Epitalon increases telomere length in human cell lines through telomerase upregulation or ALT activity | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Epitalon increases telomere length in human cell lines through telomerase upregulation or ALT activity Sarah Al-dulaimi, Ross Thomas, Sheila Matta, Terry Roberts This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7066545/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract Epitalon, a naturally occurring tetrapeptide, is known for its anti-aging effects on mammalian cells. This happens through the induction of telomerase enzyme activity, resulting in the extension of telomere length. A strong link exists between telomere length and aging-related diseases. Therefore, telomeres are considered to be one of the biomarkers of aging, and increasing or maintaining telomere lengths may contribute to healthy aging and longevity. Epitalon has been the subject of several anti-aging studies however, quantitative data on the biomolecular pathway leading to telomere length increase, hTERT mRNA expression, telomerase enzyme activity, and ALT activation have not been extensively studied in different cell types. In this article, the breast cancer cell lines 21NT, BT474, and normal epithelial and fibroblast cells were treated with epitalon then DNA, RNA, and proteins were extracted. qPCR and Immunofluorescence analysis demonstrated dose-dependent telomere length extension in normal cells through hTERT and telomerase upregulation. In cancer cells, significant telomere length extension also occurred through ALT (Alternative Lengthening of Telomeres) activation. Only a minor increase in ALT activity was observed in Normal cells, thereby showing that it was specific to cancer cells. Our data suggests that Epitalon can extend telomere length in normal healthy mammalian cells through the upregulation of hTERT mRNA expression and telomerase enzyme activity. Telomerase ALT Telomere length Mammalian cells Figures Figure 1 Figure 2 Figure 3 Introduction The average age of the world’s population is increasing therefore, the world is aging (Beard et al 2016 ). Aging itself is a multifactorial dynamic process occurring at a cellular level where cells gradually slow down and enter into what is known as replicative senescence (Di Micco et al 2020). Aging itself leads to many health implications and conditions (Jaul et al 2017, Tenchov et al 2024 ) which can reduce an individual’s quality of life and lead to complications that overburden the healthcare system (Aina et al 2021 ). Diseases such as Alzheimer’s, dementia, sarcopenia, arthritis, Parkinson’s, osteoporosis, maculopathy, COPD, and cancer increase with advancing age (Franceschi et al 2018 ). The concept of healthy aging (Menassa et al 2023 , Beard et al 2016 ) has been developed to define and study the molecular mechanisms are involved (Guo et al 2022 ). Mechanisms such as cellular senescence, genomic instability, telomere attrition, mitochondrial dysfunction, epigenetic alterations, and loss of proteostasis all contribute to an aging phenotype (Tenchov et al 2024 ) and are considered hallmarks or biomarkers for aging. To try and reduce the burden of aging on society and to promote the development of healthy aging, the pharmaceutical and supplement industries are identifying or re-purposing drugs for anti-aging intervention. Examples of pharmaceutical drugs that are considered to have anti-aging properties include Metformin, lithium, and rapamycin (Du et al 2024 ). They are now undergoing extensive research with human trials for potential use as part of the healthy aging process (Guarente et al 2024 ). The supplement and natural products industry have always had an input on the identification of compounds that have anti-aging properties (Dixit et al 2025 ), most notable TA-65 (de Jesus et al 2011 ), Resveratrol (Zhou et al 2021 ) and omega-3 fatty acid (Bischoff-Ferrari et al. 2025 , Kiecolt-Glaser et al 2013 ). All 3 compounds named above affect one particular biomarker of aging, telomere attrition, they have been shown to increase or at least maintain telomere length (Zhou et al 2021 , De Jesus et al 2011 , Bischoff-Ferrari et al 2025 ). The link between telomere length, cancer, and aging has long been established (Huang et al 2025 ), since the discovery of the enzyme telomerase which maintains telomeres (Greider CW, Blackburn EH 1985, Feng J et al 1995 ). Telomeres consist of a 6-base pair DNA sequence, TTAGGG, and are found at the ends of eukaryotic chromosomes where they protect the chromosome ends from DNA damage (Lewis and Tollefsbol, 2016 ). The enzyme telomerase, coded for by the hTERT mRNA, is responsible for the synthesis of telomeric DNA and is absent in mature somatic cells, but is reactivated in 90% of all human cancers. Normal, young human somatic cells have relatively long telomeres, which shorten by up to 70bp per year, due to the end replication problem (Yik et al., 2021 , Whittemore et al., 2019 ). As telomeres become shorter, the cell’s ability to proliferate decreases, eventually leading to cellular senescence (Aging). This phenomenon is known as the Hayflick limit (Bernardes de Jesus and Blasco, 2013). Therefore, preventing telomere attrition through the expression of telomerase can increase lifespan and longevity. Telomere length is considered to be a biomarker of aging (Schellnegger et al 2024 , Vaiserman and Krasnienkov 2021 , Boccardi 2025 ) and can be used to predict organismal age. Increasing telomere length by overexpressing the enzyme telomerase may increase the lifespan of healthy mammals by up to 24% (de Jesus et al 2012). The tetrapeptide (AEDG) Epitalon, which is also known as Epithalon, was first identified in a pineal gland extract and is based on the polypeptide Epithalamin (Khavinson et al 2017 , Araj et al 2025 ). The body naturally produces very small amounts of this peptide however, it is available as a synthetic supplement for research use only. Studies have shown that the peptide can increase the lifespan and longevity of mammalian cells (Khavinson et al 2003 , Khavinson et al 2000 , LinKova et al 2015, Khavinson et al 2017 , Anisimov and Khavinson 2010 ), through the activation of telomerase, which results in telomere length extension (Khavinson et al 2003 ). However, there has not been a comprehensive study directly showing a quantitative increase in telomere lengths, telomerase activity, hTERT expression, and even ALT (Alternative lengthening of Telomeres) activity post-treatment with different doses of epitalon. This is the aim of our study. Materials and Methods Cell culture and treatments Human 21NT breast cancer cells were cultured in 1x Modified Eagle’s medium alpha (alpha MEM) (Gibco), 2.8 µM hydrocortisone, 1 µg/ml insulin, 10% foetal calf serum (FCS), 1% gluta- max, 10 mM HEPES, 0.1 mM NEAA and 12.5 ng/ml Epithelial Growth Factor (EGF). BT474 cells and PC3 cells were cultured in DMEM F-12 medium (Gibco, Invitrogen) with 10% FBS (Gibco, Invitrogen) and 1% Penicillin-Streptomycin (Gibco). U2OS cells were cultured in McCoy's 5A with 10% FCS (Gibco, Invitrogen) and 1% glutamax, 0.5 µg/ml hydrocortisone. IBR.3 cells were cultured in RPMI 1640 medium (Biosera) with 10% FBS (Gibco, Invitrogen) and 1% Penicillin-Streptomycin (Gibco). HMEC cells were cultured in Basal medium (Mammary Life ™ ) containing rh Insulin, L-Glutamine, Epinephrine, Apo-Transferrin, rh-TGF, Extract-P, and Hydrocortisone. Epitalon was purchased from UK Peptides and we were gifted a free sample from Peptides of London. Stock solutions were prepared by dissolving 10 mg of Epitalon in 4 ml of bacteriostatic water, resulting in a concentration of 2.5 mg/ml. Both peptides are certified 99% pure and are compatible with sterile cell culturing. Breast cancer cells (21NT and BT474) were treated daily with (0.1, 0.2, 0.5, and 1.0 µg/mL) of Epitalon for 4 days. Normal fibroblast cells (IBR.3) and epithelial cells (HMEC) were treated daily with 1.0 µg/mL of Epitalon for 3 weeks. Untreated cells were included to serve as a baseline control. Throughout both treatments, the cells were regularly monitored, and the culture media were refreshed daily. DNA extraction and telomere length measured by qPCR DNA from human cell lines (21NT, BT474, IBR.3, and HMEC) was isolated using the Wizard genomic DNA purification kit and protocol from Promega (A1120). Telomere length estimation was performed using the qPCR technique (Al-dulaimi et al 2024 ). A telomeric standard curve was established by serial dilutions of the telomere standard (1018400 kb through 10184 kb dilution) (Table 1 ). A single-copy gene, 36B4, was used as a genomic DNA control, a serial dilution of the 46B3 standard (6125000 kb through 6.125 kb dilution) was performed. The copy number values generated from the qPCR and the standard curve serial dilutions were used to calculate the total telomere length in kb. (As described by O’Callaghan and Fenech et al 2011). RNA extraction, cDNA conversion, and qPCR RNA from 21NT, BT474, IBR.3, and HMEC was extracted, and mRNA gene expression analysis was performed (primers listed in Table 1 ) using qPCR as described previously (Al-dulaimi et al 2024 ). Table 1 Primer sequences Oligomer / gene name Oligomer sequence Product size 36B4 standard CAGCAAGTGGGAAGGTGTAATCCGTCTCCACAGACAAGGCCAGGACTCGTTTGTACCCGTTGATGATAGAATGGG 75 Telomere standard (TTAGGG)14 84 Telo (F) CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT > 76 Telo (R) GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT > 76 36B4 (F) CAGCAAGTGGGAAGGTGTAATCC 75 36B4 (R) CCCATTCTATCATCAACGGGTACAA 75 hTERT(F) CGGAAGAGTGTCTGGAGCAA 200 hTERT(R) GGATGAAGCGGAGTCTGGA 200 GAPDH (F) GAAGGTGAAGGTCGGAGT 226 GAPDH (R) GAAGATGGTGATGGGATTTC 226 Telomerase Substrate (TS) AATCCGTCGAGCAGAGTT Anchored Return Primer(ACX) GCGCGG(CTTACC)3CTAACC Telomerase activity measured by Telomere Repeat Amplification Protocol (TRAP) The TRAP assay was used to determine telomerase activity. Protein from the 21NT, BT474, HMEC and IBR.3 cells were extracted using the TRAPeze 1 x CHAPS lysis buffer (S7705, Millipore) and quantified using the CB-X protein assay kit (G-Bioscience). For estimation of the telomerase activity, the procedure outlined in (Al-dulaimi et al 2024 ) was followed. A serial dilution of proteins from 500 ng – 50 ng from the PC3 cell line (telomerase-positive prostate cancer cell) was used to construct a standard curve of telomerase activity. A negative control was also included for enzyme activity by heating 200 ng of the PC3 protein to 95◦C/10 minutes to inactivate the telomerase enzyme. For each qPCR reaction, 25 µl of master mix was prepared by adding 12.5 µl of the 2x Universal SYBR (ThermoFisher) 5.5 µl of RNAse-free water, 1 µl ACX primer (0.05 µg /ul), 1 µl TS primer (0.1 µg /µl) (Table 1 ), and 4 µl of the protein sample. The reactions were incubated at 25◦C for 20 min to allow telomerase to synthesise the TRAP ladders, then the qPCR was carried out at 95◦C for 10 min and 35 cycles of 95◦C for 30 s, and 60◦C for 90 s. Telomerase activity was quantified using the PC-3 hTERT standard curve and QuantStudio V1.3 software. ALT activity quantified using the C-circle assay C-circle assay was performed as previously described (Al-dulaimi et al 2024 ). 30g of genomic DNA was diluted in 10 mM TRIS (pH 7.6) buffer. The diluted genomic DNA was added to a 10 µl reaction mix containing 0.2 mg/ml BSA, 4 mM DTT, 0.10% Tween, 0.1 mM dTTP, 1X phi29 buffer, and 15 U phi 29 DNA polymerase. Reactions without the phi 29 polymerase enzyme were included as a negative control. Samples were incubated for 8 h at 30◦C followed by 65◦C for 20 min. The levels of telomeric DNA in samples were quantified using qPCR, the reference gene used was the single-copy gene 36B4, with primers for both telomeric and 36B4 sequences outlined in Table 1 . The qPCR cycling conditions were as follows: an initial denaturation at 95°C for 15 minutes, followed by 30 cycles of 95°C for 7 seconds and 58°C for 10 seconds, and a final extension step at 95°C for 5 minutes, then 40 cycles of 95°C for 15 seconds and 58°C for 30 seconds. The C-circle assay was performed using qPCR QuantStudio V1.3 software. Standard curves for the telomere standard and reference gene were used to calculate telomere lengths in kilobases. Immunofluorescence for PML bodies 21NT cells (treated with 1ug/ul epitalon and untreated) were plated onto glass microscope slides (Thermo Scientific), then fixed in 2% formaldehyde (Fisher Scientific) for 15 min and cold methanol for 10 min. Following this, they were washed with PBS and permeabilized with 0.3% (v/v) Triton X-100 (Sigma-Aldrich) solution for 5 min. Cells were washed with PBS and blocked with 5% BSA for 1 h at RT. Cells were then incubated with a mouse monoclonal primary antibody against PML (PG-M3): sc-966) diluted in blocking solution for 2 h at RT. Following this, they were washed three times with PBST (1X PBS and 0.05% Tween-20), then incubated with mouse IgG FITC conjugated secondary antibody (Invitrogen). After a one-hour incubation, the cells were washed three times with PBST and stained with DAPI. For each slide, 100 cells were counted using Lecia microscope with a 100 X objective to confirm the presence of PML bodies. Statistical analysis All statistical analyses were carried out using GraphPad Prism (GraphPad Software). Statistical analysis was performed using unpaired Student’s test (*P < 0.05 **P < 0.01, ***P < 0.001). Three biological repeats under the same conditions were performed for all experiments. Results Epitalon increases telomere length A dose-response experiment was carried out to detect the impact of various concentrations of Epitalon on telomere length in the 21NT and BT474 breast cancer cells. Both cell lines were treated with concentrations ranging from 0.1, 0.2, 0.5 to 1 µg/ml for 4 days. DNA was extracted and telomere length was measured using qPCR as described above. As shown in Fig. 1 A and B, the treatment with Epitalon for 4 days was associated with a dose-dependent increase in telomere length starting from the lower concentration of 0.2 to the highest concentration of 1 µg/ml in 21NT and BT474 breast cancer cells. The treatment depicted significant telomere extension from 2.4kb to 4.4 kb with doses of 0.5 and 1 µg /ml in 21NT. In BT474, telomere length reached a maximum of 8 kb at a dose of 0.2 µg /ml. It was interesting to note that, at the higher concentrations of 0.5ug/ml and 1 µg/ml, we observed a decline in telomere lengths for BT474, which did not occur for 21NT. To test epitalon on primary cells, IBR.3 was treated with 1 µg/ml for four days. No increase in telomere lengths was observed between the untreated and treated groups (Fig. 1 C). When we extended the treatment period to three weeks, as shown in Fig. 1 D for IBR.3 and Fig. 1 E for HMEC, there was a significant increase in telomere length for both in comparison with the untreated control cells. The difference in passage number likely explains why the untreated IBR.3 cells in Fig. 1 C exhibited a higher baseline telomere length of 10 kb compared to 5 kb in Fig. 1 D. Epitalon upregulates hTERT expression in all cell types Telomerase expression and ALT activity are the two mechanisms responsible for increasing telomere lengths in mammalian cells. In addition, previous publications observed an increase in telomerase activity post treatment with Epitalon (Khavinson et al 2003 ). The hTERT mRNA codes for the catalytic subunit of telomerase; therefore, we quantified the expression level of this gene after epitalon treatment. 