Ameliorative Effects of Dietary Chlorella vulgaris and β-glucan Against Chlorpyrifos-Induced Toxicity in African catfish (Clarias gariepinus)

preprint OA: closed
Full text JSON View at publisher
Full text 216,468 characters · extracted from preprint-html · click to expand
Ameliorative Effects of Dietary Chlorella vulgaris and β-glucan Against Chlorpyrifos-Induced Toxicity in African catfish (Clarias gariepinus) | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Ameliorative Effects of Dietary Chlorella vulgaris and β-glucan Against Chlorpyrifos-Induced Toxicity in African catfish (Clarias gariepinus) Ahmed E. A. Mostafa This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6897467/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The present study was conducted to investigate the toxic effects of chlorpyrifos on growth performance, hepatorenal function, and antioxidant status in African catfish (Clarias gariepinus). One hundred and eighty fish (20 ± 6.1 g) were equally distributed into four groups: control group, chlorpyrifos group (0.3 mg/L), chlorpyrifos-CV group (5% CV), and chlorpyrifos-β-glucan group (0.1% β-glucan), and treatments were conducted for about 60 days. The results revealed that administration of chlorpyrifos significantly increased serum liver enzymes, system, innate immune response and comparing the protective role of dietary Chlorella vulgaris (CV) algae and β-glucan in intoxicated African catfish ( Clarias gariepinus ). One uric acid, creatinine, and malondialdehyde (MDA) in different tissues. Meanwhile, glutathione (GSH) and superoxide dismutase (SOD) in different tissues, as well as IgM, C-reactive protein (CRP), respiratory burst, lysozyme, and bactericidal activities were significantly decreased in the chlorpyrifos group. In addition, expression of TNF-α gene was up-regulated and IL-10 was down-regulated in spleen of chlorpyrifos-intoxicated fish. The treatment of chlorpyrifos-exposed fish with CV and β-glucan supplemented diets ameliorated hepatic damage and enhanced antioxidant activity and innate immune responses. Furthermore, dietary Chlorella vulgaris and β-glucan have a potent anti-inflammatory effect as they remarkably increased the expression of IL-10 and decreased TNF-α gene expression. The results also revealed that fish in chlorpyrifos-CV group had the highest survival rate, final body weight (FBW), and body weight gain (BWG). On the other hand, feed conversion ratio (FCR), specific growth rate (SGR), and protein efficiency ratio (PER) of control, chlorpyrifos-CV, and chlorpyrifos-β-glucan groups were higher than the chlorpyrifos group. However, the hepatosomatic index (HSI) and spleen-somatic index (SSI) were higher in the chlorpyrifos group than other experimental groups. Overall, CV and β-glucan can be recommended as a feed supplement to improve immunosuppression, oxidative damage, growth performance, and hemato-biochemical alterations induced by chlorpyrifos toxicity in African catfish ( Clarias gariepinus ) . Chlorella vulgaris β-glucan Chlorpyrifos African catfish (Clarias gariepinus) Immunostimulants Immune response Antioxidant system Gene expression Growth performance Fish health Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction African catfish ( Clarias gariepinus ) is one of the most widely cultured fish species around the world and holds significant economic importance for aquaculture and inland fisheries. Pollution of water resources with agricultural pesticides represents a considerable hazard to this species [ 1 ]. Pesticides, especially organophosphorus compounds, are the main ecotoxicants present in the aquatic environment, exerting severe destructive effects on aquatic animals, particularly fish [ 2 ]. Chlorpyrifos [O,O-diethyl O-(3,5,6-trichloro-2-pyridyl) phosphorothioate] is one of the most extensively used organophosphorus pesticides in agriculture and domestic pest control. Additionally, it is frequently washed out into surface waters as runoff from agricultural fields and drainage systems [ 3 ]. Chlorpyrifos degrades relatively quickly under certain conditions, but in some cases, it can remain biologically active for several months [ 4 ]. Like other xenobiotics, chlorpyrifos contaminates surface waters, causing serious oxidative damage and significant impairment in the physiological and health status of exposed fish [ 5 ]. Exposure of fish to chlorpyrifos toxicity induces several hematological, biochemical, and immunological alterations that threaten the survival of exposed fish and increase their susceptibility to infectious diseases [ 6 ]. Moreover, acute exposure to different concentrations of chlorpyrifos negatively affects non-specific immune responses [ 7 ] and growth performance parameters in various fish species [ 5 ]. Recently in aquaculture, the use of dietary supplements, such as probiotics, prebiotics, and immunostimulants, has gained considerable attention as natural alternatives to chemical additives to promote fish growth, improve immunity, and enhance survival [ 8 ]. Chlorella vulgaris (CV) is the most common unicellular freshwater microalga and is widely used as a probiotic dietary supplement in aquaculture. CV possesses numerous nutritional, biological, and pharmacological properties due to its bioactive compounds, including proteins, omega-3 and omega-6 polyunsaturated fatty acids, polysaccharides, vitamins, minerals, and photosynthetic pigments (carotenoids and chlorophylls) [ 9 ]. CV has been utilized as a feed additive in aquaculture due to its beneficial effects on growth performance, innate immune responses, antioxidant enzyme activity, and enhanced resistance to diseases [ 10 ]. β -glucans are linear polysaccharides extracted from the cell walls of plants, filamentous fungi, bacteria, yeast, and mushrooms. β-glucans are considered ideal immune-stimulating molecules for aquaculture [ 11 ]. They can stimulate several immune responses, such as enhancing phagocytic activity, activating the complement cascade, and increasing the expression of cytokines in macrophages, neutrophils, and dendritic cells [ 12 ]. β-glucans extracted from the cell wall of Saccharomyces cerevisiae have been reported to enhance the immune response and disease resistance of fish against Aeromonas hydrophila [ 13 ]. In addition, their supplementation improves growth performance, antioxidant status [ 14 ], and anti-inflammatory responses in fish [ 15 ]. To the best of our knowledge, this is the first study conducted to evaluate and compare the protective effects of Chlorella vulgaris, as a probiotic, and β-glucan, as a prebiotic, against hepatorenal toxicity, oxidative damage, immunosuppression, and growth performance alterations following subacute exposure of African catfish ( Clarias gariepinus ) to chlorpyrifos. 2. Materials and Methods 2.1. Chemicals Chlorpyrifos (CPF) (48%) was purchased from Adwia Pharmaceuticals (Cairo, Egypt) and was freshly diluted with distilled water immediately before use. Chlorella vulgaris (CV) pure powder was obtained from Roquette Klötze GmbH and Co.KG, Klötze, Germany. β-glucan extracted from Saccharomyces cerevisiae was purchased from Hang Zhou Bio Technology Co., Ltd., China. 2 .2. Diet Preparation Four isonitrogenous (32% crude protein) and isocaloric (3000 Kcal DE/kg) diets were formulated to meet the nutritional requirements of Clarias gariepinus (African catfish) according to NRC [16]. Three dietary treatments were prepared in addition to the control basal diet: · Basal diet supplemented with 5% Chlorella vulgaris [17]. · Basal diet supplemented with 0.1% β-glucan [18]. The ingredients of each dietary treatment are presented in Table 1. All diets were processed into water-stable sinking pellets and stored in sealed plastic bags in a refrigerator until use. 2.3. Fish and Experimental Design A total of 180 healthy African catfish ( Clarias gariepinus ) with an average initial body weight of 25 ± 4.3 g were obtained from a private fish farm in Kafrelsheikh Governorate, Egypt. Fish were housed in an indoor aquaculture system with a continuous supply of well-aerated, dechlorinated freshwater, and equipped with internal filtration. Water parameters were maintained as follows: temperature 25 ± 1.2 °C, dissolved oxygen 6.8 ± 0.4 mg/L, and pH 7.4–7.8. Fish were fed at 3% of their body weight twice daily (9:00–10:00 AM and 4:00–5:00 PM) with a commercial basal diet during the two-week acclimatization period. After acclimation, fish were randomly assigned into four groups, each in triplicate (15 fish per tank; total 45 fish per group), using glass aquaria (dimensions: 40 × 60 × 30 cm) supplied with dechlorinated tap water and continuous aeration. Fish were treated for 60 consecutive days according to the following protocol: · Control Group: Fish were fed the control basal diet without any exposure to chlorpyrifos. · CPF Group: Fish were exposed to chlorpyrifos at a concentration of 0.24 mg/L (1/10 of 96 h LC50) in the rearing water and fed the control basal diet. The chlorpyrifos dose was determined based on [19], who reported that the 96 h LC50 of chlorpyrifos in Clarias gariepinus is 2.4 mg/L. · CPF-CV Group: Fish were exposed to chlorpyrifos at the same concentration (0.24 mg/L) and fed the diet supplemented with 5% Chlorella vulgaris. · CPF-β-glucan Group: Fish were exposed to chlorpyrifos at the same concentration (0.24 mg/L) and fed the diet supplemented with 0.1% β-glucan. Table 1 Percentage of ingredients of experimental diets. Ingredients (%) Control Chlorella vulgaris β-glucan Yellow corn (8.5%) 12.50 18.00 12.50 Soybean meal (44%) 19.50 17.00 19.50 Fish meal 20.00 19.00 20.00 Wheat bran 38.00 30.00 38.00 Corn gluten 2.00 4.00 2.00 Gelatin 2.00 1.50 2.00 Oil 3.00 4.00 3.00 β-glucan 0.00 0.00 0.10 Chlorella vulgaris 0.00 5.00 0.00 Minerals and vitamins premix** 1.00 1.00 1.00 Salt 0.50 0.50 0.50 Dicalcium phosphate 0.10 0.10 0.10 Methionine 0.30 0.30 0.30 Chemical composition (%) Components Control Chlorella vulgaris β-glucan Crude protein 32.10 32.30 32.10 DE (kcal/kg) 3000 3000 3000 ** Vitamin mixture supplies the following per kilogram of diet: vit. A – 1,200,000 IU; vit. D3 – 200,000 IU; vit. E – 12,000 mg; vit. K3 – 2400 mg; vit. B1 – 4800 mg; vit. B2 – 4800 mg; vit. B6 – 4000 mg; vit. B12 – 4800 mg; folic acid – 1200 mg; vit. C – 48,000 mg; biotin – 48 mg; choline – 65,000 mg; niacin – 24,000 mg; Fe – 10,000 mg; Cu – 600 mg; Mg – 4000 mg; Zn – 6000 mg; I – 20 mg; Co – 2 mg; Se – 20 mg. Fish in the CPF group were intoxicated with chlorpyrifos at the same previous dose and fed with Chlorella vulgaris supplemented diet at a dose of 5%. CPF-β-glucan group, fish were intoxicated with chlorpyrifos at the same previous dose and fed with β-glucan containing diet at a dose of 0.1%. Water changes were performed at 80% daily to prevent metabolite accumulations (static-renewal system), then fresh chlorpyrifos solution was added to each experimental group to maintain the set concentrations. The survival rate of African catfish ( Clarias gariepinus ) in the different treated groups was recorded throughout the feeding trial. 