Platelet ferroptosis promotes oxidized mtDNA release and SLE progression

preprint OA: closed
Full text JSON View at publisher
Full text 87,731 characters · extracted from preprint-html · click to expand
Platelet ferroptosis promotes oxidized mtDNA release and SLE progression | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Platelet ferroptosis promotes oxidized mtDNA release and SLE progression Fangyuan Yang, Zhirui Zhou, Yingshi Han, Ying Huang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7193492/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: Ferroptosis is a recently identified type of regulated necrosis and glutathione peroxidase 4 (GPX4) has been recognized as a key enzyme that protects against ferroptosis. However, the role of platelet ferroptosis in systemic lupus erythematosus (SLE) has not been explored. Methods: GPX4 protein expression in platelets was detected by Western blot and immunofluorescence analysis. The correlation of platelet GPX4 expression with SLE clinical characteristics was evaluated. The ability of platelet activation and ferroptosis was detected and the release of oxidized DNA by platelets was tested. In addition, GPX4 inhibitor and activator were used to evaluate the effect of GPX4 on platelet ferroptosis and oxidized DNA release. Finally, MRL/ lpr mice were treated with GPX4 activator or vehicle and the severity of lupus disease was assessed. Results: Platelets of SLE patients showed lower expression of GPX4 than that of healthy controls. The expression of GPX4 in SLE platelets was negativelycorrelated with disease activity and plasma oxidized DNA. SLE platelets with low expression of GPX4 were highly activated and susceptible to ferroptosis and resulting in elevated release of oxidized DNA. In vitro, GPX4 inhibitor induced ferroptosis and oxidized DNA release from healthy control platelets, whereas the GPX4 activator protected SLE platelets from ferroptosis and inhibited the release of oxidized DNA. In MRL/ lpr mice, treatment of GPX4 activator alleviated lupus-like features, inhibited platelet ferroptosis and reduced the release of oxidized DNA. Conclusions: These findings demonstrate that SLE platelets exhibit low GPX4 expression and are more susceptible to ferroptosis, highlighting the critical role of GPX4 downregulation-mediated platelet ferroptosis in the development of SLE. Therefore, activation of GPX4 may represent a therapeutic strategy for SLE. Biological sciences/Immunology/Cell death and immune response Biological sciences/Drug discovery/Biomarkers/Prognostic markers Systemic lupus erythematosus Ferroptosis Glutathione peroxidase 4 Platelets Oxidized DNA Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Systemic lupus erythematosus (SLE) is a chronic inflammatory systemic disorder clinically characterized by a global loss of immune tolerance and activation of both innate and adaptive immune systems [1]. A study has shown that the prevalence of SLE ranges from 50 to 100 cases per 100,000 individuals[2]. Patients suffer from SLE may present with severe symptoms that significantly impair their quality of life [3], and the disease is one of the leading causes of death in young women[4]. SLE exhibits multiple pathogenic features, including genetic factors of susceptibility, type I IFN signature and loss of tolerance against nuclear components. However, the exact mechanisms remain elusive[5]. Emerging evidence proves that platelet activation triggers SLE pathogenesis by inducing the release of inflammatory cytokines and mtDNA, ultimately resulting in microvascular thrombosis [6]. Thrombocytopenia and/or decreased platelet volume have been observed in SLE patients. It has been reported that the prevalence of thrombocytopenia in SLE is about 15%, higher than that of leukopenia (14%) and anemia (2%), and thrombocytopenia negatively correlated with lupus disease activity[7]. SLE-related thrombocytopenia may result from multiple mechanisms, including impaired platelet production, increased splenic sequestration or peripheral destruction. [8] Platelet clearance due to desialylation could also be relevant mechanisms leading to SLE-associated thrombocytopenia, which is evidenced by elevated desialylation biomarkers in SLE patients’ plasma [9]. CD8 T cells drive this process via directly destroy platelets or express Neuraminidase 1 (Neu1) and Neuraminidase 3 (Neu3) to induce platelet desialylation [10]. Platelet apoptosis has also been reported in SLE disease [11]. However, the predominant forms in platelet death remain unverified. Ferroptosis is an iron-mediated form of regulated cell death driven by toxic accumulation of lipid peroxidase and iron overload. It exhibits distinct mechanisms and morphology from apoptosis and necroptosis [12]. Glutathione peroxidase 4 (GPX4) is a major factor which can directly neutralize lipid peroxidation by oxidizing glutathione (GSH) to glutathione disulfide (GSSG), converting toxic lipid peroxides to non-toxic alcohols [13], leading to a reduction in damage to membrane function and the mitigation in ferroptosis [14, 15]. In this study, we demonstrated that SLE platelets with low expression of GPX4 are more prone to ferroptosis. Subjects and methods Patients According to guidelines from 1997 revised American College of Rheumatology (ACR) classification criteria, patients with SLE were recruited at the Department of Rheumatology, the Third Affiliated Hospital, Southern Medical University, between June 2022 and March 2025. Patients with the following conditions were excluded: acute and/or chronic severe infection, pregnancy and lactation, malignancy, and unstable medical conditions. In addition, age- and gender-matched healthy volunteers without a history of SLE or other immune diseases were enrolled as healthy controls (HCs). Approval of this study was granted by the Ethics Committee Office of the Third Affiliated Hospital, Southern Medical University (No. 2022-Ethical Approval-047), and written informed consent was obtained from all participants. Serological assays and clinical assessments Analysis of SLE subgroups is increasingly important for better understanding the pathogenesis of disease and providing more customized medical plans. Thus, correlations of the protein level of GPX4 in platelets with serological features, organ involvement, and disease activity were evaluated in SLE patients. We collected demographic and laboratory data from the medical records, including age, gender, inflammatory markers (CRP and ESR), serum total immunoglobulin (IgG, IgA, IgM), complements (C3, C4, C1q), D-dimer, fibrinogen, peripheral blood cell count (leukocyte count, hemoglobin, platelet count), platelet distribution width, mean platelet volume, large platelet ratio, plateletcrit, autoantibodies (including 9 autoantibodies, such as anti-dsDNA antibody, anti-RNP antibody, anti-Smith antibody, etc.), 24-hour urine protein and serum lipid concentrations. The criteria for organs involvement set in this study are as follows: serositis including pericarditis (confirmed by cardiac ultrasound) and pleuritis (confirmed by CT); blood system involvement, including hemolytic anemia (coombs test positive), thrombocytopenia (<1,000/mm 3 ), leukopenia (<4,000/mm 3 ), lymphopenia (<1,000/mm 3 ); brain involvement, including epilepsy or psychosis, excluding drugs or known metabolic disorders; alopecia defined as first or recurrent patchy or diffuse alopecia; skin involvement defined as first or recurrent inflammatory rashes; joint involvement defined as arthritis (tenderness, swelling or fluid accumulation), involving two or more peripheral joints; fever defined as temperature exceeds 38 ℃, excluding infection. The SLE Disease Activity Index (SLEDAI)-2K was used to determine disease activity of SLE patients by two professional rheumatologists. Isolation of platelets Venous blood samples (6 mL) were drawn from patients with SLE when they were enrolled on the first day using blood collection tubes containing acid citrate dextrose (ACD) anti-coagulant. Briefly, platelet-rich plasma (PRP) was centrifuged at 260 g at 25 °C for 15 minutes. PRP was then treated with 100 nM prostaglandin E1 (Sigma, catalog no. 745-65-3) and centrifuged at 1,000 g for 10 minutes. After discarding the supernatant, the platelet pellet was washed twice by suspending them in Tyrodes buffer and centrifuging at 1,000 g for 10 minutes. Platelet activation Cells were treated with FITC conjugated Annexin-V (Sigma-Aldrich, Annexin V-FITC, Apoptosis probe FITC) (4 μL) for 15 minutes at room temperature before fixing with binding buffer for 15 minutes in dark. Platelets were then washed, and fluorescence was measured using flow cytometry (BD FACSCelesta). Quantitative reverse transcription-polymerase chain reaction (RT-qPCR) Total RNA was extracted from cells using TRIzol reagent (Takara, 9109). The cDNA was reverse transcribed using HiScript Ⅲ RT SuperMix (Vazyme, R323), and qPCR was performed by Roche LightCycler® 96 with the following primers: human Annexin V (forward primer 5’- AACCCTCTCGGCTTTATGATGC -3’ and reverse primer 5’- CGCTGGTAGTACCCTGAAGTG-3’); human CD62P (forward primer 5’- ACTGCCAGAATCGCTACACAG-3’ and reverse primer 5’- CACCCATGTCCATGTCTTATTGT -3’); human GAPDH (forward primer 5’-CTGTTCGACAGTCAGCCGCATC-3’) and reverse primer 5’- GCGCCCAATACGACCAAATCCG -3’). Western blot Platelets were collected and lysed using protein lysis buffer containing a protease inhibitor cocktail (Abcam, catalog no. ab65621). Total proteins were separated by SDS-PAGE and then transferred to polyvinylidene difluoride membranes. Nonspecific binding was blocked with 5% nonfat milk at room temperature for 1 hour. The membranes were incubated with the following primary antibodies overnight at 4°C: anti-GPX4 (Proteintech, 1:2,000, catalog no.67763-1-Ig), anti-GAPDH (Proteintech, 1:5,0000, catalog no.60004-1-Ig). The membranes were then incubated with appropriate secondary antibodies (1:5,000). Relative intensities were quantified using Image Lab (Tanon 5200) using enhanced chemiluminescence (Abcam, catalog no.PK10001). Immunofluorescence For GPX4 immunofluorescence analysis, platelets were fixed and incubated with anti-GPX4 antibodies (Proteintech, 1:200, catalog no.67763-1-Ig) at 4 ℃ overnight. Secondary antibodies included Alexa Fluor 647-conjugated