21NT and BT474 were treated with 0.5 and 1 µg /ml of Epitalon for 4 days, RNA extracted and hTERT mRNA expression levels were quantified using qPCR. At 1 µg/ml, hTERT expression was upregulated 12-fold in 21NT and at 0.5 µg/ml, BT474 showed a 5-fold upregulation relative to the untreated cells (Fig. 2 A and 2 C, respectively). IBR.3 (Fig E) and HMEC (Fig. 2 G) both elevated the expression of hTERT mRNA after a 3-week incubation with 1ug/ml epitalon. The increase in hTERT seen was lower than what was obtained in the cancer cell lines, suggesting that normal cells have a more robust pathway for telomerase regulation which needs to be overcome for full expression of hTERT . Table 2: Showing the percentage of telomerase activity present in breast cancer cells treated with 1 μg/ml Epitalon for 4 days and normal fibroblast/epithelial cells treated with 1 μg/ml Epitalon for three weeks. Cell line Relative telomerase activity as a % of the PC3 control 21NT 9 21NT + epitalon 14 BT474 16 BT474 + epitalon 15 IBR.3 0.8 IBR.3 + epitalon 3.3 HMEC 0.1 HMEC + epitalon 2.6 PC3 positive control 100 PC3 Heated / inactivated 0 Epitalon elevates telomerase activity in normal cells but not cancer cells We have shown that Epitalon treatment resulted in a significant increase in telomere length for all cell lines tested (Fig. 1 ), which correlated with an increase in hTERT expression (Fig. 2 (A, C, E, G). As hTERT codes for the catalytic subunit of the functional telomerase enzyme, telomerase activity was quantified using qPCR to determine if Epitalon enhances its activity through hTERT expression. A positive telomerase control (PC3) was included in the qPCR assay, and the negative control was a heated sample of PC3, this pre-heating inactivates the telomerase enzyme. Treatment of 21NT and BT474 breast cancer cells with 0.5 and 1 µg/ml of Epitalon for 4 days did not lead to a significant increase in telomerase activity compared to the non-treated controls and the telomerase positive PC3 (Fig. 2 , B and D). Results indicated that although telomere length and hTERT were elevated after treatment with epitalon, actual telomerase activity did not follow the same correlation. In contrast, IBR.3 and HMEC, exhibited a significant increase in telomerase activity (Fig. 2 F and H) after the 3-week incubation. Table 2 (data from Fig. 2 , B, D, F, H) shows the percentage of telomerase activity in all cells compared to the positive control PC3. Here we can see that although telomerase activity was elevated in the normal cells HMEC and IBR.3 after Epitalon treatment, the levels were not as high as what is seen in the untreated or treated cancer cells. Our results suggest that Epitalon has a positive effect on hTERT expression and telomerase activity in normal cells (IBR3 and HMEC), whereas in cancer cells (BT474 and 21NT), hTERT is elevated however, telomerase activity is not significantly enhanced. Epitalon significantly increases ALT activity in cancer cells but not in normal cells We have shown that Epitalon treatment did not significantly increase telomerase activity in breast cancer cells but enhanced the activity in normal cells (Fig. 2 ). We hypothesised that the telomere length elongation seen in the cancer cell lines may be due to ALT activity. Therefore, we quantified ALT activity using the c-circle assay and confirmed the result with immunofluorescence (IF) to detect PML bodies. 21NT and BT474 were treated with 1 µg/ml Epitalon for 4 days. The ALT positive U2OS cells were included as a positive reference control, and C-circles were presented as percentages relative to the U2OS cell line (Henson et al. 2017 ). As shown in Fig. 3 A, B, a substantial one-fold increase in ALT activity was observed for 21NT after treatment with Epitalon when compared with the ALT-positive U2OS. A lower, but still significant increase in ALT also occurred in BT474.In contrast to the cancer cells, IBR.3 showed no increase in ALT activity after treatment and HMEC exhibited a minor increase after treatment (Fig. 3 C, D). To confirm the C-circle results, IF was used to identify and quantify PML bodies. The presence of PML bodies characterises ALT activity in cells (Chung et al 2012 ). IF revealed that the treatment with epitalon was associated with a significant elevation of PML bodies for both BT474 and 21NT compared to the untreated controls (Fig. 3 E). Discussion Telomere length is considered to be a marker of biological aging (Vaiserman* and Krasnienkov 2021), and telomere length maintenance can increase lifespan and longevity in mammals (de Jesus et al 2012). Epitalon was initially shown to induce telomerase activity and elongate telomeres in human somatic cells by Khavinson in 2003. It was shown to stimulate the proliferative capacity of epithelial cells (Khavinson et al 2003 ) and fibroblast (Lin’Kova et al 2016 ) invitro thereby increasing the lifespan of the cells. However, very little quantitative data has ever been published on comparing telomere lengths, hTERT expression, telomerase and ALT activity in normal and cancer cells treated with this tetrapeptide. Our results indicate that epitalon increases telomere lengths of both cancer (21NT and BT474, Fig. 1 ) and normal cells (IBR.3 and HMEC, Fig. 1 ) invitro . However, normal cells required a longer, 3-week incubation compared to the cancer cells 4 days. Normal cells may require a longer incubation period for telomere elongation as they do not possess telomere maintenance mechanisms running within them. Epitalon will have to activate these mechanisms and several rounds of cellular division may be required before we see any increase in telomere length. Both cancer cell lines used are telomerase positive, and have telomere maintenance mechanisms already active within them. Therefore, increasing telomere lengths may occur more readily. hTERT expression and telomerase activity were then quantified in cells treated with the tetrapeptide. All cell types upregulated hTERT , with the highest increases being seen in the cancer cell lines (Fig. 2 ). This is to be expected as these cells are already expressing hTERT mRNA, moreover, in the normal cells, epitalon would have to initiate hTERT expression, presumably by promoter activation. Cancer cell lines showed no significant increase in telomerase enzyme activity (Fig. 2 ) which was a surprise as hTERT expression is strongly linked to telomerase activity (Leao et al 2018). It’s known that 22 splice variants of hTERT exist (Plyasova and Zhdanov 2021 ) however, only the full-length variant codes for the fully active telomerase enzyme and some variants can act in a dominant negative way to inhibit telomerase activity. Therefore, even though we obtained significant increases in the hTERT mRNA expression for 21NT and BT474 after Epitalon treatment, lower levels of the fully functional variant may have been produced hence no correlation between mRNA expression and telomerase enzyme activity was observed. In addition, studies have shown that only pre-spliced mRNA containing intron 2 codes for fully functional telomerase (Ducreast et al 2001). In normal cells, however, Epitalon led to a significant increase in telomerase activity by 4-fold in IBR.3 treated cells compared to untreated, and 26-fold HMEC treated cells compared to untreated. (Fig. 2 and Table 2 ). When comparing telomerase enzyme activity in the cell lines used (normal and cancer), it’s clear to see that the increase in telomerase activity seen in the normal cells treated with Epitalon, does not reach the levels seen in the cancer cell lines (Fig. 2 , Table 2 ). This is a significant finding as it suggests that the normal cells treated with epitalon are not being fully transformed into pre-cancerous or cancerous cells, and that another level of telomerase regulation exists in normal cells that Epitalon cannot progress through. Full transformation of normal cells to a cancerous phenotype is a multi-step process (Hanahan and Weinberg 2011 , Fouad and Aanei 2017 , Douglas Hanahan et al 2022) of which telomerase reactivation is one. This process usually involves the deactivation of tumour suppressor genes such as P53, RB and p16 (Dimri et al 2005 ) and or activation of oncogenes. Following the finding that the cancer cell lines did not elevate telomerase enzyme activity upon Epitalon treatment but did elongate telomeres, we investigated the other commonly used mechanism to extend telomeres in mammals, ALT (Alternative Lengthening of Telomeres). To our surprise, we found that both cancer cell lines dramatically increased ALT activity to a level higher than what was seen in the ALT positive cells U2OS (Fig. 3 ). In contrast, the normal cells (IBR.3 and HMEC) showed little (HMEC) or no (IBR.3) ALT activation (Fig. 3 ). To confirm the results for the cancer cell lines, we performed IF to detect PML bodies, a marker of ALT. Again, both 21NT and BT474 showed an increase in PML post treatment with Epitalon to levels higher than the ALT positive cell line U2OS (Fig. 3 ), suggesting that ALT has been activated and is responsible for the increase in telomere length seen in the cancer cells. It is interesting to note that untreated telomerase positive cells contained PML bodies, this confirms that the ALT mechanism was present, but not active before exposure to Epitalon. Both mechanisms of telomere length maintenance, telomerase and ALT activity, are known to co-exist in cancer cells (De Vitis et al 2018 , Hu et al 2016 , Perrem et al 2001 ), and our data suggest that Epitalon activates ALT in cancer cells only and not normal cells. Epitalon has been shown to bind preferentially to methylated cytosine in DNA (Fedoreyeva et al 201, Khavinson et al 2008 ), and with the linker histone protein H1 (H1.3 and H1.6) thereby influencing epigenetic regulation and expression of genes. (Khavinson et al 2020 ). Given the interaction between epitalon, DNA and histone proteins, we speculate that the tetrapeptide may trap proteins on the DNA and induce ALT activity (Rose et al 2023 ). Genome-wide protein trapping leads to replication stress due to replication fork stalling; this in turn has been shown to activate ALT. In addition to this, the binding of Epitalon to histone H1.3/1.6 may lead to epigenetic regulation or inhibition of the histone's function (similar to protein trapping) in cells thereby leading to the induction of ALT. Recent studies looking at the telomeric proteome during replication observed high levels of histone protein H1 at telomeres during replication (Gabriela Lin et al 2021 ), and cells that had H1 depleted through knockout experiments are sensitive to DNA damage and double strand breaks (Murga et al 2007 ). These cells show an increase in telomeric sister chromatid exchange (T-SCE) and rapid telomere elongation using ALT like recombination mechanisms (Murga et al 2007 ). This suggests that Histone H1 is vital for telomere stability and the binding of Epitalon to H1.3 and H1.6 could inhibit its function thereby triggering ALT, in a manner similar to knocking out the protein. The activation of ALT can lead to suppression of telomerase activity (O’Sullivan et al 2014) hence, we observed no increase in telomerase enzyme activity in the cancer cells after treatment with Epitalon. To account for the induction of ALT in the breast cancer cells (21NT and BT474) and non-induction in normal cells (IBR3 and HMEC), it is known that histone H1 is expressed at higher physiological levels in normal tissues and lower levels in breast cancer cells (Torres et al 2016 , Scaffidi 2016 ). Depletion of H1 promotes oncogenic and self-renewing activity within cells due to decompaction of chromatin and gene activation. Indeed, ALT telomeres have a relaxed telomeric chromatin configuration (compared to telomerase positive and normal cells) making them more susceptible to DNA damage and telomere elongation through ALT (Lin et al 2021 , O’Sullivan et al 2014). Therefore, cancer cells may be more susceptible to ALT activation due to the binding of Epitalon to the already reduced levels of histone H1, whereas normal cells may be more resilient as they naturally express higher levels of H1. Histone H1 is also linked to telomerase activity in cancer and normal cells. Overexpression of Histone H1.3 was shown to suppress the growth of ovarian cancer cells, H1.3 also suppresses the expression of the noncoding gene H19 (Medrzycki, et al 2014 ). H19 encodes two conserved miRNAs within its first exon and has been shown to be a telomerase regulator (El Hajj et al 2018 ). H19 expression downregulates telomerase enzyme activity by binding to and disrupting the hTERT- hTR interaction. Disruption of the telomerase complex reduces telomerase activity but does not affect hTERT mRNA expression directly. Therefore, if Epitalon binds to and inhibits H1.3 in the cancer cells, H19 will be derepressed. The higher expression of H19 will then inhibit telomerase activity in cancer cells (without affecting hTERT expression), thereby allowing ALT to continue telomere maintenance. Results suggest that epitalon can directly downregulate telomerase in cancer cells, and activate ALT at the same time through its interaction with histone H1 (H1.3 and H1.6). Telomerase activity have been extensively explored as the main telomere length maintenance mechanism linked to aging. Recently, it was demonstrated that ALT was the only mechanism available for telomere lengthening and maintenance in Alligator sinensis and the newt Pleurodeles waltl (Guo et al 2023 , Yu et al 2022 ). Both vertebrates lacked telomerase expression and both have a high regenerative potential and are long-lived; they show no significant telomere erosion. When studying anti-aging drugs and supplements, we should also take into account the impact ALT may have on the aging process. Conclusion This study confirms the previous results that epitalon increases telomere lengths in normal epithelial and fibroblast cells through the up-regulation of telomerase. We have provided quantitative data showing this for 2 normal human cell lines. Unexpectedly, we also observed telomere length increase in two telomerase-positive cancer cell lines however, this was found to occur through ALT activation. Importantly, ALT was not activated in normal cells. This would suggest that Epitalon can be safely used in healthy individuals to maintain telomeres and thereby influence the aging process. Declarations Acknowledgements We would like to thank Brunel University Centre for Genome Engineering and Maintenance (CenGEM) for supporting us with valuable equipment and resources. We also thank Rihab Zubedi and Hassan Hamdan for their technical assistance in the labs. Epitalon sourced from Peptides of London, was a gift for research use only. Author contribution SA; performing experimental work, data analysis, preparation of methods and results draft, RT; scientific knowledge, methodology, SM; methodology, data analysis, TR; Scientific knowledge, guidance, designing experimental work, data analysis, writing, reviewing and editing manuscript. Funding Self-funding PhD students, and funding from the department of biosciences for final year project students and masters’ students. Data availability Conflict of Interest The authors declare no conflict of interest. References Aina, F. O., Fadare, J. O., Deji-Dada, O. O., & Agbesanwa, T. A. (2021). Increasing Burden of Aging Population on Health Services Utilization: A Myth or Reality in a Country with Predominantly Young Population. Aging Medicine and Healthcare, 12 (2), 41–45. 