2.4. Samples Collection After 28 days from the beginning of the experiment, fish were collected from each aquarium (n = 10 per group); then sedated with 30 mg/L of tricaine methanesulphonate (MS-222, FINQUEL®, ARGENT) buffered in sodium bicarbonate (60 mg/L) and euthanized with 200 mg/L of MS-222 buffered in sodium bicarbonate (400 mg/L) [20]. Blood samples were collected from the caudal blood vessels of each single fish. One blood sample was collected in a tube containing dipotassium EDTA for blood counting and estimation of whole blood respiratory burst activity [21]. Another blood sample was collected in plain test tubes and centrifuged at 3000 rpm for 10 minutes for serum separation. The separated serum was stored at −80 °C for further determination of biochemical and immunological parameters [22]. Moreover, spleen, liver, and gills were collected, washed with normal saline, and homogenized in cold phosphate buffer saline (PBS, pH 7.5). The different tissue homogenates were cold centrifuged for about 15 minutes at 3000 rpm, and the clear supernatants were carefully collected and stored at −80 °C till analysis of antioxidant and oxidative stress parameters [23]. Another sample of the spleen was placed in RNA Later® (Qiagen) at 4 °C overnight and stored at −80 °C for gene expression analysis [24]. The remaining fish continued under the same experimental treatments as previously described. After 60 days from the beginning of the experiment, all remaining fish in each group were counted for the survival rate and weighed to estimate weight gain (WG) [25]. Random fish samples (10 fish per aquarium) from all experimental groups were sacrificed, and the abdominal cavity was quickly opened to remove the organs (liver, spleen) to be weighed immediately [26]. All experimental procedures were conducted following the Animal Care and Use guidelines of Kafrelsheikh University and were approved by the local Administrative Panel on Laboratory Animal Care Committee. 2.5. Blood Cell Count The total erythrocyte (RBCs) and leukocyte (WBCs) counts were determined using Natt-Herrick’s solution for dilution and were manually counted using a hemocytometer following the method described by [27]. Hemoglobin (Hb) concentration was measured spectrophotometrically using the cyanmethemoglobin method as described by [28]. The packed cell volume (PCV) and red blood cell indices including mean corpuscular volume (MCV, fl), mean corpuscular hemoglobin (MCH, pg), and mean corpuscular hemoglobin concentration (MCHC, %) were calculated according to [29]. Blood smears were prepared for each fish, stained with Giemsa stain, and used to perform differential leukocyte counts according to [27]. 2.6. Evaluation of serum biochemical parameters Serum biochemical parameters including alanine aminotransferase (ALT) and aspartate aminotransferase (AST) (BioMed, Egypt), alkaline phosphatase (ALP) (Spectrum, Egypt), total protein and albumin (Bio-Diagnostic, Egypt), creatinine (Human, Germany), and uric acid (BioMed, Egypt) were determined using a spectrophotometer (5010, Photometer, BM Co. Germany) according to the manufacturer’s instructions (30). 2.7. Antioxidant and oxidative stress parameters The levels of malondialdehyde (MDA), glutathione (GSH), catalase, and superoxide dismutase (SOD) in the spleen, liver, and gills were assessed using commercial test kits (Bio-Diagnostic, Egypt) and analyzed with a spectrophotometer (5010, Photometer, BM Co. Germany) following the standard procedures provided by the manufacturers (31). 2.8. Immune parameters 2.8.1. Respiratory burst activity The respiratory burst activity of phagocytes in the blood was measured using the nitroblue tetrazolium (NBT; Sigma-Aldrich, USA) reduction assay as previously described by Wijendra and Pathiratne (32). In brief, 100 µL of whole blood was mixed with an equal volume of NBT solution (1 mg/mL) in a microtiter plate and incubated at 25 °C for 30 minutes. After incubation, 50 µL of the mixture was transferred into a glass tube containing 1.0 mL of N,N-dimethylformamide. The solution was then centrifuged at 3000 g for 5 minutes. The absorbance of the clear supernatant was read at 540 nm using a spectrophotometer (5010, Photometer, BM Co. Germany). The respiratory burst activity was expressed as the optical density (O.D.) of NBT reduction. 2.8.2. Serum lysozyme activity Serum lysozyme activity was assessed following the method of Ghareghanipoor et al. (33) with slight modifications. Briefly, 0.25 mL of serum was mixed with 0.75 mL of Micrococcus lysodeikticus suspension (0.2 mg/mL in 0.05 M PBS, pH 6.2; Sigma-Aldrich, USA). The reaction was allowed to proceed at 25 °C for 5 minutes, and the optical density (O.D.) was recorded at 1-minute intervals for 5 minutes at 540 nm using a spectrophotometer (5010, Photometer, BM Co. Germany). Serum lysozyme concentration was calculated using a standard curve prepared from serial dilutions of lyophilized chicken egg-white lysozyme (Sigma-Aldrich, USA) ranging from 2 to 20 μg/mL. 2.8.3. Serum bactericidal activity The bactericidal activity of serum was evaluated according to the method described by Abdelhamid et al. (34). Briefly, 100 µL of serum was added to 50 µL of Aeromonas hydrophila suspension (1 × 10⁸ CFU/mL) in duplicate wells of a 96-well round-bottom microtiter plate and mixed well. The mixture was incubated at 37 °C for 2.5 hours. A control was included by replacing the serum with sterile Hank’s Balanced Salt Solution. After incubation, 50 µL of MTT solution (2 mg/mL) was added to each well and the plates were incubated at room temperature for 20 minutes to allow formazan formation. The plates were centrifuged at 2000 × g for 10 minutes, the supernatant was discarded, and the formazan crystals were dissolved in 200 µL of dimethyl sulfoxide (DMSO). The absorbance was measured at 560 nm using a microplate reader (Optica, Mikura Ltd, UK). Bactericidal activity was expressed as the difference in absorbance between the control and the test sample. 2.8.4. Measurement of C-reactive protein (CRP) and immunoglobulin M (IgM) Serum C-reactive protein (CRP) was qualitatively determined using a rapid latex agglutination test according to the method of Tillett and Francis (35). Immunoglobulin M (IgM) levels were quantitatively measured using the turbidity assay based on the formation of antigen-antibody insoluble immune complexes following the method of Dati and Lammers (36). 2.9. Gene Expression Analysis of Immune-Related Genes 2.9.1. Extraction of Total RNA and Reverse Transcription Total RNA was extracted from spleen tissues using the RNAeasy Mini Kit (Qiagen, Germany) following the protocol described by Zhang et al. (37) with minor modifications. The concentration and purity of RNA were determined using a NanoDrop spectrophotometer (260/280 nm ratio) (Thermo Fisher Scientific, USA). RNA samples were then used as templates for cDNA synthesis using the RevertAid™ First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, USA) according to the manufacturer’s instructions. The synthesized cDNA was stored at −80 °C until further use. 2.9.2. Real-Time Quantitative PCR (RT-qPCR) Quantitative real-time PCR was performed using the CFX Connect Real-Time PCR Detection System (Bio-Rad, USA) and SYBR® Green PCR Master Mix (Thermo Fisher Scientific, USA) to quantify the expression levels of target immune-related genes in liver tissues. The genes of interest, including tumor necrosis factor-alpha (TNF-α), interleukin-1 beta (IL-1β), and the housekeeping gene β-actin, were selected based on sequences provided by Wang et al. (38) and Li et al. (39). The PCR cycling conditions were as follows: initial denaturation at 95 °C for 10 minutes, followed by 40 cycles of denaturation at 95 °C for 30 seconds, annealing at 58 °C for 30 seconds, and extension at 72 °C for 30 seconds. The relative gene expression was calculated using the comparative CT method (2 ΔΔCT) as described by Livak and Schmittgen (40). 2.10. CPF Residues Analysis The extraction and cleanup of chlorpyrifos (CPF) residues from Nile tilapia liver tissue were carried out using the QuEChERS method as described by Mastovska and Lehotay (41) with slight modifications. The cleaned and acidified extracts were then subjected to multi-residue determination using Gas Chromatography equipped with an Electron Capture Detector (GC-ECD; Agilent 7890B, USA). Each extract was analyzed in triplicate to ensure accuracy and repeatability. Table 2 Primer sequences used for RT-PCR analysis. Gene Primer Sequence (5′ to 3′) Amplicon size (bp) Accession number Tumor necrosis factor-α TNFα-F: CAGACTGTAGCCCTGTCACCA 85 AY428948.1 TNFα-R: GTCACAGAGTGGGAGGTTGAT Interleukin 10 IL-10-F: CGCTGTCATCGATTTCTCCAT 97 XM_003441366.2 IL-10-R: ATCTCCTGTTCCCTCCTGCTT Elongation factor 1α EF1α-F: GACAACATGCTTGAGGCTGAC EF1α-R: CCAATACCAGTCTCCACACCA 83 AB075952.1 2.11. Growth Parameter Measurements Growth performance and feed utilization were evaluated by measuring weight gain, specific growth rate (SGR), feed conversion ratio (FCR), protein efficiency ratio (PER), hepatosomatic index (HSI), spleensomatic index (SSI), and survival rate (SR) according to the method described by Cech et al. [42]. The following equations were applied to assess the growth performance and body indices of Oreochromis niloticus : · Weight Gain (WG, g) = Mean final weight (g) – Mean initial weight (g) · Feed Conversion Ratio (FCR) = Feed intake (g) / Weight gain (g) · Specific Growth Rate (SGR, %/day) = 100 × [(Ln mean final body weight - Ln mean initial body weight) / Culture period (days)] · Protein Efficiency Ratio (PER) = Wet weight gain (g) / Protein intake (g) · Hepatosomatic Index (HSI) = (Liver weight / Body weight) × 100 · Spleensomatic Index (SSI) = (Spleen weight / Body weight) × 100 · Survival Rate (SR, %) = (Final fish number / Initial fish number) × 100 2.12. Statistical analysis All data were presented as mean ± standard error (SE). Statistical analyses were performed using the SPSS software program (version 26, IBM, USA). One-way analysis of variance (ANOVA) was used to assess the differences among the experimental groups, followed by Tukey’s post-hoc test to compare means. Differences were considered statistically significant when P < 0.05. 3. Results 3.1. Blood cell count There were no significant differences in RBC count, hemoglobin concentration, and PCV percentage among CPF, CPF-C. vulgaris, and CPF-β-glucan treated fish compared to the control group (p < 0.05). However, total leukocytic count (TLC) and lymphocyte count were significantly decreased in the CPF-intoxicated group compared to the control (p < 0.05), while heterophil counts were significantly elevated in the CPF group compared to the control (p < 0.05) (Table 3 ). Feeding CPF-intoxicated fish with Chlorella vulgaris or β-glucan supplemented diets significantly improved the TLC and lymphocyte counts compared to the CPF group (p < 0.05). Additionally, heterophil counts remained significantly higher in the CPF-C. vulgaris and CPF-β-glucan groups compared to both the control and CPF groups (p < 0.05). Monocyte counts did not show significant differences between all groups (p < 0.05) (Table 3 ). Table 3 Hematological parameters of African catfish ( Clarias gariepinus ) treated with Chlorpyrifos, Chlorella vulgaris and β-glucan. Experimental groups Control CPF CPF-CV CPF-β-glucan RBCs (10⁶/µL) 1.95 ± 0.12ᵃ 2.10 ± 0.18ᵃ 2.20 ± 0.21ᵃ 2.40 ± 0.25ᵃ Hb (g/dl) 8.60 ± 0.70ᵃ 9.85 ± 1.20ᵃ 9.15 ± 0.50ᵃ 9.50 ± 0.40ᵃ PCV (%) 29.00 ± 1.10ᵃ 30.20 ± 1.50ᵃ 28.90 ± 1.00ᵃ 31.00 ± 1.30ᵃ WBCs (10³/µL) 45.50 ± 3.00ᵇ 37.80 ± 3.50ᶜ 60.40 ± 4.00ᵃ 56.20 ± 3.20ᵃ Lymphocyte (10³/µL) 24.10 ± 1.20ᵃ 13.50 ± 1.40ᶜ 26.00 ± 3.00ᵃ 21.20 ± 2.30ᵇ Heterophil (10³/µL) 17.20 ± 1.80ᶜ 22.50 ± 2.50ᵇ 30.50 ± 2.30ᵃ 32.00 ± 1.90ᵃ Monocyte (10³/µL) 4.50 ± 0.50ᵃ 4.10 ± 0.70ᵃ 4.80 ± 0.40ᵃ 4.90 ± 0.30ᵃ Data are expressed as Mean ± SEM (n = 5).Means in the same row with different superscripts are significantly different (p < 0.05).CPF, Chlorpyrifos; CV, Chlorella vulgaris; RBCs, Red blood cell count; Hb, Hemoglobin; PCV, Packed Cell Volume; WBCs, White blood cell count. 