First Time Morphological and Molecular Isolation of Epicoccum sorghinum Pathogenicity in the Cassava Brown Leaf Spot Disease in Kenya

First Time Morphological and Molecular Isolation of Epicoccum sorghinum Pathogenicity in the Cassava Brown Leaf Spot Disease in Kenya | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article First Time Morphological and Molecular Isolation of Epicoccum sorghinum Pathogenicity in the Cassava Brown Leaf Spot Disease in Kenya Ephine Awuor Onyango, Sarah Naulikha Kituyi, Carol Wangui Hunja, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4228831/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Cassava brown leaf spot (BLS) is among the most damaging diseases that significantly reduce cassava root yields. There has been need to find varieties resistant or tolerant to BLS. Hence, in this study drought-resistant cassava varieties were being agronomically screened in an experimental farm in Kitui County-Kenya. One variety in the plots, commonly referred to as Kasukari, was found to exhibit abnormal morphological aberrations whose cause necessitated systematic studies. Morphological, microscopic and DNA molecular identification techniques were applied on the isolates to identify the causal agent(s). 162 samples of the Kasukari variety were used to determine the prevalence and severity of the disease, while 15 samples were used to determine effects of the disease in the plots. The prevalence within the plots had no significant difference (ꭓ2 = 6, p -value = 0.1991). However, there was significant difference in the severity (ꭓ2 = 53.013, p -value = 1.166e-09). Pathogenicity tests of ten isolates were conducted in vitro whereby the spore suspension was made from each isolate and inoculated in detached fresh Kasukari variety leaves. Polymerase chain reaction performed by the universal primer, internal transcribed spacer (ITS) marker identified Alternaria sp, Epiccocum sp, Preussia sp, and Cladosporium sp. However, it was the Epiccocum sp that was reisolated from the reinfected Kasukari Cassava variety and hence confirmed as the main causal agent. Mycological keys found this fungus to be Epicoccum sorghinum. This is the first time for E . sorghinum to be associated with BLS in Kenya. Morphologically, the disease distorted leaves and reduced root quality. This infection necessitates further enriching and screening of the cassava genome for more resistant and tolerant varieties especially in light of the climate change phenomenon. Fungus Brown Streak Root tuber Food Security Climate change Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Introduction Cassava has been reported to be infected by different fungal infections such as brown leaf spot (BLS), white leaf spot, cassava anthracnose disease (CAD) and root rot disease. In China, BLS has been shown to be caused by Cercospora henningsii Allesch [ 1 ]. [ 2 ]identified Cercospora as the causative agent of BLS in Asia. However, in Kenya, BLS has been shown to be caused by the fungi from genera Alternaria , Cladosporium and Colletotrichum , working in synergy to cause the disease [ 3 ]. Brown leaf spot leads to losses in root yield due to the extensive defoliation of the plants [ 4 ]. The appearance of few to several brown spots on the upper surface of leaves of diseased cassava varieties is the key symptom of brown leaf spot disease [ 5 ]. Onset of white leaf spot disease caused by Cercospora sp. is characterized by circular-chlorotic regions observed on the upper lamina which later leads to formation of small white circular lesions that range in size from 1 to 7 mm and can take on a round or angular appearance [ 6 ]. Cassava anthracnose disease (CAD) caused by Collectotricum gloeosporides is characterized by the development of cankers or sore-like features on the stem [ 7 ]. Root rot disease caused by Polyporus sulphureus , a parasitic mushroom, has been reported to be attacking cassava plants repeatedly [ 8 ]. The growth and yield of cassava are impacted by biotic constraints among which pathogenic diseases are of significance [ 9 ]. Furthermore, early identification of the disease in the field is a critical initial step in managing the detection and distribution of cassava leaf diseases [ 10 ]. However, less is known about the identity of pathogens associated to the brown leaf spot disease observed at the lower eastern part of Kenya where cassava is cultivated to enhance food security owing to the prevailing harsh climatic conditions that do not favour other crops. While agronomically screening drought resistant varieties in this region, one variety in the plots, commonly referred to as Kasukari, was found to exhibit abnormal morphological aberrations whose cause necessitated systematic investigation and hence formed the basis of the current study. MATERIALS AND METHODS Experimental site and plant materials The study was carried out in an experimental site located at the South Eastern Kenya University (SEKU) in Kitui County in Kenya. This county is located between longitudes 37° 50' East and 39° 0' East and latitudes 0° 10' South and 3° 0' South. Kitui experiences semi-arid climatic conditions with about 500 to 1050 mm of annual rainfall. Rainfall is distributed over two rainy seasons; a short one around October, November and December and another long one around March and April. Kitui experiences a varying temperature range between a minimum of 14 to 22°C to a maximum of 26 to 35°C and it is in a sub humid agro-ecological zone. The soil dominant in the area is described as well drained, sandy clay to clay, friable to firm, dark reddish brown to dark yellowish brown, moderately deep with a top soil of loamy sand to sandy loam. The cassava variety used in this research was Kasukari which is a drought resistant cassava that is among the common varieties grown in the South Eastern Kenya region. This variety was of interest since it displayed morphological aberrations that were suggestive of varied disease manifestations. Other varieties in the plot were used as controls as they appeared healthy. Experimental design The experiment was conducted between 2020 and 2023. A randomized complete block design was used to lay out the field experiment. The Kasukari variety was replicated three times within the experimental site, making a total of three Kasukari plots. The plots measured 10 metres by 20 metres with 200 seedlings each and 3 metres paths separating them. The experimental units had 18 rows with a spacing of 1 metre by 1 metre. Weeding was done uniformly in the three plots. A survey was conducted in March 2022 across the experimental farm to assess the prevalence status of the grown cassavas using field observation. Six cassavas were selected from every two lines using a simple random sampling (SRS) method to determine the prevalence of the disease infestation from each block. The data was then collected on the selected cassava. To detect the disease morphologically, the inspection was done on cassava leaves based on symptoms of the disease as described by [ 11 ] in the Pacific Pests and Pathogen Fact Sheets and as described by [ 12 ]. Prevalence and symptom severity of cassava BLS in the fields Field observations for BLS foliar symptoms were performed in March 2022. Eighteen lines in each plot were grouped into two, forming 9 lines. Data for the prevalence was randomly collected from 6 cassava plants within the 9 lines, totaling to 54 cassavas per plot. The samples were taken from the 3 plots for Kasukari variety, thus totaling to 162 samples for the study. Disease prevalence (%) was calculated by dividing the total number of leaves infected by the total number of leaves observed multiplied by 100 [ 13 ]. The same cassava plants used to collect data on disease prevalence were also used in estimating disease severity. A visual rating scale that was used in the study of the brown leaf spot described by [ 14 ] was used to score for BLS in the randomly selected Kasukari plants where: 1/S1 = traces, 2/S2 = light; 3/S3 = moderate, 4/S4 = severe and 5/S5 = very severe. Yield data and root rot severity Fifteen cassava plants from the three Kasukari plots at Kitui were used. From each Kasukari plot, five cassava plants were uprooted randomly from the ends and middle of the plot and data recorded on morphology. Asymptomatic bitter cassava roots were included as a control. The uprooted roots were investigated for signs of root necrosis by cutting a total of four roots per plant longitudinally. Severity of root damage was scored using a scale of 1–5 as described by [ 15 ] where:1 = no necrosis symptom; 2 = traces of necrosis); 3 = clearly defined areas of necrosis but necrotic areas can be easily removed; 4 = most of root necrotic but may still be possible to be removed for home consumption and 5 = most or all of root is necrotic and unsuitable for human consumption. Sampling and fungal isolation Lesions from diseased cassava leaves (Fig. 1 A) were cut into small pieces and surface sterilized using 1.3% bleach for 30 mins and rinsed with two changes of sterile distilled water for 1 min. The cut sections were left to air dry, then grown on a sterile Potato Dextrose Agar (PDA) medium containing streptomycin (Fig. 1 B) and incubated at room temperature in a dark room. The control was made by spreading the last rinse water using a sterile needle onto a sterile PDA medium (Fig. 1 C). Both morphological and cultural characteristics of pure fungal isolates were used for fungal identification as guided by previous studies performed by experts in pathology in the identification manuals by [ 16 , 17 , 18 ]. Morphological identification of fungal isolates For morphological characterization, slides were prepared from pure colonies, and observed under a light microscope (Leica DM5OO). A little piece of mycelia from each colony was taken and a drop of lactophenol cotton blue dye placed on a sterilized glass slide using a sterile isolation needle. The mycelia were then entirely covered with a clean cover slip that was gently placed on top. For every sample, this process was repeated while sterilizing the needle. Each colony was first observed with a x10 objective lens, and subsequently at a higher magnification of x40. Observed microscopic characteristics comprised of the type of hypha; septate or aseptate, and type of spore. Molecular identification of fungal isolates DNA extraction CTAB-SDS method described by [ 19 ] was used. CTAB extraction buffer (0.2 M EDTA (pH 8), 1.4 M NaCl, 100 mM Tris-HCl (pH 8), 2% (w/v) CTAB and 4% (w/v) PVP) was preheated in a water bath for 15 minutes at 60°C. Mycelia and spores of fungal cultures were scrapped off the PDA medium and placed in a centrifuge tube. In the presence of prewarmed CTAB extraction buffer and 1% PVP, 200 mg of mycelia and spores were ground at room temperature using pre-chilled rods. The homogenate was incubated at 60°C in a water bath for an hour. The tubes were centrifuged at 4°C for ten minutes at 10000 rpm and the supernatant transferred into new tubes. Samples were mixed for fifteen minutes by inversion after adding same amount of chloroform: isoamyl alcohol (24:1). The tubes were then centrifuged at 4°C for ten minutes at 10000 rpm. This step was repeated and supernatant decanted then transferred into new microtubes. To precipitate the DNA, chilled isopropanol was added then incubated for thirty minutes at -20°C. To pellet down the DNA, the microtubes were centrifuged for ten minutes at 10000 rpm. 70% ethanol was used to wash the pellet two times by centrifuging for 15mins at 14,000 rpm, then air dried at room temperature. 