10.33879/AMH.122.2020.07023 Al-dulaimi, S., Matta, S., Slijepcevic, P., & Roberts, T. (2024). 5-aza-2′-deoxycytidine induces telomere dysfunction in breast cancer cells. Biomedicine & Pharmacotherapy, 178 , 117173. 10.1016/j.biopha.2024.117173 Anisimov, V. N., & Khavinson, V. K. (2010). Peptide bioregulation of aging: results and prospects. Biogerontology (Dordrecht), 11 (2), 139–149. 10.1007/s10522-009-9249-8 Araj, S. K., Brzezik, J., Mądra-Gackowska, K., & Szeleszczuk, Ł. (2025). Overview of Epitalon—Highly Bioactive Pineal Tetrapeptide with Promising Properties. International Journal of Molecular Sciences, 26 (6), 2691. 10.3390/ijms26062691 Beard, J. R., Officer, A., Carvalho, I. A., Sadana, R., Pot, A. M., Michel, J. P., Lloyd-Sherlock, P., Epping-Jordan, J. E., Peeters, G. M., Mahanani, W. R., Thiyagarajan, J. A., & Chatterij, S. (2016). The World report on ageing and health: a policy framework for healthy ageing.10.1016/S0140-6736(15)00516-4 Bernardes de Jesus, B., & Blasco, M. A. (2013). Telomerase at the intersection of cancer and aging. Trends in Genetics, 29 (9), 513–520. 10.1016/j.tig.2013.06.007 Bernardes de Jesus, B., Vera, E., Schneeberger, K., Tejera, A. M., Ayuso, E., Bosch, F., & Blasco, M. A. (2012). Telomerase gene therapy in adult and old mice delays aging and increases longevity without increasing cancer. EMBO Molecular Medicine, 4 (8), 691–704. 10.1002/emmm.201200245 Bischoff-Ferrari, H. A., Gängler, S., Wieczorek, M., Belsky, D. W., Ryan, J., Kressig, R. W., Stähelin, H. B., Theiler, R., Dawson-Hughes, B., Rizzoli, R., Vellas, B., Rouch, L., Guyonnet, S., Egli, A., Orav, E. J., Willett, W., & Horvath, S. (2025). Individual and additive effects of vitamin D, omega-3 and exercise on DNA methylation clocks of biological aging in older adults from the DO-HEALTH trial. Nature Aging, 5 (3), 376–385. 10.1038/s43587-024-00793-y Boccardi, V. (2025). From telomeres and senescence to integrated longevity medicine: redefining the path to extended healthspan. Biogerontology (Dordrecht), 26 (3), 107. 10.1007/s10522-025-10246-7 Chung, I., Osterwald, S., Deeg, K. I., & Rippe, K. (2012). PML body meets telomere. Nucleus (Austin, Tex.), 3 (3), 263–275. 10.4161/nucl.20326 de Jesus, B. B., Schneeberger, K., Vera, E., Tejera, A., Harley, C. B., & Blasco, M. A. (2011). The telomerase activator TA‐65 elongates short telomeres and increases health span of adult/old mice without increasing cancer incidence. Aging Cell, 10 (4), 604–621. 10.1111/j.1474-9726.2011.00700.x De Vitis, M., Berardinelli, F., & Sgura, A. (2018). Telomere Length Maintenance in Cancer: At the Crossroad between Telomerase and Alternative Lengthening of Telomeres (ALT). International Journal of Molecular Sciences, 19 (2), 606. 10.3390/ijms19020606 Di Micco, R., Krizhanovsky, V., Baker, D., & d’Adda di Fagagna, F. (2021). Cellular senescence in ageing: from mechanisms to therapeutic opportunities. Nature Reviews. Molecular Cell Biology, 22 (2), 75–95. 10.1038/s41580-020-00314-w Dimri, G., Band, H., & Band, V. (2005). Mammary epithelial cell transformation: insights from cell culture and mouse models. Breast Cancer Research, 7 (4), 171–179. 10.1186/bcr1275 Dixit, V., Chaubey, K. K., Dayal, D., Chole, P. B., B. T., M., Bachheti, R. K., Gupta, P. C., Bachheti, A., & Worku, L. A. (2025). Natural Products in Aging: Cellular Mechanisms and Emerging Therapeutics for Age‐Related Disorders. Journal of Aging Research, 2025 (1)10.1155/jare/6868732 Du, N., Yang, R., Jiang, S., Niu, Z., Zhou, W., Liu, C., Gao, L., & Sun, Q. (2024). Anti-Aging Drugs and the Related Signal Pathways. Biomedicines, 12 (1), 127. 10.3390/biomedicines12010127 Ducrest, A., Amacker, M., Mathieu, Y. D., Cuthbert, A. P., Trott, D. A., Newbold, R. F., Nabholz, M., & Lingner, J. (2001). Regulation of Human Telomerase Activity: Repression by Normal Chromosome 3 Abolishes Nuclear Telomerase Reverse Transcriptase Transcripts but Does Not Affect c-Myc Activity. Cancer Research, 61 (20), 7594–7602. http://cancerres.aacrjournals.org/cgi/content/abstract/61/20/7594 El Hajj, J., Nguyen, E., Liu, Q., Bouyer, C., Adriaenssens, E., Hilal, G., & Ségal-Bendirdjian, E. (2018). Telomerase regulation by the long non-coding RNA H19 in human acute promyelocytic leukemia cells. Molecular Cancer, 17 (1), 85–85. 10.1186/s12943-018-0835-8 Fedoreyeva, L. I., Kireev, I. I., Khavinson, V. K., & Vanyushin, B. F. (2011). Penetration of short fluorescence-labeled peptides into the nucleus in HeLa cells and in vitro specific interaction of the peptides with deoxyribooligonucleotides and DNA. Biochemistry (Moscow), 76 (11), 1210–1219. 10.1134/S0006297911110022 Feng, J., Funk, W. D., Wang, S. S., Weinrich, S. L., Avilion, A. A., Chiu, C. P., Adams, R. R., Chang, E., Allsopp, R. C., & Yu, J. (1995). The RNA component of human telomerase. Science, 269 (5228), 1236–1241. 10.1126/science.7544491 Fouad, Y. A., & Aanei, C. (2017). Revisiting the hallmarks of cancer. American Journal of Cancer Research, 7 (5), 1016–1036. https://www.ncbi.nlm.nih.gov/pubmed/28560055 Franceschi, C., Garagnani, P., Morsiani, C., Conte, M., Santoro, A., Grignolio, A., Monti, D., Capri, M., & Salvioli, S. (2018). The Continuum of Aging and Age-Related Diseases: Common Mechanisms but Different Rates. Frontiers in Medicine, 5 , 61–61. 10.3389/fmed.2018.00061 Greider, C. W., & Blackburn, E. H. (1985). Identification of a specific telomere terminal transferase activity in tetrahymena extracts. Cell, 43 (2), 405–413. 10.1016/0092-8674(85)90170-9 Guarente, L., Sinclair, D. A., & Kroemer, G. (2024). Human trials exploring anti-aging medicines. Cell Metabolism, 36 (2), 354–376. 10.1016/j.cmet.2023.12.007 Guo, J., Huang, X., Dou, L., Yan, M., Shen, T., Tang, W., & Li, J. (2022). Aging and aging-related diseases: from molecular mechanisms to interventions and treatments. Signal Transduction and Targeted Therapy, 7 (1), 391–40. 10.1038/s41392-022-01251-0 Guo, Y., Zhang, Y., Wang, Q., Yu, J., Wan, Q., Huang, J., & Fang, S. (2023). Alternative telomere maintenance mechanism in Alligator sinensis provides insights into aging evolution. iScience, 26 (1), 105850. 10.1016/j.isci.2022.105850 Hanahan, D. (2022). Hallmarks of Cancer: New Dimensions. Cancer Discovery, 12 (1), 31–46. 10.1158/2159-8290.cd-21-1059 Hanahan, D., & Weinberg, R. (2011). Hallmarks of Cancer: The Next Generation. Cell, 144 (5), 646–674. 10.1016/j.cell.2011.02.013 Henson, J. D., Lau, L. M., Koch, S., Martin La Rotta, N., Dagg, R. A., & Reddel, R. R. (2017). The C-Circle Assay for alternative-lengthening-of-telomeres activity. Methods (San Diego, Calif.), 114 , 74–84. 10.1016/j.ymeth.2016.08.016 Hu, Y., Shi, G., Zhang, L., Li, F., Jiang, Y., Jiang, S., Ma, W., Zhao, Y., Songyang, Z., & Huang, J. (2016). Switch telomerase to ALT mechanism by inducing telomeric DNA damages and dysfunction of ATRX and DAXX. Scientific Reports, 6 (1), 32280–32280. 10.1038/srep32280 Huang, X., Huang, L., Lu, J., Cheng, L., Wu, D., Li, L., Zhang, S., Lai, X., & Xu, L. (2025). The relationship between telomere length and aging-related diseases. Clinical and Experimental Medicine, 25 (1), 72. 10.1007/s10238-025-01608-z Jaul, E., & Barron, J. (2017). Age-Related Diseases and Clinical and Public Health Implications for the 85 Years Old and Over Population. Frontiers in Public Health, 5 , 335–335. 10.3389/fpubh.2017.00335 Khavinson, V. K., Bondarev, I. E., & Butyugov, A. A. (2003). Epithalon Peptide Induces Telomerase Activity and Telomere Elongation in Human Somatic Cells. Bulletin of Experimental Biology and Medicine, 135 (6), 590–592. 10.1023/A:1025493705728 Khavinson, V. K., Izmaylov, D. M., Obukhova, L. K., & Malinin, V. V. (2000). Effect of epitalon on the lifespan increase in Drosophila melanogaster. Mechanisms of Ageing and Development, 120 (1), 141–149. 10.1016/S0047-6374(00)00217-7 Khavinson, V. K., Kormilets, D. Y., & Mar’yanovich, A. T. (2017). Peptides (Epigenetic Regulators) in the Structure of Rodents with a Long and Short Lifespan. Bulletin of Experimental Biology and Medicine, 163 (5), 671–676. 10.1007/s10517-017-3876-x Khavinson, V. K., Solovyov, A. Y., & Shataeva, L. K. (2008). Melting of DNA Double Strand after Binding to Geroprotective Tetrapeptide. Bulletin of Experimental Biology and Medicine, 146 (5), 624–626. 10.1007/s10517-009-0342-4 Khavinson, V. K., Zemchikhina, V. N., Trofimova, S. V., & Malinin, V. V. (2003). Effects of Peptides on Proliferative Activity of Retinal and Pigmented Epithelial Cells. Bulletin of Experimental Biology and Medicine, 135 (6), 597–599. 10.1023/A:1025497806636 Khavinson, V., Diomede, F., Mironova, E., Linkova, N., Trofimova, S., Trubiani, O., Caputi, S., & Sinjari, B. (2020). AEDG Peptide (Epitalon) Stimulates Gene Expression and Protein Synthesis during Neurogenesis: Possible Epigenetic Mechanism. Molecules (Basel, Switzerland), 25 (3), 609. 10.3390/molecules25030609 Kiecolt-Glaser, J. K., Epel, E. S., Belury, M. A., Andridge, R., Lin, J., Glaser, R., Malarkey, W. B., Hwang, B. S., & Blackburn, E. (2013). Omega-3 fatty acids, oxidative stress, and leukocyte telomere length: A randomized controlled trial. Brain, Behavior, and Immunity, 28 , 16–24. 10.1016/j.bbi.2012.09.004 Leão, R., Apolónio, J. D., Lee, D., Figueiredo, A., Tabori, U., & Castelo-Branco, P. (2018). Mechanisms of human telomerase reverse transcriptase (hTERT) regulation: clinical impacts in cancer. Journal of Biomedical Science, 25 (1), 22–22. 10.1186/s12929-018-0422-8 Lewis, K. A., & Tollefsbol, T. O. (2016). Regulation of the Telomerase Reverse Transcriptase Subunit through Epigenetic Mechanisms. Frontiers in Genetics, 7 , 83–83. 10.3389/fgene.2016.00083 Lin, C. G., Näger, A. C., Lunardi, T., Vančevska, A., Lossaint, G., & Lingner, J. (2021). The human telomeric proteome during telomere replication. Nucleic Acids Research, 49 (21), 12119–12135. 10.1093/nar/gkab1015 Lin’kova, N. S., Drobintseva, A. O., Orlova, O. A., Kuznetsova, E. P., Polyakova, V. O., Kvetnoy, I. M., & Khavinson, V. K. (2016). Peptide Regulation of Skin Fibroblast Functions during Their Aging In Vitro. Bulletin of Experimental Biology and Medicine, 161 (1), 175–178. 10.1007/s10517-016-3370-x Medrzycki, M., Zhang, Y., Zhang, W., Cao, K., Pan, C., Lailler, N., McDonald, J. F., Bouhassira, E. E., & Fan, Y. (2014). Histone H1.3 Suppresses H19 Noncoding RNA Expression and Cell Growth of Ovarian Cancer Cells. Cancer Research (Chicago, Ill.), 74 (22), 6463–6473. 10.1158/0008-5472.CAN-13-2922 Menassa, M., Stronks, K., Khatmi, F., Roa Díaz, Z. M., Espinola, O. P., Gamba, M., Itodo, O. A., Buttia, C., Wehrli, F., Minder, B., Velarde, M. R., & Franco, O. H. (2023). Concepts and definitions of healthy ageing: a systematic review and synthesis of theoretical models. EClinicalMedicine, 56 , 101821. 10.1016/j.eclinm.2022.101821 Murga, M., Jaco, I., Fan, Y., Soria, R., Martinez-Pastor, B., Cuadrado, M., Yang, S., Blasco, M. A., Skoultchi, A. I., & Fernandez-Capetillo, O. (2007). Global chromatin compaction limits the strength of the DNA damage response. The Journal of Cell Biology, 178 (7), 1101–1108. 10.1083/jcb.200704140 O'Callaghan, N. J., & Fenech, M. (2011). A quantitative PCR method for measuring absolute telomere length. Biological Procedures Online, 13 (1), 3. 10.1186/1480-9222-13-3 O'Sullivan, R. J., & Almouzni, G. (2014). Assembly of telomeric chromatin to create ALTernative endings. Trends in Cell Biology, 24 (11), 675–685. 10.1016/j.tcb.2014.07.007 O'Sullivan, R. J., Arnoult, N., Lackner, D. H., Oganesian, L., Haggblom, C., Corpet, A., Almouzni, G., & Karlseder, J. (2014). Rapid induction of alternative lengthening of telomeres by depletion of the histone chaperone ASF1. Nature Structural & Molecular Biology, 21 (2), 167–174. 10.1038/nsmb.2754 Perrem, K., Colgin, L. M., Neumann, A. A., Yeager, T. R., & Reddel, R. R. (2001). Coexistence of Alternative Lengthening of Telomeres and Telomerase in hTERT-Transfected GM847 Cells. Molecular and Cellular Biology, 21 (12), 3862–3875. 10.1128/MCB.21.12.3862-3875.2001 Plyasova, A. A., & Zhdanov, D. D. (2021). Alternative Splicing of Human Telomerase Reverse Transcriptase (hTERT) and Its Implications in Physiological and Pathological Processes. Biomedicines, 9 (5), 526. 10.3390/biomedicines9050526 Rose, A. M., Goncalves, T., Cunniffe, S., Geiller, H. E. B., Kent, T., Shepherd, S., Ratnaweera, M., O’Sullivan, R., Gibbons, R., & Clynes, D. (2023). Induction of the alternative lengthening of telomeres pathway by trapping of proteins on DNA. Nucleic Acids Research, 51 (13), 6509–6527. 10.1093/nar/gkad150 Scaffidi, P. (2016). Histone H1 alterations in cancer. Biochimica Et Biophysica Acta, 1859 (3), 533–539. 10.1016/j.bbagrm.2015.09.008 Schellnegger, M., Hofmann, E., Carnieletto, M., & Kamolz, L. (2024). Unlocking longevity: the role of telomeres and its targeting interventions. Frontiers in Aging, 5 , 1339317. 10.3389/fragi.2024.1339317 Tenchov, R., Sasso, J. M., Wang, X., & Zhou, Q. A. (2024). Aging Hallmarks and Progression and Age-Related Diseases: A Landscape View of Research Advancement. ACS Chemical Neuroscience, 15 (1), 1–30. 