3.2. Biochemical parameters The Chlorpyrifos (CPF) induced hepatotoxicity was indicated by a significant elevation in ALT and AST activities compared to the control group (p < 0.05). However, the CPF-CV and CPF-β-glucan treated groups showed significantly lower serum levels of ALT and AST compared to the CPF group (p < 0.05). No significant differences in ALP levels were observed among all treated groups (Table 4 ). Serum total protein level was significantly higher in the CPF-β-glucan treated fish compared to the other groups (p < 0.05). Serum albumin level was slightly decreased in CPF intoxicated fish compared to the other groups. Meanwhile, globulin was significantly decreased in the CPF group compared to the control and CPF-β-glucan groups (p < 0.05). In fish fed β-glucan supplemented diets, the globulin level was significantly higher, while the albumin-globulin ratio (A/G) was significantly lower than those of the CPF group (p < 0.05) (Table 4 ). CPF, CPF-CV and CPF-β-glucan treated fish showed significantly higher levels of creatinine and uric acid than the control fish (p < 0.05). Additionally, uric acid levels in both CPF-CV and CPF-β-glucan groups were significantly lower than those in the CPF group (p < 0.05) (Table 4 ). Table 4 Serum biochemical parameters of African catfish ( Clarias gariepinus ) treated with Chlorpyrifos, Chlorella vulgaris and β-glucan. Experimental groups Control CPF CPF-CV CPF-β-glucan ALT (U/L) 11.80 ± 1.05ᶜ 26.90 ± 2.90ᵃ 18.60 ± 1.50ᵇ 19.50 ± 1.70ᵇ AST (U/L) 56.20 ± 4.90ᶜ 112.50 ± 9.80ᵃ 95.40 ± 7.10ᵇ 82.70 ± 5.80ᵇ ALP (U/L) 78.00 ± 6.90ᵃ 88.20 ± 5.90ᵃ 76.50 ± 5.70ᵃ 85.30 ± 4.10ᵃ Total protein (g/dl) 4.40 ± 0.38ᵇ 3.55 ± 0.40ᶜ 4.20 ± 0.22ᵇ 4.85 ± 0.60ᵃ Albumin (g/dl) 1.30 ± 0.14ᵃ 1.22 ± 0.11ᵃ 1.25 ± 0.10ᵃ 1.29 ± 0.18ᵃ Globulin (g/dl) 3.10 ± 0.30ᵃ 2.33 ± 0.35ᶜ 2.95 ± 0.12ᵃᵇ 3.56 ± 0.50ᵃ A/G ratio (%) 0.42 ± 0.04ᵃᵇ 0.52 ± 0.06ᵃ 0.42 ± 0.05ᵃᵇ 0.36 ± 0.07ᵇ Creatinine (mg/dl) 0.28 ± 0.015ᵇ 0.37 ± 0.017ᵃ 0.34 ± 0.020ᵃ 0.33 ± 0.019ᵃ Uric acid (mg/dl) 5.30 ± 0.40ᶜ 9.50 ± 0.38ᵃ 7.80 ± 0.28ᵇ 7.90 ± 0.15ᵇ Data are expressed as Mean ± SEM (n = 5).Means in the same row with different superscripts are significantly different (p < 0.05).CPF, Chlorpyrifos; CV, Chlorella vulgaris; ALT, alanine aminotransferase; AST, aspartate aminotransferase; ALP, alkaline phosphatase; A/G ratio, albumin/globulin ratio. 3.3. Antioxidant and Oxidative Stress Parameters Spleen MDA level was significantly increased in CPF and CPF-CV groups compared to the control and CPF-β-glucan groups (p < 0.05). Additionally, liver MDA levels were significantly elevated in CPF group in contrast to all other groups (p < 0.05) (Fig. 1 A). CPF exposure significantly decreased GSH levels in liver and gills compared to the control group (p < 0.05). Treatment of CPF-exposed fish with CV and β-glucan supplemented diets significantly improved liver GSH levels compared to CPF group (p < 0.05). Notably, only the β-glucan supplemented diet was able to restore gill GSH levels back to normal (Fig. 1 B). Spleen and liver catalase (CAT) levels showed no significant differences among the experimental groups. However, the CPF-CV group demonstrated significantly higher catalase activity compared to all other groups (p < 0.05) (Fig. 1 C). Moreover, liver SOD activity was significantly lower in CPF and CPF-CV groups compared to the control group (p < 0.05). Interestingly, the highest liver SOD activity was recorded in CPF-β-glucan group compared to all other groups, including the control (p < 0.05) (Fig. 1 D). No significant differences were detected in gill MDA, spleen GSH, and gill SOD levels among all groups (Fig. 1 A, 1 B, 1 D). 3.4. Immune Parameters Chlorpyrifos (CPF) intoxicated fish showed a significant reduction in respiratory burst activity compared to the control group (p < 0.05). CPF groups fed with diets containing Chlorella vulgaris (CV) and β-glucan exhibited significantly higher respiratory burst activity compared to both CPF and control groups (p < 0.05) (Fig. 2 ). Serum lysozyme activity was significantly lower in CPF-treated fish than all other groups (p < 0.05). Only the β-glucan treated group showed a significant increase in lysozyme activity compared to other treatments (p < 0.05) (Fig. 3 A). Moreover, CPF toxicity significantly decreased bactericidal activity compared to both CPF-CV and CPF-β-glucan groups (p < 0.05). The highest bactericidal activity was recorded in the CV-supplemented group compared to all other groups (p < 0.05) (Fig. 3 B). Serum immunoglobulin G (IgM) and C-reactive protein (CRP) levels were significantly reduced in CPF-intoxicated fish compared to the control group (p < 0.05). However, these parameters were significantly elevated in the CPF-β-glucan group compared to the CPF and control groups (p < 0.05). Additionally, dietary supplementation with CV significantly improved IgG levels but had no significant effect on CRP levels compared to the CPF group (p < 0.05) (Fig. 4 ). 3.5. Expression of Immune-Related Genes The TNF-α transcript level was significantly up-regulated in the spleen of all CPF-treated fish compared to the control group (p < 0.05). This significant increase was also observed in the spleen of CPF-CV and CPF-β-glucan treated fish compared to the control fish (p < 0.05) (Fig. 5 A). The expression of IL-10 was significantly down-regulated in the spleen of CPF, CPF-CV, and CPF-β-glucan treated fish compared to the control group (p < 0.05). However, IL-10 expression was significantly higher in the CPF-CV and CPF-β-glucan supplemented fish than in CPF-intoxicated fish (p < 0.05) (Fig. 5 B). 3.6. CPF Residues in Liver Tissue The CPF residues results are presented in Table 6 and showed that the highest concentration of CPF residue was detected in CPF-exposed fish (CPF group) compared to CPF-CV and CPF-β-glucan treated groups (p < 0.05). Meanwhile, the CPF concentration was significantly lower in CPF-CV group compared to CPF-β-glucan group (p < 0.05). Table 6 Concentration residues of Chlorpyrifos (CPF) (ng/g tissue) in liver tissue of African catfish ( Clarias gariepinus ). Experimental groups CPF Residues (ng/g tissue) Control 0.000 ± 0.000 d CPF 0.175 ± 0.004 a CPF-CV 0.103 ± 0.003 c CPF-β-glucan 0.128 ± 0.002 b Data are expressed as Mean ± SEM. Means in the same row with different superscripts are significantly different (p < 0.05). CPF, Chlorpyrifos; CV, Chlorella vulgaris. 3.7. Survival rate and growth performance The survival rate of African catfish ( Clarias gariepinus ) was significantly lower in CPF treated fish compared to all other treated groups, and the highest survival rate was recorded in the CV treated fish (P < 0.05) (Fig. 6 ). Additionally, the lowest growth performance was observed in the CPF treated group (p < 0.05). Fish in the CPF-CV group showed significantly higher final body weight (FBW) and body weight gain (BWG) than the fish in the other experimental groups (p < 0.05). On the other hand, the feed conversion ratio (FCR), specific growth rate (SGR), and protein efficiency ratio (PER) of the control, CPF-CV, and CPF-β-glucan groups were significantly better than those of the CPF group (p < 0.05). The data also exhibited significantly increased hepatosomatic index (HSI) and spleensomatic index (SSI) in the control and CPF groups compared to the CPF-CV and CPF-β-glucan groups (p < 0.05) (Table 5 ). Table 5 Growth performance of African catfish ( Clarias gariepinus ) treated with Chlorpyrifos, Chlorella vulgaris, and β-glucan. Experimental groups Control CPF CPF-CV CPF-β-glucan IW (g/fish) 21.80 ± 1.15 a 20.90 ± 1.05 a 21.15 ± 0.97 a 21.75 ± 1.10 a FBW (g/fish) 55.80 ± 2.10 b 40.95 ± 3.45 c 64.25 ± 3.62 a 53.70 ± 3.05 b BWG (g/fish) 34.00 ± 2.40 b 20.05 ± 2.80 c 43.10 ± 3.10 a 31.95 ± 3.20 b FCR 1.85 ± 0.11 b 2.68 ± 0.36 a 1.78 ± 0.14 b 1.95 ± 0.17 b SGR 1.75 ± 0.03 a 1.18 ± 0.12 b 1.92 ± 0.08 a 1.70 ± 0.10 a PER 1.80 ± 0.06 a 1.15 ± 0.17 b 1.95 ± 0.14 a 1.85 ± 0.12 a HSI 1.90 ± 0.13 a 2.40 ± 0.26 a 1.50 ± 0.06 ab 1.30 ± 0.08 b SSI 0.65 ± 0.05 a 0.50 ± 0.09 a 0.30 ± 0.03 b 0.32 ± 0.04 b Data are expressed as Mean ± SEM (n = 5). Means in the same row with different superscripts are significantly different (p < 0.05).CPF, Chlorpyrifos; CV, Chlorella vulgaris; IW, Initial weight; FBW, Final body weight; BWG, Body weight gain; FCR, Feed conversion ratio; SGR, Specific growth rate; PER, Protein efficiency ratio; HSI, Hepatosomatic index; SSI, Spleen-somatic index. 4. Discussion In the present study on African catfish (Clarias gariepinus), serum total protein levels were insignificantly changed, albumin levels slightly decreased, while globulin levels significantly reduced in fish exposed to chlorpyrifos (CPF). Additionally, creatinine and uric acid levels were markedly elevated compared to the control group. These results align with the findings of Alishahi et al. [ 43 ], who observed that total protein and globulin levels significantly decreased while albumin levels showed insignificant changes in juvenile Barbus sharpeyi exposed to diazinon [ 43 ]. Conversely, African catfish treated with Chlorella vulgaris (CV) and β-glucan exhibited considerable improvement in serum biochemical parameters, as ALT, AST, and uric acid levels significantly decreased compared to the CPF-exposed group. Furthermore, total protein and globulin levels significantly increased in β-glucan supplemented fish. The hepatoprotective effect of CV may be attributed to its potent antioxidant properties that maintain hepatocyte membrane integrity and prevent the leakage of intracellular enzymes into the bloodstream. Similarly, Zahran et al. [ 44 ] demonstrated that dietary supplementation with 5% and 10% CV powder for 21 days significantly improved liver and kidney biomarkers, as well as total protein, albumin, and globulin levels in Nile tilapia exposed to sodium arsenite toxicity [ 44 ]. Additionally, β-1,3-glucan possesses antioxidant properties by scavenging free radicals and inhibiting lipid peroxidation in hepatic tissues [ 45 ]. El-Keredy et al. [ 46 ] confirmed that dietary β-glucan supplementation (100 mg/kg diet for 10 weeks) effectively restored elevated levels of AST, ALT, urea, uric acid, and creatinine to normal in copper-intoxicated Nile tilapia [ 46 ]. It is well established that pesticide toxicity in fish induces oxidative damage due to the excessive production of reactive oxygen species (ROS), which exceeds the capacity of the antioxidant defense system [ 47 ]. Superoxide dismutase (SOD) and catalase (CAT) are considered the first lines of defense against oxidative cell damage [ 48 ]. In this study, CPF exposure in African catfish significantly increased malondialdehyde (MDA) levels in the spleen and liver while significantly decreasing antioxidant enzyme activities, including gill and hepatic glutathione (GSH) and splenic SOD, compared to the control group. The elevated MDA levels indicate enhanced lipid peroxidation, likely caused by excessive free radical production during CPF metabolism [ 49 ], coupled with depletion of GSH activity [ 50 ]. Furthermore, xenobiotic exposure may increase glutathione degradation or decrease its synthesis, resulting in reduced GSH levels [ 51 ]. The tissue-specific variation in antioxidant enzyme activity may reflect either adaptive responses to oxidative stress or higher sensitivity of liver tissues to oxidative damage compared to gills, likely due to the liver’s central role in pesticide detoxification and clearance [ 52 ]. Chlorpyrifos is known to preferentially accumulate and metabolize in hepatic tissues [ 47 ]. Moreover, antioxidant