycoprotein ligand-1 is required for high affinity binding to P-selectin. Journal of Biological Chemistry 1995;270:22677\u0026ndash;80. https://doi.org/10.1074/jbc.270.39.22677.\u003c/li\u003e\n\u003cli\u003eWalcheck B, Moore KL, McEver RP, Kishimoto TK. Neutrophil-neutrophil interactions under hydrodynamic shear stress involve L-selectin and PSGL-1: A mechanism that amplifies initial leukocyte accumulation on P-selectin in vitro. Journal of Clinical Investigation 1996;98:1081\u0026ndash;7. https://doi.org/10.1172/JCI118888.\u003c/li\u003e\n\u003cli\u003eBorges E, Pendl G, Eytner R, Steegmaier M, Z\u0026ouml;llner O, Vestweber D. The binding of T cell-expressed P-selectin glycoprotein ligand-1 to E- and P-selectin is differentially regulated. Journal of Biological Chemistry 1997;272:28786\u0026ndash;92. https://doi.org/10.1074/jbc.272.45.28786.\u003c/li\u003e\n\u003cli\u003eMartinez M, Joffraud M, Giraud S, Ba\u0026iuml;sse B, Bernimoulin MP, Schapira M, et al. Regulation of PSGL-1 interactions with L-selectin, P-selectin, and E-selectin: Role of human fucosyltransferase-IV and -VII. Journal of Biological Chemistry 2005;280:5378\u0026ndash;90. https://doi.org/10.1074/jbc.M410899200.\u003c/li\u003e\n\u003cli\u003eMatsumoto M, Miyasaka M, Hirata T. P-Selectin Glycoprotein Ligand-1 Negatively Regulates T-Cell Immune Responses. The Journal of Immunology 2009;183:7204\u0026ndash;11. https://doi.org/10.4049/jimmunol.0902173.\u003c/li\u003e\n\u003cli\u003eVeerman KM, Carlow DA, Shanina I, Priatel JJ, Horwitz MS, Ziltener HJ. PSGL-1 Regulates the Migration and Proliferation of CD8+ T Cells under Homeostatic Conditions. The Journal of Immunology 2012;188:1638\u0026ndash;46. https://doi.org/10.4049/jimmunol.1103026.\u003c/li\u003e\n\u003cli\u003eTinoco R, Carrette F, Barraza ML, Otero DC, Maga\u0026ntilde;a J, Bosenberg MW, et al. PSGL-1 is an immune checkpoint regulator that promotes T cell exhaustion. Immunity 2016;44:1190\u0026ndash;203. https://doi.org/10.1016/j.immuni.2016.04.015.PSGL-1.\u003c/li\u003e\n\u003cli\u003eTinoco R, Neubert EN, Stairiker CJ, Henriquez ML, Bradley LM. PSGL-1 Is a T Cell Intrinsic Inhibitor That Regulates Effector and Memory Differentiation and Responses During Viral Infection. Front Immunol 2021;12:1\u0026ndash;13. https://doi.org/10.3389/fimmu.2021.677824.\u003c/li\u003e\n\u003cli\u003eViramontes KM, Neubert EN, DeRogatis JM, Tinoco R. PD-1 Immune Checkpoint Blockade and PSGL-1 Inhibition Synergize to Reinvigorate Exhausted T Cells. Front Immunol 2022;13. https://doi.org/10.3389/fimmu.2022.869768.\u003c/li\u003e\n\u003cli\u003eDeRogatis JM, Viramontes KM, Neubert EN, Henriquez ML, Guerrero-Juarez CF, Tinoco R. Targeting the PSGL-1 Immune Checkpoint Promotes Immunity to PD-1\u0026ndash;Resistant Melanoma. Cancer Immunol Res 2022:OF1\u0026ndash;14. https://doi.org/10.1158/2326-6066.cir-21-0690.\u003c/li\u003e\n\u003cli\u003eKauffman K, Manfra D, Nowakowska D, Zafari M, Nguyen PA, Phennicie R, et al. PSGL-1 Blockade Induces Classical Activation of Human Tumor-Associated Macrophages. Cancer Research Communications 2023. https://doi.org/10.1158/2767-9764.