45µl of nuclease free water was used to dissolve the pellet. RNA was digested by adding 5µl of RNAse to the DNA suspension and incubated at 4°C overnight. The DNA was incubated at 37°C for 30 minutes in a water bath and stored at -20°C for further use. Gel Electrophoresis [ 20 ] procedure was used. A 25-minute run at 100 V with 1 × TE buffer and aliquots of 3 µl of the PCR products on 1% agarose gels (w/v) was used for gel electrophoresis. After being post-stained with the ethidium bromide dye, the gels were examined under an ultraviolet light. Polymerase chain reaction A 25 µl reaction volume containing 5 µl of 10 µm primers, 0.75 µl of 10 mm dNTP, 0.5 µl of 50 mm MgCl2,5 µl of 10× buffer, 0.2 µl of Taq DNA polymerase, and 1 µl of genomic DNA was used for the PCR. The final volume was then adjusted using sterile distilled water [ 21 ]. The internal transcribed spacer (ITS), translation elongation factor (EF1), differentially expressed gene, and chitin synthases genes were amplified with primer pairs of ITS1 (F) (TCCGTAGGTGAACCTGCGG) and ITS4 (R) (TCCTCCGCTTATTGATATGC); EF1-688F (CGGTCACTTGATCTACAAGTGC) and EF1-1251R (CCTCGAACTCACCAGTACCG); GDF (GCCGTCAACGACCCCTTCATTGA) and FDR (GGGTGGAGTCGTACTTGAGCATGT); CHS-79F (TGGGGCAAGGATGCTTGGAAGAAG) and CHS-354R (TGGAAGAACCATCTGTGAGAGTTG). The primer pairs were expected to amplify regions of about 500 and 600 bp. Different primer pairs were used with an aim of amplifying various sections of the DNA, thus enhancing the confidence level of the molecular identification. Sequencing and phylogenetic analysis The amplicons were cleaned and sequenced on the sanger sequencing platform to obtain the nucleotide sequences. The sequences were cleaned and analyzed using the BioEdit analysis software. The ITS sequence for each isolate was blasted on the BLASTn database, and the sequences for the top 10 similar species were obtained for phylogenetic analysis. The sequences were aligned sing the Claustlw alignment tool in MEGA version 11. Phylogenetic trees were generated using the maximum-likelihood model in MEGA11 and edited in FigTree v 1.4.4 software. Pathogenicity of fungal isolates on cassava leaves Using a modified [ 22 ] procedure, the pure fungal isolates were utilized to create spore solution for detached leaf pathogenicity testing. A tiny piece of the innermost fungal mycelia, about 1 centimeter by 1 centimeter, was carefully scraped off of each plate using a sterilized nichrome wire loop. Care was taken to remove as little of the media as possible. One milliliter of sterile distilled water was added to each of the labeled sterile Eppendorf® tubes containing the scraped pieces. To make a suspension, the fungus mycelia were macerated with sterile microfuge pestles. For one minute, the suspension was thoroughly stirred using a vortex mixer. Next, the Eppendorf Minispin® Plus centrifuge was used to centrifuge the Eppendorf® tubes for 15 minutes at 500 rpm. A volume of 500 milliliters of the supernatant was cautiously and aseptically moved to an additional pair of sterile Eppendorf® tubes with the appropriate labels. Both hyphal and spore suspensions were present in these. In order to remove the hyphal fragments and preserve just the conidial suspension, each suspension was strained through a sterile syringe that was connected to a sterile filter with a pore diameter of 10 µm (Tisch Scientific) [ 22 ]. Using a hemocytometer, the spore suspensions' concentration was brought to 106 spores per milliliter of water. In vitro detached leaf pathogenicity test The leaves were detached from a healthy susceptible Kasukari cultivar and used to test for the pathogenicity of all the fungal isolates. The Kasukari cultivar with fully developed and healthy leaves, were detached from the parent plants that were grown and maintained in a greenhouse at the University of Nairobi. The leaves were sterilized by running tap water on them first to get rid of any dirt, then washing them for 30 seconds in 70% ethanol, and finally rinsing them once with sterile distilled water. The leaves were then placed in 1.3% sodium hypochlorite and thereafter subjected to three cycles of washing in sterile distilled water. For controls, the water from each leaf's most recent washing was utilized. Paper towels that were sterile were used to line sterile Petri plates. Using a micropipette, 600 microliters of sterile distilled water was aseptically applied to the paper towels. This was done to make sure that the petri dishes' relative humidity was more than 80%. After the leaves had been sterilized, leaflets were cut from them and distributed at random to petri dishes using a random number generator (RANDOM.ORG - True Random Number Service). With the adaxial leaf surface facing the bottom of the plates, the leaflets were positioned on sterile wire gauzes on top of the paper towels in the petri dishes. Five tiny puncture holes were made transversely along each leaf's equator using sterile inoculating needles. This was done to enable possible fungal pathogen to invade the cuticle of the leaf and produce a disease. In each of the leaf puncture sites, ten microliters of the prepared 106 spores/ml spore suspension were added. Additionally, sterile paper towels were used to line the petri dish covers, and 400 µl of sterile distilled water was used to soak them. Following the inoculation, the leaflets were wrapped in parafilm, sealed, and incubated for seven days at 23 ± 2 ºC with 12 hours of darkness and 12 hours of daylight. Two sets of controls were established with the leaves from Kasukari cultivar and they received the same treatment except the first set of control being inoculated with last rinse water and the second with sterile distilled water. Any inoculated leaves that differed from the features of the control were considered to have been treated with pathogenic fungal isolates. Based on the descriptions provided by [ 23 ], usual symptoms taken into account were chlorosis, necrosis, leaf coloration and leaf discolorations on the affected leaves. Using a random number generator (RANDOM.ORG - True Random Number Service), representative pathogenic isolates of each type of symptom were chosen at random based on the unique symptoms that appeared on leaves following in vitro pathogenicity tests. These particular pathogenic fungal isolates were utilized for morpho-cultural characterization whereby they were inoculated onto new PDA petri dishes from the previously made pure cultures. Data analysis Microsoft Excel was used to summarize the data. R-GUI (version 4.2.2.0) software was used for analysis of Chi-square for BLS prevalence and severity at a confidence interval of p ≤ 0.05. RESULTS Prevalence and severity of BLS on Kasukari germplasm in Kitui experimental farm From the observations, fungal disease infestation was identified upon comparing the symptoms with those found in the Pacific Pests and Pathogen Fact Sheets. Detection and inspection of brown leaf spots was done on the older leaves by checking for the appearance of round and angular light brown spots with yellow margins. Thus, disease infection was identified as brown leaf spot disease (fungal) for all the assessed plants. Few to several brown spots on the upper surface of leaves, especially on old and mature leaves were observed as shown in Fig. 2 (b) and (c) above. In some leaves, the margins were irregular, and the middle of the leaves had small perforations, which further suggested brown leaf spot disease caused by a fungal pathogen. Therefore, the identified infections matched the descriptions in literature for fungal disease presentation in contrast to Fig. 2 (a) illustrating healthy bitter cassava leaves. The dominant weed type was grass, although some oxalis and shrubs were also recorded. Most plants had a white stem covering. Different prevalence levels were obtained in the three randomized blocks. For blocks 18, 9 and 2, there were 27.7%, 32.9%, and 29.4%, respectively. However, these variations were not statistically significant (p-value = 0.1991, ꭓ2 = 6). Similarly, variations in severity scores within the blocks were also found (Fig. 3 ). The differences in this instance, however, were statistically significant (p-value = 1.166e-09, (ꭓ2 = 53.013). Severity of root damage Most Kasukari roots scored a severity of 2 and 3 whereby most part of the root tissue had clearly defined areas of infection and traces respectively. The roots were rotten and smelly with perforations due to degradation of root tissues as shown in Fig. 4 (b, c and d). No Kasukari root was found to be healthy, they each had some traces of root necrosis. Interestingly, the asymptomatic bitter cassava had healthy roots shown by white appearance of the tissue in Fig. 4 a. Morphological characteristics of fungal isolates on PDA medium Ten fungal cultures were obtained. Generally, the fungal colonies were from four genera; Alternaria , Cladosporium , Epicoccum and Preussia . Morphological and cultural characteristics of the four cultures indicated that all the four fungal pathogens had septate hyphae. The identified Epicoccum sp. had colonies of white clusters (Fig. 5 ). The identified Alternaria sps. had muriform conidia , with wooly and gray colonies as shown in Fig. 6 (1a-c) and wooly white colonies with red pigment on the medium as shown in Fig. 6 (2a-c). Cladosporium sp. displayed macro- and microconidia with tapering ends, and the colonies had a velvety to suede-like texture with olive-green colour (Fig. 7 ). Preussia species had colonies of white and brown clusters with irregular margins and ellipsoidal to oval conidia. (Fig. 8). Molecular identification of fungal isolates Polymerase chain reaction performed by a universal primer, internal transcribed spacer (ITS) 1 and 4 sequences, gave the result shown in Fig. 9 below. 1 Kb Plus DNA Ladder was used as a marker for the confirmation of the expected band sizes (500-600bp). Negative (-ve) control containing nuclease free water was used for confirmation that the reaction was correctly performed. Sequencing and phylogenetic analysis The ITS marker identified the 10 isolates as Alternaria sp, Epiccocum sp, Preussia sp, and Cladosporium sp (Fig. 10 ). The GDF: FDR and EF1 primers had a coverage of below 50% and therefore were not used in genetic analysis. Although CHS primer had a coverage of about 75% (Fig. 11 ), it was not used in identification since ITS had a best coverage. Therefore, the isolates were identified using ITS primer since it had a good coverage, nearly 100%. Pathogenicity of fungal isolates on cassava leaves Pathogenicity results delineated 8 isolates as pathogens labelled 1a1,1a2,1c,1d,1b 1e,1f and 6b (Fig. 12 ). The results showed Preussia sp. not producing disease symptom, the inoculated leaves remained the same as controls. The onset of the disease symptom was characterized by enlarged holes which was followed by manifestation of grey lesions on the leaf surface. After 5 days, most inoculated leaves developed necrotic lesions except samples that were inoculated with Preussia sp . As the days progressed, two of the samples that were inoculated with Alternaria sp developed a dark colour around the centre of inoculation. The controls remained symptom free. DISCUSSIONS Cassava has been mainly used as a staple food in arid and semi-arid lands (ASALs) as shown by [ 24 ] with high content in carbohydrates, leaves being a source of minerals, vitamins and proteins. However, cassava leaf diseases remain to be major constraints in production of cassava in Kenya. This study investigated the possible cause, effect and severity of some morphological aberrations observed in the Kasukari cassava variety in experimental farms in Kitui County -Kenya. Data from our study shows BLS as the disease responsible for the observed morphological aberrations in the Kasukari variety. Morphological characteristics identified by microscopy, pathogenicity test together with genetic analysis identified fungal pathogens; Alternaria , Cladosporium and Epicoccum as the root cause of BLS. The isolate identified to be from genera Preussia shown in Fig. 8 was thought to be an associated endophytes since it did not produce any disease symptom. Preussia sp . has been reported to be an associated endophyte of oak tree in Iran [ 25 ]. In a research conducted by [ 26 ], the three pathogens from genera Alternaria , Colletotrichum and Cladosporium