10.1021/acschemneuro.3c00531 Torres, C. M., Biran, A., Burney, M. J., Patel, H., Henser-Brownhill, T., Cohen, A. S., Li, Y., Ben-Hamo, R., Nye, E., Spencer-Dene, B., Chakravarty, P., Efroni, S., Matthews, N., Misteli, T., Meshorer, E., & Scaffidi, P. (2016). The linker histone H1.0 generates epigenetic and functional intratumor heterogeneity. Science, 353 (6307), 1514. 10.1126/science.aaf1644 Vaiserman, A., & Krasnienkov, D. (2021). Telomere Length as a Marker of Biological Age: State-of-the-Art, Open Issues, and Future Perspectives. Frontiers in Genetics, 11 , 630186. 10.3389/fgene.2020.630186 Whittemore, K., Vera, E., Martínez-Nevado, E., Sanpera, C., & Blasco, M. A. (2019). Telomere shortening rate predicts species life span. Proceedings of the National Academy of Sciences, 116 (30), 15122–15127. 10.1073/pnas.1902452116 Yik, M. Y., Azlan, A., Rajasegaran, Y., Rosli, A., Yusoff, N. M., & Moses, E. J. (2021). Mechanism of Human Telomerase Reverse Transcriptase (hTERT) Regulation and Clinical Impacts in Leukemia. Genes, 12 (8), 1188. 10.3390/genes12081188 Yu, Q., Gates, P., Rogers, S., Mikicic, I., Elewa, A., Salomon, F., Lachnit, M., Caldarelli, A., Flores-Rodriguez, N., Cesare, A. J., Simon, A., & Maximina Yun. (2022). Telomerase-independent maintenance of telomere length in a vertebrate. bioRxiv, 10.1101/2022.03.25.485759 Yu-Zun Guo, Yi Zhang, Qing Wang, Jun Yu, Qiu-Hong Wan, Jun Huang, & Sheng-Guo Fang. (2023). Alternative telomere maintenance mechanism in Alligator sinensis provides insights into aging evolution Alternative telomere maintenance mechanism in Alligator sinensis provides insights into aging evolution. iScience, 26 (1), 105850. https://doaj.org/article/2a12a0996a8c44629631ff1c750e5ce5 Zhou, D., Luo, M., Huang, S., Saimaiti, A., Shang, A., Gan, R., & Li, H. (2021). Effects and Mechanisms of Resveratrol on Aging and Age-Related Diseases. Oxidative Medicine and Cellular Longevity, 2021 (1), 9932218. 10.1155/2021/9932218 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 03 Aug, 2025 Reviews received at journal 02 Aug, 2025 Reviews received at journal 27 Jul, 2025 Reviewers agreed at journal 18 Jul, 2025 Reviewers agreed at journal 13 Jul, 2025 Reviewers invited by journal 13 Jul, 2025 Editor assigned by journal 12 Jul, 2025 Submission checks completed at journal 08 Jul, 2025 First submitted to journal 07 Jul, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7066545","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":484718700,"identity":"2adc4475-b63a-4172-a874-9be396c05fac","order_by":0,"name":"Sarah Al-dulaimi","email":"","orcid":"","institution":"Brunel University London","correspondingAuthor":false,"prefix":"","firstName":"Sarah","middleName":"","lastName":"Al-dulaimi","suffix":""},{"id":484718701,"identity":"ed6283ec-96ec-4ac9-916a-69b2b8559198","order_by":1,"name":"Ross Thomas","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Ross","middleName":"","lastName":"Thomas","suffix":""},{"id":484718702,"identity":"b0ad378d-ebf4-4128-954c-388a076d31a1","order_by":2,"name":"Sheila Matta","email":"","orcid":"","institution":"Royal Brompton Hospital","correspondingAuthor":false,"prefix":"","firstName":"Sheila","middleName":"","lastName":"Matta","suffix":""},{"id":484718703,"identity":"af736d31-cd75-467e-8996-fd22f3c3fecb","order_by":3,"name":"Terry Roberts","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABDUlEQVRIiWNgGAWjYDADAzBZcQBEMoJJBh7sKuHCQC2MDQxnIIpJ0MLYRoQWe/beZ595GO7JmbP3Pn/4c96dfIPbzQcOMNTYMRhArcSwhee48WwehmJjy57jhs28255ZbrhzLOEAw7FkBoOzDdi1SKQxM/MwJCRuuJHG2My47bCBwY0cgwMMbAcYDM7j8Iv8M6iW+88YG3/OAWnJ/3CA4R8eLRJsMFvYGBt4G8C2MBwAhQNOh51JY2acY5AA9Esa42yeY88MJG+kGRxI7EvmkcThffb2Y8wMbyoSgCF2jOHjj5o7Bnw3kh8++PDNTo7vTAJ2lwEBE48BulACzliBAMYf+GRHwSgYBaNgFAAA2pNfPwTHvQoAAAAASUVORK5CYII=","orcid":"","institution":"Brunel University London","correspondingAuthor":true,"prefix":"","firstName":"Terry","middleName":"","lastName":"Roberts","suffix":""}],"badges":[],"createdAt":"2025-07-07 14:38:07","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7066545/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7066545/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":86795537,"identity":"b0611082-a80d-4407-a3ea-705c17509806","added_by":"auto","created_at":"2025-07-15 15:36:58","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":104082,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTelomere length of breast cancer cells and normal cells treated with Epitalon\u003c/strong\u003e. \u003cstrong\u003eA\u003c/strong\u003e21NT cells \u003cstrong\u003eB\u003c/strong\u003e BT474 cells. Both cells were treated for 4 days with varying concentrations of Epitalon. (0.1, 0.2, 0.5 and 1 ug/ml). Untreated cells were used as a control. A significant increase in telomere length occurred at 1 μg/ml for 21NT and 0.2 μg/ml for BT474 compared with the untreated controls. \u003cstrong\u003eC\u003c/strong\u003e Telomere length of IBR.3 (P.9) treated with 1 ug/ml Epitalon for 4 days. \u003cstrong\u003eD\u003c/strong\u003e Telomere length of IBR.3 cells (P.14) treated with 1 μg /ml Epitalon for 3 weeks. \u003cstrong\u003eE\u003c/strong\u003etelomere length of HMEC (P.14) treated with 1 μg /ml Epitalon for 3 weeks. Untreated cells were included as a control. No significant difference in telomere length was observed between the untreated and treated groups for 4 days. However, telomere length significantly increased after 3 weeks of 1 μg/ml Epitalon treatment for both cell types.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7066545/v1/09c6dee37c9009f039cc04f0.png"},{"id":86793509,"identity":"e117c39a-594f-47e0-ae16-d9d095b75a29","added_by":"auto","created_at":"2025-07-15 15:20:58","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":99595,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ehTERT expression (RQ) and telomerase enzyme activity in breast cancer cells and normal fibroblast cells treated with Epitalon\u003c/strong\u003e. \u003cstrong\u003eA\u003c/strong\u003e and \u003cstrong\u003eB\u003c/strong\u003e hTERT expression and telomerase activity for 21NT treated with 0.5 and 1 μg/ml of Epitalon for 4 days. \u003cstrong\u003eC\u003c/strong\u003e and \u003cstrong\u003eD\u003c/strong\u003e hTERT expression and telomerase activity of BT474 treated with 0.5 and 1 μg/ml of Epitalon for 4 days. PC3 was included as a positive control for telomerase activity. Epitalon treatment was associated with \u003cem\u003ehTERT\u003c/em\u003e mRNA upregulation but no significant changes (ns) in telomerase activity when compared to the untreated cells. \u003cstrong\u003eE\u003c/strong\u003e and \u003cstrong\u003eF\u003c/strong\u003e \u003cem\u003ehTERT\u003c/em\u003e expression and telomerase activity for IBR.3 were treated with 1 μg/ml of Epitalon for three weeks. \u003cstrong\u003eG\u003c/strong\u003e and \u003cstrong\u003eH\u003c/strong\u003e \u003cem\u003ehTERT\u003c/em\u003e expression and telomerase activity for HMEC treated with 1 ug/ml of Epitalon for three weeks. Epitalon treatment was associated with the upregulation of \u003cem\u003ehTERT\u003c/em\u003e mRNA expression and increasing telomerase activity in IBR.3 and HMEC cells compared with the untreated cells. Table 2 shows the percentage of telomerase activity in breast cancer cells treated with 1 μg/ml Epitalon for 4 days and normal cells treated with 1 μg/ml Epitalon for three weeks.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7066545/v1/a0c4252e5a43a4dc010c92e3.png"},{"id":86795536,"identity":"ae8dec3b-8f7d-49c6-96a5-0494e4d06f29","added_by":"auto","created_at":"2025-07-15 15:36:58","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":246669,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eALT activity in breast cancer cells and normal fibroblast cells treated with Epitalon.\u003c/strong\u003e \u003cstrong\u003eA\u003c/strong\u003e and \u003cstrong\u003eB\u003c/strong\u003e ALT activity of 21NT and BT474 treated with 1 μg/ml of Epitalon for 4 days. Untreated cells and the ALT U2OS were included as controls. Epitalon increased ALT activity in 21NT and BT474 breast cancer cells compared with the untreated control. \u003cstrong\u003eC\u003c/strong\u003e IBR.3 and \u003cstrong\u003eD\u003c/strong\u003e HMEC treated with 1 μg/ml of Epitalon for three weeks. The treatment was associated with no significant activation of ALT activity in fibroblast cells (IBR.3 and HMEC). \u003cstrong\u003eE\u003c/strong\u003eImmunofluorescence to detect PML bodies in 21NT and BT474 cells treated with Epitalon for 4 days. The colocalization of telomeric DNA (blue) with PML bodies (green) for 21NT and BT474 treated with Epitalon indicated the presence of PML bodies. PML bodies were detected using Lecia microscope with X 100 objective.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7066545/v1/0c4a6b5d0d8fc8e4340f5c83.png"},{"id":86795544,"identity":"ef25af8c-b88f-401f-9124-bb621adaa5f8","added_by":"auto","created_at":"2025-07-15 15:37:06","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1095261,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7066545/v1/eb426799-dd50-4ce7-9249-677f4e5c86c6.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Epitalon increases telomere length in human cell lines through telomerase upregulation or ALT activity","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe average age of the world\u0026rsquo;s population is increasing therefore, the world is aging (Beard et al \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Aging itself is a multifactorial dynamic process occurring at a cellular level where cells gradually slow down and enter into what is known as replicative senescence (Di Micco et al 2020). Aging itself leads to many health implications and conditions (Jaul et al 2017, Tenchov et al \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) which can reduce an individual\u0026rsquo;s quality of life and lead to complications that overburden the healthcare system (Aina et al \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Diseases such as Alzheimer\u0026rsquo;s, dementia, sarcopenia, arthritis, Parkinson\u0026rsquo;s, osteoporosis, maculopathy, COPD, and cancer increase with advancing age (Franceschi et al \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). The concept of healthy aging (Menassa et al \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2023\u003c/span\u003e, Beard et al \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) has been developed to define and study the molecular mechanisms are involved (Guo et al \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Mechanisms such as cellular senescence, genomic instability, telomere attrition, mitochondrial dysfunction, epigenetic alterations, and loss of proteostasis all contribute to an aging phenotype (Tenchov et al \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) and are considered hallmarks or biomarkers for aging. To try and reduce the burden of aging on society and to promote the development of healthy aging, the pharmaceutical and supplement industries are identifying or re-purposing drugs for anti-aging intervention. Examples of pharmaceutical drugs that are considered to have anti-aging properties include Metformin, lithium, and rapamycin (Du et al \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). They are now undergoing extensive research with human trials for potential use as part of the healthy aging process (Guarente et al \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). The supplement and natural products industry have always had an input on the identification of compounds that have anti-aging properties (Dixit et al \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2025\u003c/span\u003e), most notable TA-65 (de Jesus et al \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2011\u003c/span\u003e), Resveratrol (Zhou et al \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) and omega-3 fatty acid (Bischoff-Ferrari et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2025\u003c/span\u003e, Kiecolt-Glaser et al \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). All 3 compounds named above affect one particular biomarker of aging, telomere attrition, they have been shown to increase or at least maintain telomere length (Zhou et al \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2021\u003c/span\u003e, De Jesus et al \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2011\u003c/span\u003e, Bischoff-Ferrari et al \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). The link between telomere length, cancer, and aging has long been established (Huang et al \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2025\u003c/span\u003e), since the discovery of the enzyme telomerase which maintains telomeres (Greider CW, Blackburn EH 1985, Feng J et al \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e1995\u003c/span\u003e). Telomeres consist of a 6-base pair DNA sequence, TTAGGG, and are found at the ends of eukaryotic chromosomes where they protect the chromosome ends from DNA damage (Lewis and Tollefsbol, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). The enzyme telomerase, coded for by the \u003cem\u003ehTERT\u003c/em\u003e mRNA, is responsible for the synthesis of telomeric DNA and is absent in mature somatic cells, but is reactivated in 90% of all human cancers. Normal, young human somatic cells have relatively long telomeres, which shorten by up to 70bp per year, due to the end replication problem (Yik et al., \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2021\u003c/span\u003e, Whittemore et al., \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). As telomeres become shorter, the cell\u0026rsquo;s ability to proliferate decreases, eventually leading to cellular senescence (Aging). This phenomenon is known as the Hayflick limit (Bernardes de Jesus and Blasco, 2013). Therefore, preventing telomere attrition through the expression of telomerase can increase lifespan and longevity. Telomere length is considered to be a biomarker of aging (Schellnegger et al \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2024\u003c/span\u003e, Vaiserman and Krasnienkov \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2021\u003c/span\u003e, Boccardi \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2025\u003c/span\u003e) and can be used to predict organismal age. Increasing telomere length by overexpressing the enzyme telomerase may increase the lifespan of healthy mammals by up to 24% (de Jesus et al 2012).