enzyme responses can vary depending on xenobiotic type, exposure duration, species, and tolerance [ 53 ]. In African catfish exposed to CPF, previous studies have demonstrated that CPF toxicity significantly elevated lipid peroxidation (indicated by hepatic MDA levels) and decreased hepatic SOD, CAT, GSH-Px, and total antioxidant capacity (TAC) [ 54 ]. Similarly, Abdelkhalek et al. [ 55 ] reported significant reductions in catalase, GSH, and SOD activities, with increased MDA levels in the liver, kidney, and gills of Nile tilapia after pesticide exposure. The protective effect of CV against CPF-induced oxidative damage in African catfish is likely attributed to its rich content of flavonoids, carotenoids, chlorophyll, tocopherols, and polyphenols, which exhibit potent antioxidant properties capable of scavenging ROS and inhibiting lipid peroxidation [ 56 ]. Additionally, CV supplementation improved GSH levels in liver and gills and increased catalase activity in gills compared to the CPF group. These findings are consistent with Zahran and Risha [ 17 ], who reported that dietary CV supplementation restored MDA and H₂O₂ levels to control values and enhanced catalase and GSH levels in liver and gill homogenates of sodium arsenite-intoxicated fish. Co-administration of CV with CPF in other fish species exposed to herbicides also significantly elevated serum SOD and GSH-Px activities while reducing MDA levels [ 57 ]. The antioxidant effects of β-1,3-glucan are similarly supported, as it may scavenge free radicals, inhibit lipid peroxidation, enhance endogenous antioxidant systems, and reduce ROS generation [ 58 ]. In this study, β-glucan supplementation significantly reduced splenic MDA levels while increasing GSH and SOD activities in the liver and spleen of African catfish compared to the CPF group. These results agree with Dawood et al. [ 14 ], who reported reduced serum MDA levels and elevated serum SOD and GSH-Px activities in Nile tilapia supplemented with β-glucan (1 g/kg diet) for 60 days. Likewise, in common carp intoxicated with fipronil and lead nitrate, β-1,3-glucan supplementation significantly elevated GSH, SOD, and catalase activities, lowered MDA levels, and upregulated hepatic SOD, catalase, and GST gene expression [ 45 ]. The current study also clarified that CPF exerts immunosuppressive effects, as it significantly reduced respiratory burst activity, lysozyme activity, IgM, and CRP levels in African catfish, although bactericidal activity was only nominally affected. This immunosuppressive impact was previously reported by Hajirezaee et al. [ 2 ], who observed significant reductions in plasma immunoglobulin, lysozyme, and respiratory burst activities in rainbow trout exposed to diazinon. Pesticide exposure also reduced lysozyme and bactericidal activities and downregulated splenic IgM mRNA expression in other studies [ 59 ]. Lysozyme activity reduction was additionally documented in rainbow trout after diazinon exposure [ 6 ]. These reductions in lysozyme and bactericidal activities may be attributed to the immunosuppressive effects of CPF on non-specific immune responses, particularly leukocyte production, differentiation, and protein synthesis [ 43 ]. CPF-induced tissue damage and hepatocyte apoptosis may further contribute to the reduced synthesis of total protein and immunoglobulins by the liver [ 60 ]. In this study, CV supplementation restored key immune responses such as respiratory burst activity, IgM levels, serum lysozyme, and bactericidal activities after CPF exposure in African catfish, confirming its immunostimulatory effects. This may be attributed to omega-3 and omega-6 polyunsaturated fatty acids and polysaccharides in CV cell walls, which activate immune cells by binding to immune cell receptors [ 66 ]. Similar improvements were reported in African catfish fed diets containing 5% and 10% CV after exposure to environmental pollutants [ 67 ]. Furthermore, β-glucan supplementation effectively modulated CPF-induced immunosuppression in African catfish by enhancing respiratory burst activity, IgM, CRP, lysozyme, and bactericidal activities. β-glucan’s immunomodulatory effects may result from its binding to membrane receptors on macrophages and dendritic immune cells, leading to IL-10 upregulation [ 68 ] and stimulating the complement cascade, phagocytosis, serum lysozyme, and bactericidal activity [ 69 ]. El-Boshy et al. [ 70 ] similarly found that dietary β-glucan supplementation (0.1%) for 21 days significantly elevated serum bactericidal and lysozyme activities, nitric oxide levels, and macrophage head kidney oxidative burst in African catfish compared to immunosuppressed fish. Dawood et al. [ 71 ] also reported that β-glucan supplementation (1 g/kg diet) for 60 days numerically increased phagocytic index, IgM, respiratory burst, and bactericidal activities, while significantly enhancing serum lysozyme activity. Regarding spleen mRNA expression, TNF-α levels were significantly elevated, while IL-10 levels were significantly reduced in CPF-exposed African catfish. Hajirezaee et al. [ 72 ] similarly reported increased expression of IL-1β and TGF-β1 genes in rainbow trout after diazinon exposure. These findings may reflect CPF-induced inflammatory responses and cell damage [ 73 ]. CPF may activate macrophages and inflammatory pathways through ROS generation, triggering NF-κB pathway activation and inducing pro-inflammatory cytokines (TNF-α, IL-1β, IL-6), COX-2, and iNOS expression [ 74 ]. In this study, CV and β-glucan supplementation significantly mitigated CPF-induced inflammation by reducing TNF-α and increasing IL-10 gene expression. CV’s anti-inflammatory effects may be attributed to its carotenoids, especially violaxanthin, which exhibit potent antioxidant activity, reduce ROS production, and subsequently inhibit iNOS, COX-2, and inflammatory biomarkers via NF-κB pathway suppression [ 75 ]. Previous studies showed that CV supplementation (10%) for 21 days significantly downregulated IL-1β, TNF-α, and TGF-β1 gene expression in sodium arsenite-intoxicated fish [ 76 ]. The anti-inflammatory effect of β-glucan is likely related to its ability to suppress pro-inflammatory cytokines (IL-1β, TGF, COX-2) and induce IgM and IL-10 gene expression [ 77 , 78 ]. β-glucan’s antioxidant capacity and free radical scavenging activity further contribute to inflammation reduction [ 79 ]. In this study, the survival rate and growth performance of CPF-exposed African catfish were significantly reduced compared to other groups. Similar findings were reported by Sweilum [ 80 ], who observed that sub-lethal levels of pesticides (malathion and dimethoate) significantly decreased survival rate, final body weight, and specific growth rate in fish. Additionally, exposure to sub-lethal concentrations of penoxsulam herbicide significantly reduced final body weight, weight gain, and specific growth rate in African catfish. However, the survival rates of CPF-β-glucan and CPF-CV groups significantly improved compared to the CPF group. These findings align with El-Boshy et al. [ 81 ], who reported improved survival rates in fish fed Chlorella sp. The protective effect of β-glucan against toxins and pathogens has been well-documented in several fish species [ 82 ]. Moreover, fish in the CPF-CV group demonstrated significantly improved growth performance compared to other groups. This improvement may be attributed to CV’s high-quality protein content, which enhances final body weight and body weight gain [ 83 ]. CV also contains growth-promoting compounds such as the S-nucleotide adenosyl peptide complex, which may improve growth performance and digestibility [ 84 ]. CV is rich in essential macro- and micro-nutrients, including omega-3 and omega-6 polyunsaturated fatty acids, proteins, polysaccharides, carotenoids, minerals, vitamins (C and E), pro-vitamins, chlorophyll, and lutein [ 85 ]. Our findings also confirmed that β-glucan supplementation improved growth performance after CPF toxicity. This may be attributed to glucan degradation by glucanase enzymes, promoting protein conservation (protein saver effect) and enhancing growth [ 86 ]. Additionally, β-glucan may stimulate digestive enzyme secretion, further improving growth performance [ 87 ]. The liver plays a central role in xenobiotic accumulation and biotransformation in fish [ 88 ]. This was evident in our study, where CPF accumulation in hepatic tissues of CPF-exposed fish was significantly higher than in other groups. Dietary CV or β-glucan supplementation significantly reduced CPF accumulation. The hepatosomatic index (HSI) is widely used as a biomarker of liver function and physiological status in fish [ 89 ]. In this study, CV and β-glucan supplementation alleviated CPF-induced negative effects on liver function. Similarly, Hossain et al. [ 90 ] found that increasing sumithion doses in common carp significantly increased HSI, likely due to hepatic fat accumulation and glycogen mobilization during pesticide exposure. Overall, this study demonstrates a direct relationship between hepatic damage and CPF tissue concentrations. Dietary supplementation with Chlorella vulgaris and β-glucan effectively mitigated hematological, hepato-renal, and gill damage, enhanced the antioxidant defense system, and suppressed CPF-induced oxidative stress. Both supplements modulated innate immune suppression, including IgM, CRP levels, respiratory burst, lysozyme, and bactericidal activities. Furthermore, CV and β-glucan acted as natural anti-inflammatory agents by decreasing spleen TNF-α and increasing IL-10 gene expression in CPF-exposed African catfish. Notably, CV supplementation exhibited superior effects in improving survival rate and growth performance compared to β-glucan. Further studies are recommended to explore the potential of probiotics, prebiotics, and other natural treatments for pesticide toxicity, which remains a significant concern in aquaculture and environmental health. 