were reported to be cooperating to cause BLS on cassava leaves. The identified pathogens in this study are thought to be working in synergy and via interaction as explained by [ 27 ] to generate phytotoxins which play a significant part in the colonization of the plant. The advancing mycelia releases toxins that are responsible for the yellow halo seen around the lesion. Epicoccum sps have been reported to cause brown leaf spot disease in tea in China [ 28 , 29 ]. From this study, it can be said that Epicoccum sps has a varied host range and to the best of our knowledge, this study provides the first identification of this species as a causal agent of BSL in Kenya. There was no significant difference in BLS prevalence across the three Kasukari plots. This potentially suggests that the source of infection was germplasms. Since the germplasm used were the same, if all were infected, then the result would have shown in all the three Kasukari plots which is exactly what was observed in this study. This also concurs with the reports suggesting that BLS occurrence is largely facilitated by infected cuttings in Kenya [ 30 ]. The slight variation in high prevalence of BLS across the blocks potentially depict slight variation in the incidence of infected germplasms used during plantation. High incidence of the disease perpetuated through infected cuttings is dangerous since it can lead to increased severity, incidence and decreased cassava yield if combined with consistent use of diseased planting materials [ 31 ]. High prevalence of BLS infection in Kasukari can cause significant losses to farmers in the arid and semi-arid lands like Kitui. This is because reduced production rate due to diseases and low rainfall can lead to food insecurity in ASALs. For instance, continuous crop failure affects food access and income in Kitui, Kenya, at least once every five seasons [ 32 ]. Since Kasukari is a drought resistant cassava, its farming with effective control of diseases can help to increase both the income and food supply within ASALs as the farmers sell its roots to generate income and consume them as well.Generally, the highest severity scores for BLS disease were 2 (mild/ light) and score 3 (moderate). Few Kasukari plants had traces of BLS leaf symptom. This clearly shows that the number of asymptomatic plants to be selected for planting may be limited by the increased occurrence of diseased cassava plants. On the same note, cuttings or seeds cannot be generated from the severely infected plants [ 31 ]. The severity of Kasukari root damage depicts potential reduction in food supply. Moreover, processors typically reject roots with a necrosis score of 3 or above because they are unfit for processing [ 15 ]. It is essential to note that Kasukari variety produced big roots which is a good agronomic trait. However, BLS infections reduced the quality of the roots. This potentially indicates that Kasukari variety can be promising in increasing food security within arid and semi-arid regions of Kenya if the disease is prevented or eradicated. Brown leaf spot disease significantly affected the growth of Kasukari variety; mainly affecting leaves and storage roots. The infection started from the leaves, causing distortion and defoliation, and then ended in the roots. Moreover, distortion of leaves has been shown to be negatively affecting yield due to too much defoliation [ 4 ]. Depending on the surface area of the leaf affected, farmers can harvest small roots if microbial infection is extreme. Also, 10% of roots scored 5 and these were rotten and smelling. In addition to rotten and smelling roots, [ 33 ] s howed a positive correlation between decrease in storage roots and severity of the symptom. Furthermore, occurrence of the brown leaf spot disease in Kasukari variety in Kitui is a phenomenon that can result to high yield losses in cassava based on the fact that at least each root had a trace of root necrosis and none was identified to be healthy. For example, BLS are responsible for enormous annual losses of cassava in tropics and subtropics [ 9 ]. Additionally, the infection caused by BLS may lead to mycotoxicity and affected cassava thus upon consumption can be poisonous. This can be a threat to Kitui’s economy since significant funding is directed to control of the disease. CONCLUSIONS Our study confirmed that the morphological aberrations observed in the Kasukari variety were as a result of infection by BLS disease. We further determined the prevalence, severity and impact of the diseases on the variety. Brown leaf spot disease pose a great threat in food supply in Kitui county by reducing the quality of the produce, thus reducing food supply. With rotten roots, the produce is rendered unimportant since it cannot be consumed. The study recommends that most farmers within Kitui county practice field sanitation practices, such as burning unhealthy plant parts, and disinfecting farm equipment to minimize the spread of the disease. Such actions might lessen the propagation of the disease across planting seasons and fields as opposed to the use of diseased germplasm. As suggested by [ 34 ], improved farming practices and monitoring of the diseases can decrease the effect of this disease on the plant. As a control mechanism, majority of farmers need to regularly scout for early disease indicators on their farms. There is thus need to accurately inform farmers on the best farming and management practices and create control and eradication programs in order to successfully increase cassava yield in Kenya. However, it is essential to note that the research was conducted when the rains were scanty and the cassava had not been established well, thus the effects of climate change variations might have facilitated the occurrence of the observed diseases. Declarations We confirm that all the authors have read this manuscript and are in agreement with the list of authorship and the sentiments expressed herein. We further confirm that no persons who meet the authorship criteria have been excluded from the list of authors. Ethical Approval The study did not use any human or animal samples and neither were any interviews conducted. Competing Interests The authors declare no competing interests. Authors’ Contributions E.A.O: Proposal writing, data collection, data analysis & manuscript drafting. S.N.K: Supervision, proposal writing & manuscript writing. C.W.H: Proposal writing, funding & manuscript writing. J.N.K: Proposal writing, funding & manuscript writing. E.N.N: Provided laboratory space and equipment; manuscript writing. Corresponding author Correspondence to [email protected] Funding The research; National Research Fund Multidisciplinary Collaborative research 2019/20; Cassava Project number NRF/2/MMC/3 was fully supported by funds from National Research Fund (NRF) Kenya. Availability of data and materials All the data described in this manuscript is readily available for sharing upon request. The datasets generated during the current study are available in the NCBI repository with accession numbers: SUB14295632 Sample_1a1 PP471615 SUB14295632 Sample_1a2 PP471616 SUB14295632 Sample_1b PP471617 SUB14295632 Sample_1c PP471618 SUB14295632 Sample_1d PP471619 SUB14295632 Sample_1e PP471620 SUB14295632 Sample_1f PP471621 SUB14295632 Sample_2a PP471622 SUB14295632 Sample_6b PP471623 SUB14295632 Sample_7a PP471624 References Pei YL, Shi T, Li CP, Liu XB, Cai JM, Huang GX. Distribution and pathogen identification of cassava brown leaf spot in China. Genet Mol Res. 2014;13(2):3461–73. Lozano JC, Booth RH. Diseases of cassava (Manihot esculenta Crantz). PANS Pest Articles News Summaries. 1974;20(1):30–54. Ng’ang’a PW. Identification and Characterization of Causative Agents of Brown Leaf Spot of Cassava and Phenotypic Response of Elite Cassava Genotypes to Infection by the Pathogens. University of Nairobi; 2022. Julião EC, Santana MD, Freitas-Lopes R do, Vieira L, de Carvalho A, J. S. B., Lopes UP. (2020). Reduction of brown leaf spot and changes in the chlorophyll a content induced by fungicides in cassava plants. European Journal of Plant Pathology , 157 (2). McCallum EJ, Anjanappa RB, Gruissem W. Tackling agriculturally relevant diseases in the staple crop cassava (Manihot esculenta). Curr Opin Plant Biol. 2017;38:50–8. Alvarez E, Bellotti AC, Calvert LA, Arias V, López BC, Pineda LF, López B, Llano Rodríguez GA, Cuervo Ibáñez M. (2012). Practical Handbook: For Managing Cassava Diseases, Pests, and Nutritional Disorders. Publicación CIAT No. 378 . Onyeka TJ, Dixon AGO, Ekpo EJA. Field evaluation of root rot disease and relationship between disease severity and yield in cassava. Exp Agric. 2005;41(3):357–63. Moses E. (2010). Development of appropriate strategies to control cassava diseases in Ghana. The Role of Plant Pathology in Food Safety and Food Security , 11–24. Prasad RR, Dean MRU, Alungo B, Chand VV. Prevalence and Incidence of Cassava (Manihot esculenta) Brown Leaf Spot Disease Caused by Cercospora heningsii in Macuata Province, Vanua Levu, Fiji. J Agric Sci. 2021;13(8):91. https://doi.org/10.5539/jas.v13n8p91 . Ramcharan A, Baranowski K, McCloskey P, Ahmed B, Legg J, Hughes DP. Deep learning for image-based cassava disease detection. Front Plant Sci. 2017;8(October):1–7. https://doi.org/10.3389/fpls.2017.01852 . Tsatsia H, Jackson G. (2012). Cassava brown leaf spot. Cassava Brown Leaf Spot, 95 . Saokham K, Hemniam N, Roekwan S, Hunsawattanakul S, Thawinampan J, Siriwan W. (2021). Survey and molecular detection of Sri Lankan cassava mosaic virus in Thailand. PLoS ONE, 16(10), e0252846. Mukhtar, P. T. (n.d.). A survey of okra (Abelmoschus esculentus) in the Punjab province of Pakistan for the determination of prevalence … . Pedrosa AM Jr. EVALUATION OF SEVERAL METHODS OF TAKING DISEASE SEVERITY READINGS FOR CERCOSPORA LEAFSPOT OF PEANUTS. Oklahoma State University; 1975. Hillocks R, Maruthi M, Kulembeka H, Jeremiah S, Alacho F, Masinde E, Ogendo J, Arama P, Mulwa R, Mkamilo G, Kimata B, Mwakanyamale D, Mhone A, Benesi I. Disparity between Leaf and Root Symptoms and Crop Losses Associated with Cassava Brown Streak Disease in Four Countries in Eastern Africa. J Phytopathol. 2016;164(2):86–93. https://doi.org/10.1111/jph.12430 . Humber RA. Fungi: identification. Manual of techniques in insect pathology. Elsevier; 1997. pp. 153–85. Dugan FM, Dugan FM. (2006). The identification of fungi: an illustrated introduction with keys, glossary, and guide to literature . PALESTINE. F. (n.d.). Book Illustrated Genera Of Imperfect Fungi . Osena G, Nyaboga EN, Amugune NO. Rapid and efficient isolation of high quality DNA from cassava (Manihot esculenta crantz) suitable for PCR based downstream applications. Annual Res Rev Biology. 2017;12(2). https://doi.org/10.9734/ARRB/2017/32195 . Valizadeh N, Holasou HA, Mohammadi SA, Khawar KM. A comparison of genomic DNA extraction protocols in Artemisia annua L. for large scale genetic analyses studies. Iran J Sci Technol Trans A: Sci. 2021;45(5):1587–95. Sangpueak R, Phansak P, Buensanteai N. Morphological and molecular identification of Colletotrichum species associated with cassava anthracnose in Thailand. J Phytopathol. 2018;166(2):129–42. Aberkane A, Cuenca-Estrella M, Gomez-Lopez A, Petrikkou E, Mellado E, Monzon A, Rodriguez-Tudela JL. Comparative evaluation of two different methods of inoculum preparation for antifungal susceptibility testing of filamentous fungi. J Antimicrob Chemother. 2002;50(5):719–22. Imathiu SM, Ray RV, Back M, Hare MC, Edwards SG. Fusarium langsethiae pathogenicity and aggressiveness towards oats and wheat in wounded and unwounded in vitro detached leaf assays. Eur J Plant Pathol. 2009;124:117–26. El-Sharkawy MA. Cassava biology and physiology. Plant Mol Biol. 2004;56(4):481–501. Hajizadeh A, Amini J, Abdollahzadeh J. New records of endophytic fungi isolated from oak trees in Kurdistan province (Iran). Rostaniha. 