anti-mouse antibody (Abcam, 1:200, catalog no. ab150115). For IgG immunofluorescence analysis, kidney tissue sections were fixed and incubated with anti-mouse IgG antibody (Thermofisher, 1:400, catalog A32723) at 4 ℃ overnight. Cells and sections were captured using fluorescence microscope (×20 immersion lens, Olympus). Lactate dehydrogenase (LDH) assay Platelets (8×10 7 cells/mL) were treated with or without deferoxamine (DFO) (Sigma-Aldrich, D9533-1G) (100 μM) for 24 hours at 37 °C and platelets were pelleted by centrifugation at 1000×g for 10 minutes. The supernatant was collected and used to detect LDH release using LDH kit (Promega, LDH-Glo™ Cytotoxicity Assay) according to the manufacturer's protocol. Quantification of oxidized DNA levels Cell-free plasma samples or supernatant of platelets were used to quantify oxidized DNA levels by using a general 8-OHdG ELISA kit (Develop, dl-8-OHdG-Ge) according to manufacturer's instructions. Intracellular lipid peroxidation assays Lipid peroxidation in platelets was detected by Beyotime Lipid Peroxidation Detection Kit (BODIPY581/591C11) (S0043). Cells were captured using immunofluorescence microscopy (Olympus). Transmission Electron Microscopy Centrifuge to collect freshly isolated or cultured platelets (1000 g for 10 minutes) until a visible cell pellet. Discard the culture medium and add electron microscopy fixative to fix the cells at room temperature for 2 hours. The sample was examined under the TEM-1400 plus electron microscope. Electron micrographs were taken at 5,000–50,000-fold magnification. Platelets from SLE patients and HCs were evaluated for mitochondrial vacuolization by transmission electron microscopy. Inhibition and activation of GPX4 in platelets For GPX4 inhibition, platelets of healthy controls were treated with GPX4-IN-3 (HY-141809). For GPX4 activation, platelets of SLE patients were treated with GPX4 activator (HY-161928). All of them were treated for 24 hours or 48 hours and the cells were harvested for RNA or protein detection. Animal experiment Eight-week-old female MRL/ lpr mice and MRL/Mpj mice were purchased from SHANGHAI SLAC LABORATORY ANIMAL CO. LTD. After being raised to 10 weeks of age, MRL/ lpr mice (n=6) were orally treated with 25 mg/kg GPX4 activator every two days for 10 weeks. Vehicle-treated MRL/ lpr mice (n=6) received the same volume of solvent alone. All mice were housed in a special pathogen-free environment. All procedures were received and supervised by the Animal Care and Use Committee of Southern Medical University. Urine protein was assessed using urine protein test strips weekly. All mice were anesthetized at the age of 20 weeks. Serum was collected from peripheral blood. Spleens, lymph nodes and kidneys were collected. Standard hematoxylin & eosin (H&E), periodic acid–Schiff (PAS) and masson staining were performed, and results were assessed by experienced pathologists. Statistical analysis All data were analyzed using GraphPad Prism 8 (version 8.0) software and the images were processed by Adobe Photoshop 2020. Quantitative data were presented as the mean ± standard deviation (SD), and categorical variables were expressed as numbers or percentages. Data with a Gaussian distribution was analyzed using an unpaired t test or one-way analysis of variance (ANOVA), and categorical data were compared by the chi-square test. Spearman’s correlation analysis was used to analyze the correlation of GPX4 protein levels with clinical characteristics. Results Platelets from SLE patients are highly activated and more prone to ferroptosis At first, the numbers of CD62P-positive and Annexin V-positive cells were higher in platelets from SLE patients than in those from healthy controls (Fig.1A-F), indicating activation of SLE platelets. We also found that SLE platelets could release higher levels of LDH than HC platelets (Fig.1G), suggesting that SLE platelets undergo necrosis. To identify whether ferroptosis occurs in SLE platelets, we isolated platelets and conducted a series of tests. High levels of intracellular lipid peroxides were detected in SLE platelets by Beyotime Lipid Peroxidation Detection Kit (Fig.1J). Further investigation via electron microscopy revealed that a substantial fraction of platelets extracted from SLE patients displayed hallmark mitochondria features of ferroptosis characterized by reduction in mitochondrial volume, heightened mitochondrial membrane density and loss of mitochondrial cristae (Fig.1I). To further confirm the expression of GPX4, the key regulator of ferroptosis, in SLE platelets, we isolated platelets from SLE patients (n=37) and healthy controls (n=23), and further performed Western blot and immunofluorescence analysis. Clinical and demographic characteristics of SLE patients were shown in Table 1. The mean age of SLE patients was 37 years and 97% of patients were female. Low expression of GPX4 was observed in platelets from SLE patients compared to healthy controls (Fig.1K-M). These results suggested that platelets of SLE patients are highly activated and more prone to ferroptosis. GPX4 expression of SLE platelets was strongly correlated with SLE disease activity Due to the inability to quantitatively measure other ferroptosis indicators,we selected expression of the key protein of ferroptosis-GPX4 to represent for ferroptosis, to conduct the following correlation analysis. According to the SLEDAI-2K score, the severity of SLE disease is classified into mild activity (SLEDAI-2K= 0~6), moderate activity (SLEDAI-2K=7~12) and severe activity (SLEDAI-2K≥13). As figure 2 shows, protein expression of GPX4 in platelets was low in SLE patients with moderate activity and lower in SLE patients with severe activity (Fig.2A-B). Next, we analyzed the correlations between protein expression of platelet GPX4 and clinical characteristics of SLE patients (Table 2). Importantly, platelet GPX4 expression was negatively correlated with SLEDAI-2K score (r=-0.6072, p=0.0008) (Fig.2C) and 24-hour urine protein (r=-0.5219, p=0.0381) (Fig.2D). By contrast, platelet GPX4 expression was positively associated with platelet count (r=0.3723, p=0.0232) (Fig.2E), plateletcrit (r=0.3389, p=0.0432) (Fig.2F). Furthermore, we investigated platelet GPX4 protein expression in SLE patients involved with or without different organ systems (Fig.2I-L). SLE patients involved with skin or joint system had a marked reduction in GPX4 protein expression (Fig.2I-J). However, no significant difference was observed in those involved with alopecia and serositis (Fig.2K-L). These data indicated that ferroptosis of SLE platelets was associated with disease activity, kidney damage and involvement of skin and joint in SLE patients. Inhibition of GPX4 induces activation and ferroptosis in platelets of healthy controls To investigate the effect of GPX4 inhibition on platelet activation and ferroptosis, we isolated platelets from healthy controls and then stimulated HC platelets with GPX4-IN-3, an efficient GPX4 inhibitor. The numbers of CD62P-positive and Annexin V-positive cells were increased after stimulation with GPX4-IN-3 (Fig.3A-D). Moreover,GPX4-IN-3 stimulation resulted in an increased release of LDH (Fig.3E) and high levels of intracellular lipid peroxides, as SLE platelets presented (Fig.3G). Electron microscopy revealed that GPX4-IN-3-stimulated platelets were observed with similar mitochondrial morphological alterations to the SLE platelets (Fig.3H). The above results demonstrated that inhibition of GPX4 induces activation and ferroptosis in HC platelets. GPX4 activation inhibits activation and ferroptosis in platelets of SLE patients To further verify the effect of GPX4 activator on platelet activation and ferroptosis, we treated SLE platelets with GPX4 activator. Contrary to GPX4 inhibition, GPX4 activation reduced ferroptosis in SLE patients, characterized by decreased release of LDH, low expression of intracellular lipid peroxides and reduction of mitochondrial damage (Fig.4A-H). And GPX4 activation also decreased the numbers of CD62P-positive and Annexin V-positive cells. These findings illustrate that GPX4 activation can suppress activation and ferroptosis in platelets of SLE patients. The drugs targeting GPX4 activation may be a potential treatment for SLE patients. Platelet ferroptosis results in the release of oxidized mitochondrial DNA Similar to previous studies, the concentration of oxidized DNA was significantly increased in the plasma of SLE patients (Fig.1H). Because of high immunogenicity, oxidized DNA has been reported to play a critical role in SLE pathogenesis. However, the source and molecular mechanism of oxidized DNA is not yet fully clarified. Interestingly, we demonstrated for the first time that the levels of GPX4 protein in SLE platelets were negatively related to plasma oxidized DNA levels (r=-0.4034, p=0.0244, Fig.2H), documenting platelet ferroptosis may be a main source of extracellular oxidized DNA in SLE patients. Moreover, compared with HC platelets, SLE platelets released high levels of oxidized DNA (Fig.3F). Oxidized DNA levels were notably increased in the supernatant of HC platelets with GPX4 inhibition (Fig.3F), but decreased in that of SLE platelets treated with GPX4 activation (Fig.4F). In combination with the fact that platelets are anucleate, but contain mitochondria, these results indicate that platelet ferroptosis leads to release of oxidized mitochondria DNA (mtDNA). GPX4 activator treatment alleviates lupus-like manifestations in MRL/ lpr mice Considering that GPX4 expression in SLE platelets strongly associated with SLE disease activity, we speculate that the GPX4 downregulation-mediated ferroptosis plays an important role in SLE progression. And thus, we evaluated the effect of GPX4 activator on SLE development using a spontaneous lupus model mice-MRL/ lpr mice in present study. Administration of vehicle or GPX4 activator started at the age of 10 weeks and continued to the age of 20 weeks in MRL/ lpr mice (Fig.5A). Clinically, anti-dsDNA antibodies serve as an indicator for assessing the disease activity of SLE patients. MRL/ lpr mice also showed high levels of circulating anti-dsDNA antibodies, but the treatment of GPX4 activator markedly reduced this antibody levels of MRL/ lpr mice (Fig.5E). Furthermore, GPX4 activator