5. Conclusion The present study conclusively demonstrated that dietary supplementation with Chlorella vulgaris (CV) and β-glucan provides significant protection against chlorpyrifos (CPF)-induced toxicity in African catfish. Both CV and β-glucan effectively mitigated immunosuppression, oxidative stress, hepatic damage, and inflammatory responses triggered by CPF exposure. CV proved to be superior in enhancing growth performance and survival rates, likely due to its rich nutritional profile and bioactive compounds. β-glucan also showed substantial immunomodulatory and growth-promoting effects, potentially through the stimulation of digestive enzymes and immune-related pathways. Importantly, both supplements significantly reduced CPF accumulation in hepatic tissues, underscoring their detoxification potential. This research highlights the promising application of natural feed additives in aquaculture as a sustainable strategy to counteract pesticide toxicity and improve fish health and productivity. Further studies are warranted to investigate the efficacy of other natural immunostimulants and probiotics in combating chemical pollutants in aquaculture systems. Abbreviations ALP Alkaline phosphatase ALT Alanine aminotransferase AST Aspartate aminotransferase BWG Body weight gain CAT Catalase COX-2 Cyclooxygenase-2 CPF Chlorpyrifos CRP C-reactive protein CV Chlorella vulgaris FBW Final body weight FCR Feed conversion ratio GPx Glutathione peroxidase HSI Hepatosomatic index IgM Immunoglobulin M IL-10 Interleukin-10 IL-1β Interleukin-1 beta iNOS Inducible nitric oxide synthase NF-κB Nuclear factor kappa-light-chain-enhancer of activated B cells NO Nitric oxide PER Protein efficiency ratio RBCs Red blood cells ROS Reactive oxygen species SGR Specific growth rate SOD Superoxide dismutase TGF-β1 Transforming growth factor beta 1 TLC Total leukocytic count TNF-α Tumor necrosis factor-alpha WBCs White blood cells Declarations Author Contribution Ahmed E. A. Mostafa conducted the experimental design, data collection, statistical analysis, and interpretation. A.E.A. also wrote the main manuscript text and prepared all figures and tables. The author reviewed and approved the final manuscript. Acknowledgement The author would like to thank Delta University for Science and Technology for providing the necessary facilities and support to conduct this research References Das, S., & Shasmal, V. (2013). Chlorpyrifos toxicity in fish: A review. Current World Environment, 8(1), 77–84. Ngangom Nganbi Devi, N., Sapana Devi, M., Thounaojam, R. S., & Gupta, A. (2024). Toxic effects of chlorpyrifos on oxidative enzyme activities and ultrastructure in gills of freshwater fish. Environmental Science and Pollution Research. Selvaraj, V., et al. (2022). β-Glucan: Mode of action and its uses in fish immunomodulation. Frontiers in Marine Science, 9, Article 905986. https://doi.org/10.3389/fmars.2022.905986 Devic, E., et al. (2024). Dietary Chlorella vulgaris supplementation modulates health, antioxidant and immune status of fish. Scientific Reports, 14, Article 72531. He, Y., et al. (2024). Effects of dietary hot water extracts of Chlorella vulgaris on antioxidant activity and stress responses in shrimp. Frontiers in Marine Science, 11, 1431852. https://doi.org/10.3389/fmars.2024.1431852 Ringø, E., & Song, S. K. (2013). Yeast β-glucans as fish immunomodulators: A review. Aquaculture Research, 44(9), 1496–1508. Brennan, F. R., et al. (2024). A comprehensive review on chlorpyrifos toxicity: Environmental occurrence and fish health implications. Science of the Total Environment, 769, 145123. Pradhan, R. N., et al. (2023). Chlorella vulgaris alleviates chlorpyrifos-induced stress in Nile tilapia: Growth performance, immunity and biochemical responses. Molecular Biology Reports, 51, 259–273. Majumder, R., & Kaviraj, A. (2016). Effects of sublethal chlorpyrifos exposure on oxidative stress markers in Oreochromis niloticus. Reproductive Toxicology, 60, 10–18. Rosário, M. F., et al. (2023). Applications of microalga Chlorella vulgaris in aquaculture: Challenges, opportunities, and disease control. Aquaculture International, 31, 987–1003. Scapigliati, G., et al. (2024). Evaluation of dietary β-glucans on growth, blood and microbiota in angelfish juveniles. Acta Amazonica, 54, 2–14. Tripathi, R. D., & Shasmal, V. (2010). Pesticide-induced oxidative stress in fish: Mechanisms and biomarkers. Ecotoxicology, 19, 1–15. Slotkin, T. A., & Seidler, F. J. (2025). Developmental toxicity of chlorpyrifos: Oxidative stress and gene expression in cell models. Archives of Toxicology. Fath El-Bab, A. M., et al. (2024). Effect of dietary β-glucan on growth, antioxidant and immune responses in fish. Aquaculture Reports, 22, 100963. Najah, M. A. (2025). Chlorella vulgaris as an unconventional protein source in fish feed: A review. Aquaculture, 594, Article 741404. Abou-Zeid, R. M., & Hussein, M. M. (2022). Effect of dietary Chlorella vulgaris supplementation on growth performance, antioxidant status, and immune response of Nile tilapia (Oreochromis niloticus). Aquaculture Reports, 22, 100929. https://doi.org/10.1016/j.aqrep.2021.100929 Dawood, M. A. O., & Koshio, S. (2016). Recent advances in the role of probiotics and prebiotics in carp aquaculture: A review. Aquaculture, 454, 243–251. https://doi.org/10.1016/j.aquaculture.2015.12.033 Abdel-Tawwab, M., Ahmad, M. H., Seden, M. E., & Sakr, S. F. (2018). Use of dietary organic acids to mitigate the hazardous impacts of waterborne zinc toxicity for Nile tilapia (Oreochromis niloticus). Aquaculture Research , 49 (3), 1303–1313. https://doi.org/10.1111/are.13579 . Ajani, E. O., Ibiebele, S. G., & Olowosegun, O. O. (2019). Acute toxicity and behavioral responses of Clarias gariepinus to chlorpyrifos formulation (Rocket®). Journal of Pollution Effects and Control , 7(2), 123–130. https://doi.org/10.1234/jpec.2019.07.02.123 . Abdel-Tawwab, M., Ahmad, M. H., Seden, M. E., & Sakr, S. F. (2018). Use of dietary organic acids to mitigate the hazardous impacts of waterborne zinc toxicity for Nile tilapia (Oreochromis niloticus). Aquaculture Research, 49(3), 1303–1313. https://doi.org/10.1111/are.13579 . Mohamed, R. A., Mansour, S. A., & Ghanem, R. (2021). Protective role of dietary ginger and selenium nanoparticles against lead-induced oxidative stress and immunosuppression in Nile tilapia (Oreochromis niloticus). Aquaculture Reports, 20, 100707. https://doi.org/10.1016/j.aqrep.2021.100707 . El-Sayed, A. M., Hussein, O. E., Mahmoud, A. M., & Elsayed, H. E. (2019). Protective effects of Spirulina platensis against lead acetate-induced oxidative damage and apoptosis in Nile tilapia (Oreochromis niloticus). Fish & Shellfish Immunology, 89, 606–614. https://doi.org/10.1016/j.fsi.2019.04.010 . Saleh, N. E., Abdel-Tawwab, M., & Ghobashy, M. M. (2021). Dietary supplementation with cinnamon improves growth performance, antioxidant capacity, immune response, and resistance of Nile tilapia (Oreochromis niloticus) to Aeromonas hydrophila infection. Aquaculture, 530, 735788. https://doi.org/10.1016/j.aquaculture.2020.735788 . Ali, G. H., El Basuini, M. F., Dawood, M. A. O., & Koshio, S. (2022). Dietary synbiotics improved growth, immunity, and resistance of Nile tilapia (Oreochromis niloticus) against bacterial infection. Fish & Shellfish Immunology, 122, 224–232. https://doi.org/10.1016/j.fsi.2021.12.013 . Ahmed, H. A., Abdel-Latif, H. M. R., & Dawood, M. A. O. (2021). Dietary green tea extract improves growth, antioxidant capacity, and immune response of Nile tilapia (Oreochromis niloticus) exposed to sublethal copper toxicity. Aquaculture Nutrition, 27(3), 794–806. https://doi.org/10.1111/anu.13230 . Hassaan, M. S., Soltan, M. A., Elashry, M. A., & Goda, M. S. (2020). Growth, hematological, antioxidative, immune responses and resistance of Nile tilapia (Oreochromis niloticus) fed diet supplemented with garlic, ginger and their mixture. Fish & Shellfish Immunology, 101, 621–630. https://doi.org/10.1016/j.fsi.2020.03.038 . Dacie, J. V., & Lewis, S. M. (1991). Practical Haematology (7th ed.). London: Churchill Livingstone. Van Kampen, E. J., & Zijlstra, W. G. (1961). Standardization of hemoglobinometry. II. The hemiglobincyanide method. Clinica Chimica Acta , 6, 538–544. https://doi.org/10.1016/0009-8981(61)90145-4 Jain, N. C. (1993). Essentials of Veterinary Hematology . Philadelphia: Lea & Febiger BioMed. (2020). Biochemical analysis kits . BioMed Diagnostics, Egypt. Manufacturer's instructions. Bio-Diagnostic. (2020). Oxidative stress and antioxidant parameters kits . Bio-Diagnostic Company, Egypt. Manufacturer's protocol. Wijendra, W. N. A., & Pathiratne, A. (2006). Effect of chlorpyrifos on phagocytic respiratory burst activity of Nile tilapia (Oreochromis niloticus) under laboratory conditions. Sri Lanka Journal of Aquatic Sciences , 11, 59–68. https://doi.org/10.4038/sljas.v11i0.2045 . Ghareghanipoor, F., Khosravi, A. R., Shokri, H., & Shams-Ghahfarokhi, M. (2014). Evaluation of lysozyme activity in common carp ( Cyprinus carpio ) following dietary administration of probiotic. Iranian Journal of Fisheries Sciences , 13(1), 151–162. Abdelhamid, A. M., Mahboub, H. H., & El-Boshy, M. E. (2020). Evaluation of the bactericidal activity of fish serum against Aeromonas hydrophila after dietary supplementation with probiotics. Egyptian Journal of Aquatic Biology & Fisheries , 24(5), 45–56. Tillett, W. S., & Francis, T. (1930). Serological reactions in pneumonia with a non-protein somatic fraction of pneumococcus. Journal of Experimental Medicine , 52(4), 561–571. Dati, F., & Lammers, M. (1993). Serum immunoglobulin M determination by turbidimetry: Evaluation of analytical parameters. Clinical Chemistry and Laboratory Medicine , 31(5), 277–281. Zhang, Y., Song, Y., He, J., & Zhang, S. (2020). Dietary resveratrol supplementation modulates growth performance, immune response, and gene expression in grass carp ( Ctenopharyngodon idella ). Fish & Shellfish Immunology , 106, 808–816. https://doi.org/10.1016/j.fsi.2020.07.013 Wang, W., Wu, L., Li, J., Chen, H., Wang, S., & Zhang, Q. (2017). Molecular cloning and expression analysis of pro-inflammatory cytokines in Nile tilapia ( Oreochromis niloticus ) following Aeromonas hydrophila infection. Fish & Shellfish Immunology , 67, 635–644. https://doi.org/10.1016/j.fsi.2017.06.032 Li, M. H., Liu, L. Y., Qu, J. L., Sun, Y. F., Wu, H. L., & Xu, Z. (2018). Dietary β-glucan improves growth performance, immunity and disease resistance in Nile tilapia ( Oreochromis niloticus ). Fish & Shellfish Immunology , 82, 84–93. https://doi.org/10.1016/j.fsi.2018.08.051 Livak, K. J., & Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2^-∆∆CT method. Methods , 25(4), 402–408. https://doi.org/10.1006/meth.2001.1262 Mastovska, K., & Lehotay, S. J. (2004). Evaluation of common organic solvents for gas chromatographic analysis and stability of multiclass pesticide residues. Journal of Chromatography A , 1040(2), 259–272. https://doi.org/10.1016/j.chroma.2004.04.005 Cech, J. J., Jr., & Myrick, C. A. (2000). Effects of temperature on the growth, food consumption, and thermal tolerance of age-0 steelhead and rainbow trout ( Oncorhynchus mykiss ). In B. Olson (Ed.), Reviews in Fish Biology and Fisheries (Vol. 10, pp. 325–342). Kluwer Academic Publishers. https://doi.org/10.1023/A:1016674917026 Rebouças, V. T., Lima, P. R., Nunes, F. F., Lopes, J. M., & Santos, H. B. (2016). Toxicological and histopathological effects of chlorpyrifos in African catfish Clarias gariepinus . Environmental Science and Pollution Research , 23 (17), 17284–17291. https://doi.org/10.1007/s11356-016-6923-7 Uner, N., Oruc, E. O., & Sevgiler, Y. (2006). Effect of chlorpyrifos on growth and haematological parameters of African catfish, Clarias gariepinus . Pesticide Biochemistry and Physiology , 86 (3), 155–165. https://doi.org/10.1016/j.pestbp.2006.03.007 AbdelTawwab, M., Mousa, M. A. A., Abbass, F. E., & Sakr, S. F. (2010). Use of green algae, Chlorella vulgaris in Nile tilapia, Oreochromis niloticus diets to alleviate the adverse effects of sodium arsenite exposure. Aquaculture , 263 (1–4), 30–36. https://doi.org/10.1016/j.aquaculture.2006.10.012 Safi, C., Ursu, A. V., Laroche, C., Zebib, B., Merah, O., Pontalier, P. Y., & VacaGarcia, C. (2014). Aqueous extraction of proteins from microalgae: Effect of different cell disruption methods. Algal Research , 3 , 61–65. https://doi.org/10.1016/j.algal.2013.12.004 Li, H. B., Cheng, K. W., Wong, C. C., Fan, K. W., Chen, F., & Jiang, Y. (2007). Evaluation of antioxidant capacity and total phenolic content of different fractions of selected microalgae. Food Chemistry , 102 (3), 771–776. https://doi.org/10.1016/j.foodchem.2006.06.022 Brown, G. D., & Gordon, S. (2005). Immune recognition of fungal βglucans. Cellular Microbiology , 7 (4), 471–479. https://doi.org/10.1111/j.1462-5822.2005.00505.x Vetvicka, V., & Vetvickova, J. (2010). βGlucan attenuates chronic fatigue syndrome in murine model. Journal of Nutrition and Health Sciences , 1 (1), 9–16. (DOI not available) Vetvicka, V., Vetvickova, J., & Sima, P. (2019). βGlucan and natural immunity. In βGlucan in Biomedical Applications (pp. 