2015;16(1):109–22. Wangari P, Ang NG. (2022). IDENTIFICATION AND CHARACTERIZATION OF CAUSATIVE AGENTS OF BROWN . Peng Y, Li SJ, Yan J, Tang Y, Cheng JP, Gao AJ, Yao X, Ruan JJ, Xu BL. Research progress on phytopathogenic fungi and their role as biocontrol agents. Front Microbiol. 2021;12:670135. Bao XT, Dharmasena DSP, Li DX, Wang X, Jiang SL, Ren YF, Wang DL, Song BA, Chen Z. First report of Epicoccum sorghinum causing leaf spot on tea in China. Plant Dis. 2019;103(12):3282. Yin QX, Jiang SL, Li DX, Huang HL, Wang Y, Wang DL, Chen Z. First report of Epicoccum nigrum causing brown leaf spot in tea in Guizhou Province, China. Plant Dis. 2022;106(1):321. Wangari Ng’ang’a P, Miano DW, Wagacha JM, Kuria P. Identification and characterization of causative agents of brown leaf spot disease of cassava in Kenya. J Appl Biology Biotechnol. 2019;7(6):1–7. Torkpo SK, Gafni Y, Danquah EY, Offei SK. Incidence and severity of cassava mosaic disease in farmer’s fields in Ghana. Ghana J Agricultural Sci. 2018;53:61–71. Omoyo NN, Wakhungu J, Oteng’i S. Effects of climate variability on maize yield in the arid and semi arid lands of lower eastern Kenya. Agric Food Secur. 2015;4(1):1–13. Otim-Nape GW, Shaw MW, Thresh JM. The effects of African cassava mosaic geminivirus on the growth and yield of cassava in Uganda. Tropical Science (United Kingdom; 1994. Legg JP, Owor B, Sseruwagi P, Ndunguru J. Cassava mosaic virus disease in East and Central Africa: epidemiology and management of a regional pandemic. Adv Virus Res. 2006;67:355–418. Additional Declarations No competing interests reported. Supplementary Files Supplementarymaterial1PCRITS.jpg Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4228831","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":290566034,"identity":"04a6f64d-9241-4e7d-bda5-10d99330147c","order_by":0,"name":"Ephine Awuor Onyango","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA4UlEQVRIiWNgGAWjYFACHoYDUBbjAxCXjxQtzAYgLhsxWmCATQJMEtLAL9178HBBhV3ihuO9zyq/5tjJsDEwP3x0A48WyTnnEg7POJOcuOHMcbPbstuSgQ5jMzbOwaPF4EaOwWHeNubcDTfS2G5LbmMGauFhk8anxR6s5V89WEux5LZ6wloMJEBaGg6DtTB+3HaYsBaJO2cMDvMcO14/88wxZmnGbcd52JgJ+IV/do/xZ56aamO+422MH39uq7bnZ29++BifFgYJJDYzOI6Y8SlH18L4g5DqUTAKRsEoGJEAAB2/R4u3ftRxAAAAAElFTkSuQmCC","orcid":"","institution":"University of Embu","correspondingAuthor":true,"prefix":"","firstName":"Ephine","middleName":"Awuor","lastName":"Onyango","suffix":""},{"id":290566035,"identity":"b107252c-2baa-40ef-9ee3-93e7bedeff9e","order_by":1,"name":"Sarah Naulikha Kituyi","email":"","orcid":"","institution":"University of Embu","correspondingAuthor":false,"prefix":"","firstName":"Sarah","middleName":"Naulikha","lastName":"Kituyi","suffix":""},{"id":290566038,"identity":"aa72de56-9868-4c30-b169-7422341c7a29","order_by":2,"name":"Carol Wangui Hunja","email":"","orcid":"","institution":"South Eastern Kenya University","correspondingAuthor":false,"prefix":"","firstName":"Carol","middleName":"Wangui","lastName":"Hunja","suffix":""},{"id":290566040,"identity":"dbd6719b-55a4-44ef-a2b6-7bb1c8ff49fe","order_by":3,"name":"Josphert Ngui Kimatu","email":"","orcid":"","institution":"South Eastern Kenya University","correspondingAuthor":false,"prefix":"","firstName":"Josphert","middleName":"Ngui","lastName":"Kimatu","suffix":""},{"id":290566043,"identity":"c16927d8-f279-48dc-b1d5-b6e6bbecdbd7","order_by":4,"name":"Evans Nyaega Nyaboga","email":"","orcid":"","institution":"University of Nairobi","correspondingAuthor":false,"prefix":"","firstName":"Evans","middleName":"Nyaega","lastName":"Nyaboga","suffix":""}],"badges":[],"createdAt":"2024-04-06 22:29:22","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4228831/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4228831/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":54855760,"identity":"ec20c034-790f-44be-a3e7-911b5c61b6fc","added_by":"auto","created_at":"2024-04-17 17:58:07","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":51587,"visible":true,"origin":"","legend":"\u003cp\u003eIllustration of fungal isolation from a leaf of a symptomatic Kasukari cassava variety plant: A, part of cassava leaf with a brown spot showed with an arrow; B, petri dish containing cut leaf sections grown in PDA medium; C, control containing last rinse water\u003c/p\u003e","description":"","filename":"Picture26.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4228831/v1/b85385b473ccf746162d8df7.jpg"},{"id":54855763,"identity":"c875f56c-9e61-4c4f-9b9a-f679b7b9bc5e","added_by":"auto","created_at":"2024-04-17 17:58:07","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":682497,"visible":true,"origin":"","legend":"\u003cp\u003eImages of samples showing healthy cassava leaves(a) and various diseased leaves (b, c and d) of brown leaf spot disease in the experimental farm at the South Eastern Kenya University (SEKU) in Kitui County.\u003c/p\u003e","description":"","filename":"Picture27.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4228831/v1/fd2186065b595dc0a343da56.jpg"},{"id":54855764,"identity":"f9a61c0a-3347-4b03-bdf2-4c298793c86a","added_by":"auto","created_at":"2024-04-17 17:58:07","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":108933,"visible":true,"origin":"","legend":"\u003cp\u003eBLS severity score within Kasukari plots (plot 18, 9 and 2) in South Eastern Kenya University (SEKU) experimental farm in Kitui County.\u003c/p\u003e","description":"","filename":"Picture28.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4228831/v1/cac3af0258c0c6f51cff83ad.jpg"},{"id":54855761,"identity":"0e4a6419-b5d0-4ec9-a1be-918e0539a75b","added_by":"auto","created_at":"2024-04-17 17:58:07","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":146842,"visible":true,"origin":"","legend":"\u003cp\u003eCassava roots from SEKU (Kitui) experimental farm: (a), sample of asymptomatic bitter cassava tubers; (b, c and d), infected Kasukari tubers, showing root damage\u003c/p\u003e","description":"","filename":"Picture29.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4228831/v1/8f5f023dbf3012919dc85dcb.jpg"},{"id":54855770,"identity":"f2c67de3-e14f-45a2-9181-b1b97382a048","added_by":"auto","created_at":"2024-04-17 17:58:08","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":442120,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eEpicoccum sp.\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eCultural and morphological characteristics of \u003cem\u003eEpicoccum\u003c/em\u003e sp.: (a and b) top and bottom view of culture on PDA medium; (c) septate hyphae\u003c/p\u003e","description":"","filename":"Picture30.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4228831/v1/90321ee80a67906f11e1afb8.jpg"},{"id":54855773,"identity":"8486f32b-cb62-41ef-8da0-9b1ae6be2959","added_by":"auto","created_at":"2024-04-17 17:58:08","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":905090,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eAlternaria \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003esp.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCultural and morphological characteristics of \u003cem\u003eAlternaria\u003c/em\u003e sps.: (1a, 1b) obverse and reverse view of culture on PDA medium respectively; The images (1c, 1d,) show the mature spores.\u003c/p\u003e","description":"","filename":"Picture31.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4228831/v1/adea492f19312cdd138235b4.jpg"},{"id":54855765,"identity":"2e9528e4-8257-470c-ab9b-181e25d8fc54","added_by":"auto","created_at":"2024-04-17 17:58:08","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":977715,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eCladosporium\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003esp.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCultural and morphological characteristics of \u003cem\u003eCladosporium sp\u003c/em\u003e.: (a and b) top and bottom view of culture on PDA medium; (c) Conidiophores bearing conidia; (d) Macro- and micro conidia\u003c/p\u003e","description":"","filename":"Picture32.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4228831/v1/179e89d53ff6c214a5e4157c.jpg"},{"id":54855772,"identity":"62269151-0725-4282-9696-34e05a482438","added_by":"auto","created_at":"2024-04-17 17:58:08","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":534441,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003ePreussia sp.\u003c/strong\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eCultural and morphological characteristics of \u003cem\u003ePreussia sp\u003c/em\u003e. showing obverse (O) and reverse (R) view; hyphal and conidiophores bearing conidia on PDA medium.\u003c/p\u003e","description":"","filename":"Picture33.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4228831/v1/2f93f81813d0fef34181e7e1.jpg"},{"id":54855762,"identity":"a722200a-9756-4724-9264-044b4e51e277","added_by":"auto","created_at":"2024-04-17 17:58:07","extension":"jpg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":40112,"visible":true,"origin":"","legend":"\u003cp\u003ePCR products for \u003cem\u003eAlternaria\u003c/em\u003e, \u003cem\u003eCladosporium\u003c/em\u003e, \u003cem\u003eEpicoccum\u003c/em\u003eand \u003cem\u003ePreussia\u003c/em\u003e sp.\u003c/p\u003e","description":"","filename":"Picture34.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4228831/v1/ee427feeb0c652aa94e61aae.jpg"},{"id":54856553,"identity":"7d6c7b8f-7ee1-4da2-9d4b-218974a2f93c","added_by":"auto","created_at":"2024-04-17 18:06:08","extension":"jpg","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":496055,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic tree showing fungi identification using the ITS maker. The support values of the associated taxa are shown on the branches. The isolates and the identified genus are highlighted in the red color\u003c/p\u003e","description":"","filename":"Picture35.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4228831/v1/05b716421ebb37b0947e5f17.jpg"},{"id":54856552,"identity":"211d80bc-015c-4534-b10d-91fb7699421f","added_by":"auto","created_at":"2024-04-17 18:06:08","extension":"jpg","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":173805,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic tree showing fungi identification using the CHS maker. The support values of the associated taxa are shown on the branches\u003c/p\u003e","description":"","filename":"Picture36.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4228831/v1/501af68393ed2f09e2e33277.jpg"},{"id":54855768,"identity":"4339bef0-af7e-4974-8578-4a3af405cce1","added_by":"auto","created_at":"2024-04-17 17:58:08","extension":"jpg","order_by":12,"title":"Figure 12","display":"","copyAsset":false,"role":"figure","size":1341584,"visible":true,"origin":"","legend":"\u003cp\u003ePathogenicity of the fungal isolates with the controls. \u003cem\u003eAlternaria\u003c/em\u003e sp: 1a1, 1a2, 1c, 1d; \u003cem\u003eCladosporium\u003c/em\u003esp: 1b, 1e, 1f, \u003cem\u003eEpicoccum\u003c/em\u003e sp: 6b; \u003cem\u003ePreussia\u003c/em\u003e sp: 2a, 7a\u003c/p\u003e","description":"","filename":"Picture37.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4228831/v1/ce832d26b3016c5c7eafab09.jpg"},{"id":55265476,"identity":"9108c61b-0023-4112-8bca-fb8c1a939c88","added_by":"auto","created_at":"2024-04-25 02:05:26","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1937811,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4228831/v1/2c067226-3a9f-463f-b273-981274e9476b.pdf"},{"id":54855767,"identity":"7ec7e0dc-7a7e-4f18-b834-81afc4915432","added_by":"auto","created_at":"2024-04-17 17:58:08","extension":"jpg","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":164133,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarymaterial1PCRITS.