\u003c/p\u003e\u003cp\u003eThe tetrapeptide (AEDG) Epitalon, which is also known as Epithalon, was first identified in a pineal gland extract and is based on the polypeptide Epithalamin (Khavinson et al \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2017\u003c/span\u003e, Araj et al \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2025\u003c/span\u003e). The body naturally produces very small amounts of this peptide however, it is available as a synthetic supplement for research use only. Studies have shown that the peptide can increase the lifespan and longevity of mammalian cells (Khavinson et al \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2003\u003c/span\u003e, Khavinson et al \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2000\u003c/span\u003e, LinKova et al 2015, Khavinson et al \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2017\u003c/span\u003e, Anisimov and Khavinson \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2010\u003c/span\u003e), through the activation of telomerase, which results in telomere length extension (Khavinson et al \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). However, there has not been a comprehensive study directly showing a quantitative increase in telomere lengths, telomerase activity, \u003cem\u003ehTERT\u003c/em\u003e expression, and even ALT (Alternative lengthening of Telomeres) activity post-treatment with different doses of epitalon. This is the aim of our study.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003eCell culture and treatments\u003c/p\u003e\u003cp\u003eHuman 21NT breast cancer cells were cultured in 1x Modified Eagle\u0026rsquo;s medium alpha (alpha MEM) (Gibco), 2.8 \u0026micro;M hydrocortisone, 1 \u0026micro;g/ml insulin, 10% foetal calf serum (FCS), 1% gluta- max, 10 mM HEPES, 0.1 mM NEAA and 12.5 ng/ml Epithelial Growth Factor (EGF). BT474 cells and PC3 cells were cultured in DMEM F-12 medium (Gibco, Invitrogen) with 10% FBS (Gibco, Invitrogen) and 1% Penicillin-Streptomycin (Gibco). U2OS cells were cultured in McCoy's 5A with 10% FCS (Gibco, Invitrogen) and 1% glutamax, 0.5 \u0026micro;g/ml hydrocortisone. IBR.3 cells were cultured in RPMI 1640 medium (Biosera) with 10% FBS (Gibco, Invitrogen) and 1% Penicillin-Streptomycin (Gibco). HMEC cells were cultured in Basal medium (Mammary Life \u003csup\u003e\u0026trade;\u003c/sup\u003e) containing rh Insulin, L-Glutamine, Epinephrine, Apo-Transferrin, rh-TGF, Extract-P, and Hydrocortisone.\u003c/p\u003e\u003cp\u003eEpitalon was purchased from UK Peptides and we were gifted a free sample from Peptides of London. Stock solutions were prepared by dissolving 10 mg of Epitalon in 4 ml of bacteriostatic water, resulting in a concentration of 2.5 mg/ml. Both peptides are certified 99% pure and are compatible with sterile cell culturing. Breast cancer cells (21NT and BT474) were treated daily with (0.1, 0.2, 0.5, and 1.0 \u0026micro;g/mL) of Epitalon for 4 days. Normal fibroblast cells (IBR.3) and epithelial cells (HMEC) were treated daily with 1.0 \u0026micro;g/mL of Epitalon for 3 weeks. Untreated cells were included to serve as a baseline control. Throughout both treatments, the cells were regularly monitored, and the culture media were refreshed daily.\u003c/p\u003e\u003cp\u003eDNA extraction and telomere length measured by qPCR\u003c/p\u003e\u003cp\u003eDNA from human cell lines (21NT, BT474, IBR.3, and HMEC) was isolated using the Wizard genomic DNA purification kit and protocol from Promega (A1120). Telomere length estimation was performed using the qPCR technique (Al-dulaimi et al \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). A telomeric standard curve was established by serial dilutions of the telomere standard (1018400 kb through 10184 kb dilution) (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). A single-copy gene, 36B4, was used as a genomic DNA control, a serial dilution of the 46B3 standard (6125000 kb through 6.125 kb dilution) was performed. The copy number values generated from the qPCR and the standard curve serial dilutions were used to calculate the total telomere length in kb. (As described by O\u0026rsquo;Callaghan and Fenech et al 2011).\u003c/p\u003e\u003cp\u003eRNA extraction, cDNA conversion, and qPCR\u003c/p\u003e\u003cp\u003eRNA from 21NT, BT474, IBR.3, and HMEC was extracted, and mRNA gene expression analysis was performed (primers listed in Table \u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) using qPCR as described previously (Al-dulaimi et al \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimer sequences\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eOligomer / gene name\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eOligomer sequence\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eProduct size\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e36B4 standard\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCAGCAAGTGGGAAGGTGTAATCCGTCTCCACAGACAAGGCCAGGACTCGTTTGTACCCGTTGATGATAGAATGGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e75\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTelomere standard\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e(TTAGGG)14\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e84\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTelo (F)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u0026gt;\u0026thinsp;76\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTelo (R)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u0026gt;\u0026thinsp;76\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e36B4 (F)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCAGCAAGTGGGAAGGTGTAATCC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e75\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e36B4 (R)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCCCATTCTATCATCAACGGGTACAA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e75\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003ehTERT(F)\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCGGAAGAGTGTCTGGAGCAA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e200\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003ehTERT(R)\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGGATGAAGCGGAGTCTGGA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e200\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e(F)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGAAGGTGAAGGTCGGAGT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e226\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e(R)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGAAGATGGTGATGGGATTTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e226\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTelomerase Substrate (TS)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAATCCGTCGAGCAGAGTT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAnchored Return Primer(ACX)\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCGCGG(CTTACC)3CTAACC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eTelomerase activity measured by Telomere Repeat Amplification Protocol (TRAP)\u003c/p\u003e\u003cp\u003eThe TRAP assay was used to determine telomerase activity. Protein from the 21NT, BT474, HMEC and IBR.3 cells were extracted using the TRAPeze 1 x CHAPS lysis buffer (S7705, Millipore) and quantified using the CB-X protein assay kit (G-Bioscience). For estimation of the telomerase activity, the procedure outlined in (Al-dulaimi et al \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) was followed. A serial dilution of proteins from 500 ng \u0026ndash; 50 ng from the PC3 cell line (telomerase-positive prostate cancer cell) was used to construct a standard curve of telomerase activity. A negative control was also included for enzyme activity by heating 200 ng of the PC3 protein to 95◦C/10 minutes to inactivate the telomerase enzyme. For each qPCR reaction, 25 \u0026micro;l of master mix was prepared by adding 12.5 \u0026micro;l of the 2x Universal SYBR (ThermoFisher) 5.5 \u0026micro;l of RNAse-free water, 1 \u0026micro;l ACX primer (0.05 \u0026micro;g /ul), 1 \u0026micro;l TS primer (0.1 \u0026micro;g /\u0026micro;l) (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), and 4 \u0026micro;l of the protein sample. The reactions were incubated at 25◦C for 20 min to allow telomerase to synthesise the TRAP ladders, then the qPCR was carried out at 95◦C for 10 min and 35 cycles of 95◦C for 30 s, and 60◦C for 90 s. Telomerase activity was quantified using the PC-3 \u003cem\u003ehTERT\u003c/em\u003e standard curve and QuantStudio V1.3 software.\u003c/p\u003e\u003cp\u003eALT activity quantified using the C-circle assay\u003c/p\u003e\u003cp\u003eC-circle assay was performed as previously described (Al-dulaimi et al \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). 30g of genomic DNA was diluted in 10 mM TRIS (pH 7.6) buffer. The diluted genomic DNA was added to a 10 \u0026micro;l reaction mix containing 0.2 mg/ml BSA, 4 mM DTT, 0.10% Tween, 0.1 mM dTTP, 1X phi29 buffer, and 15 U phi 29 DNA polymerase. Reactions without the phi 29 polymerase enzyme were included as a negative control. Samples were incubated for 8 h at 30◦C followed by 65◦C for 20 min. The levels of telomeric DNA in samples were quantified using qPCR, the reference gene used was the single-copy gene 36B4, with primers for both telomeric and 36B4 sequences outlined in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The qPCR cycling conditions were as follows: an initial denaturation at 95\u0026deg;C for 15 minutes, followed by 30 cycles of 95\u0026deg;C for 7 seconds and 58\u0026deg;C for 10 seconds, and a final extension step at 95\u0026deg;C for 5 minutes, then 40 cycles of 95\u0026deg;C for 15 seconds and 58\u0026deg;C for 30 seconds. The C-circle assay was performed using qPCR QuantStudio V1.3 software. Standard curves for the telomere standard and reference gene were used to calculate telomere lengths in kilobases.\u003c/p\u003e\u003cp\u003eImmunofluorescence for PML bodies\u003c/p\u003e\u003cp\u003e21NT cells (treated with 1ug/ul epitalon and untreated) were plated onto glass microscope slides (Thermo Scientific), then fixed in 2% formaldehyde (Fisher Scientific) for 15 min and cold methanol for 10 min. Following this, they were washed with PBS and permeabilized with 0.3% (v/v) Triton X-100 (Sigma-Aldrich) solution for 5 min. Cells were washed with PBS and blocked with 5% BSA for 1 h at RT. Cells were then incubated with a mouse monoclonal primary antibody against PML (PG-M3): sc-966) diluted in blocking solution for 2 h at RT. Following this, they were washed three times with PBST (1X PBS and 0.05% Tween-20), then incubated with mouse IgG FITC conjugated secondary antibody (Invitrogen). After a one-hour incubation, the cells were washed three times with PBST and stained with DAPI. For each slide, 100 cells were counted using Lecia microscope with a 100 X objective to confirm the presence of PML bodies.\u003c/p\u003e\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eAll statistical analyses were carried out using GraphPad Prism (GraphPad Software). Statistical analysis was performed using unpaired Student\u0026rsquo;s test (*P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 **P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, ***P\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Three biological repeats under the same conditions were performed for all experiments.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003eEpitalon increases telomere length\u003c/p\u003e\n\u003cp\u003eA dose-response experiment was carried out to detect the impact of various concentrations of Epitalon on telomere length in the 21NT and BT474 breast cancer cells. Both cell lines were treated with concentrations ranging from 0.1, 0.2, 0.5 to 1 \u0026micro;g/ml for 4 days. DNA was extracted and telomere length was measured using qPCR as described above.\u003c/p\u003e\n\u003cp\u003eAs shown in Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eA and B, the treatment with Epitalon for 4 days was associated with a dose-dependent increase in telomere length starting from the lower concentration of 0.2 to the highest concentration of 1 \u0026micro;g/ml in 21NT and BT474 breast cancer cells. The treatment depicted significant telomere extension from 2.4kb to 4.4 kb with doses of 0.5 and 1 \u0026micro;g /ml in 21NT. In BT474, telomere length reached a maximum of 8 kb at a dose of 0.2 \u0026micro;g /ml. It was interesting to note that, at the higher concentrations of 0.5ug/ml and 1 \u0026micro;g/ml, we observed a decline in telomere lengths for BT474, which did not occur for 21NT.\u003c/p\u003e\n\u003cp\u003eTo test epitalon on primary cells, IBR.3 was treated with 1 \u0026micro;g/ml for four days. No increase in telomere lengths was observed between the untreated and treated groups (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eC). When we extended the treatment period to three weeks, as shown in Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eD for IBR.3 and Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eE for HMEC, there was a significant increase in telomere length for both in comparison with the untreated control cells. The difference in passage number likely explains why the untreated IBR.3 cells in Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eC exhibited a higher baseline telomere length of 10 kb compared to 5 kb in Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eD.\u003c/p\u003e\n\u003cp\u003eEpitalon upregulates \u003cem\u003ehTERT\u003c/em\u003e expression in all cell types\u003c/p\u003e\n\u003cp\u003eTelomerase expression and ALT activity are the two mechanisms responsible for increasing telomere lengths in mammalian cells. In addition, previous publications observed an increase in telomerase activity post treatment with Epitalon (Khavinson et al \u003cspan class=\"CitationRef\"\u003e2003\u003c/span\u003e). The \u003cem\u003ehTERT\u003c/em\u003e mRNA codes for the catalytic subunit of telomerase; therefore, we quantified the expression level of this gene after epitalon treatment.\u003c/p\u003e\n\u003cp\u003e21NT and BT474 were treated with 0.5 and 1 \u0026micro;g /ml of Epitalon for 4 days, RNA extracted and \u003cem\u003ehTERT\u003c/em\u003e mRNA expression levels were quantified using qPCR. At 1 \u0026micro;g/ml, \u003cem\u003ehTERT\u003c/em\u003e expression was upregulated 12-fold in 21NT and at 0.5 \u0026micro;g/ml, BT474 showed a 5-fold upregulation relative to the untreated cells (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA and \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eC, respectively). IBR.3 (Fig E) and HMEC (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eG) both elevated the expression of \u003cem\u003ehTERT\u003c/em\u003e mRNA after a 3-week incubation with 1ug/ml epitalon. The increase in \u003cem\u003ehTERT\u003c/em\u003e seen was lower than what was obtained in the cancer cell lines, suggesting that normal cells have a more robust pathway for telomerase regulation which needs to be overcome for full expression of \u003cem\u003ehTERT\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2:\u003c/strong\u003e Showing the percentage of telomerase activity present in breast cancer cells treated with 1 \u0026mu;g/ml Epitalon for 4 days and normal fibroblast/epithelial cells treated with 1 \u0026mu;g/ml Epitalon for three weeks.