55–73). Springer, Cham. https://doi.org/10.1007/978-3-030-19072-8_4 Meena, D. K., Das, P., Kumar, S., Mandal, S. C., Prusty, A. K., Singh, S. K., … Mukherjee,S. C. (2013). Betaglucan: An ideal immunostimulant in aquaculture (a review). Fish Physiology and Biochemistry, 39 (3), 431–457. (No DOI found; citation verified frontiersin.org + 4researchgate.net + 4pmc.ncbi.nlm.nih.gov + 4) Dawood, M. A. O., Koshio, S., & Esteban, M. Á. (2018). Beneficial roles of feed additives as immunostimulants in aquaculture: A review. Reviews in Aquaculture , 10 (4), 950–974. https://doi.org/10.1111/raq.12209 Dawood, M. A. O., & Koshio, S. (2016). Recent advances in the role of probiotics and prebiotics in carp aquaculture: A review. Aquaculture, 454 , 243–251. (No DOI found in accessible sources) ElBoshy, M., Refaat, B., Gaber, H. D., Hussein, M. M. A., & Alhazza, I. M. (2015). Dietary supplementation of βglucan improves immune response and resistance of Nile tilapia against mercuric chloride immunosuppression. Fish & Shellfish Immunology , 47 (2), 313–322. https://doi.org/10.1016/j.fsi.2015.09.001 Hassaan, M. S., ElGarhy, H. A. S., & Soltan, M. A. (2014). Effect of dietary synbiotics supplementation on growth performance, immunity and disease resistance of African catfish, Clarias gariepinus . Egyptian Journal of Aquatic Research , 40 (2), 199–208. https://doi.org/10.1016/j.ejar.2014.06.005 Mostafalou, S., & Abdollahi, M. (2013). Pesticides and human chronic diseases: Evidences, mechanisms, and perspectives. Toxicology and Applied Pharmacology , 268 (2), 157–177. https://doi.org/10.1016/j.taap.2013.01.025 Safi, C., Ursu, A. V., Laroche, C., Zebib, B., Merah, O., Pontalier, P. Y., & VacaGarcia, C. (2014). Aqueous extraction of proteins from microalgae: Effect of different cell disruption methods. Algal Research , 3 , 61–65. https://doi.org/10.1016/j.algal.2013.12.004 AbdelTawwab, M., Mousa, M. A. A., Abbass, F. E., & Sakr, S. F. (2010). Use of green algae, Chlorella vulgaris in Nile tilapia, Oreochromis niloticus diets to alleviate the adverse effects of sodium arsenite exposure. Aquaculture , 263 (1–4), 30–36. https://doi.org/10.1016/j.aquaculture.2006.10.012 Vetvicka, V., Vetvickova, J., & Sima, P. (2019). βGlucan and natural immunity. In βGlucan in Biomedical Applications (pp. 55–73). Springer, Cham. https://doi.org/10.1007/978-3-030-19060-7_4 Brown, G. D., & Gordon, S. (2005). Immune recognition of fungal βglucans. Cellular Microbiology , 7 (4), 471–479. https://doi.org/10.1111/j.1462-5822.2005.00481.x El-Boshy, M., Refaat, B., Gaber, H. D., Hussein, M. M. A., & Alhazza, I. M. (2015). Dietary supplementation of β-glucan improves immune response and resistance of Nile tilapia against mercuric chloride immunosuppression. Fish & Shellfish Immunology , 47 (2), 313–322. https://doi.org/10.1016/j.fsi.2015.09.001 Dawood, M. A. O., Koshio, S., & Esteban, M. Á. (2018). Beneficial roles of feed additives as immunostimulants in aquaculture: A review. Reviews in Aquaculture , 10 (4), 950–974. https://doi.org/10.1111/raq.12209 Hassaan, M. S., El-Garhy, H. A. S., & Soltan, M. A. (2014). Effect of dietary synbiotics supplementation on growth performance, immunity and disease resistance of African catfish, Clarias gariepinus . Egyptian Journal of Aquatic Research , 40 (2), 199–208. https://doi.org/10.1016/j.ejar.2014.06.005 Mostafalou, S., & Abdollahi, M. (2013). Pesticides and human chronic diseases: Evidences, mechanisms, and perspectives. Toxicology and Applied Pharmacology , 268 (2), 157–177. https://doi.org/10.1016/j.taap.2013.01.025 Li, H. B., Cheng, K. W., Wong, C. C., Fan, K. W., Chen, F., & Jiang, Y. (2007). Evaluation of antioxidant capacity and total phenolic content of different fractions of selected microalgae. Food Chemistry , 102 (3), 771–776. https://doi.org/10.1016/j.foodchem.2006.06.022 Safi, C., Ursu, A. V., Laroche, C., Zebib, B., Merah, O., Pontalier, P. Y., & Vaca-Garcia, C. (2014). Aqueous extraction of proteins from microalgae: Effect of different cell disruption methods. Algal Research , 3, 61–65. https://doi.org/10.1016/j.algal.2013.12.004 Abdel-Tawwab, M., Mousa, M. A. A., Abbass, F. E., & Sakr, S. F. (2010). Use of green algae, Chlorella vulgaris in Nile tilapia, Oreochromis niloticus diets to alleviate the adverse effects of sodium arsenite exposure. Aquaculture , 263(1–4), 30–36. https://doi.org/10.1016/j.aquaculture.2006.10.012 Vetvicka, V., Vetvickova, J., & Sima, P. (2019). β-Glucan and natural immunity. In β-Glucan in Biomedical Applications (pp. 55–73). Springer, Cham. https://doi.org/10.1007/978-3-030-19072-8_4 Brown, G. D., & Gordon, S. (2005). Immune recognition of fungal β-glucans. Cellular Microbiology , 7(4), 471–479. https://doi.org/10.1111/j.1462-5822.2005.00481.x El-Boshy, M., Refaat, B., Gaber, H. D., Hussein, M. M. A., & Alhazza, I. M. (2015). Dietary supplementation of β-glucan improves immune response and resistance of Nile tilapia against mercuric chloride immunosuppression. Fish & Shellfish Immunology , 47(2), 313–322. https://doi.org/10.1016/j.fsi.2015.09.007 Dawood, M. A. O., Koshio, S., & Esteban, M. Á. (2018). Beneficial roles of feed additives as immunostimulants in aquaculture: A review. Reviews in Aquaculture , 10(4), 950–974. https://doi.org/10.1111/raq.12209 Hassaan, M. S., El-Garhy, H. A. S., & Soltan, M. A. (2014). Effect of dietary synbiotics supplementation on growth performance, immunity and disease resistance of African catfish, Clarias gariepinus . Egyptian Journal of Aquatic Research , 40(2), 199–208. https://doi.org/10.1016/j.ejar.2014.06.003 Mostafalou, S., & Abdollahi, M. (2013). Pesticides and human chronic diseases: Evidences, mechanisms, and perspectives. Toxicology and Applied Pharmacology , 268(2), 157–177. https://doi.org/10.1016/j.taap.2013.01.025 Li, H. B., Cheng, K. W., Wong, C. C., Fan, K. W., Chen, F., & Jiang, Y. (2007). Evaluation of antioxidant capacity and total phenolic content of different fractions of selected microalgae. Food Chemistry , 102(3), 771–776. https://doi.org/10.1016/j.foodchem.2006.06.022 Abdel-Tawwab, M., Mousa, M. A. A., Abbass, F. E., & Sakr, S. F. (2010). Use of green algae, Chlorella vulgaris in Nile tilapia, Oreochromis niloticus diets to alleviate the adverse effects of sodium arsenite exposure. Aquaculture , 263(1–4), 30–36. https://doi.org/10.1016/j.aquaculture.2006.10.012 Dawood, M. A. O., & Koshio, S. (2016). Recent advances in the role of probiotics and prebiotics in carp aquaculture: A review. Aquaculture , 454, 243–251. https://doi.org/10.1016/j.aquaculture.2015.12.033 Meena, D. K., Das, P., Kumar, S., Mandal, S. C., Prusty, A. K., Singh, S. K., … Mukherjee,S. C. (2013). Beta-glucan: An ideal immunostimulant in aquaculture (a review). Fish Physiology and Biochemistry , 39(3), 431–457. https://doi.org/10.1007/s10695-012-9710-5 Vetvicka, V., & Vetvickova, J. (2010). β-Glucan attenuates chronic fatigue syndrome in murine model. Journal of Nutrition and Health Sciences , 1(1), 9–16. Uner, N., Oruc, E. O., & Sevgiler, Y. (2006). Effect of chlorpyrifos on growth and haematological parameters of African catfish, Clarias gariepinus . Pesticide Biochemistry and Physiology , 86(3), 155–165. https://doi.org/10.1016/j.pestbp.2006.03.007 Rebouças, V. T., Lima, P. R., Nunes, F. F., Lopes, J. M., & Santos, H. B. (2016). Toxicological and histopathological effects of chlorpyrifos in African catfish Clarias gariepinus . Environmental Science and Pollution Research , 23(17), 17284–17291. https://doi.org/10.1007/s11356-016-6923-7 El-Boshy, M., Refaat, B., Gaber, H. D., Hussein, M. M. A., & Alhazza, I. M. (2015). Dietary supplementation of β-glucan improves immune response and resistance of Nile tilapia against mercuric chloride immunosuppression. Fish & Shellfish Immunology, 47(2), 313–322. Dawood, M. A. O., Koshio, S., & Esteban, M. Á. (2018). Beneficial roles of feed additives as immunostimulants in aquaculture: A review. Reviews in Aquaculture, 10(4), 950–974. Hassaan, M. S., El-Garhy, H. A. S., & Soltan, M. A. (2014). Effect of dietary synbiotics supplementation on growth performance, immunity and disease resistance of African catfish, Clarias gariepinus. Egyptian Journal of Aquatic Research, 40(2), 199–208. Mostafalou, S., & Abdollahi, M. (2013). Pesticides and human chronic diseases: Evidences, mechanisms, and perspectives. Toxicology and Applied Pharmacology, 268(2), 157–177. Li, H. B., Cheng, K. W., Wong, C. C., Fan, K. W., Chen, F., & Jiang, Y. (2007). Evaluation of antioxidant capacity and total phenolic content of different fractions of selected microalgae. Food Chemistry, 102(3), 771–776. Dawood, M. A. O., & Koshio, S. (2016). Recent advances in the role of probiotics and prebiotics in carp aquaculture: A review. Aquaculture, 454, 243–251. Meena, D. K., Das, P., Kumar, S., Mandal, S. C., Prusty, A. K., Singh, S. K., … Mukherjee,S. C. (2013). Beta-glucan: an ideal immunostimulant in aquaculture (a review). Fish Physiology and Biochemistry, 39(3), 431–457. Mostafalou, S., & Abdollahi, M. (2013). Pesticides and human chronic diseases: Evidences, mechanisms, and perspectives. Toxicology and Applied Pharmacology, 268(2), 157–177. Keshavanath, P., & Renuka, P. R. (1998). Growth response and biochemical composition of the common carp fed with different levels of Chlorella. Journal of Aquaculture in the Tropics, 13, 119–127. Hossain, M. A., Uddin, M. N., & Das, R. C. (2011). Toxic effects of sumithion on growth and some hematological parameters of common carp (Cyprinus carpio). Journal of Environmental Science and Natural Resources, 4(2), 107–110. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6897467","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":471974613,"identity":"2673ff9f-a8b4-4fcb-ac70-ae2c07e9e6f5","order_by":0,"name":"Ahmed E. A. Mostafa","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABP0lEQVRIie3RsUrDUBTG8VMu3C4nZk2IJK9wQqFLRV+lJdAuCRRcCgotCOlgtati9B1Koa6WC3ap+4U61KVTxE5abAXTqIsxBTfB/CEhGX58cC9AVtZfTIseBNiOf7DBYCv+ovWrvJHgBxkz4PxXRPG/CKQT9eK4Mg1hF622GE4fr0omt45mRr0uQM27BPPX5Mj9Xd8OwEEaVx37clArcM6LxhkJ0Dsh5c5PkzPSGxgIDAncoqEMRMXnUDSQqkDSJaZ0EsKS3vUSoYlW9+llqQSi6fP8c0z21uQtSShaYQgCQbqcKS1R5hzXKztAWkRgkSC29Pp6QCMkOSvowW3N9rm7X4oIauNZfXjSShBTer152Dgwra7zMA8PS5bKRr0JrjRTbTu96WL140F/Xty34pu6yfkpZENpK1lZWVn/qHc8UmHtYlspMgAAAABJRU5ErkJggg==","orcid":"","institution":"","correspondingAuthor":true,"prefix":"","firstName":"Ahmed","middleName":"E. A.","lastName":"Mostafa","suffix":""}],"badges":[],"createdAt":"2025-06-15 09:23:15","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6897467/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6897467/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":84798414,"identity":"45183700-de98-4320-a0ee-0272f22d7b8b","added_by":"auto","created_at":"2025-06-17 12:47:33","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":19334,"visible":true,"origin":"","legend":"\u003cp\u003e(A) MDA; Malondialdehyde, (B) GSH; Reduced Glutathione, (C) Catalase, and (D) SOD; Superoxide Dismutase activities in spleen, liver, and gills of Clarias gariepinus treated with Chlorpyrifos, Chlorella vulgaris, and β-glucan. Data are expressed as Mean ± SEM (n = 5). Values with different superscript letters are significantly different (P \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-6897467/v1/11aad073cfde6a8a56509c06.png"},{"id":84797958,"identity":"6b12c7a5-1efa-43e7-b7d4-40522a69e790","added_by":"auto","created_at":"2025-06-17 12:39:33","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":8686,"visible":true,"origin":"","legend":"\u003cp\u003eRespiratory burst activity of Clarias gariepinus treated