treatment resulted in a reduction of spleen weight, limiting lupus splenomegaly (Fig.5C-D). Renal disease development in MRL/ lpr mice was characterized by a marked increase in proteinuria. Importantly, the levels of urinary protein excretion were significantly decreased in MRL/ lpr mice treated with GPX4 activator (Fig.5B). The renal pathological changes in MRL/ lpr mice were also evaluated by using H&E, PAS, and Masson staining after treatment with either vehicle or GPX4 activator. Significant kidney pathological damage was observed in MRL/ lpr mice compared to their MRL/Mpj counterparts (Fig.5F). Administration of GPX4 activator resulted in a reduction in glomerular hypercellularity, mesangial expansion, crescent formation, and tubulointerstitial injury (Fig.5F). Additionally, IgG deposition in the kidneys was markedly decreased in GPX4 activator-treated MRL/ lpr mice (Fig.5G). Taken together, these results indicate that the GPX4 activator effectively alleviates lupus-related damage in MRL/ lpr mice. Treatment of MRL/ lpr mice with GPX4 activator prevents platelets from ferroptosis in vivo The expression of GPX4 in platelets of GPX4 activator-treated MRL/lpr mice has no significant difference with that of vehicle-treated MRL/ lpr mice (Fig.6A-B). However, platelets of GPX4 activator-treated MRL/ lpr mice exhibited a decreased level of intracellular lipid peroxides (Fig.6C). Besides, LDH (Fig.6D) and oxidized DNA (Fig.6E) in serum were all decreased in platelets of MRL/ lpr mice after GPX4 activator treatment. Collectively, our findings demonstrate that treatment of GPX4 activator can inhibit ferroptosis and oxidized DNA release in platelets of MRL/ lpr mice. Discussion Thrombocytopenia is a common hematological manifestation of SLE and also an important indicator for evaluating disease activity. Severe thrombocytopenia is often associated with a high mortality rate of SLE[16]. Previous studies have reported that thrombocytopenia is mainly due to excessive platelet destruction and defects in platelet production from megakaryocytes[17]. Although platelet apoptosis has been documented as a clearance mechanism in SLE [11], the contribution of other form of programmed death pathways to thrombocytopenia remain poorly defined. While platelet pyroptosis exacerbates inflammation in sepsis, its role in SLE remains unexplored [18]. Herein, we identified ferroptosis as a new and major form of platelet death and driven thrombocytopenia in SLE, although the contribution of apoptosis cannot be excluded. The pathogenic role of platelet ferroptosis in SLE was further validated in vivo by the findings that treatment of ferroptosis inhibitor resulted in the alleviation of lupus-like disease in MRL/ lpr mice. Collectively, our research results partially explain the cause of thrombocytopenia and extend previous understanding of platelet death, providing a missing link among platelet ferroptosis, thrombocytopenia and disease progression in SLE. Ferroptosis can be induced by excessive oxidative modification of polyunsaturated fatty acids and the inhibition of GPX4 [19]. In this study, we observed that GPX4 expression was decreased in SLE platelets. In vitro, GPX4 inhibitor induced ferroptosis in HC platelets while GPX4 activator inhibited ferroptosis in SLE platelets. This study highlights the factthat decreased levels of GPX4 may contribute to platelet ferroptosis in SLE. However, further efforts are needed to explore the exact mechanisms of low expression of GPX4, especially the degradation of GPX4 protein. Our results further revealed that platelet GPX4 levels are negatively correlated with SLEDAI-2K score, 24-hour urine protein and positively correlated with platelet count in SLE patients. In addition, lower levels of GPX4 in platelets were observed in SLE patients with skin or joint systems involvement. These findings emphasize again the pathogenic role of GPX4 downregulation-mediated ferroptosis in SLE. Moreover, the amelioration of lupus-like disease in MRL/lpr mice by treating with GPX4 activator highlights the importance of targeting GPX4 and platelet ferroptosis in the treatment of SLE. Necrosis can induce immune response and aggravate inflammation, critically depending on the release of damage-associated molecular patterns (DAMPs)[20]. The cell death of platelets, the most abundant cells in the peripheral blood, represents one dominant source of DAMPs in our body. Previous studies have demonstrated that ferroptosis results in the production of DAMPs, such as HMGB1 and LL-37[21, 22]. Of note, platelets are key sources of mitochondrial DNA in SLE [23]. In the present study, we found that platelet GPX4 levels in SLE patients negatively correlated with plasma oxidized DNA concentration and further identified that platelet ferroptosis contributed to the release of oxidized mtDNA. As an important DAMPs, ox-mtDNA can trigger proinflammatory and type I interferon (IFN) responses that can ignite human autoimmunity and chronic inflammation [24]. Taking together, these findings update our understanding of the underlying mechanism of oxidized mtDNA release by platelets-ferroptosis and partially explain how platelet ferroptosis participates in SLE occurrence and progression. However, further studies are needed to delineate in detail mechanisms whereby platelet ferroptosis boosts inflammation in SLE. In conclusion, our study demonstrates the important role of GPX4-mediated ferroptosis of platelets in the pathogenesis of SLE and provides a potential therapeutic approach targeting GPX4 in SLE. Declarations Data availability Restrictions apply to the availability of these data, and they are not publicly available because they contain information of electronic health records and human genetic data, consented for research use by investigators. Making the data publicly available without additional consent or ethical approval might compromise patients’ privacy and the original ethical approval. However, data are available from the corresponding author ( [email protected] ) upon reasonable request and with the ethical permission of the institution. Acknowledgements Not applicable. Contribution statement Yi He, Jiaochan Han and Fangyuan Yang conceived and designed the study. Zhirui Zhou, Yingshi Han, Ying Huang, Wanfen Li, Meichen Ai, Jian Zhuang and Pan Liao recruited patients and collected the data. Zhirui Zhou, Yingshi Han and Ying Huang conducted these experiments and analysed all these datas. Zhirui Zhou and Ying Huang wrote the first draft of the manuscript, Yi He and Fangyuan Yang contributed to critical revision of the manuscript for important intellectual content. All authors have given the final approval of the manuscript for submission and publication. Funding This work was supported by grants from National Natural Science Foundation of China (82471843), Guangzhou Science and Technology Program Project (Grant No. 202201010926 and No. SL2022A03J01194), International Science and Technology Cooperation Program of Guangdong, China (2022A0505050040), President Foundation of The Third Affiliated Hospital of Southern Medical University, Guangzhou, China (YL202205), Hunan Provincial Department of Education Outstanding Youth Project (24B1089) and Clinical Medical Technology Demonstration Base for rheumatological immunology of HuaiHua (2022N2403). Availability of data and material The datasets generated and/or analyzed during the current study are available from the corresponding author on reasonable request. Ethics approval and consent to participate This study has been approved by the Ethics Committee of The Third Affiliated Hospital of Southern Medical University. All patients gave their informed consent to the study. Competing interests All authors declare that they have no competing interests. References Tsokos, G.C., Systemic lupus erythematosus. N Engl J Med, 2011. 365(22): p. 2110-21. Yu, H., Y. Nagafuchi and K. Fujio, Clinical and Immunological Biomarkers for Systemic Lupus Erythematosus. Biomolecules, 2021. 11(7). Connelly, K., et al., Towards a novel clinical outcome assessment for systemic lupus erythematosus: first outcomes of an international taskforce. Nat Rev Rheumatol, 2023. 19(9): p. 592-602. Yen, E.Y. and R.R. Singh, Brief Report: Lupus-An Unrecognized Leading Cause of Death in Young Females: A Population-Based Study Using Nationwide Death Certificates, 2000-2015. Arthritis Rheumatol, 2018. 70(8): p. 1251-1255. Scherlinger, M., et al., Systemic lupus erythematosus and systemic sclerosis: All roads lead to platelets. Autoimmun Rev, 2018. 17(6): p. 625-635. Nhek, S., et al., Activated Platelets Induce Endothelial Cell Activation via an Interleukin-1beta Pathway in Systemic Lupus Erythematosus. Arterioscler Thromb Vasc Biol, 2017. 37(4): p. 707-716. Abdel Galil, S.M., et al., Prognostic significance of platelet count in SLE patients. Platelets, 2017. 28(2): p. 203-207. Linge, P., et al., The non-haemostatic role of platelets in systemic lupus erythematosus. Nat Rev Rheumatol, 2018. 14(4): p. 195-213. Baroni Pietto, M.C., et al., Pathogenic mechanisms contributing to thrombocytopenia in patients with systemic lupus erythematosus. Platelets, 2022. 33(5): p. 743-754. Vrbensky, J.R., et al., Increased cytotoxic potential of CD8(+) T cells in immune thrombocytopenia. Br J Haematol, 2020. 188(5): p. e72-e76. Zheng, S.S., et al., Antiplatelet antibody predicts platelet desialylation and apoptosis in immune thrombocytopenia. Haematologica, 2022. 107(9): p. 2195-2205. Li, P., et al., Glutathione peroxidase 4-regulated neutrophil ferroptosis induces systemic autoimmunity. Nat Immunol, 2021. 22(9): p. 1107-1117. Maiorino, M., M. Conrad and F. Ursini, GPx4, Lipid Peroxidation, and Cell Death: Discoveries, Rediscoveries, and Open Issues. Antioxid Redox Signal, 2018. 29(1): p. 61-74. Alim, I., et al., Selenium Drives a Transcriptional Adaptive Program to Block Ferroptosis and Treat Stroke. Cell, 2019. 177(5): p. 1262-1279.e25. Ingold, I., et al., Selenium Utilization by GPX4 Is Required to Prevent Hydroperoxide-Induced Ferroptosis. Cell, 2018. 172(3): p. 409-422.e21. Pratama, Y.S., et al., Autoimmune Thrombocytopenia in SLE and COVID-19. Eur J Case Rep Intern Med, 2021. 8(11): p. 002863. Jiang, Y., et al., Systemic lupus erythematosus-complicating immune thrombocytopenia: From pathogenesis to treatment. J Autoimmun, 2022. 