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4228831/v1/e635627b74c4f712753a403f.jpg"}],"financialInterests":"No competing interests reported.","formattedTitle":"First Time Morphological and Molecular Isolation of Epicoccum sorghinum Pathogenicity in the Cassava Brown Leaf Spot Disease in Kenya","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCassava has been reported to be infected by different fungal infections such as brown leaf spot (BLS), white leaf spot, cassava anthracnose disease (CAD) and root rot disease. In China, BLS has been shown to be caused by \u003cem\u003eCercospora henningsii\u003c/em\u003e Allesch [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]identified \u003cem\u003eCercospora\u003c/em\u003e as the causative agent of BLS in Asia. However, in Kenya, BLS has been shown to be caused by the fungi from genera \u003cem\u003eAlternaria\u003c/em\u003e, \u003cem\u003eCladosporium\u003c/em\u003e and \u003cem\u003eColletotrichum\u003c/em\u003e, working in synergy to cause the disease [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eBrown leaf spot leads to losses in root yield due to the extensive defoliation of the plants [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. The appearance of few to several brown spots on the upper surface of leaves of diseased cassava varieties is the key symptom of brown leaf spot disease [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Onset of white leaf spot disease caused by \u003cem\u003eCercospora sp.\u003c/em\u003e is characterized by circular-chlorotic regions observed on the upper lamina which later leads to formation of small white circular lesions that range in size from 1 to 7 mm and can take on a round or angular appearance [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Cassava anthracnose disease (CAD) caused by \u003cem\u003eCollectotricum gloeosporides\u003c/em\u003e is characterized by the development of cankers or sore-like features on the stem [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Root rot disease caused by \u003cem\u003ePolyporus sulphureus\u003c/em\u003e, a parasitic mushroom, has been reported to be attacking cassava plants repeatedly [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe growth and yield of cassava are impacted by biotic constraints among which pathogenic diseases are of significance [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Furthermore, early identification of the disease in the field is a critical initial step in managing the detection and distribution of cassava leaf diseases [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. However, less is known about the identity of pathogens associated to the brown leaf spot disease observed at the lower eastern part of Kenya where cassava is cultivated to enhance food security owing to the prevailing harsh climatic conditions that do not favour other crops. While agronomically screening drought resistant varieties in this region, one variety in the plots, commonly referred to as Kasukari, was found to exhibit abnormal morphological aberrations whose cause necessitated systematic investigation and hence formed the basis of the current study.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eExperimental site and plant materials\u003c/h2\u003e \u003cp\u003eThe study was carried out in an experimental site located at the South Eastern Kenya University (SEKU) in Kitui County in Kenya. This county is located between longitudes 37\u0026deg; 50' East and 39\u0026deg; 0' East and latitudes 0\u0026deg; 10' South and 3\u0026deg; 0' South. Kitui experiences semi-arid climatic conditions with about 500 to 1050 mm of annual rainfall. Rainfall is distributed over two rainy seasons; a short one around October, November and December and another long one around March and April. Kitui experiences a varying temperature range between a minimum of 14 to 22\u0026deg;C to a maximum of 26 to 35\u0026deg;C and it is in a sub humid agro-ecological zone. The soil dominant in the area is described as well drained, sandy clay to clay, friable to firm, dark reddish brown to dark yellowish brown, moderately deep with a top soil of loamy sand to sandy loam.\u003c/p\u003e \u003cp\u003eThe cassava variety used in this research was Kasukari which is a drought resistant cassava that is among the common varieties grown in the South Eastern Kenya region. This variety was of interest since it displayed morphological aberrations that were suggestive of varied disease manifestations. Other varieties in the plot were used as controls as they appeared healthy.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eExperimental design\u003c/h2\u003e \u003cp\u003eThe experiment was conducted between 2020 and 2023. A randomized complete block design was used to lay out the field experiment. The Kasukari variety was replicated three times within the experimental site, making a total of three Kasukari plots. The plots measured 10 metres by 20 metres with 200 seedlings each and 3 metres paths separating them. The experimental units had 18 rows with a spacing of 1 metre by 1 metre. Weeding was done uniformly in the three plots.\u003c/p\u003e \u003cp\u003eA survey was conducted in March 2022 across the experimental farm to assess the prevalence status of the grown cassavas using field observation. Six cassavas were selected from every two lines using a simple random sampling (SRS) method to determine the prevalence of the disease infestation from each block. The data was then collected on the selected cassava. To detect the disease morphologically, the inspection was done on cassava leaves based on symptoms of the disease as described by [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e] in the Pacific Pests and Pathogen Fact Sheets and as described by [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003ePrevalence and symptom severity of cassava BLS in the fields\u003c/h2\u003e \u003cp\u003eField observations for BLS foliar symptoms were performed in March 2022. Eighteen lines in each plot were grouped into two, forming 9 lines. Data for the prevalence was randomly collected from 6 cassava plants within the 9 lines, totaling to 54 cassavas per plot. The samples were taken from the 3 plots for Kasukari variety, thus totaling to 162 samples for the study. Disease prevalence (%) was calculated by dividing the total number of leaves infected by the total number of leaves observed multiplied by 100 [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe same cassava plants used to collect data on disease prevalence were also used in estimating disease severity. A visual rating scale that was used in the study of the brown leaf spot described by [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e] was used to score for BLS in the randomly selected Kasukari plants where: 1/S1\u0026thinsp;=\u0026thinsp;traces, 2/S2\u0026thinsp;=\u0026thinsp;light; 3/S3\u0026thinsp;=\u0026thinsp;moderate, 4/S4\u0026thinsp;=\u0026thinsp;severe and 5/S5\u0026thinsp;=\u0026thinsp;very severe.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eYield data and root rot severity\u003c/h2\u003e \u003cp\u003eFifteen cassava plants from the three Kasukari plots at Kitui were used. From each Kasukari plot, five cassava plants were uprooted randomly from the ends and middle of the plot and data recorded on morphology. Asymptomatic bitter cassava roots were included as a control. The uprooted roots were investigated for signs of root necrosis by cutting a total of four roots per plant longitudinally. Severity of root damage was scored using a scale of 1\u0026ndash;5 as described by [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] where:1\u0026thinsp;=\u0026thinsp;no necrosis symptom; 2\u0026thinsp;=\u0026thinsp;traces of necrosis); 3\u0026thinsp;=\u0026thinsp;clearly defined areas of necrosis but necrotic areas can be easily removed; 4\u0026thinsp;=\u0026thinsp;most of root necrotic but may still be possible to be removed for home consumption and 5\u0026thinsp;=\u0026thinsp;most or all of root is necrotic and unsuitable for human consumption.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eSampling and fungal isolation\u003c/h2\u003e \u003cp\u003eLesions from diseased cassava leaves (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA) were cut into small pieces and surface sterilized using 1.3% bleach for 30 mins and rinsed with two changes of sterile distilled water for 1 min. The cut sections were left to air dry, then grown on a sterile Potato Dextrose Agar (PDA) medium containing streptomycin (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB) and incubated at room temperature in a dark room. The control was made by spreading the last rinse water using a sterile needle onto a sterile PDA medium (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Both morphological and cultural characteristics of pure fungal isolates were used for fungal identification as guided by previous studies performed by experts in pathology in the identification manuals by [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eMorphological identification of fungal isolates\u003c/h2\u003e \u003cp\u003eFor morphological characterization, slides were prepared from pure colonies, and observed under a light microscope (Leica DM5OO). A little piece of mycelia from each colony was taken and a drop of lactophenol cotton blue dye placed on a sterilized glass slide using a sterile isolation needle. The mycelia were then entirely covered with a clean cover slip that was gently placed on top. For every sample, this process was repeated while sterilizing the needle. Each colony was first observed with a x10 objective lens, and subsequently at a higher magnification of x40. Observed microscopic characteristics comprised of the type of hypha; septate or aseptate, and type of spore.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eMolecular identification of fungal isolates\u003c/h2\u003e \u003cdiv id=\"Sec10\" class=\"Section3\"\u003e \u003ch2\u003eDNA extraction\u003c/h2\u003e \u003cp\u003eCTAB-SDS method described by [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e] was used. CTAB extraction buffer (0.2 M EDTA (pH 8), 1.4 M NaCl, 100 mM Tris-HCl (pH 8), 2% (w/v) CTAB and 4% (w/v) PVP) was preheated in a water bath for 15 minutes at 60\u0026deg;C. Mycelia and spores of fungal cultures were scrapped off the PDA medium and placed in a centrifuge tube. In the presence of prewarmed CTAB extraction buffer and 1% PVP, 200 mg of mycelia and spores were ground at room temperature using pre-chilled rods. The homogenate was incubated at 60\u0026deg;C in a water bath for an hour. The tubes were centrifuged at 4\u0026deg;C for ten minutes at 10000 rpm and the supernatant transferred into new tubes. Samples were mixed for fifteen minutes by inversion after adding same amount of chloroform: isoamyl alcohol (24:1). The tubes were then centrifuged at 4\u0026deg;C for ten minutes at 10000 rpm. This step was repeated and supernatant decanted then transferred into new microtubes. To precipitate the DNA, chilled isopropanol was added then incubated for thirty minutes at -20\u0026deg;C. To pellet down the DNA, the microtubes were centrifuged for ten minutes at 10000 rpm. 70% ethanol was used to wash the pellet two times by centrifuging for 15mins at 14,000 rpm, then air dried at room temperature. 45\u0026micro;l of nuclease free water was used to dissolve the pellet. RNA was digested by adding 5\u0026micro;l of RNAse to the DNA suspension and incubated at 4\u0026deg;C overnight. The DNA was incubated at 37\u0026deg;C for 30 minutes in a water bath and stored at -20\u0026deg;C for further use.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eGel Electrophoresis\u003c/h2\u003e \u003cp\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e] procedure was used. A 25-minute run at 100 V with 1 \u0026times; TE buffer and aliquots of 3 \u0026micro;l of the PCR products on 1% agarose gels (w/v) was used for gel electrophoresis. After being post-stained with the ethidium bromide dye, the gels were examined under an ultraviolet light.