\u003c/li\u003e\n\u003cli\u003eCardoso MS, Santos RF, Almeida S, S\u0026aacute; M, P\u0026eacute;rez-Cabezas B, Oliveira L, et al. Physical Interactions With Bacteria and Protozoan Parasites Establish the Scavenger Receptor SSC4D as a Broad-Spectrum Pattern Recognition Receptor. Front Immunol 2021;12. https://doi.org/10.3389/fimmu.2021.760770.\u003c/li\u003e\n\u003cli\u003evan Kuppeveld FJ, van der Logt JT, Angulo AF, van Zoest MJ, Quint WG, Niesters HG, et al. Genus- and species-specific identification of mycoplasmas by 16S rRNA amplification. Appl Environ Microbiol 1992;58:2606\u0026ndash;15. https://doi.org/10.1128/aem.58.8.2606-2615.1992.\u003c/li\u003e\n\u003cli\u003eConcordet JP, Haeussler M. CRISPOR: Intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens. Nucleic Acids Res 2018;46:W242\u0026ndash;5. https://doi.org/10.1093/nar/gky354.\u003c/li\u003e\n\u003cli\u003eYang J, Hirata T, Croce K, Merrill-Skoloff G, Tchernychev B, Williams E, et al. Targeted gene disruption demonstrates that P-selectin glycoprotein ligand 1 (PSGL-1) is required for P-selectin-mediated but not E-selectin-mediated neutrophil rolling and migration. J Exp Med 1999;190:1769\u0026ndash;82. https://doi.org/10.1084/jem.190.12.1769.\u003c/li\u003e\n\u003cli\u003eLynne S. Dunsford, Rosie H. Thoirs, Emma Rathbone, Agapitos Patakas. A Human In Vitro T Cell Exhaustion Model for Assessing Immuno-Oncology Therapies. In: Seng-Lai Tan, editor. Methods in Pharmacology and Toxicology, vol. Immuno-Oncology, New York: Humana; 2020, p. 91\u0026ndash;2.\u003c/li\u003e\n\u003cli\u003ePereira JL, Cavaco P, da Silva RC, Pacheco-Leyva I, Mereiter S, Pinto R, et al. P-selectin glycoprotein ligand 1 promotes T cell lymphoma development and dissemination. Transl Oncol 2021;14:101125. https://doi.org/10.1016/j.tranon.2021.101125.\u003c/li\u003e\n\u003cli\u003eAbraham RT, Weiss A. Jurkat T cells and development of the T-cell receptor signalling paradigm. Nat Rev Immunol 2004;4:301\u0026ndash;8. https://doi.org/10.1038/nri1330.\u003c/li\u003e\n\u003cli\u003eThatte A, Ficarro S, Snapp KR, Wild MK, Vestweber D, Hunt DF, et al. Binding of function-blocking mAbs to mouse and human P-selectin glycoprotein ligand-1 peptides with and without tyrosine sulfation. J Leukoc Biol 2002;72:470\u0026ndash;7. https://doi.org/10.1189/jlb.72.3.470.\u003c/li\u003e\n\u003cli\u003eMcLane LM, Abdel-Hakeem MS, Wherry EJ. CD8 T Cell Exhaustion During Chronic Viral Infection and Cancer. Annu Rev Immunol 2019;37:457\u0026ndash;95. https://doi.org/10.1146/annurev-immunol-041015-055318.\u003c/li\u003e\n\u003cli\u003eBezman NA, Jhatakia A, Kearney AY, Brender T, Maurer M, Henning K, et al. PD-1 blockade enhances elotuzumab efficacy in mouse tumor models. Blood Adv 2017;1:753\u0026ndash;65. https://doi.org/10.1182/bloodadvances.2017004382.\u003c/li\u003e\n\u003cli\u003eHope JL, Otero DC, Bae EA, Stairiker CJ, Palete AB, Faso HA, et al. PSGL-1 attenuates early TCR signaling to suppress CD8+ T cell progenitor differentiation and elicit terminal CD8+ T cell exhaustion. Cell Rep 2023;42. https://doi.org/10.1016/j.celrep.2023.112436.\u003c/li\u003e\n\u003cli\u003eSaule P, Trauet J, Dutriez V, Lekeux V, Dessaint JP, Labalette M. Accumulation of memory T cells from childhood to old age: Central and effector memory cells in CD4+ versus effector memory and terminally differentiated memory cells in CD8+ compartment. Mech Ageing Dev 2006;127:274\u0026ndash;81. https://doi.org/10.1016/j.mad.2005.11.001.