132: p. 102887. Su, M., et al., Gasdermin D-dependent platelet pyroptosis exacerbates NET formation and inflammation in severe sepsis. Nat Cardiovasc Res, 2022. 1(8): p. 732-747. Stockwell, B.R., et al., Ferroptosis: A Regulated Cell Death Nexus Linking Metabolism, Redox Biology, and Disease. Cell, 2017. 171(2): p. 273-285. Yang, F., et al., Programmed Cell Death Pathways in the Pathogenesis of Systemic Lupus Erythematosus. J Immunol Res, 2019. 2019: p. 3638562. Wen, Q., et al., The release and activity of HMGB1 in ferroptosis. Biochem Biophys Res Commun, 2019. 510(2): p. 278-283. Liu, Z., et al., Antimicrobial peptide CRAMP/LL-37 mediates ferroptosis resistance in cardiomyocytes by inhibiting cathepsin L. Basic Res Cardiol, 2025. Melki, I., et al., Platelets release mitochondrial antigens in systemic lupus erythematosus. Sci Transl Med, 2021. 13(581). Xian, H. and M. Karin, Oxidized mitochondrial DNA: a protective signal gone awry. Trends Immunol, 2023. 44(3): p. 188-200. Tables Tables 1 and 2 are available in the Supplementary Files section. Additional Declarations There is no conflict of interest Supplementary Files Table1.xlsx Table 1. Demographic, laboratory and clinical characteristics of the subjects. Table2.xlsx Table 2. Correlations between platelet GPX4 protein expression and clinical characteristics of SLE patients. Originalwesternblots.docx Original western blots. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7193492","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":491760840,"identity":"1efcce3e-28fb-4ab0-9a95-3c567cc32362","order_by":0,"name":"Fangyuan Yang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1UlEQVRIiWNgGAWjYDAC5gPMDxIqJOQgPDZitLAlsBl8OGNhTJIWBsmZbRWJDURrMTjGY2DMwyaRPn/aGQOGD2WHGfhnNxDW8piHRyJ3w+0cA8YZ5w4zSNw5QEDL/R6gLRJALdI5Bsy8bYcZDCQSCNsizWMgkS4/G6jlL7FaJGckAJUBHcbMSIwWyWNsZQYfDkgYbridVnCw51w6j8QNAlr4jjFvfpD4r05efnbyxgc/yqzl+GcQ0KJwgMMAzjkAxDz41QOBfAP7A4KKRsEoGAWjYIQDAPpVQkbNblLtAAAAAElFTkSuQmCC","orcid":"","institution":"The Third Affiliated Hospital Of Southern Medical University","correspondingAuthor":true,"prefix":"","firstName":"Fangyuan","middleName":"","lastName":"Yang","suffix":""},{"id":491760841,"identity":"c84d66be-9aaf-4f0f-ab1d-4ab6ae8085de","order_by":1,"name":"Zhirui Zhou","email":"","orcid":"","institution":"The Third Affiliated Hospital Of Southern Medical University","correspondingAuthor":false,"prefix":"","firstName":"Zhirui","middleName":"","lastName":"Zhou","suffix":""},{"id":491760842,"identity":"62fb3e36-55be-40db-9e13-61c72cae7569","order_by":2,"name":"Yingshi Han","email":"","orcid":"","institution":"The Third Affiliated Hospital Of Southern Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yingshi","middleName":"","lastName":"Han","suffix":""},{"id":491760843,"identity":"e961c1a4-0523-4207-a52f-9fe0b92235f4","order_by":3,"name":"Ying Huang","email":"","orcid":"","institution":"The Third Affiliated Hospital Of Southern Medical University","correspondingAuthor":false,"prefix":"","firstName":"Ying","middleName":"","lastName":"Huang","suffix":""}],"badges":[],"createdAt":"2025-07-23 07:52:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7193492/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7193492/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":88000388,"identity":"93224a9e-3a1d-48a4-aa49-e61c6f15ec8f","added_by":"auto","created_at":"2025-07-31 10:19:57","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":27426856,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSLE platelets show low expression of GPX4.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A-B) Quantitative PCR analysis of \u003cem\u003eAnnexin V \u003c/em\u003eand \u003cem\u003eCD62P\u003c/em\u003e in HC and SLE platelets. (C-D) The percentage of the Annexin V\u003csup\u003e+\u003c/sup\u003e platelets was measured using flow cytometry in HC and SLE groups. (E-F) Western blot (WB) and quantification of Annexin V and CD62P in HC and SLE platelets. (G) LDH release by HC and SLE platelets. (H) Plasma oxidized DNA levels in HC and SLE patients.\u0026nbsp; (I) Representative electron microscopy images of platelets in HC and SLE patients. The scale bar represents 500 nm.\u0026nbsp; (J) Fluorescence detection of lipid peroxidation in platelets of HCs and SLE patients. \u0026nbsp;(K-L) Western blot (WB) and quantification of GPX4 in platelets from HC (n=23) and SLE patients (n=37). The relative protein expression was calculated by gray intensity analysis and compared with GAPDH. (M) Immunofluorescence staining of platelet GPX4 in heathy controls and SLE patients. *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001, ns = not significant. Data are shown as mean ± SD. Statistical analyses were conducted using Student’s t-test (A-J).\u003c/p\u003e","description":"","filename":"FIG1.png","url":"https://assets-eu.researchsquare.com/files/rs-7193492/v1/99623fcc02ae611480fdaf08.png"},{"id":88000385,"identity":"7e42dfb5-fdf3-41ed-a8f9-5f11db256a20","added_by":"auto","created_at":"2025-07-31 10:19:56","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":11350989,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe correlations between platelet GPX4 protein expression and clinical characteristics of SLE patients\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A-B) Western blot and quantification of platelet GPX4 expression in HC and SLE patients with SLEDAI-2K=0~6, SLEDAI-2K=7~12 and SLEDAI-2K≥13. (C) Platelet GPX4 levels were negatively correlated with SLE disease activity as measured by SLEDAI-2K score (r=-0.6072, p=0.0008). (D) Platelet GPX4 levels were also negatively associated with 24-hour urine protein (r=-0.5219, p=0.0381). (E-G) Platelet GPX4 levels positively correlated with platelet count (r=0.3723, p=0.0232), plateletcrit (r=0.3389, p=0.0432), but negatively correlated with large platelet ratio (r=-0.3876, p=0.0178). (H) Platelet GPX4 levels negatively correlated with plasma oxidized DNAlevels (r=-0.4034, p=0.0244). (I) Quantification of GPX4 expression in platelets of SLE patients with or without skin system involvement. (J) Quantification of GPX4 expression in platelets of SLE patients with or without joint system involvement. (K) Quantification of GPX4 expression in platelets of SLE patients with or without alopecia. (L) Quantification of GPX4 expression in platelets of SLE patients with or without serositis. *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001. Data are shown as mean ± SD. Statistical analyses were conducted using one-way analysis of variance followed by Dunnett’s multiple comparison test (B) or Student’s t-test (I-L).\u003c/p\u003e","description":"","filename":"FIG2.png","url":"https://assets-eu.researchsquare.com/files/rs-7193492/v1/a6f81e88ae0fc50e496841c1.png"},{"id":88000386,"identity":"dbbbd37b-a609-4f84-a8de-4dab23cb5a20","added_by":"auto","created_at":"2025-07-31 10:19:56","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":27877114,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGPX4 inhibition induces activation and ferroptosis of platelets in healthy controls.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A-B) WB and quantification of Annexin V and CD62P\u003cem\u003e \u003c/em\u003ein HC and SLE platelets in presence or absences of GPX4 inhibitor. (C-D) Quantitative PCR analysis of\u003cem\u003e Annexin V \u003c/em\u003eand \u003cem\u003eCD62P\u003c/em\u003e in platelets. (E) Assessment of platelet viability by LDH release assay. (F) Oxidized DNA levels in platelets by ELISA. (G) Representative electron microscopy images of platelets. The scale bar represents 500 nm. (H) Fluorescence detectionof lipid peroxidation in platelets. \u0026nbsp;*P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001. Data are shown as mean ± SD. Statistical analyses were conducted using one-way analysis of variance followed by Dunnett’s multiple comparison test (C-G).\u003c/p\u003e","description":"","filename":"FIG3.png","url":"https://assets-eu.researchsquare.com/files/rs-7193492/v1/b447975a0d7a393608392d6d.png"},{"id":88000387,"identity":"0934c2c5-ec07-4ef4-9600-dc918ff26924","added_by":"auto","created_at":"2025-07-31 10:19:56","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":27243886,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGPX4 activation inhibits ferroptosis and activation in platelets of SLE patients.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A-B) WB and quantification of Annexin V and CD62P in HC and SLE platelets in presence or absence of GPX4 activator. (C-D) Quantitative PCR analysis of \u003cem\u003eAnnexin V \u003c/em\u003eand \u003cem\u003eCD62P\u003c/em\u003e in platelets. (E) Assessment of platelet viability by LDH release assay. (F) Oxidized DNA levels in platelets by ELISA. (G) Representative electron microscopy images of platelets. The scale bar represents 500 nm. (H) Fluorescence detectionof lipid peroxidation in platelets. \u0026nbsp;*P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001. Data are shown as mean ± SD. Statistical analyses were conducted using one-way analysis of variance followed by Dunnett’s multiple comparison test (C-G).\u003c/p\u003e","description":"","filename":"FIG4.png","url":"https://assets-eu.researchsquare.com/files/rs-7193492/v1/6f708fc21e22be75066ead03.png"},{"id":88000390,"identity":"ca4568ff-2f1a-4f66-8140-f7134e7c3e84","added_by":"auto","created_at":"2025-07-31 10:19:57","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":87625725,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of GPX4 activator treatment on MRL/lpr mice. \u0026nbsp;\u003c/strong\u003e(A) Overall animal experimental procedure. (C-D) Quantification and schematic diagram of \u0026nbsp;spleen. Levels of (B)urine protein, (E) anti-dsDNA IgG. (F) Renal pathological alteration by light microscopy. (G) IgG deposition in the kidneys. *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001. Data are shown as mean ± SD. Statistical analyses were conducted using one-way analysis of variance followed by Dunnett’s multiple comparison test (B, D-E).