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003ePolymerase chain reaction\u003c/h2\u003e \u003cp\u003eA 25 \u0026micro;l reaction volume containing 5 \u0026micro;l of 10 \u0026micro;m primers, 0.75 \u0026micro;l of 10 mm dNTP, 0.5 \u0026micro;l of 50 mm MgCl2,5 \u0026micro;l of 10\u0026times; buffer, 0.2 \u0026micro;l of Taq DNA polymerase, and 1 \u0026micro;l of genomic DNA was used for the PCR. The final volume was then adjusted using sterile distilled water [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. The internal transcribed spacer (ITS), translation elongation factor (EF1), differentially expressed gene, and chitin synthases genes were amplified with primer pairs of ITS1 (F) (TCCGTAGGTGAACCTGCGG) and ITS4 (R) (TCCTCCGCTTATTGATATGC); EF1-688F (CGGTCACTTGATCTACAAGTGC) and EF1-1251R (CCTCGAACTCACCAGTACCG); GDF (GCCGTCAACGACCCCTTCATTGA) and FDR (GGGTGGAGTCGTACTTGAGCATGT); CHS-79F (TGGGGCAAGGATGCTTGGAAGAAG) and CHS-354R (TGGAAGAACCATCTGTGAGAGTTG). The primer pairs were expected to amplify regions of about 500 and 600 bp. Different primer pairs were used with an aim of amplifying various sections of the DNA, thus enhancing the confidence level of the molecular identification.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eSequencing and phylogenetic analysis\u003c/h2\u003e \u003cp\u003eThe amplicons were cleaned and sequenced on the sanger sequencing platform to obtain the nucleotide sequences. The sequences were cleaned and analyzed using the BioEdit analysis software. The ITS sequence for each isolate was blasted on the BLASTn database, and the sequences for the top 10 similar species were obtained for phylogenetic analysis. The sequences were aligned sing the Claustlw alignment tool in MEGA version 11. Phylogenetic trees were generated using the maximum-likelihood model in MEGA11 and edited in FigTree v 1.4.4 software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003ePathogenicity of fungal isolates on cassava leaves\u003c/h2\u003e \u003cp\u003eUsing a modified [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e] procedure, the pure fungal isolates were utilized to create spore solution for detached leaf pathogenicity testing. A tiny piece of the innermost fungal mycelia, about 1 centimeter by 1 centimeter, was carefully scraped off of each plate using a sterilized nichrome wire loop. Care was taken to remove as little of the media as possible. One milliliter of sterile distilled water was added to each of the labeled sterile Eppendorf\u0026reg; tubes containing the scraped pieces. To make a suspension, the fungus mycelia were macerated with sterile microfuge pestles. For one minute, the suspension was thoroughly stirred using a vortex mixer. Next, the Eppendorf Minispin\u0026reg; Plus centrifuge was used to centrifuge the Eppendorf\u0026reg; tubes for 15 minutes at 500 rpm. A volume of 500 milliliters of the supernatant was cautiously and aseptically moved to an additional pair of sterile Eppendorf\u0026reg; tubes with the appropriate labels. Both hyphal and spore suspensions were present in these. In order to remove the hyphal fragments and preserve just the conidial suspension, each suspension was strained through a sterile syringe that was connected to a sterile filter with a pore diameter of 10 \u0026micro;m (Tisch Scientific) [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Using a hemocytometer, the spore suspensions' concentration was brought to 106 spores per milliliter of water.\u003c/p\u003e \u003cp\u003e \u003cb\u003eIn vitro\u003c/b\u003e \u003cb\u003edetached leaf pathogenicity test\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe leaves were detached from a healthy susceptible Kasukari cultivar and used to test for the pathogenicity of all the fungal isolates. The Kasukari cultivar with fully developed and healthy leaves, were detached from the parent plants that were grown and maintained in a greenhouse at the University of Nairobi. The leaves were sterilized by running tap water on them first to get rid of any dirt, then washing them for 30 seconds in 70% ethanol, and finally rinsing them once with sterile distilled water. The leaves were then placed in 1.3% sodium hypochlorite and thereafter subjected to three cycles of washing in sterile distilled water. For controls, the water from each leaf's most recent washing was utilized.\u003c/p\u003e \u003cp\u003ePaper towels that were sterile were used to line sterile Petri plates. Using a micropipette, 600 microliters of sterile distilled water was aseptically applied to the paper towels. This was done to make sure that the petri dishes' relative humidity was more than 80%. After the leaves had been sterilized, leaflets were cut from them and distributed at random to petri dishes using a random number generator (RANDOM.ORG - True Random Number Service). With the adaxial leaf surface facing the bottom of the plates, the leaflets were positioned on sterile wire gauzes on top of the paper towels in the petri dishes. Five tiny puncture holes were made transversely along each leaf's equator using sterile inoculating needles. This was done to enable possible fungal pathogen to invade the cuticle of the leaf and produce a disease.\u003c/p\u003e \u003cp\u003eIn each of the leaf puncture sites, ten microliters of the prepared 106 spores/ml spore suspension were added. Additionally, sterile paper towels were used to line the petri dish covers, and 400 \u0026micro;l of sterile distilled water was used to soak them. Following the inoculation, the leaflets were wrapped in parafilm, sealed, and incubated for seven days at 23\u0026thinsp;\u0026plusmn;\u0026thinsp;2 \u0026ordm;C with 12 hours of darkness and 12 hours of daylight. Two sets of controls were established with the leaves from Kasukari cultivar and they received the same treatment except the first set of control being inoculated with last rinse water and the second with sterile distilled water. Any inoculated leaves that differed from the features of the control were considered to have been treated with pathogenic fungal isolates. Based on the descriptions provided by [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], usual symptoms taken into account were chlorosis, necrosis, leaf coloration and leaf discolorations on the affected leaves.\u003c/p\u003e \u003cp\u003eUsing a random number generator (RANDOM.ORG - True Random Number Service), representative pathogenic isolates of each type of symptom were chosen at random based on the unique symptoms that appeared on leaves following in vitro pathogenicity tests. These particular pathogenic fungal isolates were utilized for morpho-cultural characterization whereby they were inoculated onto new PDA petri dishes from the previously made pure cultures.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eData analysis\u003c/h2\u003e \u003cp\u003eMicrosoft Excel was used to summarize the data. R-GUI (version 4.2.2.0) software was used for analysis of Chi-square for BLS prevalence and severity at a confidence interval of \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.05.\u003c/p\u003e \u003c/div\u003e"},{"header":"RESULTS","content":"\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\n \u003ch2\u003ePrevalence and severity of BLS on Kasukari germplasm in Kitui experimental farm\u003c/h2\u003e\n \u003cp\u003eFrom the observations, fungal disease infestation was identified upon comparing the symptoms with those found in the Pacific Pests and Pathogen Fact Sheets. Detection and inspection of brown leaf spots was done on the older leaves by checking for the appearance of round and angular light brown spots with yellow margins. Thus, disease infection was identified as brown leaf spot disease (fungal) for all the assessed plants.\u003c/p\u003e\n \u003cp\u003eFew to several brown spots on the upper surface of leaves, especially on old and mature leaves were observed as shown in Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e(b) and (c) above. In some leaves, the margins were irregular, and the middle of the leaves had small perforations, which further suggested brown leaf spot disease caused by a fungal pathogen. Therefore, the identified infections matched the descriptions in literature for fungal disease presentation in contrast to Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e(a) illustrating healthy bitter cassava leaves. The dominant weed type was grass, although some oxalis and shrubs were also recorded. Most plants had a white stem covering.\u003c/p\u003e\n \u003cp\u003eDifferent prevalence levels were obtained in the three randomized blocks. For blocks 18, 9 and 2, there were 27.7%, 32.9%, and 29.4%, respectively. However, these variations were not statistically significant (p-value\u0026thinsp;=\u0026thinsp;0.1991, ꭓ2\u0026thinsp;=\u0026thinsp;6).\u003c/p\u003e\n \u003cp\u003eSimilarly, variations in severity scores within the blocks were also found (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e). The differences in this instance, however, were statistically significant (p-value\u0026thinsp;=\u0026thinsp;1.166e-09, (ꭓ2\u0026thinsp;=\u0026thinsp;53.013).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\n \u003ch2\u003eSeverity of root damage\u003c/h2\u003e\n \u003cp\u003eMost Kasukari roots scored a severity of 2 and 3 whereby most part of the root tissue had clearly defined areas of infection and traces respectively. The roots were rotten and smelly with perforations due to degradation of root tissues as shown in Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e (b, c and d). No Kasukari root was found to be healthy, they each had some traces of root necrosis. Interestingly, the asymptomatic bitter cassava had healthy roots shown by white appearance of the tissue in Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ea.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\n \u003ch2\u003eMorphological characteristics of fungal isolates on PDA medium\u003c/h2\u003e\n \u003cp\u003eTen fungal cultures were obtained. Generally, the fungal colonies were from four genera; \u003cem\u003eAlternaria\u003c/em\u003e, \u003cem\u003eCladosporium\u003c/em\u003e, \u003cem\u003eEpicoccum\u003c/em\u003e and \u003cem\u003ePreussia\u003c/em\u003e. Morphological and cultural characteristics of the four cultures indicated that all the four fungal pathogens had septate hyphae. The identified \u003cem\u003eEpicoccum\u003c/em\u003e sp. had colonies of white clusters (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e). The identified \u003cem\u003eAlternaria\u003c/em\u003e sps. had \u003cem\u003emuriform conidia\u003c/em\u003e, with wooly and gray colonies as shown in Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e (1a-c) and wooly white colonies with red pigment on the medium as shown in Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e (2a-c). \u003cem\u003eCladosporium\u003c/em\u003e sp. displayed macro- and microconidia with tapering ends, and the colonies had a velvety to suede-like texture with olive-green colour (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003e). \u003cem\u003ePreussia\u003c/em\u003e species had colonies of white and brown clusters with irregular margins and ellipsoidal to oval conidia. (Fig. 8).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\n \u003ch2\u003eMolecular identification of fungal isolates\u003c/h2\u003e\n \u003cp\u003ePolymerase chain reaction performed by a universal primer, internal transcribed spacer (ITS) 1 and 4 sequences, gave the result shown in Fig. \u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003e below. 1 Kb Plus DNA Ladder was used as a marker for the confirmation of the expected band sizes (500-600bp). Negative (-ve) control containing nuclease free water was used for confirmation that the reaction was correctly performed.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\n \u003ch2\u003eSequencing and phylogenetic analysis\u003c/h2\u003e\n \u003cp\u003eThe ITS marker identified the 10 isolates as \u003cem\u003eAlternaria\u003c/em\u003e sp, \u003cem\u003eEpiccocum\u003c/em\u003e sp, \u003cem\u003ePreussia\u003c/em\u003e sp, and \u003cem\u003eCladosporium\u003c/em\u003e sp (Fig. \u003cspan class=\"InternalRef\"\u003e10\u003c/span\u003e). The GDF: FDR and EF1 primers had a coverage of below 50% and therefore were not used in genetic analysis. Although CHS primer had a coverage of about 75% (Fig. \u003cspan class=\"InternalRef\"\u003e11\u003c/span\u003e), it was not used in identification since ITS had a best coverage. Therefore, the isolates were identified using ITS primer since it had a good coverage, nearly 100%.