\u003c/li\u003e\n\u003cli\u003eUrzainqui A, Serrador JM, Viedma F, Y\u0026aacute;\u0026ntilde;ez-M\u0026oacute; M, Rodrı́guez A, Corbı́ AL, et al. ITAM-Based Interaction of ERM Proteins with Syk Mediates Signaling by the Leukocyte Adhesion Receptor PSGL-1. Immunity 2002;17:401\u0026ndash;12. https://doi.org/10.1016/S1074-7613(02)00420-X.\u003c/li\u003e\n\u003cli\u003eSerrador JM, Urzainqui A, Alonso-Lebrero JL, Cabrero JR, Montoya MC, Vicente-Manzanares M, et al. A juxta-membrane amino acid sequence of P-selectin glycoprotein ligand-1 is involved in moesin binding and ezrin/radixin/moesin-directed targeting at the trailing edge of migrating lymphocytes. Eur J Immunol 2002;32:1560\u0026ndash;6. https://doi.org/10.1002/1521-4141(200206)32:6\u0026lt;1560::AID-IMMU1560\u0026gt;3.0.CO;2-U.\u003c/li\u003e\n\u003cli\u003eIlani T, Khanna C, Zhou M, Veenstra TD, Bretscher A. Immune synapse formation requires ZAP-70 recruitment by ezrin and CD43 removal by moesin. J Cell Biol 2007;179:733\u0026ndash;46. https://doi.org/10.1083/jcb.200707199.\u003c/li\u003e\n\u003cli\u003eTinoco R, Otero DC, Takahashi AA, Bradley LM. PSGL-1: A New Player in the Immune Checkpoint Landscape. Trends Immunol 2017;38:323\u0026ndash;35. https://doi.org/10.1016/j.it.2017.02.002.\u003c/li\u003e\n\u003cli\u003eLi F, Erickson HP, James JA, Moore KL, Cummings RD, McEver RP. Visualization of P-selectin glycoprotein ligand-1 as a highly extended molecule and mapping of protein epitopes for monoclonal antibodies. J Biol Chem 1996;271:6342\u0026ndash;8. https://doi.org/10.1074/jbc.271.11.6342.\u003c/li\u003e\n\u003cli\u003eJohnston RJ, Su LJ, Pinckney J, Critton D, Boyer E, Krishnakumar A, et al. VISTA is an acidic pH-selective ligand for PSGL-1. Nature 2019;574:565\u0026ndash;70. https://doi.org/10.1038/s41586-019-1674-5.\u003c/li\u003e\n\u003cli\u003eYuan D, Zhang Y, Liu W, He X, Chen W, Liu L, et al. Transcriptome profiling reveals transcriptional regulation of VISTA in T cell activation. Mol Immunol 2023;157:101\u0026ndash;11. https://doi.org/10.1016/j.molimm.2023.03.021.\u003c/li\u003e\n\u003cli\u003ePereira JL, Ferreira F, dos Santos NR. Antibody targeting of surface P‐selectin glycoprotein ligand 1 leads to lymphoma apoptosis and tumorigenesis inhibition. Hematol Oncol 2024;42. https://doi.org/10.1002/hon.3257.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"leukemia","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"leu","sideBox":"Learn more about [Leukemia](http://www.nature.com/leu/)","snPcode":"41375","submissionUrl":"https://mts-leu.nature.com/cgi-bin/main.plex","title":"Leukemia","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-4018077/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4018077/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eDespite advancements in cancer immunotherapy, most lymphomas remain unresponsive to checkpoint inhibitors. P-selectin glycoprotein ligand-1 (PSGL-1), recently identified as a promoter of T cell exhaustion in melanoma murine models, has emerged as a novel immune checkpoint protein and promising immunotherapeutic target. In this study, we investigated the potential of PSGL-1 antibody targeting in B-cell lymphoma. Using allogeneic coculture systems, we demonstrated