\u003c/p\u003e","description":"","filename":"Fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-7193492/v1/87994e64c669a0307ccc5f85.png"},{"id":88000389,"identity":"514a4a82-4f79-4120-829a-f36b6d3dd8e8","added_by":"auto","created_at":"2025-07-31 10:19:57","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":26338489,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGPX4 activation inhibits ferroptosis and activation in platelets of MRL/lpr mice.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A-B) Immunofluorescence staining of GPX4 in the platelets of MRL/Mpj mice, MRL/lpr mice with or without GPX4 activator treatment. (C) Fluorescence detection of lipid peroxidationin platelets of mice. (D) Assessment of platelet viability by LDH release assay. (E) Oxidized DNA levels in platelets of mice. *P \u0026lt; 0.05, **P \u0026lt; 0.01, ***P \u0026lt; 0.001. Data are shown as mean ± SD. Statistical analyses were conducted using one-way analysis of variance followed by Dunnett’s multiple comparison test (B, D-E).\u003c/p\u003e","description":"","filename":"Fig6.png","url":"https://assets-eu.researchsquare.com/files/rs-7193492/v1/1bab14ec094c2d65a82d8d81.png"},{"id":88000384,"identity":"0794f92e-89d1-4011-abe8-b3f0b33cb870","added_by":"auto","created_at":"2025-07-31 10:19:55","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":8488426,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eModel of promoting oxidized mtDNA release and \u0026nbsp;SLE progression by platelet ferroptosis. \u003c/strong\u003eSLE platelets with low expression of GPX4 were highly activated and susceptible to ferroptosis, and then released high levels of oxidized mtDNA. In MRL/\u003cem\u003elpr\u003c/em\u003e mice, treatment of GPX4 activators alleviated lupus-like features, inhibited platelet ferroptosis and reduced release of oxidized mtDNA.\u003c/p\u003e","description":"","filename":"Fig7.png","url":"https://assets-eu.researchsquare.com/files/rs-7193492/v1/ccbcfa74fad1cfb409bbe43c.png"},{"id":88002611,"identity":"0ff73fd6-9d15-4217-8d64-732630350036","added_by":"auto","created_at":"2025-07-31 10:27:55","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":10750,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTable 1. Demographic, laboratory and clinical characteristics of the subjects.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Table1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7193492/v1/0e69cfb66979d39139e65344.xlsx"},{"id":88000380,"identity":"27df729b-1116-45fb-b30d-e9c4399b5649","added_by":"auto","created_at":"2025-07-31 10:19:55","extension":"xlsx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":12160,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTable 2. Correlations between platelet GPX4 protein expression and clinical characteristics of SLE patients.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"Table2.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7193492/v1/1e14b9d20765ea725a01f68c.xlsx"},{"id":88000382,"identity":"a5e5a32d-eef8-484c-bbb1-e811ce10bddf","added_by":"auto","created_at":"2025-07-31 10:19:55","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":325126,"visible":true,"origin":"","legend":"Original western blots.","description":"","filename":"Originalwesternblots.docx","url":"https://assets-eu.researchsquare.com/files/rs-7193492/v1/8d9337e10419bffbd20809c6.docx"}],"financialInterests":"There is no conflict of interest","formattedTitle":"Platelet ferroptosis promotes oxidized mtDNA release and SLE progression","fulltext":[{"header":"Introduction","content":"\u003cp\u003eSystemic lupus erythematosus (SLE) is a chronic inflammatory systemic disorder clinically characterized by a global loss of immune tolerance and activation of both innate and adaptive immune systems\u0026nbsp;[1]. A study has shown that the prevalence of SLE ranges from 50 to 100 cases per 100,000 individuals[2]. Patients suffer from SLE may present with severe symptoms that significantly impair their quality of life\u0026nbsp;[3], and the disease is one of the leading causes of death in young women[4]. SLE exhibits multiple pathogenic features, including genetic factors of susceptibility, type I IFN signature and loss of tolerance against nuclear components. However, the exact mechanisms remain elusive[5].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eEmerging evidence proves that platelet activation triggers SLE pathogenesis by inducing the release of inflammatory cytokines and mtDNA, ultimately resulting in microvascular thrombosis\u0026nbsp;[6]. Thrombocytopenia and/or decreased platelet volume have been observed in SLE patients. It has been reported that the prevalence of thrombocytopenia in SLE is about 15%, higher than that of leukopenia (14%) and anemia (2%), and thrombocytopenia negatively correlated with lupus disease activity[7]. SLE-related thrombocytopenia may result from multiple mechanisms, including impaired platelet production, increased splenic sequestration or peripheral destruction.\u0026nbsp;[8]\u0026nbsp;Platelet clearance due to desialylation could also be relevant mechanisms leading to SLE-associated thrombocytopenia, which is evidenced by elevated desialylation biomarkers in SLE patients\u0026rsquo; plasma\u0026nbsp;[9]. CD8 T cells drive this process via directly destroy platelets or express Neuraminidase 1 (Neu1) and Neuraminidase 3 (Neu3) to induce platelet desialylation\u0026nbsp;[10]. Platelet apoptosis has also been reported in SLE disease\u0026nbsp;[11]. However, the predominant forms in platelet death remain unverified.\u003c/p\u003e\n\u003cp\u003eFerroptosis is an iron-mediated form of regulated cell death driven by toxic accumulation of lipid peroxidase and iron overload. It exhibits distinct mechanisms and morphology from apoptosis and necroptosis\u0026nbsp;[12].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eGlutathione peroxidase 4 (GPX4) is a major factor which can directly neutralize lipid peroxidation by oxidizing glutathione (GSH) to glutathione disulfide (GSSG), converting toxic lipid peroxides to non-toxic alcohols [13], leading to a reduction in damage to membrane function and the mitigation in ferroptosis [14, 15]. In this study, we demonstrated that SLE platelets with low expression of GPX4 are more prone to ferroptosis.\u003c/p\u003e"},{"header":"Subjects and methods","content":"\u003cp\u003e\u003cstrong\u003ePatients\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAccording to guidelines from 1997 revised American College of Rheumatology (ACR) classification criteria, patients with SLE were recruited at the Department of Rheumatology, the Third Affiliated Hospital, Southern Medical University, between June 2022 and March 2025. Patients with the following conditions were excluded: acute and/or chronic severe infection, pregnancy and lactation, malignancy, and unstable medical conditions. In addition, age- and gender-matched healthy volunteers without a history of SLE or other immune diseases were enrolled as healthy controls (HCs). Approval of this study was granted by the Ethics Committee Office of the Third Affiliated Hospital, Southern Medical University (No. 2022-Ethical Approval-047), and written informed consent was obtained from all participants.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eSerological assays and clinical assessments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAnalysis of SLE subgroups is increasingly important for better understanding the pathogenesis of disease and providing more customized medical plans. Thus, correlations of the protein level of GPX4 in platelets with serological features, organ involvement, and disease activity were evaluated in SLE patients. We collected \u0026nbsp; \u0026nbsp; demographic and laboratory data from the medical records, including age, gender,\u0026nbsp;\u003c/p\u003e\n\u003cp\u003einflammatory markers (CRP and ESR), serum total immunoglobulin (IgG, IgA, IgM),\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ecomplements (C3, C4, C1q), D-dimer, fibrinogen, peripheral blood cell count (leukocyte count, hemoglobin, platelet count), platelet distribution width, mean platelet volume, large platelet ratio, plateletcrit, autoantibodies (including 9 autoantibodies, such as anti-dsDNA antibody, anti-RNP antibody, anti-Smith antibody, etc.), 24-hour urine protein and serum lipid concentrations. The criteria for organs involvement set in this study are as follows: serositis including pericarditis (confirmed by cardiac ultrasound) and pleuritis (confirmed by CT); blood system involvement, including hemolytic anemia (coombs test positive), thrombocytopenia (\u0026lt;1,000/mm\u003csup\u003e3\u003c/sup\u003e), leukopenia (\u0026lt;4,000/mm\u003csup\u003e3\u003c/sup\u003e), lymphopenia (\u0026lt;1,000/mm\u003csup\u003e3\u003c/sup\u003e); brain involvement, including epilepsy or psychosis, excluding drugs or known metabolic disorders; alopecia defined as first or recurrent patchy or diffuse alopecia; skin involvement defined as first or recurrent inflammatory rashes; joint involvement defined as arthritis (tenderness, swelling or fluid accumulation), involving two or more peripheral joints; fever defined as temperature exceeds 38 ℃, excluding infection. The SLE Disease Activity Index (SLEDAI)-2K was used to determine disease activity of SLE patients by two professional rheumatologists.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIsolation of platelets\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eVenous blood samples (6 mL) were drawn from patients with SLE when they were enrolled on the first day using blood collection tubes containing acid citrate dextrose (ACD) anti-coagulant. Briefly, platelet-rich plasma (PRP) was centrifuged at 260 g at 25 °C for 15 minutes. PRP was then treated with 100 nM prostaglandin E1 (Sigma, catalog no. 745-65-3) and centrifuged at 1,000 g for 10 minutes. After discarding the supernatant, the platelet pellet was washed twice by suspending them in Tyrodes buffer and centrifuging at 1,000 g for 10 minutes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePlatelet activation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCells were treated with FITC conjugated Annexin-V (Sigma-Aldrich, Annexin V-FITC, Apoptosis\u0026nbsp;probe FITC) (4 μL) for 15 minutes at room temperature before fixing with binding buffer for 15 minutes in dark. Platelets were then washed, and fluorescence was measured using flow cytometry (BD FACSCelesta).