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\n \u003ch2\u003ePathogenicity of fungal isolates on cassava leaves\u003c/h2\u003e\n \u003cp\u003ePathogenicity results delineated 8 isolates as pathogens labelled 1a1,1a2,1c,1d,1b 1e,1f and 6b (Fig. \u003cspan class=\"InternalRef\"\u003e12\u003c/span\u003e). The results showed \u003cem\u003ePreussia sp.\u003c/em\u003e not producing disease symptom, the inoculated leaves remained the same as controls. The onset of the disease symptom was characterized by enlarged holes which was followed by manifestation of grey lesions on the leaf surface. After 5 days, most inoculated leaves developed necrotic lesions except samples that were inoculated with \u003cem\u003ePreussia sp\u003c/em\u003e. As the days progressed, two of the samples that were inoculated with \u003cem\u003eAlternaria sp\u003c/em\u003e developed a dark colour around the centre of inoculation. The controls remained symptom free.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"DISCUSSIONS","content":"\u003cp\u003eCassava has been mainly used as a staple food in arid and semi-arid lands (ASALs) as shown by [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e] with high content in carbohydrates, leaves being a source of minerals, vitamins and proteins. However, cassava leaf diseases remain to be major constraints in production of cassava in Kenya. This study investigated the possible cause, effect and severity of some morphological aberrations observed in the Kasukari cassava variety in experimental farms in Kitui County -Kenya.\u003c/p\u003e \u003cp\u003eData from our study shows BLS as the disease responsible for the observed morphological aberrations in the Kasukari variety. Morphological characteristics identified by microscopy, pathogenicity test together with genetic analysis identified fungal pathogens; \u003cem\u003eAlternaria\u003c/em\u003e, \u003cem\u003eCladosporium\u003c/em\u003e and \u003cem\u003eEpicoccum\u003c/em\u003e as the root cause of BLS. The isolate identified to be from genera \u003cem\u003ePreussia\u003c/em\u003e shown in Fig.\u0026nbsp;8 was thought to be an associated endophytes since it did not produce any disease symptom. \u003cem\u003ePreussia sp\u003c/em\u003e. has been reported to be an associated endophyte of oak tree in Iran [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn a research conducted by [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], the three pathogens from genera \u003cem\u003eAlternaria\u003c/em\u003e, \u003cem\u003eColletotrichum\u003c/em\u003e and \u003cem\u003eCladosporium\u003c/em\u003e were reported to be cooperating to cause BLS on cassava leaves. The identified pathogens in this study are thought to be working in synergy and via interaction as explained by [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e] to generate phytotoxins which play a significant part in the colonization of the plant. The advancing mycelia releases toxins that are responsible for the yellow halo seen around the lesion. \u003cem\u003eEpicoccum sps\u003c/em\u003e have been reported to cause brown leaf spot disease in tea in China [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. From this study, it can be said that \u003cem\u003eEpicoccum sps\u003c/em\u003e has a varied host range and to the best of our knowledge, this study provides the first identification of this species as a causal agent of BSL in Kenya.\u003c/p\u003e \u003cp\u003eThere was no significant difference in BLS prevalence across the three Kasukari plots. This potentially suggests that the source of infection was germplasms. Since the germplasm used were the same, if all were infected, then the result would have shown in all the three Kasukari plots which is exactly what was observed in this study. This also concurs with the reports suggesting that BLS occurrence is largely facilitated by infected cuttings in Kenya [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. The slight variation in high prevalence of BLS across the blocks potentially depict slight variation in the incidence of infected germplasms used during plantation. High incidence of the disease perpetuated through infected cuttings is dangerous since it can lead to increased severity, incidence and decreased cassava yield if combined with consistent use of diseased planting materials [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eHigh prevalence of BLS infection in Kasukari can cause significant losses to farmers in the arid and semi-arid lands like Kitui. This is because reduced production rate due to diseases and low rainfall can lead to food insecurity in ASALs. For instance, continuous crop failure affects food access and income in Kitui, Kenya, at least once every five seasons [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Since Kasukari is a drought resistant cassava, its farming with effective control of diseases can help to increase both the income and food supply within ASALs as the farmers sell its roots to generate income and consume them as well.Generally, the highest severity scores for BLS disease were 2 (mild/ light) and score 3 (moderate). Few Kasukari plants had traces of BLS leaf symptom. This clearly shows that the number of asymptomatic plants to be selected for planting may be limited by the increased occurrence of diseased cassava plants. On the same note, cuttings or seeds cannot be generated from the severely infected plants [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe severity of Kasukari root damage depicts potential reduction in food supply. Moreover, processors typically reject roots with a necrosis score of 3 or above because they are unfit for processing [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. It is essential to note that Kasukari variety produced big roots which is a good agronomic trait. However, BLS infections reduced the quality of the roots. This potentially indicates that Kasukari variety can be promising in increasing food security within arid and semi-arid regions of Kenya if the disease is prevented or eradicated.\u003c/p\u003e \u003cp\u003eBrown leaf spot disease significantly affected the growth of Kasukari variety; mainly affecting leaves and storage roots. The infection started from the leaves, causing distortion and defoliation, and then ended in the roots. Moreover, distortion of leaves has been shown to be negatively affecting yield due to too much defoliation [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Depending on the surface area of the leaf affected, farmers can harvest small roots if microbial infection is extreme. Also, 10% of roots scored 5 and these were rotten and smelling. In addition to rotten and smelling roots, [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e] \u003cb\u003es\u003c/b\u003ehowed a positive correlation between decrease in storage roots and severity of the symptom.\u003c/p\u003e \u003cp\u003eFurthermore, occurrence of the brown leaf spot disease in Kasukari variety in Kitui is a phenomenon that can result to high yield losses in cassava based on the fact that at least each root had a trace of root necrosis and none was identified to be healthy. For example, BLS are responsible for enormous annual losses of cassava in tropics and subtropics [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Additionally, the infection caused by BLS may lead to mycotoxicity and affected cassava thus upon consumption can be poisonous. This can be a threat to Kitui\u0026rsquo;s economy since significant funding is directed to control of the disease.\u003c/p\u003e"},{"header":"CONCLUSIONS","content":"\u003cp\u003eOur study confirmed that the morphological aberrations observed in the Kasukari variety were as a result of infection by BLS disease. We further determined the prevalence, severity and impact of the diseases on the variety. Brown leaf spot disease pose a great threat in food supply in Kitui county by reducing the quality of the produce, thus reducing food supply. With rotten roots, the produce is rendered unimportant since it cannot be consumed. The study recommends that most farmers within Kitui county practice field sanitation practices, such as burning unhealthy plant parts, and disinfecting farm equipment to minimize the spread of the disease. Such actions might lessen the propagation of the disease across planting seasons and fields as opposed to the use of diseased germplasm.\u003c/p\u003e \u003cp\u003eAs suggested by [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e], improved farming practices and monitoring of the diseases can decrease the effect of this disease on the plant. As a control mechanism, majority of farmers need to regularly scout for early disease indicators on their farms. There is thus need to accurately inform farmers on the best farming and management practices and create control and eradication programs in order to successfully increase cassava yield in Kenya. However, it is essential to note that the research was conducted when the rains were scanty and the cassava had not been established well, thus the effects of climate change variations might have facilitated the occurrence of the observed diseases.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eWe confirm that all the authors have read this manuscript and are in agreement with the list of authorship and the sentiments expressed herein. We further confirm that no persons who meet the authorship criteria have been excluded from the list of authors.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical Approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study did not use any human or animal samples and neither were any interviews conducted.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eE.A.O: Proposal writing, data collection, data analysis \u0026amp; manuscript drafting. S.N.K: Supervision, proposal writing \u0026amp; manuscript writing. C.W.H: Proposal writing, funding \u0026amp; manuscript writing. J.N.K: Proposal writing, funding \u0026amp; manuscript writing. E.N.N: Provided laboratory space and equipment; manuscript writing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorresponding author\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCorrespondence to\u003cem\[email protected]\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe research; National Research Fund Multidisciplinary Collaborative research 2019/20; Cassava Project number NRF/2/MMC/3 was fully supported by funds from National Research Fund (NRF) Kenya.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll the data described in this manuscript is readily available for sharing upon request. The datasets generated during the current study are available in the NCBI repository with accession numbers:\u003c/p\u003e\n\u003cp\u003eSUB14295632 Sample_1a1\u0026nbsp; \u0026nbsp;\u0026nbsp;PP471615\u003c/p\u003e\n\u003cp\u003eSUB14295632 Sample_1a2\u0026nbsp; \u0026nbsp;\u0026nbsp;PP471616\u003c/p\u003e\n\u003cp\u003eSUB14295632 Sample_1b \u0026nbsp; \u0026nbsp;\u0026nbsp;PP471617\u003c/p\u003e\n\u003cp\u003eSUB14295632 Sample_1c \u0026nbsp; \u0026nbsp; \u0026nbsp;PP471618\u003c/p\u003e\n\u003cp\u003eSUB14295632 Sample_1d \u0026nbsp; \u0026nbsp;\u0026nbsp;PP471619\u003c/p\u003e\n\u003cp\u003eSUB14295632 Sample_1e \u0026nbsp; \u0026nbsp; \u0026nbsp;PP471620\u003c/p\u003e\n\u003cp\u003eSUB14295632 Sample_1f \u0026nbsp; \u0026nbsp; \u0026nbsp;PP471621\u003c/p\u003e\n\u003cp\u003eSUB14295632 Sample_2a \u0026nbsp; \u0026nbsp; \u0026nbsp;PP471622\u003c/p\u003e\n\u003cp\u003eSUB14295632 Sample_6b \u0026nbsp; \u0026nbsp;\u0026nbsp;PP471623\u003c/p\u003e\n\u003cp\u003eSUB14295632 Sample_7a \u0026nbsp; \u0026nbsp; \u0026nbsp;PP471624\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003ePei YL, Shi T, Li CP, Liu XB, Cai JM, Huang GX. Distribution and pathogen identification of cassava brown leaf spot in China. Genet Mol Res. 2014;13(2):3461\u0026ndash;73.