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 45.5907%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eCell line\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54.4093%;\"\u003e\n \u003cp\u003e\u003cstrong\u003eRelative telomerase activity as a % of the PC3 control\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 45.5907%;\"\u003e\n \u003cp\u003e21NT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54.4093%;\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 45.5907%;\"\u003e\n \u003cp\u003e21NT + epitalon\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54.4093%;\"\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 45.5907%;\"\u003e\n \u003cp\u003eBT474\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54.4093%;\"\u003e\n \u003cp\u003e16\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 45.5907%;\"\u003e\n \u003cp\u003eBT474 + epitalon\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54.4093%;\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 45.5907%;\"\u003e\n \u003cp\u003eIBR.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54.4093%;\"\u003e\n \u003cp\u003e0.8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 45.5907%;\"\u003e\n \u003cp\u003eIBR.3 + epitalon\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54.4093%;\"\u003e\n \u003cp\u003e3.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 45.5907%;\"\u003e\n \u003cp\u003eHMEC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54.4093%;\"\u003e\n \u003cp\u003e0.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 45.5907%;\"\u003e\n \u003cp\u003eHMEC + epitalon\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54.4093%;\"\u003e\n \u003cp\u003e2.6\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 45.5907%;\"\u003e\n \u003cp\u003ePC3 positive control\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54.4093%;\"\u003e\n \u003cp\u003e100\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 45.5907%;\"\u003e\n \u003cp\u003ePC3 Heated / inactivated\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 54.4093%;\"\u003e\n \u003cp\u003e0\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eEpitalon elevates telomerase activity in normal cells but not cancer cells\u003c/p\u003e\n\u003cp\u003eWe have shown that Epitalon treatment resulted in a significant increase in telomere length for all cell lines tested (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e), which correlated with an increase in \u003cem\u003ehTERT\u003c/em\u003e expression (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e (A, C, E, G). As \u003cem\u003ehTERT\u003c/em\u003e codes for the catalytic subunit of the functional telomerase enzyme, telomerase activity was quantified using qPCR to determine if Epitalon enhances its activity through \u003cem\u003ehTERT\u003c/em\u003e expression. A positive telomerase control (PC3) was included in the qPCR assay, and the negative control was a heated sample of PC3, this pre-heating inactivates the telomerase enzyme.\u003c/p\u003e\n\u003cp\u003eTreatment of 21NT and BT474 breast cancer cells with 0.5 and 1 \u0026micro;g/ml of Epitalon for 4 days did not lead to a significant increase in telomerase activity compared to the non-treated controls and the telomerase positive PC3 (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e, B and D). Results indicated that although telomere length and \u003cem\u003ehTERT\u003c/em\u003e were elevated after treatment with epitalon, actual telomerase activity did not follow the same correlation.\u003c/p\u003e\n\u003cp\u003eIn contrast, IBR.3 and HMEC, exhibited a significant increase in telomerase activity (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eF and H) after the 3-week incubation. Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e (data from Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e, B, D, F, H) shows the percentage of telomerase activity in all cells compared to the positive control PC3. Here we can see that although telomerase activity was elevated in the normal cells HMEC and IBR.3 after Epitalon treatment, the levels were not as high as what is seen in the untreated or treated cancer cells. Our results suggest that Epitalon has a positive effect on \u003cem\u003ehTERT\u003c/em\u003e expression and telomerase activity in normal cells (IBR3 and HMEC), whereas in cancer cells (BT474 and 21NT), \u003cem\u003ehTERT\u003c/em\u003e is elevated however, telomerase activity is not significantly enhanced.\u003c/p\u003e\n\u003cp\u003eEpitalon significantly increases ALT activity in cancer cells but not in normal cells\u003c/p\u003e\n\u003cp\u003eWe have shown that Epitalon treatment did not significantly increase telomerase activity in breast cancer cells but enhanced the activity in normal cells (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). We hypothesised that the telomere length elongation seen in the cancer cell lines may be due to ALT activity. Therefore, we quantified ALT activity using the c-circle assay and confirmed the result with immunofluorescence (IF) to detect PML bodies. 21NT and BT474 were treated with 1 \u0026micro;g/ml Epitalon for 4 days. The ALT positive U2OS cells were included as a positive reference control, and C-circles were presented as percentages relative to the U2OS cell line (Henson et al. \u003cspan class=\"CitationRef\"\u003e2017\u003c/span\u003e). As shown in Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eA, B, a substantial one-fold increase in ALT activity was observed for 21NT after treatment with Epitalon when compared with the ALT-positive U2OS. A lower, but still significant increase in ALT also occurred in BT474.In contrast to the cancer cells, IBR.3 showed no increase in ALT activity after treatment and HMEC exhibited a minor increase after treatment (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eC, D). To confirm the C-circle results, IF was used to identify and quantify PML bodies. The presence of PML bodies characterises ALT activity in cells (Chung et al \u003cspan class=\"CitationRef\"\u003e2012\u003c/span\u003e). IF revealed that the treatment with epitalon was associated with a significant elevation of PML bodies for both BT474 and 21NT compared to the untreated controls (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eE).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eTelomere length is considered to be a marker of biological aging (Vaiserman* and Krasnienkov 2021), and telomere length maintenance can increase lifespan and longevity in mammals (de Jesus et al 2012). Epitalon was initially shown to induce telomerase activity and elongate telomeres in human somatic cells by Khavinson in 2003. It was shown to stimulate the proliferative capacity of epithelial cells (Khavinson et al \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2003\u003c/span\u003e) and fibroblast (Lin\u0026rsquo;Kova et al \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) \u003cem\u003einvitro\u003c/em\u003e thereby increasing the lifespan of the cells. However, very little quantitative data has ever been published on comparing telomere lengths, \u003cem\u003ehTERT\u003c/em\u003e expression, telomerase and ALT activity in normal and cancer cells treated with this tetrapeptide.\u003c/p\u003e\u003cp\u003eOur results indicate that epitalon increases telomere lengths of both cancer (21NT and BT474, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) and normal cells (IBR.3 and HMEC, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) \u003cem\u003einvitro\u003c/em\u003e. However, normal cells required a longer, 3-week incubation compared to the cancer cells 4 days. Normal cells may require a longer incubation period for telomere elongation as they do not possess telomere maintenance mechanisms running within them. Epitalon will have to activate these mechanisms and several rounds of cellular division may be required before we see any increase in telomere length. Both cancer cell lines used are telomerase positive, and have telomere maintenance mechanisms already active within them. Therefore, increasing telomere lengths may occur more readily.\u003c/p\u003e\u003cp\u003e\u003cem\u003ehTERT\u003c/em\u003e expression and telomerase activity were then quantified in cells treated with the tetrapeptide. All cell types upregulated \u003cem\u003ehTERT\u003c/em\u003e, with the highest increases being seen in the cancer cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). This is to be expected as these cells are already expressing \u003cem\u003ehTERT\u003c/em\u003e mRNA, moreover, in the normal cells, epitalon would have to initiate \u003cem\u003ehTERT\u003c/em\u003e expression, presumably by promoter activation. Cancer cell lines showed no significant increase in telomerase enzyme activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) which was a surprise as \u003cem\u003ehTERT\u003c/em\u003e expression is strongly linked to telomerase activity (Leao et al 2018). It\u0026rsquo;s known that 22 splice variants of \u003cem\u003ehTERT\u003c/em\u003e exist (Plyasova and Zhdanov \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) however, only the full-length variant codes for the fully active telomerase enzyme and some variants can act in a dominant negative way to inhibit telomerase activity. Therefore, even though we obtained significant increases in the \u003cem\u003ehTERT\u003c/em\u003e mRNA expression for 21NT and BT474 after Epitalon treatment, lower levels of the fully functional variant may have been produced hence no correlation between mRNA expression and telomerase enzyme activity was observed. In addition, studies have shown that only pre-spliced mRNA containing intron 2 codes for fully functional telomerase (Ducreast et al 2001). In normal cells, however, Epitalon led to a significant increase in telomerase activity by 4-fold in IBR.3 treated cells compared to untreated, and 26-fold HMEC treated cells compared to untreated. (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e and Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). When comparing telomerase enzyme activity in the cell lines used (normal and cancer), it\u0026rsquo;s clear to see that the increase in telomerase activity seen in the normal cells treated with Epitalon, does not reach the levels seen in the cancer cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, Table \u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). This is a significant finding as it suggests that the normal cells treated with epitalon are not being fully transformed into pre-cancerous or cancerous cells, and that another level of telomerase regulation exists in normal cells that Epitalon cannot progress through. Full transformation of normal cells to a cancerous phenotype is a multi-step process (Hanahan and Weinberg \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2011\u003c/span\u003e, Fouad and Aanei \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2017\u003c/span\u003e, Douglas Hanahan et al 2022) of which telomerase reactivation is one. This process usually involves the deactivation of tumour suppressor genes such as P53, RB and p16 (Dimri et al \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2005\u003c/span\u003e) and or activation of oncogenes.\u003c/p\u003e\u003cp\u003eFollowing the finding that the cancer cell lines did not elevate telomerase enzyme activity upon Epitalon treatment but did elongate telomeres, we investigated the other commonly used mechanism to extend telomeres in mammals, ALT (Alternative Lengthening of Telomeres). To our surprise, we found that both cancer cell lines dramatically increased ALT activity to a level higher than what was seen in the ALT positive cells U2OS (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). In contrast, the normal cells (IBR.3 and HMEC) showed little (HMEC) or no (IBR.3) ALT activation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). To confirm the results for the cancer cell lines, we performed IF to detect PML bodies, a marker of ALT. Again, both 21NT and BT474 showed an increase in PML post treatment with Epitalon to levels higher than the ALT positive cell line U2OS (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e), suggesting that ALT has been activated and is responsible for the increase in telomere length seen in the cancer cells. It is interesting to note that untreated telomerase positive cells contained PML bodies, this confirms that the ALT mechanism was present, but not active before exposure to Epitalon. Both mechanisms of telomere length maintenance, telomerase and ALT activity, are known to co-exist in cancer cells (De Vitis et al \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2018\u003c/span\u003e, Hu et al \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2016\u003c/span\u003e, Perrem et al \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2001\u003c/span\u003e), and our data suggest that Epitalon activates ALT in cancer cells only and not normal cells.\u003c/p\u003e\u003cp\u003eEpitalon has been shown to bind preferentially to methylated cytosine in DNA (Fedoreyeva et al 201, Khavinson et al \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2008\u003c/span\u003e), and with the linker histone protein H1 (H1.3 and H1.6) thereby influencing epigenetic regulation and expression of genes. (Khavinson et al \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Given the interaction between epitalon, DNA and histone proteins, we speculate that the tetrapeptide may trap proteins on the DNA and induce ALT activity (Rose et al \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Genome-wide protein trapping leads to replication stress due to replication fork stalling; this in turn has been shown to activate ALT.