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantitative reverse transcription-polymerase chain reaction (RT-qPCR)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from cells using TRIzol reagent (Takara, 9109). The cDNA was reverse transcribed using HiScript\u0026nbsp;Ⅲ\u0026nbsp;RT SuperMix (Vazyme, R323), and qPCR was performed by Roche LightCycler® 96 with the following primers: human \u003cem\u003eAnnexin V\u0026nbsp;\u003c/em\u003e(forward primer 5’- AACCCTCTCGGCTTTATGATGC -3’ and reverse primer 5’- CGCTGGTAGTACCCTGAAGTG-3’); human\u003cem\u003e\u0026nbsp;CD62P\u0026nbsp;\u003c/em\u003e(forward primer 5’- ACTGCCAGAATCGCTACACAG-3’ and reverse primer 5’- CACCCATGTCCATGTCTTATTGT -3’); human \u003cem\u003eGAPDH\u003c/em\u003e (forward primer 5’-CTGTTCGACAGTCAGCCGCATC-3’) and reverse primer 5’- GCGCCCAATACGACCAAATCCG -3’).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blot\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePlatelets were collected and lysed using protein lysis buffer containing a protease inhibitor cocktail (Abcam, catalog no. ab65621). Total proteins were separated by SDS-PAGE and then transferred to polyvinylidene difluoride membranes. Nonspecific binding was blocked with 5% nonfat milk at room temperature for 1 hour. The membranes were incubated with the following primary antibodies overnight at 4°C: anti-GPX4 (Proteintech, 1:2,000, catalog no.67763-1-Ig), anti-GAPDH (Proteintech, 1:5,0000, catalog no.60004-1-Ig). The membranes were then incubated with appropriate secondary antibodies (1:5,000). Relative intensities were quantified using Image Lab (Tanon 5200) using enhanced chemiluminescence (Abcam, catalog no.PK10001).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunofluorescence\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor\u0026nbsp;GPX4 immunofluorescence analysis, platelets were fixed and incubated with anti-GPX4 antibodies (Proteintech, 1:200, catalog no.67763-1-Ig) at 4 ℃ overnight. Secondary antibodies included Alexa Fluor 647-conjugated anti-mouse antibody (Abcam, 1:200, catalog no. ab150115). For\u0026nbsp;IgG\u0026nbsp;immunofluorescence\u0026nbsp;analysis,\u0026nbsp;kidney tissue sections\u0026nbsp;were fixed and incubated with\u0026nbsp;anti-mouse IgG\u0026nbsp;antibody\u0026nbsp;(Thermofisher, 1:400, catalog\u0026nbsp;A32723)\u0026nbsp;at 4\u0026nbsp;℃ overnight.\u0026nbsp;Cells\u0026nbsp;and sections\u0026nbsp;were captured using fluorescence microscope (×20\u0026nbsp;immersion lens, Olympus).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eLactate dehydrogenase (LDH) assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePlatelets (8×10\u003csup\u003e7\u003c/sup\u003e cells/mL) were treated with or without deferoxamine\u0026nbsp;(DFO) (Sigma-Aldrich, D9533-1G) (100 μM) for 24 hours at 37 °C and platelets were pelleted by centrifugation at 1000×g for 10 minutes. The supernatant was collected and used to detect LDH release using LDH kit (Promega, LDH-Glo™ Cytotoxicity Assay) according to the manufacturer's protocol.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eQuantification of oxidized DNA levels\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCell-free plasma samples or supernatant of platelets were used to quantify\u0026nbsp;oxidized DNA levels by using a general 8-OHdG ELISA kit\u0026nbsp;(Develop, dl-8-OHdG-Ge) according to manufacturer's instructions.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eIntracellular lipid peroxidation assays\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLipid peroxidation in platelets was detected by Beyotime Lipid Peroxidation Detection Kit (BODIPY581/591C11) (S0043). Cells were captured using immunofluorescence microscopy (Olympus).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTransmission Electron Microscopy\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCentrifuge to collect freshly isolated or cultured platelets (1000 g for 10 minutes) until a visible cell pellet. Discard the culture medium and add electron microscopy fixative to fix the cells at room temperature for 2 hours. The sample was examined under the TEM-1400 plus electron microscope. Electron micrographs were taken at 5,000–50,000-fold magnification. Platelets from SLE patients and \u0026nbsp;HCs were evaluated for mitochondrial vacuolization by transmission electron microscopy.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInhibition and activation of GPX4 in platelets\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor GPX4 inhibition, platelets of healthy controls were treated with GPX4-IN-3 (HY-141809). For GPX4 activation, platelets of SLE patients were treated with GPX4 activator (HY-161928). All of them were treated for 24 hours or 48 hours and the cells were harvested for RNA or protein detection.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnimal experiment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEight-week-old female MRL/\u003cem\u003elpr\u003c/em\u003e mice and MRL/Mpj mice were purchased from SHANGHAI SLAC LABORATORY ANIMAL CO. LTD. After being raised to 10 weeks of age, MRL/\u003cem\u003elpr\u003c/em\u003e mice (n=6) were orally treated with 25 mg/kg GPX4 activator every two days for 10 weeks. Vehicle-treated MRL/\u003cem\u003elpr\u003c/em\u003e mice (n=6) received the same volume of solvent alone. All mice were housed in a special pathogen-free environment. All procedures were received and supervised by the Animal Care and Use Committee of Southern Medical University. Urine protein was assessed using urine protein test strips weekly. All mice were anesthetized at the age of 20 weeks. Serum was collected from peripheral blood. Spleens, lymph nodes and kidneys were collected. Standard hematoxylin \u0026amp; eosin (H\u0026amp;E), periodic acid–Schiff (PAS) and masson staining were performed, and results were assessed by experienced pathologists.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data were analyzed using GraphPad Prism 8 (version 8.0) software and the images were processed by Adobe Photoshop 2020. Quantitative data were presented as the mean ± standard deviation (SD), and categorical variables were expressed as numbers or percentages. Data with a Gaussian distribution was analyzed using an unpaired t test or one-way analysis of variance (ANOVA), and categorical data were compared by the chi-square test. Spearman’s correlation analysis was used to analyze the correlation of GPX4 protein levels with clinical characteristics.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003ePlatelets from SLE patients are\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003ehighly activated and\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003emore prone to ferroptosis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAt first, the numbers of CD62P-positive and Annexin V-positive cells were higher in platelets from SLE patients than in those from healthy controls (Fig.1A-F), indicating activation of SLE platelets. We also found that SLE platelets could release higher levels of LDH than HC platelets (Fig.1G), suggesting that SLE platelets undergo necrosis. To identify whether ferroptosis occurs in SLE platelets, we isolated platelets and conducted a series of tests. High levels of intracellular lipid peroxides were detected in SLE platelets by Beyotime Lipid Peroxidation Detection Kit (Fig.1J). Further investigation via electron microscopy revealed that a substantial fraction of platelets extracted from SLE patients displayed hallmark mitochondria features of ferroptosis characterized by reduction in mitochondrial volume, heightened mitochondrial membrane density and loss of mitochondrial cristae (Fig.1I). To further confirm the expression of GPX4, the key regulator of ferroptosis, in SLE platelets, we isolated platelets from SLE patients (n=37) and healthy controls (n=23), and further performed Western blot and immunofluorescence analysis. Clinical and demographic characteristics of SLE patients were shown in Table 1. The mean age of SLE patients was 37 years and 97% of patients were female. Low expression of GPX4 was observed in platelets from SLE patients compared to healthy controls (Fig.1K-M). These results suggested that platelets of SLE patients are highly activated and more prone to ferroptosis.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGPX4 expression of SLE platelets was strongly correlated with SLE disease activity\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDue to the inability to quantitatively measure other ferroptosis indicators,we selected expression of the key protein of ferroptosis-GPX4 to represent for\u0026nbsp;ferroptosis, to conduct the following correlation analysis. According to the SLEDAI-2K score, the severity of SLE disease is classified into mild activity (SLEDAI-2K= 0~6), moderate activity (SLEDAI-2K=7~12) and severe activity (SLEDAI-2K≥13). As figure 2 shows, protein\u0026nbsp;expression of GPX4 in\u0026nbsp;platelets\u0026nbsp;was low in SLE patients with moderate\u0026nbsp;activity and lower in\u0026nbsp;SLE patients with\u0026nbsp;severe activity (Fig.2A-B). Next, we analyzed the correlations between protein expression of platelet GPX4 and clinical characteristics of SLE patients (Table 2). Importantly, platelet GPX4 expression\u0026nbsp;was negatively correlated with SLEDAI-2K score (r=-0.6072, p=0.0008) (Fig.2C) and\u0026nbsp;24-hour urine protein (r=-0.5219, p=0.0381) (Fig.2D). By contrast, platelet GPX4 expression was positively associated with platelet count (r=0.3723, p=0.0232) (Fig.2E), plateletcrit (r=0.3389, p=0.0432) (Fig.2F). Furthermore, we investigated platelet GPX4 protein expression in SLE patients involved with or without different organ systems (Fig.2I-L). SLE patients involved with skin or joint system had a marked reduction in GPX4 protein expression (Fig.2I-J). However, no significant difference was observed in those involved with\u0026nbsp;alopecia\u0026nbsp;and serositis\u0026nbsp;(Fig.2K-L). These data indicated that ferroptosis of SLE platelets was associated with disease activity, kidney damage and involvement of skin and joint in SLE patients.