that targeted antibody interventions against human PSGL-1 resulted in enhancement of T cell activation and effector cytokine production in response to lymphoma cells. Moreover, \u003cem\u003ein vitro\u003c/em\u003e treatment of primary lymphoma cell suspensions with PSGL-1 antibody resulted in increased activation of autologous lymphoma-infiltrating T cells. Finally, using a syngeneic B-cell lymphoma mouse model, we found that PSGL-1 antibody treatment significantly slowed tumor development and reduced endpoint tumor burden. This anti-tumoral action was accompanied by augmented tumor infiltration with CD4\u003csup\u003e+\u003c/sup\u003e and CD8\u003csup\u003e+\u003c/sup\u003e T cells and reduced infiltration with regulatory T cells. These results demonstrate that PSGL-1 antibody blockade bolsters T-cell activity against B-cell lymphoma, suggesting a potential novel immunotherapeutic approach to treat these malignancies.\u003c/p\u003e","manuscriptTitle":"Antibody blockade of the PSGL-1 immune checkpoint enhances T-cell responses to B-cell lymphoma","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-11 09:42:39","doi":"10.21203/rs.3.rs-4018077/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2024-05-20T13:19:48+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2024-05-19T09:58:16+00:00","index":3,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2024-05-19T09:18:25+00:00","index":3,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2024-05-18T16:14:31+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2024-03-22T10:03:24+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2024-03-15T11:41:03+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2024-03-07T10:53:17+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-03-06T10:38:07+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-03-06T10:37:30+00:00","index":"","fulltext":""},{"type":"submitted","content":"Leukemia","date":"2024-03-05T16:49:54+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"leukemia","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"leu","sideBox":"Learn more about [Leukemia](http://www.nature.com/leu/)","snPcode":"41375","submissionUrl":"https://mts-leu.nature.com/cgi-bin/main.plex","title":"Leukemia","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"1aae1952-e691-4d6f-9ff8-4e14c652b5b4","owner":[],"postedDate":"March 11th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":29190800,"name":"Biological sciences/Cancer/Haematological cancer/Lymphoma/Non-hodgkin lymphoma/B-cell lymphoma"},{"id":29190801,"name":"Biological sciences/Cancer/Cancer therapy/Cancer immunotherapy"}],"tags":[],"updatedAt":"2024-10-26T07:05:22+00:00","versionOfRecord":{"articleIdentity":"rs-4018077","link":"https://doi.org/10.1038/s41375-024-02446-w","journal":{"identity":"leukemia","isVorOnly":false,"title":"Leukemia"},"publishedOn":"2024-10-25 04:00:00","publishedOnDateReadable":"October 25th, 2024"},"versionCreatedAt":"2024-03-11 09:42:39","video":"","vorDoi":"10.1038/s41375-024-02446-w","vorDoiUrl":"https://doi.org/10.1038/s41375-024-02446-w","workflowStages":[]},"version":"v1","identity":"rs-4018077","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4018077","identity":"rs-4018077","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.