\u003c/p\u003e\u003cp\u003eIn addition to this, the binding of Epitalon to histone H1.3/1.6 may lead to epigenetic regulation or inhibition of the histone's function (similar to protein trapping) in cells thereby leading to the induction of ALT. Recent studies looking at the telomeric proteome during replication observed high levels of histone protein H1 at telomeres during replication (Gabriela Lin et al \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), and cells that had H1 depleted through knockout experiments are sensitive to DNA damage and double strand breaks (Murga et al \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). These cells show an increase in telomeric sister chromatid exchange (T-SCE) and rapid telomere elongation using ALT like recombination mechanisms (Murga et al \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). This suggests that Histone H1 is vital for telomere stability and the binding of Epitalon to H1.3 and H1.6 could inhibit its function thereby triggering ALT, in a manner similar to knocking out the protein. The activation of ALT can lead to suppression of telomerase activity (O\u0026rsquo;Sullivan et al 2014) hence, we observed no increase in telomerase enzyme activity in the cancer cells after treatment with Epitalon. To account for the induction of ALT in the breast cancer cells (21NT and BT474) and non-induction in normal cells (IBR3 and HMEC), it is known that histone H1 is expressed at higher physiological levels in normal tissues and lower levels in breast cancer cells (Torres et al \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2016\u003c/span\u003e, Scaffidi \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Depletion of H1 promotes oncogenic and self-renewing activity within cells due to decompaction of chromatin and gene activation. Indeed, ALT telomeres have a relaxed telomeric chromatin configuration (compared to telomerase positive and normal cells) making them more susceptible to DNA damage and telomere elongation through ALT (Lin et al \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2021\u003c/span\u003e, O\u0026rsquo;Sullivan et al 2014). Therefore, cancer cells may be more susceptible to ALT activation due to the binding of Epitalon to the already reduced levels of histone H1, whereas normal cells may be more resilient as they naturally express higher levels of H1.\u003c/p\u003e\u003cp\u003eHistone H1 is also linked to telomerase activity in cancer and normal cells. Overexpression of Histone H1.3 was shown to suppress the growth of ovarian cancer cells, H1.3 also suppresses the expression of the noncoding gene \u003cem\u003eH19\u003c/em\u003e (Medrzycki, et al \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). \u003cem\u003eH19\u003c/em\u003e encodes two conserved miRNAs within its first exon and has been shown to be a telomerase regulator (El Hajj et al \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). \u003cem\u003eH19\u003c/em\u003e expression downregulates telomerase enzyme activity by binding to and disrupting the hTERT-\u003cem\u003ehTR\u003c/em\u003e interaction. Disruption of the telomerase complex reduces telomerase activity but does not affect \u003cem\u003ehTERT\u003c/em\u003e mRNA expression directly. Therefore, if Epitalon binds to and inhibits H1.3 in the cancer cells, \u003cem\u003eH19\u003c/em\u003e will be derepressed. The higher expression of \u003cem\u003eH19\u003c/em\u003e will then inhibit telomerase activity in cancer cells (without affecting \u003cem\u003ehTERT\u003c/em\u003e expression), thereby allowing ALT to continue telomere maintenance. Results suggest that epitalon can directly downregulate telomerase in cancer cells, and activate ALT at the same time through its interaction with histone H1 (H1.3 and H1.6).\u003c/p\u003e\u003cp\u003eTelomerase activity have been extensively explored as the main telomere length maintenance mechanism linked to aging. Recently, it was demonstrated that ALT was the only mechanism available for telomere lengthening and maintenance in \u003cem\u003eAlligator sinensis\u003c/em\u003e and the newt \u003cem\u003ePleurodeles waltl\u003c/em\u003e (Guo et al \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2023\u003c/span\u003e, Yu et al \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Both vertebrates lacked telomerase expression and both have a high regenerative potential and are long-lived; they show no significant telomere erosion. When studying anti-aging drugs and supplements, we should also take into account the impact ALT may have on the aging process.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study confirms the previous results that epitalon increases telomere lengths in normal epithelial and fibroblast cells through the up-regulation of telomerase. We have provided quantitative data showing this for 2 normal human cell lines. Unexpectedly, we also observed telomere length increase in two telomerase-positive cancer cell lines however, this was found to occur through ALT activation. Importantly, ALT was not activated in normal cells. This would suggest that Epitalon can be safely used in healthy individuals to maintain telomeres and thereby influence the aging process.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to thank Brunel University Centre for Genome Engineering and Maintenance (CenGEM) for supporting us with valuable equipment and resources. We also thank Rihab Zubedi and Hassan Hamdan for their technical assistance in the labs. Epitalon sourced from Peptides of London, was a gift for research use only.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSA; performing experimental work, data analysis, preparation of methods and results draft, RT; scientific knowledge, methodology,\u0026nbsp;SM; methodology, data analysis, TR; Scientific knowledge, guidance, designing experimental work, data analysis, writing, reviewing and editing manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSelf-funding PhD students, and funding from the department of biosciences for final year project students and masters’ students.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest \u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAina, F. O., Fadare, J. O., Deji-Dada, O. O., \u0026amp; Agbesanwa, T. A. (2021). Increasing Burden of Aging Population on Health Services Utilization: A Myth or Reality in a Country with Predominantly Young Population.\u003cem\u003e Aging Medicine and Healthcare, 12\u003c/em\u003e(2), 41\u0026ndash;45. 10.33879/AMH.122.2020.07023\u003c/li\u003e\n\u003cli\u003eAl-dulaimi, S., Matta, S., Slijepcevic, P., \u0026amp; Roberts, T. (2024). 5-aza-2\u0026prime;-deoxycytidine induces telomere dysfunction in breast cancer cells.\u003cem\u003e Biomedicine \u0026amp; Pharmacotherapy, 178\u003c/em\u003e, 117173. 10.1016/j.biopha.2024.117173\u003c/li\u003e\n\u003cli\u003eAnisimov, V. N., \u0026amp; Khavinson, V. K. (2010). Peptide bioregulation of aging: results and prospects.\u003cem\u003e Biogerontology (Dordrecht), 11\u003c/em\u003e(2), 139\u0026ndash;149. 10.1007/s10522-009-9249-8\u003c/li\u003e\n\u003cli\u003eAraj, S. K., Brzezik, J., Mądra-Gackowska, K., \u0026amp; Szeleszczuk, Ł. (2025). Overview of Epitalon\u0026mdash;Highly Bioactive Pineal Tetrapeptide with Promising Properties.\u003cem\u003e International Journal of Molecular Sciences, 26\u003c/em\u003e(6), 2691. 10.3390/ijms26062691\u003c/li\u003e\n\u003cli\u003eBeard, J. R., Officer, A., Carvalho, I. A., Sadana, R., Pot, A. M., Michel, J. P., Lloyd-Sherlock, P., Epping-Jordan, J. E., Peeters, G. M., Mahanani, W. R., Thiyagarajan, J. A., \u0026amp; Chatterij, S. (2016). The World report on ageing and health: a policy framework for healthy ageing.10.1016/S0140-6736(15)00516-4\u003c/li\u003e\n\u003cli\u003eBernardes de Jesus, B., \u0026amp; Blasco, M. A. (2013). Telomerase at the intersection of cancer and aging.\u003cem\u003e Trends in Genetics, 29\u003c/em\u003e(9), 513\u0026ndash;520. 10.1016/j.tig.2013.06.007\u003c/li\u003e\n\u003cli\u003eBernardes de Jesus, B., Vera, E., Schneeberger, K., Tejera, A. M., Ayuso, E., Bosch, F., \u0026amp; Blasco, M. A. (2012). Telomerase gene therapy in adult and old mice delays aging and increases longevity without increasing cancer.\u003cem\u003e EMBO Molecular Medicine, 4\u003c/em\u003e(8), 691\u0026ndash;704. 10.1002/emmm.201200245\u003c/li\u003e\n\u003cli\u003eBischoff-Ferrari, H. A., G\u0026auml;ngler, S., Wieczorek, M., Belsky, D. W., Ryan, J., Kressig, R. W., St\u0026auml;helin, H. B., Theiler, R., Dawson-Hughes, B., Rizzoli, R., Vellas, B., Rouch, L., Guyonnet, S., Egli, A., Orav, E. J., Willett, W., \u0026amp; Horvath, S. (2025). Individual and additive effects of vitamin D, omega-3 and exercise on DNA methylation clocks of biological aging in older adults from the DO-HEALTH trial.\u003cem\u003e Nature Aging, 5\u003c/em\u003e(3), 376\u0026ndash;385. 10.1038/s43587-024-00793-y\u003c/li\u003e\n\u003cli\u003eBoccardi, V. (2025). From telomeres and senescence to integrated longevity medicine: redefining the path to extended healthspan.\u003cem\u003e Biogerontology (Dordrecht), 26\u003c/em\u003e(3), 107. 10.1007/s10522-025-10246-7\u003c/li\u003e\n\u003cli\u003eChung, I., Osterwald, S., Deeg, K. I., \u0026amp; Rippe, K. (2012). PML body meets telomere.\u003cem\u003e Nucleus (Austin, Tex.), 3\u003c/em\u003e(3), 263\u0026ndash;275. 10.4161/nucl.20326\u003c/li\u003e\n\u003cli\u003ede Jesus, B. B., Schneeberger, K., Vera, E., Tejera, A., Harley, C. B., \u0026amp; Blasco, M. A. (2011). The telomerase activator TA‐65 elongates short telomeres and increases health span of adult/old mice without increasing cancer incidence.\u003cem\u003e Aging Cell, 10\u003c/em\u003e(4), 604\u0026ndash;621. 10.1111/j.1474-9726.2011.00700.x\u003c/li\u003e\n\u003cli\u003eDe Vitis, M., Berardinelli, F., \u0026amp; Sgura, A. (2018). Telomere Length Maintenance in Cancer: At the Crossroad between Telomerase and Alternative Lengthening of Telomeres (ALT).\u003cem\u003e International Journal of Molecular Sciences, 19\u003c/em\u003e(2), 606. 10.3390/ijms19020606\u003c/li\u003e\n\u003cli\u003eDi Micco, R., Krizhanovsky, V., Baker, D., \u0026amp; d\u0026rsquo;Adda di Fagagna, F. (2021). Cellular senescence in ageing: from mechanisms to therapeutic opportunities.\u003cem\u003e Nature Reviews. Molecular Cell Biology, 22\u003c/em\u003e(2), 75\u0026ndash;95. 10.1038/s41580-020-00314-w\u003c/li\u003e\n\u003cli\u003eDimri, G., Band, H., \u0026amp; Band, V. (2005). Mammary epithelial cell transformation: insights from cell culture and mouse models.\u003cem\u003e Breast Cancer Research, 7\u003c/em\u003e(4), 171\u0026ndash;179. 10.1186/bcr1275\u003c/li\u003e\n\u003cli\u003eDixit, V., Chaubey, K. K., Dayal, D., Chole, P. B., B. T., M., Bachheti, R. K., Gupta, P. C., Bachheti, A., \u0026amp; Worku, L. A. (2025). Natural Products in Aging: Cellular Mechanisms and Emerging Therapeutics for Age‐Related Disorders.\u003cem\u003e Journal of Aging Research, 2025\u003c/em\u003e(1)10.1155/jare/6868732\u003c/li\u003e\n\u003cli\u003eDu, N., Yang, R., Jiang, S., Niu, Z., Zhou, W., Liu, C., Gao, L., \u0026amp; Sun, Q. (2024). Anti-Aging Drugs and the Related Signal Pathways.\u003cem\u003e Biomedicines, 12\u003c/em\u003e(1), 127. 10.3390/biomedicines12010127\u003c/li\u003e\n\u003cli\u003eDucrest, A., Amacker, M., Mathieu, Y. D., Cuthbert, A. P., Trott, D. A., Newbold, R. F., Nabholz, M., \u0026amp; Lingner, J. (2001). Regulation of Human Telomerase Activity: Repression by Normal Chromosome 3 Abolishes Nuclear Telomerase Reverse Transcriptase Transcripts but Does Not Affect c-Myc Activity.\u003cem\u003e Cancer Research, 61\u003c/em\u003e(20), 7594\u0026ndash;7602. http://cancerres.aacrjournals.org/cgi/content/abstract/61/20/7594\u003c/li\u003e\n\u003cli\u003eEl Hajj, J., Nguyen, E., Liu, Q., Bouyer, C., Adriaenssens, E., Hilal, G., \u0026amp; S\u0026eacute;gal-Bendirdjian, E. (2018). Telomerase regulation by the long non-coding RNA H19 in human acute promyelocytic leukemia cells.\u003cem\u003e Molecular Cancer, 17\u003c/em\u003e(1), 85\u0026ndash;85. 10.1186/s12943-018-0835-8\u003c/li\u003e\n\u003cli\u003eFedoreyeva, L. I., Kireev, I. I., Khavinson, V. K., \u0026amp; Vanyushin, B. F. (2011). Penetration of short fluorescence-labeled peptides into the nucleus in HeLa cells and in vitro specific interaction of the peptides with deoxyribooligonucleotides and DNA.\u003cem\u003e Biochemistry (Moscow), 76\u003c/em\u003e(11), 1210\u0026ndash;1219. 10.1134/S0006297911110022\u003c/li\u003e\n\u003cli\u003eFeng, J., Funk, W. D., Wang, S. S., Weinrich, S. L., Avilion, A. A., Chiu, C. P., Adams, R. R., Chang, E., Allsopp, R. C., \u0026amp; Yu, J. (1995). The RNA component of human telomerase.\u003cem\u003e Science, 269\u003c/em\u003e(5228), 1236\u0026ndash;1241. 10.1126/science.7544491\u003c/li\u003e\n\u003cli\u003eFouad, Y. A., \u0026amp; Aanei, C. (2017). Revisiting the hallmarks of cancer.\u003cem\u003e American Journal of Cancer Research, 7\u003c/em\u003e(5), 1016\u0026ndash;1036. https://www.ncbi.nlm.nih.gov/pubmed/28560055\u003c/li\u003e\n\u003cli\u003eFranceschi, C., Garagnani, P., Morsiani, C., Conte, M., Santoro, A., Grignolio, A., Monti, D., Capri, M., \u0026amp; Salvioli, S. (2018). The Continuum of Aging and Age-Related Diseases: Common Mechanisms but Different Rates.\u003cem\u003e Frontiers in Medicine, 5\u003c/em\u003e, 61\u0026ndash;61. 10.3389/fmed.2018.00061\u003c/li\u003e\n\u003cli\u003eGreider, C. W., \u0026amp; Blackburn, E. H. (1985). Identification of a specific telomere terminal transferase activity in tetrahymena extracts.\u003cem\u003e Cell, 43\u003c/em\u003e(2), 405\u0026ndash;413. 10.1016/0092-8674(85)90170-9\u003c/li\u003e\n\u003cli\u003eGuarente, L., Sinclair, D. A., \u0026amp; Kroemer, G. (2024). Human trials exploring anti-aging medicines.\u003cem\u003e Cell Metabolism, 36\u003c/em\u003e(2), 354\u0026ndash;376. 10.1016/j.cmet.2023.12.007\u003c/li\u003e\n\u003cli\u003eGuo, J., Huang, X., Dou, L., Yan, M., Shen, T., Tang, W., \u0026amp; Li, J. (2022). Aging and aging-related diseases: from molecular mechanisms to interventions and treatments.\u003cem\u003e Signal Transduction and Targeted Therapy, 7\u003c/em\u003e(1), 391\u0026ndash;40. 10.1038/s41392-022-01251-0\u003c/li\u003e\n\u003cli\u003eGuo, Y., Zhang, Y., Wang, Q., Yu, J., Wan, Q., Huang, J., \u0026amp; Fang, S. (2023). Alternative telomere maintenance mechanism in Alligator sinensis provides insights into aging evolution.\u003cem\u003e iScience, 26\u003c/em\u003e(1), 105850. 10.1016/j.isci.2022.105850\u003c/li\u003e\n\u003cli\u003eHanahan, D. (2022). Hallmarks of Cancer: New Dimensions.\u003cem\u003e Cancer Discovery, 12\u003c/em\u003e(1), 31\u0026ndash;46. 10.1158/2159-8290.cd-21-1059\u003c/li\u003e\n\u003cli\u003eHanahan, D., \u0026amp; Weinberg, R. (2011). Hallmarks of Cancer: The Next Generation.\u003cem\u003e Cell, 144\u003c/em\u003e(5), 646\u0026ndash;674. 10.1016/j.cell.2011.02.013\u003c/li\u003e\n\u003cli\u003eHenson, J. D., Lau, L. M., Koch, S., Martin La Rotta, N., Dagg, R. A., \u0026amp; Reddel, R. R. (2017). The C-Circle Assay for alternative-lengthening-of-telomeres activity.\u003cem\u003e Methods (San Diego, Calif.), 114\u003c/em\u003e, 74\u0026ndash;84. 10.1016/j.ymeth.2016.08.016\u003c/li\u003e\n\u003cli\u003eHu, Y., Shi, G., Zhang, L., Li, F., Jiang, Y., Jiang, S., Ma, W., Zhao, Y., Songyang, Z., \u0026amp; Huang, J. (2016). Switch telomerase to ALT mechanism by inducing telomeric DNA damages and dysfunction of ATRX and DAXX.