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInhibition of GPX4 induces\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eactivation and ferroptosis in platelets of healthy controls\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo investigate the effect of GPX4 inhibition on platelet activation and ferroptosis, we isolated platelets from healthy controls and then stimulated HC platelets with GPX4-IN-3, an efficient GPX4 inhibitor. The numbers of CD62P-positive and Annexin V-positive cells were increased after stimulation with GPX4-IN-3 (Fig.3A-D). Moreover,GPX4-IN-3 stimulation resulted in an increased release of LDH (Fig.3E) and high levels of intracellular lipid peroxides, as SLE platelets presented (Fig.3G). Electron microscopy revealed that GPX4-IN-3-stimulated platelets were observed with similar mitochondrial morphological alterations to the SLE platelets (Fig.3H). The above results demonstrated that inhibition of GPX4 induces activation and ferroptosis in HC platelets.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGPX4 activation inhibits\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eactivation and ferroptosis in platelets\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eof SLE patients\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo further verify the effect of GPX4 activator on platelet activation and ferroptosis, we treated SLE platelets with GPX4 activator. Contrary to GPX4 inhibition, GPX4 activation reduced ferroptosis in SLE patients, characterized by decreased release of LDH, low expression of intracellular lipid peroxides and reduction of mitochondrial damage (Fig.4A-H). And GPX4 activation also decreased the numbers of CD62P-positive and Annexin V-positive cells. These findings illustrate that GPX4 activation can suppress activation and ferroptosis in platelets of SLE patients. The drugs targeting GPX4 activation may be a potential treatment for SLE patients.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePlatelet ferroptosis results in the release of oxidized mitochondrial DNA\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSimilar to previous studies, the concentration of oxidized DNA was significantly increased in the plasma of SLE patients (Fig.1H). Because of high immunogenicity, oxidized DNA has been reported to play a critical role in SLE pathogenesis. However, the source and molecular mechanism of oxidized DNA is not yet fully clarified. Interestingly, we demonstrated for the first time that the levels of GPX4 protein in SLE platelets were negatively related to plasma oxidized DNA levels (r=-0.4034, p=0.0244, Fig.2H), documenting platelet ferroptosis may be a main source of extracellular oxidized DNA in SLE patients. Moreover, compared with HC platelets, SLE platelets released high levels of oxidized DNA (Fig.3F). Oxidized DNA levels were notably increased in the supernatant of HC platelets with GPX4 inhibition (Fig.3F), but decreased in that of SLE platelets treated with GPX4 activation (Fig.4F). In combination with the fact that platelets are anucleate, but contain mitochondria, these results indicate that platelet ferroptosis leads to release of oxidized mitochondria DNA (mtDNA).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGPX4 activator treatment alleviates lupus-like manifestations in MRL/\u003cem\u003elpr\u0026nbsp;\u003c/em\u003emice\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConsidering that GPX4 expression in SLE platelets strongly associated with SLE disease activity, we speculate that the GPX4 downregulation-mediated ferroptosis plays an important role in SLE progression. And thus, we evaluated the effect of GPX4 activator on SLE development using a spontaneous lupus model mice-MRL/\u003cem\u003elpr\u003c/em\u003e mice in present study. Administration of vehicle or GPX4 activator started at the age of 10 weeks and continued to the age of 20 weeks in MRL/\u003cem\u003elpr\u003c/em\u003e mice (Fig.5A). Clinically, anti-dsDNA antibodies serve as an indicator for assessing the disease activity of SLE patients. \u0026nbsp;MRL/\u003cem\u003elpr\u003c/em\u003e mice also showed high levels of circulating anti-dsDNA antibodies, but the treatment of GPX4 activator markedly reduced this antibody levels of MRL/\u003cem\u003elpr\u003c/em\u003e mice (Fig.5E). Furthermore, GPX4 activator treatment resulted in a reduction of spleen weight, limiting lupus splenomegaly (Fig.5C-D). Renal disease development in MRL/\u003cem\u003elpr\u003c/em\u003e mice was characterized by a marked increase in proteinuria. Importantly, the levels of urinary protein excretion were significantly decreased in MRL/\u003cem\u003elpr\u003c/em\u003e mice treated with GPX4 activator (Fig.5B). The renal pathological changes in MRL/\u003cem\u003elpr\u003c/em\u003e mice were also evaluated by using H\u0026amp;E, PAS, and Masson staining after treatment with either vehicle or GPX4 activator. Significant kidney pathological damage was observed in MRL/\u003cem\u003elpr\u003c/em\u003e mice compared to their MRL/Mpj counterparts (Fig.5F). Administration of GPX4 activator resulted in a reduction in glomerular hypercellularity, mesangial expansion, crescent formation, and tubulointerstitial injury (Fig.5F). Additionally, IgG deposition in the kidneys was markedly decreased in GPX4 activator-treated MRL/\u003cem\u003elpr\u003c/em\u003e mice (Fig.5G). Taken together, these results indicate that the GPX4 activator effectively alleviates lupus-related damage in MRL/\u003cem\u003elpr\u003c/em\u003e mice.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTreatment of MRL/\u003cem\u003elpr\u003c/em\u003e mice with GPX4 activator prevents platelets from ferroptosis \u0026nbsp;in vivo\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe expression of GPX4 in platelets of GPX4 activator-treated MRL/lpr mice has no significant difference with that of vehicle-treated MRL/\u003cem\u003elpr\u003c/em\u003e mice (Fig.6A-B). However, platelets of GPX4 activator-treated MRL/\u003cem\u003elpr\u003c/em\u003e mice exhibited a decreased level of intracellular lipid peroxides (Fig.6C). Besides, LDH (Fig.6D) and oxidized DNA (Fig.6E) in serum were all decreased in platelets of MRL/\u003cem\u003elpr\u003c/em\u003e mice after GPX4 activator treatment. Collectively, our findings demonstrate that treatment of GPX4 activator can inhibit ferroptosis and oxidized DNA release in platelets of MRL/\u003cem\u003elpr\u003c/em\u003e mice.\u0026nbsp;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThrombocytopenia is a common hematological manifestation of SLE and also an important indicator for evaluating disease activity. Severe thrombocytopenia is often associated with a high mortality rate of SLE[16]. Previous studies have reported that thrombocytopenia is mainly due to excessive platelet destruction and defects in platelet production from megakaryocytes[17]. Although platelet apoptosis has been documented as a clearance mechanism in SLE\u0026nbsp;[11], the contribution of other form of programmed death pathways to thrombocytopenia remain poorly defined. While platelet pyroptosis exacerbates inflammation in sepsis, its role in SLE remains unexplored\u0026nbsp;[18]. Herein, we identified ferroptosis as a new and major form of platelet death and driven thrombocytopenia in SLE, although the contribution of apoptosis cannot be excluded. The pathogenic role of platelet ferroptosis in SLE was further validated in vivo by the findings that treatment of ferroptosis inhibitor resulted in the alleviation of lupus-like disease in MRL/\u003cem\u003elpr\u003c/em\u003e mice. Collectively, our research results partially explain the cause of thrombocytopenia and extend previous understanding of platelet death, providing a missing link among platelet ferroptosis, thrombocytopenia and disease progression in SLE.\u003c/p\u003e\n\u003cp\u003eFerroptosis can be induced by excessive oxidative modification of polyunsaturated fatty acids and the inhibition of GPX4\u0026nbsp;[19]. In this study, we observed that GPX4 expression was decreased in SLE platelets. In vitro, GPX4 inhibitor induced ferroptosis in HC platelets while GPX4 activator inhibited ferroptosis in SLE platelets. This study highlights the factthat decreased levels of GPX4 may contribute to platelet ferroptosis in SLE. However, further efforts are needed to explore the exact mechanisms of low expression of GPX4, especially the degradation of GPX4 protein. Our results further revealed that platelet GPX4 levels are negatively correlated with SLEDAI-2K score, 24-hour urine protein and positively correlated with platelet count in SLE patients. In addition, lower levels of GPX4 in platelets were observed in SLE patients with skin or joint systems involvement. These findings emphasize again the pathogenic role of GPX4 downregulation-mediated ferroptosis in SLE. Moreover, the amelioration of lupus-like disease in MRL/lpr mice by treating with GPX4 activator highlights the importance of targeting GPX4 and platelet ferroptosis in the treatment of SLE.\u003c/p\u003e\n\u003cp\u003eNecrosis can induce immune response and aggravate inflammation, critically depending on the release of damage-associated molecular patterns (DAMPs)[20]. The cell death of platelets, the most abundant cells in the peripheral blood, represents one dominant source of DAMPs in our body. Previous studies have demonstrated that ferroptosis results in the production of DAMPs, such as HMGB1 and LL-37[21, 22]. Of note, platelets are key sources of mitochondrial DNA in SLE\u0026nbsp;[23]. In the present study, we found that platelet GPX4 levels in SLE patients negatively correlated with plasma oxidized DNA concentration and further identified that platelet ferroptosis contributed to the release of oxidized mtDNA. As an important DAMPs, ox-mtDNA can trigger proinflammatory and type I interferon (IFN) responses that can ignite human autoimmunity and chronic inflammation\u0026nbsp;[24]. Taking together, these findings update our understanding of the underlying mechanism of oxidized mtDNA release by platelets-ferroptosis and partially explain how platelet ferroptosis participates in SLE occurrence and progression. However, further studies are needed to delineate in detail mechanisms whereby platelet ferroptosis boosts inflammation in SLE.\u003c/p\u003e\n\u003cp\u003eIn conclusion, our study demonstrates the important role of GPX4-mediated ferroptosis of platelets in the pathogenesis of SLE and provides a potential therapeutic approach targeting GPX4 in SLE.