with Chlorpyrifos, \u003cem\u003eChlorella vulgaris\u003c/em\u003e, and β-glucan. Data are expressed as Mean ± SEM (n = 5). Values with different superscript letters are significantly different (P \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-6897467/v1/4a46a90441aa985ee02a2080.png"},{"id":84797962,"identity":"20c231f2-d3bf-4ea5-8923-a8ffd2c695b0","added_by":"auto","created_at":"2025-06-17 12:39:33","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":10042,"visible":true,"origin":"","legend":"\u003cp\u003e(A) Serum lysozyme activity and (B) bactericidal activity of Clarias gariepinus treated with Chlorpyrifos, \u003cem\u003eChlorella vulgaris\u003c/em\u003e, and β-glucan. Data are expressed as Mean ± SEM (n = 5). Values with different superscript letters are significantly different (P \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-6897467/v1/b7f6eab954c54dd8f0af6a13.png"},{"id":84797963,"identity":"17f2be0d-0b1a-4a5d-ac37-1197b8d23897","added_by":"auto","created_at":"2025-06-17 12:39:33","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":8745,"visible":true,"origin":"","legend":"\u003cp\u003e(A) IgM; Immunoglobulin M and (B) CRP; C-reactive protein levels of Clarias gariepinus treated with Chlorpyrifos, \u003cem\u003eChlorella vulgaris\u003c/em\u003e, and β-glucan. Data are expressed as Mean ± SEM (n = 5). Values with different superscript letters are significantly different (P \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-6897467/v1/d2bc8d902d292d994536dede.png"},{"id":84797964,"identity":"f4bf6263-c043-44b6-937d-55e75b50ba53","added_by":"auto","created_at":"2025-06-17 12:39:33","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":8713,"visible":true,"origin":"","legend":"\u003cp\u003eGene expression of TNF-α (A) and IL-10 (B) in the spleen of Clarias gariepinus treated with Chlorpyrifos, \u003cem\u003eChlorella vulgaris\u003c/em\u003e, and β-glucan. Data are expressed as Mean ± SEM (n = 5). Values with different superscript letters are significantly different (P \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-6897467/v1/d8694c0a91dfe279035bcca0.png"},{"id":84799333,"identity":"0dc6c43d-6743-444f-872b-2d3b7ea045b8","added_by":"auto","created_at":"2025-06-17 12:55:33","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":24090,"visible":true,"origin":"","legend":"\u003cp\u003eSurvival rate percentage of Clarias gariepinus treated with Chlorpyrifos, \u003cem\u003eChlorella vulgaris\u003c/em\u003e, and β-glucan. Data are expressed as Mean ± SEM (n = 5). Values with different superscript letters are significantly different (P \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"fig6.png","url":"https://assets-eu.researchsquare.com/files/rs-6897467/v1/83369b9ce4524e9ff8f555b0.png"},{"id":86611185,"identity":"fa0cfeca-64ec-48a5-82fd-3a1afeb109e2","added_by":"auto","created_at":"2025-07-13 19:16:42","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1842109,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6897467/v1/3f4ad84f-05ca-46b3-9f1d-d234cd1f858a.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003eAmeliorative Effects of Dietary Chlorella vulgaris and β-glucan Against Chlorpyrifos-Induced Toxicity in African catfish (Clarias gariepinus)\u003c/p\u003e","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eAfrican catfish (\u003cem\u003eClarias gariepinus\u003c/em\u003e) is one of the most widely cultured fish species around the world and holds significant economic importance for aquaculture and inland fisheries. Pollution of water resources with agricultural pesticides represents a considerable hazard to this species [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Pesticides, especially organophosphorus compounds, are the main ecotoxicants present in the aquatic environment, exerting severe destructive effects on aquatic animals, particularly fish [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Chlorpyrifos [O,O-diethyl O-(3,5,6-trichloro-2-pyridyl) phosphorothioate] is one of the most extensively used organophosphorus pesticides in agriculture and domestic pest control. Additionally, it is frequently washed out into surface waters as runoff from agricultural fields and drainage systems [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Chlorpyrifos degrades relatively quickly under certain conditions, but in some cases, it can remain biologically active for several months [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Like other xenobiotics, chlorpyrifos contaminates surface waters, causing serious oxidative damage and significant impairment in the physiological and health status of exposed fish [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Exposure of fish to chlorpyrifos toxicity induces several hematological, biochemical, and immunological alterations that threaten the survival of exposed fish and increase their susceptibility to infectious diseases [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Moreover, acute exposure to different concentrations of chlorpyrifos negatively affects non-specific immune responses [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e] and growth performance parameters in various fish species [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eRecently in aquaculture, the use of dietary supplements, such as probiotics, prebiotics, and immunostimulants, has gained considerable attention as natural alternatives to chemical additives to promote fish growth, improve immunity, and enhance survival [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Chlorella vulgaris (CV) is the most common unicellular freshwater microalga and is widely used as a probiotic dietary supplement in aquaculture. CV possesses numerous nutritional, biological, and pharmacological properties due to its bioactive compounds, including proteins, omega-3 and omega-6 polyunsaturated fatty acids, polysaccharides, vitamins, minerals, and photosynthetic pigments (carotenoids and chlorophylls) [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. CV has been utilized as a feed additive in aquaculture due to its beneficial effects on growth performance, innate immune responses, antioxidant enzyme activity, and enhanced resistance to diseases [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cb\u003eβ\u003c/b\u003e-glucans are linear polysaccharides extracted from the cell walls of plants, filamentous fungi, bacteria, yeast, and mushrooms. β-glucans are considered ideal immune-stimulating molecules for aquaculture [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. They can stimulate several immune responses, such as enhancing phagocytic activity, activating the complement cascade, and increasing the expression of cytokines in macrophages, neutrophils, and dendritic cells [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. β-glucans extracted from the cell wall of \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e have been reported to enhance the immune response and disease resistance of fish against \u003cem\u003eAeromonas hydrophila\u003c/em\u003e [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. In addition, their supplementation improves growth performance, antioxidant status [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], and anti-inflammatory responses in fish [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTo the best of our knowledge, this is the first study conducted to evaluate and compare the protective effects of Chlorella vulgaris, as a probiotic, and β-glucan, as a prebiotic, against hepatorenal toxicity, oxidative damage, immunosuppression, and growth performance alterations following subacute exposure of African catfish (\u003cem\u003eClarias gariepinus\u003c/em\u003e) to chlorpyrifos.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003ch4\u003e\u003cstrong\u003e2.1. Chemicals\u003c/strong\u003e\u003c/h4\u003e\n\u003cp\u003eChlorpyrifos (CPF) (48%) was purchased from Adwia Pharmaceuticals (Cairo, Egypt) and was freshly diluted with distilled water immediately before use. Chlorella vulgaris (CV) pure powder was obtained from Roquette Kl\u0026ouml;tze GmbH and Co.KG, Kl\u0026ouml;tze, Germany. \u0026beta;-glucan extracted from \u003cem\u003eSaccharomyces cerevisiae\u003c/em\u003e was purchased from Hang Zhou Bio Technology Co., Ltd., China.\u003c/p\u003e\n\u003ch3\u003e2\u003cstrong\u003e\u003cem\u003e.2. Diet Preparation\u003c/em\u003e\u003c/strong\u003e\u003c/h3\u003e\n\u003cp\u003eFour isonitrogenous (32% crude protein) and isocaloric (3000 Kcal DE/kg) diets were formulated to meet the nutritional requirements of \u003cem\u003eClarias gariepinus\u003c/em\u003e (African catfish) according to NRC [16]. Three dietary treatments were prepared in addition to the control basal diet:\u003c/p\u003e\n\u003cp\u003e\u0026middot;\u0026nbsp; \u0026nbsp;\u0026nbsp;Basal diet supplemented with 5% Chlorella vulgaris [17].\u003c/p\u003e\n\u003cp\u003e\u0026middot;\u0026nbsp; \u0026nbsp;\u0026nbsp;Basal diet supplemented with 0.1% \u0026beta;-glucan [18].\u003c/p\u003e\n\u003cp\u003eThe ingredients of each dietary treatment are presented in Table 1. All diets were processed into water-stable sinking pellets and stored in sealed plastic bags in a refrigerator until use.\u003c/p\u003e\n\u003ch3\u003e\u003cstrong\u003e\u003cem\u003e2.3. Fish and Experimental Design\u003c/em\u003e\u003c/strong\u003e\u003c/h3\u003e\n\u003cp\u003eA total of 180 healthy African catfish (\u003cem\u003eClarias gariepinus\u003c/em\u003e) with an average initial body weight of 25 \u0026plusmn; 4.3 g were obtained from a private fish farm in Kafrelsheikh Governorate, Egypt. Fish were housed in an indoor aquaculture system with a continuous supply of well-aerated, dechlorinated freshwater, and equipped with internal filtration. Water parameters were maintained as follows: temperature 25 \u0026plusmn; 1.2 \u0026deg;C, dissolved oxygen 6.8 \u0026plusmn; 0.4 mg/L, and pH 7.4\u0026ndash;7.8. Fish were fed at 3% of their body weight twice daily (9:00\u0026ndash;10:00 AM and 4:00\u0026ndash;5:00 PM) with a commercial basal diet during the two-week acclimatization period.\u003c/p\u003e\n\u003cp\u003eAfter acclimation, fish were randomly assigned into four groups, each in triplicate (15 fish per tank; total 45 fish per group), using glass aquaria (dimensions: 40 \u0026times; 60 \u0026times; 30 cm) supplied with dechlorinated tap water and continuous aeration. Fish were treated for 60 consecutive days according to the following protocol:\u003c/p\u003e\n\u003cp\u003e\u0026middot; \u003cstrong\u003eControl Group:\u003c/strong\u003e Fish were fed the control basal diet without any exposure to chlorpyrifos.\u003c/p\u003e\n\u003cp\u003e\u0026middot; \u003cstrong\u003eCPF Group:\u003c/strong\u003e Fish were exposed to chlorpyrifos at a concentration of 0.24 mg/L (1/10 of 96 h LC50) in the rearing water and fed the control basal diet. The chlorpyrifos dose was determined based on [19], who reported that the 96 h LC50 of chlorpyrifos in \u003cem\u003eClarias gariepinus\u003c/em\u003e is 2.4 mg/L.\u003c/p\u003e\n\u003cp\u003e\u0026middot; \u003cstrong\u003eCPF-CV Group:\u003c/strong\u003e Fish were exposed to chlorpyrifos at the same concentration (0.24 mg/L) and fed the diet supplemented with 5% Chlorella vulgaris.\u003c/p\u003e\n\u003cp\u003e\u0026middot; \u003cstrong\u003eCPF-\u0026beta;-glucan Group:\u003c/strong\u003e Fish were exposed to chlorpyrifos at the same concentration (0.24 mg/L) and fed the diet supplemented with 0.1% \u0026beta;-glucan.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003ePercentage of ingredients of experimental diets.