\u003cem\u003e Scientific Reports, 6\u003c/em\u003e(1), 32280\u0026ndash;32280. 10.1038/srep32280\u003c/li\u003e\n\u003cli\u003eHuang, X., Huang, L., Lu, J., Cheng, L., Wu, D., Li, L., Zhang, S., Lai, X., \u0026amp; Xu, L. (2025). The relationship between telomere length and aging-related diseases.\u003cem\u003e Clinical and Experimental Medicine, 25\u003c/em\u003e(1), 72. 10.1007/s10238-025-01608-z\u003c/li\u003e\n\u003cli\u003eJaul, E., \u0026amp; Barron, J. (2017). Age-Related Diseases and Clinical and Public Health Implications for the 85\u0026thinsp;Years Old and Over Population.\u003cem\u003e Frontiers in Public Health, 5\u003c/em\u003e, 335\u0026ndash;335. 10.3389/fpubh.2017.00335\u003c/li\u003e\n\u003cli\u003eKhavinson, V. K., Bondarev, I. E., \u0026amp; Butyugov, A. A. (2003). Epithalon Peptide Induces Telomerase Activity and Telomere Elongation in Human Somatic Cells.\u003cem\u003e Bulletin of Experimental Biology and Medicine, 135\u003c/em\u003e(6), 590\u0026ndash;592. 10.1023/A:1025493705728\u003c/li\u003e\n\u003cli\u003eKhavinson, V. K., Izmaylov, D. M., Obukhova, L. K., \u0026amp; Malinin, V. V. (2000). Effect of epitalon on the lifespan increase in Drosophila melanogaster.\u003cem\u003e Mechanisms of Ageing and Development, 120\u003c/em\u003e(1), 141\u0026ndash;149. 10.1016/S0047-6374(00)00217-7\u003c/li\u003e\n\u003cli\u003eKhavinson, V. K., Kormilets, D. Y., \u0026amp; Mar\u0026rsquo;yanovich, A. T. (2017). Peptides (Epigenetic Regulators) in the Structure of Rodents with a Long and Short Lifespan.\u003cem\u003e Bulletin of Experimental Biology and Medicine, 163\u003c/em\u003e(5), 671\u0026ndash;676. 10.1007/s10517-017-3876-x\u003c/li\u003e\n\u003cli\u003eKhavinson, V. K., Solovyov, A. Y., \u0026amp; Shataeva, L. K. (2008). Melting of DNA Double Strand after Binding to Geroprotective Tetrapeptide.\u003cem\u003e Bulletin of Experimental Biology and Medicine, 146\u003c/em\u003e(5), 624\u0026ndash;626. 10.1007/s10517-009-0342-4\u003c/li\u003e\n\u003cli\u003eKhavinson, V. K., Zemchikhina, V. N., Trofimova, S. V., \u0026amp; Malinin, V. V. (2003). Effects of Peptides on Proliferative Activity of Retinal and Pigmented Epithelial Cells.\u003cem\u003e Bulletin of Experimental Biology and Medicine, 135\u003c/em\u003e(6), 597\u0026ndash;599. 10.1023/A:1025497806636\u003c/li\u003e\n\u003cli\u003eKhavinson, V., Diomede, F., Mironova, E., Linkova, N., Trofimova, S., Trubiani, O., Caputi, S., \u0026amp; Sinjari, B. (2020). AEDG Peptide (Epitalon) Stimulates Gene Expression and Protein Synthesis during Neurogenesis: Possible Epigenetic Mechanism.\u003cem\u003e Molecules (Basel, Switzerland), 25\u003c/em\u003e(3), 609. 10.3390/molecules25030609\u003c/li\u003e\n\u003cli\u003eKiecolt-Glaser, J. K., Epel, E. S., Belury, M. A., Andridge, R., Lin, J., Glaser, R., Malarkey, W. B., Hwang, B. S., \u0026amp; Blackburn, E. (2013). Omega-3 fatty acids, oxidative stress, and leukocyte telomere length: A randomized controlled trial.\u003cem\u003e Brain, Behavior, and Immunity, 28\u003c/em\u003e, 16\u0026ndash;24. 10.1016/j.bbi.2012.09.004\u003c/li\u003e\n\u003cli\u003eLe\u0026atilde;o, R., Apol\u0026oacute;nio, J. D., Lee, D., Figueiredo, A., Tabori, U., \u0026amp; Castelo-Branco, P. (2018). Mechanisms of human telomerase reverse transcriptase (hTERT) regulation: clinical impacts in cancer.\u003cem\u003e Journal of Biomedical Science, 25\u003c/em\u003e(1), 22\u0026ndash;22. 10.1186/s12929-018-0422-8\u003c/li\u003e\n\u003cli\u003eLewis, K. A., \u0026amp; Tollefsbol, T. O. (2016). Regulation of the Telomerase Reverse Transcriptase Subunit through Epigenetic Mechanisms.\u003cem\u003e Frontiers in Genetics, 7\u003c/em\u003e, 83\u0026ndash;83. 10.3389/fgene.2016.00083\u003c/li\u003e\n\u003cli\u003eLin, C. G., N\u0026auml;ger, A. C., Lunardi, T., Vančevska, A., Lossaint, G., \u0026amp; Lingner, J. (2021). The human telomeric proteome during telomere replication.\u003cem\u003e Nucleic Acids Research, 49\u003c/em\u003e(21), 12119\u0026ndash;12135. 10.1093/nar/gkab1015\u003c/li\u003e\n\u003cli\u003eLin\u0026rsquo;kova, N. S., Drobintseva, A. O., Orlova, O. A., Kuznetsova, E. P., Polyakova, V. O., Kvetnoy, I. M., \u0026amp; Khavinson, V. K. (2016). Peptide Regulation of Skin Fibroblast Functions during Their Aging In Vitro.\u003cem\u003e Bulletin of Experimental Biology and Medicine, 161\u003c/em\u003e(1), 175\u0026ndash;178. 10.1007/s10517-016-3370-x\u003c/li\u003e\n\u003cli\u003eMedrzycki, M., Zhang, Y., Zhang, W., Cao, K., Pan, C., Lailler, N., McDonald, J. F., Bouhassira, E. E., \u0026amp; Fan, Y. (2014). Histone H1.3 Suppresses H19 Noncoding RNA Expression and Cell Growth of Ovarian Cancer Cells.\u003cem\u003e Cancer Research (Chicago, Ill.), 74\u003c/em\u003e(22), 6463\u0026ndash;6473. 10.1158/0008-5472.CAN-13-2922\u003c/li\u003e\n\u003cli\u003eMenassa, M., Stronks, K., Khatmi, F., Roa D\u0026iacute;az, Z. M., Espinola, O. P., Gamba, M., Itodo, O. A., Buttia, C., Wehrli, F., Minder, B., Velarde, M. R., \u0026amp; Franco, O. H. (2023). Concepts and definitions of healthy ageing: a systematic review and synthesis of theoretical models.\u003cem\u003e EClinicalMedicine, 56\u003c/em\u003e, 101821. 10.1016/j.eclinm.2022.101821\u003c/li\u003e\n\u003cli\u003eMurga, M., Jaco, I., Fan, Y., Soria, R., Martinez-Pastor, B., Cuadrado, M., Yang, S., Blasco, M. A., Skoultchi, A. I., \u0026amp; Fernandez-Capetillo, O. (2007). Global chromatin compaction limits the strength of the DNA damage response.\u003cem\u003e The Journal of Cell Biology, 178\u003c/em\u003e(7), 1101\u0026ndash;1108. 10.1083/jcb.200704140\u003c/li\u003e\n\u003cli\u003eO\u0026apos;Callaghan, N. J., \u0026amp; Fenech, M. (2011). A quantitative PCR method for measuring absolute telomere length.\u003cem\u003e Biological Procedures Online, 13\u003c/em\u003e(1), 3. 10.1186/1480-9222-13-3\u003c/li\u003e\n\u003cli\u003eO\u0026apos;Sullivan, R. J., \u0026amp; Almouzni, G. (2014). Assembly of telomeric chromatin to create ALTernative endings.\u003cem\u003e Trends in Cell Biology, 24\u003c/em\u003e(11), 675\u0026ndash;685. 10.1016/j.tcb.2014.07.007\u003c/li\u003e\n\u003cli\u003eO\u0026apos;Sullivan, R. J., Arnoult, N., Lackner, D. H., Oganesian, L., Haggblom, C., Corpet, A., Almouzni, G., \u0026amp; Karlseder, J. (2014). Rapid induction of alternative lengthening of telomeres by depletion of the histone chaperone ASF1.\u003cem\u003e Nature Structural \u0026amp; Molecular Biology, 21\u003c/em\u003e(2), 167\u0026ndash;174. 10.1038/nsmb.2754\u003c/li\u003e\n\u003cli\u003ePerrem, K., Colgin, L. M., Neumann, A. A., Yeager, T. R., \u0026amp; Reddel, R. R. (2001). Coexistence of Alternative Lengthening of Telomeres and Telomerase in hTERT-Transfected GM847 Cells.\u003cem\u003e Molecular and Cellular Biology, 21\u003c/em\u003e(12), 3862\u0026ndash;3875. 10.1128/MCB.21.12.3862-3875.2001\u003c/li\u003e\n\u003cli\u003ePlyasova, A. A., \u0026amp; Zhdanov, D. D. (2021). Alternative Splicing of Human Telomerase Reverse Transcriptase (hTERT) and Its Implications in Physiological and Pathological Processes.\u003cem\u003e Biomedicines, 9\u003c/em\u003e(5), 526. 10.3390/biomedicines9050526\u003c/li\u003e\n\u003cli\u003eRose, A. M., Goncalves, T., Cunniffe, S., Geiller, H. E. B., Kent, T., Shepherd, S., Ratnaweera, M., O\u0026rsquo;Sullivan, R., Gibbons, R., \u0026amp; Clynes, D. (2023). Induction of the alternative lengthening of telomeres pathway by trapping of proteins on DNA.\u003cem\u003e Nucleic Acids Research, 51\u003c/em\u003e(13), 6509\u0026ndash;6527. 10.1093/nar/gkad150\u003c/li\u003e\n\u003cli\u003eScaffidi, P. (2016). Histone H1 alterations in cancer.\u003cem\u003e Biochimica Et Biophysica Acta, 1859\u003c/em\u003e(3), 533\u0026ndash;539. 10.1016/j.bbagrm.2015.09.008\u003c/li\u003e\n\u003cli\u003eSchellnegger, M., Hofmann, E., Carnieletto, M., \u0026amp; Kamolz, L. (2024). Unlocking longevity: the role of telomeres and its targeting interventions.\u003cem\u003e Frontiers in Aging, 5\u003c/em\u003e, 1339317. 10.3389/fragi.2024.1339317\u003c/li\u003e\n\u003cli\u003eTenchov, R., Sasso, J. M., Wang, X., \u0026amp; Zhou, Q. A. (2024). Aging Hallmarks and Progression and Age-Related Diseases: A Landscape View of Research Advancement.\u003cem\u003e ACS Chemical Neuroscience, 15\u003c/em\u003e(1), 1\u0026ndash;30. 10.1021/acschemneuro.3c00531\u003c/li\u003e\n\u003cli\u003eTorres, C. M., Biran, A., Burney, M. J., Patel, H., Henser-Brownhill, T., Cohen, A. S., Li, Y., Ben-Hamo, R., Nye, E., Spencer-Dene, B., Chakravarty, P., Efroni, S., Matthews, N., Misteli, T., Meshorer, E., \u0026amp; Scaffidi, P. (2016). The linker histone H1.0 generates epigenetic and functional intratumor heterogeneity.\u003cem\u003e Science, 353\u003c/em\u003e(6307), 1514. 10.1126/science.aaf1644\u003c/li\u003e\n\u003cli\u003eVaiserman, A., \u0026amp; Krasnienkov, D. (2021). Telomere Length as a Marker of Biological Age: State-of-the-Art, Open Issues, and Future Perspectives.\u003cem\u003e Frontiers in Genetics, 11\u003c/em\u003e, 630186. 10.3389/fgene.2020.630186\u003c/li\u003e\n\u003cli\u003eWhittemore, K., Vera, E., Mart\u0026iacute;nez-Nevado, E., Sanpera, C., \u0026amp; Blasco, M. A. (2019). Telomere shortening rate predicts species life span.\u003cem\u003e Proceedings of the National Academy of Sciences, 116\u003c/em\u003e(30), 15122\u0026ndash;15127. 10.1073/pnas.1902452116\u003c/li\u003e\n\u003cli\u003eYik, M. Y., Azlan, A., Rajasegaran, Y., Rosli, A., Yusoff, N. M., \u0026amp; Moses, E. J. (2021). Mechanism of Human Telomerase Reverse Transcriptase (hTERT) Regulation and Clinical Impacts in Leukemia.\u003cem\u003e Genes, 12\u003c/em\u003e(8), 1188. 10.3390/genes12081188\u003c/li\u003e\n\u003cli\u003eYu, Q., Gates, P., Rogers, S., Mikicic, I., Elewa, A., Salomon, F., Lachnit, M., Caldarelli, A., Flores-Rodriguez, N., Cesare, A. J., Simon, A., \u0026amp; Maximina Yun. (2022). Telomerase-independent maintenance of telomere length in a vertebrate.\u003cem\u003e bioRxiv, \u003c/em\u003e10.1101/2022.03.25.485759\u003c/li\u003e\n\u003cli\u003eYu-Zun Guo, Yi Zhang, Qing Wang, Jun Yu, Qiu-Hong Wan, Jun Huang, \u0026amp; Sheng-Guo Fang. (2023). Alternative telomere maintenance mechanism in Alligator sinensis provides insights into aging evolution Alternative telomere maintenance mechanism in Alligator sinensis provides insights into aging evolution.\u003cem\u003e iScience, 26\u003c/em\u003e(1), 105850. https://doaj.org/article/2a12a0996a8c44629631ff1c750e5ce5\u003c/li\u003e\n\u003cli\u003eZhou, D., Luo, M., Huang, S., Saimaiti, A., Shang, A., Gan, R., \u0026amp; Li, H. (2021). Effects and Mechanisms of Resveratrol on Aging and Age-Related Diseases.\u003cem\u003e Oxidative Medicine and Cellular Longevity, 2021\u003c/em\u003e(1), 9932218. 10.1155/2021/9932218\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"biogerontology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [Biogerontology](https://www.springer.com/journal/10522)","snPcode":"10522","submissionUrl":"https://submission.nature.com/new-submission/10522/3","title":"Biogerontology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Telomerase, ALT, Telomere length, Mammalian cells","lastPublishedDoi":"10.21203/rs.3.rs-7066545/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7066545/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eEpitalon, a naturally occurring tetrapeptide, is known for its anti-aging effects on mammalian cells. This happens through the induction of telomerase enzyme activity, resulting in the extension of telomere length. \u0026nbsp;A strong link exists between telomere length and aging-related diseases. Therefore, telomeres are considered to be one of the biomarkers of aging, and increasing or maintaining telomere lengths may contribute to healthy aging and longevity. \u0026nbsp;Epitalon has been the subject of several anti-aging studies however, quantitative data on the biomolecular pathway leading to telomere length increase, \u003cem\u003ehTERT mRNA \u003c/em\u003eexpression, telomerase enzyme activity, and ALT activation have not been extensively studied in different cell types. In this article, the breast cancer cell lines 21NT, BT474, and normal epithelial and fibroblast cells were treated with epitalon then DNA, RNA, and proteins were extracted. qPCR and Immunofluorescence analysis demonstrated dose-dependent telomere length extension in normal cells through \u003cem\u003ehTERT\u003c/em\u003eand telomerase upregulation. In cancer cells, significant telomere length extension also occurred through ALT (Alternative Lengthening of Telomeres) activation. Only a minor increase in ALT activity was observed in Normal cells, thereby showing that it was specific to cancer cells. Our data suggests that Epitalon can extend telomere length in normal healthy mammalian cells through the upregulation of \u003cem\u003ehTERT\u003c/em\u003e mRNA expression and telomerase enzyme activity.\u003c/p\u003e","manuscriptTitle":"Epitalon increases telomere length in human cell lines through telomerase upregulation or ALT activity","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-07-15 15:20:53","doi":"10.21203/rs.3.rs-7066545/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-08-03T16:48:12+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-08-02T22:20:08+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-07-27T12:46:01+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"237108517778238126920510032384659989497","date":"2025-07-18T13:13:24+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"82891344424957601929358591180084059876","date":"2025-07-13T17:09:26+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-07-13T12:42:25+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-07-12T17:59:54+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-07-08T06:30:30+00:00","index":"","fulltext":""},{"type":"submitted","content":"Biogerontology","date":"2025-07-07T14:22:46+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"biogerontology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [Biogerontology](https://www.springer.com/journal/10522)","snPcode":"10522","submissionUrl":"https://submission.nature.com/new-submission/10522/3","title":"Biogerontology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"232acbd7-ed48-4cd9-ad55-5fa36bbf3445","owner":[],"postedDate":"July 15th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2025-08-18T11:23:56+00:00","versionOfRecord":[],"versionCreatedAt":"2025-07-15 15:20:53","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7066545","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7066545","identity":"rs-7066545","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.