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLozano JC, Booth RH. Diseases of cassava (Manihot esculenta Crantz). PANS Pest Articles News Summaries. 1974;20(1):30\u0026ndash;54.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNg\u0026rsquo;ang\u0026rsquo;a PW. Identification and Characterization of Causative Agents of Brown Leaf Spot of Cassava and Phenotypic Response of Elite Cassava Genotypes to Infection by the Pathogens. University of Nairobi; 2022.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJuli\u0026atilde;o EC, Santana MD, Freitas-Lopes R do, Vieira L, de Carvalho A, J. S. B., Lopes UP. (2020). Reduction of brown leaf spot and changes in the chlorophyll a content induced by fungicides in cassava plants. \u003cem\u003eEuropean Journal of Plant Pathology\u003c/em\u003e, \u003cem\u003e157\u003c/em\u003e(2).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcCallum EJ, Anjanappa RB, Gruissem W. Tackling agriculturally relevant diseases in the staple crop cassava (Manihot esculenta). Curr Opin Plant Biol. 2017;38:50\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlvarez E, Bellotti AC, Calvert LA, Arias V, L\u0026oacute;pez BC, Pineda LF, L\u0026oacute;pez B, Llano Rodr\u0026iacute;guez GA, Cuervo Ib\u0026aacute;\u0026ntilde;ez M. (2012). Practical Handbook: For Managing Cassava Diseases, Pests, and Nutritional Disorders. Publicaci\u0026oacute;n CIAT No. \u003cem\u003e378\u003c/em\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOnyeka TJ, Dixon AGO, Ekpo EJA. Field evaluation of root rot disease and relationship between disease severity and yield in cassava. Exp Agric. 2005;41(3):357\u0026ndash;63.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoses E. (2010). Development of appropriate strategies to control cassava diseases in Ghana. \u003cem\u003eThe Role of Plant Pathology in Food Safety and Food Security\u003c/em\u003e, 11\u0026ndash;24.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePrasad RR, Dean MRU, Alungo B, Chand VV. Prevalence and Incidence of Cassava (Manihot esculenta) Brown Leaf Spot Disease Caused by Cercospora heningsii in Macuata Province, Vanua Levu, Fiji. J Agric Sci. 2021;13(8):91. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.5539/jas.v13n8p91\u003c/span\u003e\u003cspan address=\"10.5539/jas.v13n8p91\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRamcharan A, Baranowski K, McCloskey P, Ahmed B, Legg J, Hughes DP. Deep learning for image-based cassava disease detection. Front Plant Sci. 2017;8(October):1\u0026ndash;7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpls.2017.01852\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2017.01852\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTsatsia H, Jackson G. (2012). Cassava brown leaf spot. Cassava Brown Leaf Spot, \u003cem\u003e95\u003c/em\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaokham K, Hemniam N, Roekwan S, Hunsawattanakul S, Thawinampan J, Siriwan W. (2021). Survey and molecular detection of Sri Lankan cassava mosaic virus in Thailand. PLoS ONE, 16(10), e0252846.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMukhtar, P. T. (n.d.). \u003cem\u003eA survey of okra (Abelmoschus esculentus) in the Punjab province of Pakistan for the determination of prevalence \u0026hellip;\u003c/em\u003e .\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePedrosa AM Jr. EVALUATION OF SEVERAL METHODS OF TAKING DISEASE SEVERITY READINGS FOR CERCOSPORA LEAFSPOT OF PEANUTS. Oklahoma State University; 1975.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHillocks R, Maruthi M, Kulembeka H, Jeremiah S, Alacho F, Masinde E, Ogendo J, Arama P, Mulwa R, Mkamilo G, Kimata B, Mwakanyamale D, Mhone A, Benesi I. Disparity between Leaf and Root Symptoms and Crop Losses Associated with Cassava Brown Streak Disease in Four Countries in Eastern Africa. J Phytopathol. 2016;164(2):86\u0026ndash;93. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/jph.12430\u003c/span\u003e\u003cspan address=\"10.1111/jph.12430\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHumber RA. Fungi: identification. Manual of techniques in insect pathology. Elsevier; 1997. pp. 153\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDugan FM, Dugan FM. (2006). \u003cem\u003eThe identification of fungi: an illustrated introduction with keys, glossary, and guide to literature\u003c/em\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePALESTINE. F. (n.d.). \u003cem\u003eBook Illustrated Genera Of Imperfect Fungi\u003c/em\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOsena G, Nyaboga EN, Amugune NO. Rapid and efficient isolation of high quality DNA from cassava (Manihot esculenta crantz) suitable for PCR based downstream applications. Annual Res Rev Biology. 2017;12(2). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.9734/ARRB/2017/32195\u003c/span\u003e\u003cspan address=\"10.9734/ARRB/2017/32195\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eValizadeh N, Holasou HA, Mohammadi SA, Khawar KM. A comparison of genomic DNA extraction protocols in Artemisia annua L. for large scale genetic analyses studies. Iran J Sci Technol Trans A: Sci. 2021;45(5):1587\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSangpueak R, Phansak P, Buensanteai N. Morphological and molecular identification of Colletotrichum species associated with cassava anthracnose in Thailand. J Phytopathol. 2018;166(2):129\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAberkane A, Cuenca-Estrella M, Gomez-Lopez A, Petrikkou E, Mellado E, Monzon A, Rodriguez-Tudela JL. Comparative evaluation of two different methods of inoculum preparation for antifungal susceptibility testing of filamentous fungi. J Antimicrob Chemother. 2002;50(5):719\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eImathiu SM, Ray RV, Back M, Hare MC, Edwards SG. Fusarium langsethiae pathogenicity and aggressiveness towards oats and wheat in wounded and unwounded in vitro detached leaf assays. Eur J Plant Pathol. 2009;124:117\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEl-Sharkawy MA. Cassava biology and physiology. Plant Mol Biol. 2004;56(4):481\u0026ndash;501.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHajizadeh A, Amini J, Abdollahzadeh J. New records of endophytic fungi isolated from oak trees in Kurdistan province (Iran). Rostaniha. 2015;16(1):109\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWangari P, Ang NG. (2022). \u003cem\u003eIDENTIFICATION AND CHARACTERIZATION OF CAUSATIVE AGENTS OF BROWN\u003c/em\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePeng Y, Li SJ, Yan J, Tang Y, Cheng JP, Gao AJ, Yao X, Ruan JJ, Xu BL. Research progress on phytopathogenic fungi and their role as biocontrol agents. Front Microbiol. 2021;12:670135.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBao XT, Dharmasena DSP, Li DX, Wang X, Jiang SL, Ren YF, Wang DL, Song BA, Chen Z. First report of Epicoccum sorghinum causing leaf spot on tea in China. Plant Dis. 2019;103(12):3282.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYin QX, Jiang SL, Li DX, Huang HL, Wang Y, Wang DL, Chen Z. First report of Epicoccum nigrum causing brown leaf spot in tea in Guizhou Province, China. Plant Dis. 2022;106(1):321.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWangari Ng\u0026rsquo;ang\u0026rsquo;a P, Miano DW, Wagacha JM, Kuria P. Identification and characterization of causative agents of brown leaf spot disease of cassava in Kenya. J Appl Biology Biotechnol. 2019;7(6):1\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTorkpo SK, Gafni Y, Danquah EY, Offei SK. Incidence and severity of cassava mosaic disease in farmer\u0026rsquo;s fields in Ghana. Ghana J Agricultural Sci. 2018;53:61\u0026ndash;71.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOmoyo NN, Wakhungu J, Oteng\u0026rsquo;i S. Effects of climate variability on maize yield in the arid and semi arid lands of lower eastern Kenya. Agric Food Secur. 2015;4(1):1\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOtim-Nape GW, Shaw MW, Thresh JM. The effects of African cassava mosaic geminivirus on the growth and yield of cassava in Uganda. Tropical Science (United Kingdom; 1994.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLegg JP, Owor B, Sseruwagi P, Ndunguru J. Cassava mosaic virus disease in East and Central Africa: epidemiology and management of a regional pandemic. Adv Virus Res. 2006;67:355\u0026ndash;418.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Fungus, Brown Streak, Root tuber, Food Security, Climate change","lastPublishedDoi":"10.21203/rs.3.rs-4228831/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4228831/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eCassava brown leaf spot (BLS) is among the most damaging diseases that significantly reduce cassava root yields. There has been need to find varieties resistant or tolerant to BLS. Hence, in this study drought-resistant cassava varieties were being agronomically screened in an experimental farm in Kitui County-Kenya. One variety in the plots, commonly referred to as Kasukari, was found to exhibit abnormal morphological aberrations whose cause necessitated systematic studies. Morphological, microscopic and DNA molecular identification techniques were applied on the isolates to identify the causal agent(s). 162 samples of the Kasukari variety were used to determine the prevalence and severity of the disease, while 15 samples were used to determine effects of the disease in the plots. The prevalence within the plots had no significant difference (ꭓ2\u0026thinsp;=\u0026thinsp;6, \u003cem\u003ep\u003c/em\u003e-value\u0026thinsp;=\u0026thinsp;0.1991). However, there was significant difference in the severity (ꭓ2\u0026thinsp;=\u0026thinsp;53.013, \u003cem\u003ep\u003c/em\u003e-value\u0026thinsp;=\u0026thinsp;1.166e-09). Pathogenicity tests of ten isolates were conducted \u003cem\u003ein vitro\u003c/em\u003e whereby the spore suspension was made from each isolate and inoculated in detached fresh Kasukari variety leaves. Polymerase chain reaction performed by the universal primer, internal transcribed spacer (ITS) marker identified \u003cem\u003eAlternaria\u003c/em\u003e sp, \u003cem\u003eEpiccocum\u003c/em\u003e sp, \u003cem\u003ePreussia\u003c/em\u003e sp, and \u003cem\u003eCladosporium\u003c/em\u003e sp. However, it was the \u003cem\u003eEpiccocum\u003c/em\u003e sp that was reisolated from the reinfected Kasukari Cassava variety and hence confirmed as the main causal agent. Mycological keys found this fungus to be \u003cem\u003eEpicoccum sorghinum.\u003c/em\u003e This is the first time for \u003cem\u003eE\u003c/em\u003e. \u003cem\u003esorghinum\u003c/em\u003e to be associated with BLS in Kenya. Morphologically, the disease distorted leaves and reduced root quality. This infection necessitates further enriching and screening of the cassava genome for more resistant and tolerant varieties especially in light of the climate change phenomenon.\u003c/p\u003e","manuscriptTitle":"First Time Morphological and Molecular Isolation of Epicoccum sorghinum Pathogenicity in the Cassava Brown Leaf Spot Disease in Kenya","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-17 17:58:02","doi":"10.21203/rs.3.rs-4228831/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"806c0454-5299-47e8-87e7-43eee933c1fa","owner":[],"postedDate":"April 17th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-04-24T18:15:48+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-17 17:58:02","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4228831","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4228831","identity":"rs-4228831","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}