\u0026nbsp;\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData availability\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRestrictions apply to the availability of these data, and they are not publicly available because they contain information of electronic health records and human genetic data, consented for research use by investigators. Making the data publicly available without additional consent or ethical approval might compromise patients\u0026rsquo; privacy and the original ethical approval. However, data are available from the corresponding author ([email protected]) upon reasonable request and with the ethical permission of the institution.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eContribution statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYi He, Jiaochan Han and Fangyuan Yang conceived and designed the study. Zhirui Zhou, Yingshi Han, Ying Huang, Wanfen Li, Meichen Ai, Jian Zhuang and Pan Liao recruited patients and collected the data. Zhirui Zhou, Yingshi Han and Ying Huang conducted these experiments and analysed all these datas. Zhirui Zhou and Ying Huang wrote the first draft of the manuscript, Yi He and Fangyuan Yang contributed to critical revision of the manuscript for important intellectual content. All authors have given the final approval of the manuscript for submission and publication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by grants from National Natural Science Foundation of China (82471843), Guangzhou Science and Technology Program Project (Grant No. 202201010926 and No. SL2022A03J01194), International Science and Technology Cooperation Program of Guangdong, China (2022A0505050040), President Foundation of The Third Affiliated Hospital of Southern Medical University, Guangzhou, China (YL202205), Hunan Provincial Department of Education Outstanding Youth Project (24B1089) \u0026nbsp;and Clinical Medical Technology Demonstration Base for rheumatological immunology of HuaiHua (2022N2403).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and material\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets generated and/or analyzed during the current study are available from the corresponding author on reasonable request.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study has been approved by the Ethics Committee of The Third Affiliated\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eHospital of Southern Medical University. All patients gave their informed consent to the study.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors declare that they have no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eTsokos, G.C., Systemic lupus erythematosus. N Engl J Med, 2011. 365(22): p. 2110-21.\u003c/li\u003e\n\u003cli\u003eYu, H., Y. Nagafuchi and K. Fujio, Clinical and Immunological Biomarkers for Systemic Lupus Erythematosus. Biomolecules, 2021. 11(7).\u003c/li\u003e\n\u003cli\u003eConnelly, K., et al., Towards a novel clinical outcome assessment for systemic lupus erythematosus: first outcomes of an international taskforce. Nat Rev Rheumatol, 2023. 19(9): p. 592-602.\u003c/li\u003e\n\u003cli\u003eYen, E.Y. and R.R. Singh, Brief Report: Lupus-An Unrecognized Leading Cause of Death in Young Females: A Population-Based Study Using Nationwide Death Certificates, 2000-2015. Arthritis Rheumatol, 2018. 70(8): p. 1251-1255.\u003c/li\u003e\n\u003cli\u003eScherlinger, M., et al., Systemic lupus erythematosus and systemic sclerosis: All roads lead to platelets. Autoimmun Rev, 2018. 17(6): p. 625-635.\u003c/li\u003e\n\u003cli\u003eNhek, S., et al., Activated Platelets Induce Endothelial Cell Activation via an Interleukin-1beta Pathway in Systemic Lupus Erythematosus. Arterioscler Thromb Vasc Biol, 2017. 37(4): p. 707-716.\u003c/li\u003e\n\u003cli\u003eAbdel Galil, S.M., et al., Prognostic significance of platelet count in SLE patients. Platelets, 2017. 28(2): p. 203-207.\u003c/li\u003e\n\u003cli\u003eLinge, P., et al., The non-haemostatic role of platelets in systemic lupus erythematosus. Nat Rev Rheumatol, 2018. 14(4): p. 195-213.\u003c/li\u003e\n\u003cli\u003eBaroni Pietto, M.C., et al., Pathogenic mechanisms contributing to thrombocytopenia in patients with systemic lupus erythematosus. Platelets, 2022. 33(5): p. 743-754.\u003c/li\u003e\n\u003cli\u003eVrbensky, J.R., et al., Increased cytotoxic potential of CD8(+) T cells in immune thrombocytopenia. Br J Haematol, 2020. 188(5): p. e72-e76.\u003c/li\u003e\n\u003cli\u003eZheng, S.S., et al., Antiplatelet antibody predicts platelet desialylation and apoptosis in immune thrombocytopenia. Haematologica, 2022. 107(9): p. 2195-2205.\u003c/li\u003e\n\u003cli\u003eLi, P., et al., Glutathione peroxidase 4-regulated neutrophil ferroptosis induces systemic autoimmunity. Nat Immunol, 2021. 22(9): p. 1107-1117.\u003c/li\u003e\n\u003cli\u003eMaiorino, M., M. Conrad and F. Ursini, GPx4, Lipid Peroxidation, and Cell Death: Discoveries, Rediscoveries, and Open Issues. Antioxid Redox Signal, 2018. 29(1): p. 61-74.\u003c/li\u003e\n\u003cli\u003eAlim, I., et al., Selenium Drives a Transcriptional Adaptive Program to Block Ferroptosis and Treat Stroke. Cell, 2019. 177(5): p. 1262-1279.e25.\u003c/li\u003e\n\u003cli\u003eIngold, I., et al., Selenium Utilization by GPX4 Is Required to Prevent Hydroperoxide-Induced Ferroptosis. Cell, 2018. 172(3): p. 409-422.e21.\u003c/li\u003e\n\u003cli\u003ePratama, Y.S., et al., Autoimmune Thrombocytopenia in SLE and COVID-19. Eur J Case Rep Intern Med, 2021. 8(11): p. 002863.\u003c/li\u003e\n\u003cli\u003eJiang, Y., et al., Systemic lupus erythematosus-complicating immune thrombocytopenia: From pathogenesis to treatment. J Autoimmun, 2022. 132: p. 102887.\u003c/li\u003e\n\u003cli\u003eSu, M., et al., Gasdermin D-dependent platelet pyroptosis exacerbates NET formation and inflammation in severe sepsis. Nat Cardiovasc Res, 2022. 1(8): p. 732-747.\u003c/li\u003e\n\u003cli\u003eStockwell, B.R., et al., Ferroptosis: A Regulated Cell Death Nexus Linking Metabolism, Redox Biology, and Disease. Cell, 2017. 171(2): p. 273-285.\u003c/li\u003e\n\u003cli\u003eYang, F., et al., Programmed Cell Death Pathways in the Pathogenesis of Systemic Lupus Erythematosus. J Immunol Res, 2019. 2019: p. 3638562.\u003c/li\u003e\n\u003cli\u003eWen, Q., et al., The release and activity of HMGB1 in ferroptosis. Biochem Biophys Res Commun, 2019. 510(2): p. 278-283.\u003c/li\u003e\n\u003cli\u003eLiu, Z., et al., Antimicrobial peptide CRAMP/LL-37 mediates ferroptosis resistance in cardiomyocytes by inhibiting cathepsin L. Basic Res Cardiol, 2025.\u003c/li\u003e\n\u003cli\u003eMelki, I., et al., Platelets release mitochondrial antigens in systemic lupus erythematosus. Sci Transl Med, 2021. 13(581).\u003c/li\u003e\n\u003cli\u003eXian, H. and M. Karin, Oxidized mitochondrial DNA: a protective signal gone awry. Trends Immunol, 2023. 44(3): p. 188-200.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTables 1 and 2 are available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":false,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Systemic lupus erythematosus, Ferroptosis, Glutathione peroxidase 4, Platelets, Oxidized DNA","lastPublishedDoi":"10.21203/rs.3.rs-7193492/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7193492/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e Ferroptosis is a recently identified type of regulated necrosis and glutathione peroxidase 4 (GPX4) has been recognized as a key enzyme that protects against ferroptosis. However, the role of platelet ferroptosis in systemic lupus erythematosus (SLE) has not been explored.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods: \u003c/strong\u003eGPX4 protein expression in platelets was detected by Western blot and immunofluorescence analysis. The correlation of platelet GPX4 expression with SLE clinical characteristics was evaluated. The ability of platelet activation and ferroptosis was detected and the release of oxidized DNA by platelets was tested. In addition, GPX4 inhibitor and activator were used to evaluate the effect of GPX4 on platelet ferroptosis and oxidized DNA release. Finally, MRL/\u003cem\u003elpr\u003c/em\u003emice were treated with GPX4 activator or vehicle and the severity of lupus disease was assessed.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e Platelets of SLE patients showed lower expression of GPX4 than that of healthy controls. The expression of GPX4 in SLE platelets was negativelycorrelated with disease activity and plasma oxidized DNA. SLE platelets with low expression of GPX4 were highly activated and susceptible to ferroptosis and resulting in elevated release of oxidized DNA. In vitro, GPX4 inhibitor induced ferroptosis and oxidized DNA release from healthy control platelets, whereas the GPX4 activator protected SLE platelets from ferroptosis and inhibited the release of oxidized DNA. In MRL/\u003cem\u003elpr\u003c/em\u003emice, treatment of GPX4 activator alleviated lupus-like features, inhibited platelet ferroptosis and reduced the release of oxidized DNA.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions: \u003c/strong\u003eThese findings demonstrate that SLE platelets exhibit low GPX4 expression and are more susceptible to ferroptosis, highlighting the critical role of GPX4 downregulation-mediated platelet ferroptosis in the development of SLE. Therefore, activation of GPX4 may represent a therapeutic strategy for SLE.\u003c/p\u003e","manuscriptTitle":"Platelet ferroptosis promotes oxidized mtDNA release and SLE progression","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-07-31 10:19:50","doi":"10.21203/rs.3.rs-7193492/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"1286bda1-1581-47ce-ab77-2c656216b3a5","owner":[],"postedDate":"July 31st, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":52204874,"name":"Biological sciences/Immunology/Cell death and immune response"},{"id":52204875,"name":"Biological sciences/Drug discovery/Biomarkers/Prognostic markers"}],"tags":[],"updatedAt":"2025-09-08T10:06:03+00:00","versionOfRecord":[],"versionCreatedAt":"2025-07-31 10:19:50","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7193492","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7193492","identity":"rs-7193492","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00