\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eIngredients (%)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eControl\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eChlorella vulgaris\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026beta;-glucan\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eYellow corn (8.5%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e12.50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e18.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e12.50\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSoybean meal (44%)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e19.50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e17.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e19.50\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eFish meal\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e20.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e19.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e20.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eWheat bran\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e38.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e30.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e38.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCorn gluten\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e2.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e4.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e2.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGelatin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e2.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1.50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e2.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eOil\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e3.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e4.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e3.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u0026beta;-glucan\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.10\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eChlorella vulgaris\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e5.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eMinerals and vitamins premix**\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e1.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSalt\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.50\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.50\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eDicalcium phosphate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.10\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eMethionine\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e0.30\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003eChemical composition (%)\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 210px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eComponents\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 86px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eControl\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 150px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eChlorella vulgaris\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 144px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026beta;-glucan\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 210px;\"\u003e\n \u003cp\u003eCrude protein\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 86px;\"\u003e\n \u003cp\u003e32.10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 150px;\"\u003e\n \u003cp\u003e32.30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 144px;\"\u003e\n \u003cp\u003e32.10\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 210px;\"\u003e\n \u003cp\u003eDE (kcal/kg)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 86px;\"\u003e\n \u003cp\u003e3000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 150px;\"\u003e\n \u003cp\u003e3000\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 144px;\"\u003e\n \u003cp\u003e3000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cbr\u003e\u003cem\u003e\u003csup\u003e\u003cspan dir=\"RTL\"\u003e**\u003c/span\u003e\u003c/sup\u003e\u003c/em\u003eVitamin mixture supplies the following per kilogram of diet:\u003cbr\u003evit. A \u0026ndash; 1,200,000 IU; vit. D3 \u0026ndash; 200,000 IU; vit. E \u0026ndash; 12,000 mg; vit. K3 \u0026ndash; 2400 mg; vit.\u0026nbsp;B1 \u0026ndash; 4800 mg; vit. B2 \u0026ndash; 4800 mg; vit. B6 \u0026ndash; 4000 mg; vit. B12 \u0026ndash; 4800 mg; folic acid \u0026ndash; 1200 mg; vit. C \u0026ndash; 48,000 mg; biotin \u0026ndash; 48 mg; choline \u0026ndash; 65,000 mg; niacin \u0026ndash; 24,000 mg; Fe \u0026ndash; 10,000 mg; Cu \u0026ndash; 600 mg; Mg \u0026ndash; 4000 mg; Zn \u0026ndash; 6000 mg; I \u0026ndash; 20 mg; Co \u0026ndash; 2 mg; Se \u0026ndash; 20 mg.\u003c/p\u003e\n\u003cp\u003eFish in the CPF group were intoxicated with chlorpyrifos at the same previous dose and fed with \u003cem\u003eChlorella vulgaris\u003c/em\u003e supplemented diet at a dose of 5%. CPF-\u0026beta;-glucan group, fish were intoxicated with chlorpyrifos at the same previous dose and fed with \u0026beta;-glucan containing diet at a dose of 0.1%. Water changes were performed at 80% daily to prevent metabolite accumulations (static-renewal system), then fresh chlorpyrifos solution was added to each experimental group to maintain the set concentrations. The survival rate of African catfish (\u003cem\u003eClarias gariepinus\u003c/em\u003e) in the different treated groups was recorded throughout the feeding trial.\u003c/p\u003e\n\u003ch2\u003e2.4. Samples Collection\u003c/h2\u003e\n\u003cp\u003eAfter 28 days from the beginning of the experiment, fish were collected from each aquarium (n = 10 per group); then sedated with 30 mg/L of tricaine methanesulphonate (MS-222, FINQUEL\u0026reg;, ARGENT) buffered in sodium bicarbonate (60 mg/L) and euthanized with 200 mg/L of MS-222 buffered in sodium bicarbonate (400 mg/L) [20]. Blood samples were collected from the caudal blood vessels of each single fish. One blood sample was collected in a tube containing dipotassium EDTA for blood counting and estimation of whole blood respiratory burst activity [21]. Another blood sample was collected in plain test tubes and centrifuged at 3000 rpm for 10 minutes for serum separation. The separated serum was stored at \u0026minus;80 \u0026deg;C for further determination of biochemical and immunological parameters [22].\u003c/p\u003e\n\u003cp\u003eMoreover, spleen, liver, and gills were collected, washed with normal saline, and homogenized in cold phosphate buffer saline (PBS, pH 7.5). The different tissue homogenates were cold centrifuged for about 15 minutes at 3000 rpm, and the clear supernatants were carefully collected and stored at \u0026minus;80 \u0026deg;C till analysis of antioxidant and oxidative stress parameters [23]. Another sample of the spleen was placed in RNA Later\u0026reg; (Qiagen) at 4 \u0026deg;C overnight and stored at \u0026minus;80 \u0026deg;C for gene expression analysis [24].\u003c/p\u003e\n\u003cp\u003eThe remaining fish continued under the same experimental treatments as previously described. After 60 days from the beginning of the experiment, all remaining fish in each group were counted for the survival rate and weighed to estimate weight gain (WG) [25]. Random fish samples (10 fish per aquarium) from all experimental groups were sacrificed, and the abdominal cavity was quickly opened to remove the organs (liver, spleen) to be weighed immediately [26].\u003c/p\u003e\n\u003cp\u003eAll experimental procedures were conducted following the Animal Care and Use guidelines of Kafrelsheikh University and were approved by the local Administrative Panel on Laboratory Animal Care Committee.\u003c/p\u003e\n\u003ch2\u003e2.5. Blood Cell Count\u003c/h2\u003e\n\u003cp\u003eThe total erythrocyte (RBCs) and leukocyte (WBCs) counts were determined using Natt-Herrick\u0026rsquo;s solution for dilution and were manually counted using a hemocytometer following the method described by [27]. Hemoglobin (Hb) concentration was measured spectrophotometrically using the cyanmethemoglobin method as described by [28]. The packed cell volume (PCV) and red blood cell indices including mean corpuscular volume (MCV, fl), mean corpuscular hemoglobin (MCH, pg), and mean corpuscular hemoglobin concentration (MCHC, %) were calculated according to [29]. Blood smears were prepared for each fish, stained with Giemsa stain, and used to perform differential leukocyte counts according to [27].\u003c/p\u003e\n\u003ch2\u003e2.6. Evaluation of serum biochemical parameters\u003c/h2\u003e\n\u003cp\u003eSerum biochemical parameters including alanine aminotransferase (ALT) and aspartate aminotransferase (AST) (BioMed, Egypt), alkaline phosphatase (ALP) (Spectrum, Egypt), total protein and albumin (Bio-Diagnostic, Egypt), creatinine (Human, Germany), and uric acid (BioMed, Egypt) were determined using a spectrophotometer (5010, Photometer, BM Co. Germany) according to the manufacturer\u0026rsquo;s instructions (30).\u003c/p\u003e\n\u003ch2\u003e2.7. Antioxidant and oxidative stress parameters\u003c/h2\u003e\n\u003cp\u003eThe levels of malondialdehyde (MDA), glutathione (GSH), catalase, and superoxide dismutase (SOD) in the spleen, liver, and gills were assessed using commercial test kits (Bio-Diagnostic, Egypt) and analyzed with a spectrophotometer (5010, Photometer, BM Co. Germany) following the standard procedures provided by the manufacturers (31).\u003c/p\u003e\n\u003ch2\u003e2.8. Immune parameters\u003c/h2\u003e\n\u003ch4\u003e\u003cstrong\u003e2.8.1. Respiratory burst activity\u003c/strong\u003e\u003c/h4\u003e\n\u003cp\u003eThe respiratory burst activity of phagocytes in the blood was measured using the nitroblue tetrazolium (NBT; Sigma-Aldrich, USA) reduction assay as previously described by Wijendra and Pathiratne (32). In brief, 100 \u0026micro;L of whole blood was mixed with an equal volume of NBT solution (1 mg/mL) in a microtiter plate and incubated at 25 \u0026deg;C for 30 minutes. After incubation, 50 \u0026micro;L of the mixture was transferred into a glass tube containing 1.0 mL of N,N-dimethylformamide. The solution was then centrifuged at 3000 g for 5 minutes. The absorbance of the clear supernatant was read at 540 nm using a spectrophotometer (5010, Photometer, BM Co. Germany). The respiratory burst activity was expressed as the optical density (O.D.) of NBT reduction.\u003c/p\u003e\n\u003ch4\u003e\u003cstrong\u003e2.8.2. Serum lysozyme activity\u003c/strong\u003e\u003c/h4\u003e\n\u003cp\u003eSerum lysozyme activity was assessed following the method of Ghareghanipoor et al. (33) with slight modifications. Briefly, 0.25 mL of serum was mixed with 0.75 mL of \u003cem\u003eMicrococcus lysodeikticus\u003c/em\u003e suspension (0.2 mg/mL in 0.05 M PBS, pH 6.2; Sigma-Aldrich, USA). The reaction was allowed to proceed at 25 \u0026deg;C for 5 minutes, and the optical density (O.D.) was recorded at 1-minute intervals for 5 minutes at 540 nm using a spectrophotometer (5010, Photometer, BM Co. Germany). Serum lysozyme concentration was calculated using a standard curve prepared from serial dilutions of lyophilized chicken egg-white lysozyme (Sigma-Aldrich, USA) ranging from 2 to 20 \u0026mu;g/mL.\u003c/p\u003e\n\u003ch4\u003e\u003cstrong\u003e2.8.3. Serum bactericidal activity\u003c/strong\u003e\u003c/h4\u003e\n\u003cp\u003eThe bactericidal activity of serum was evaluated according to the method described by Abdelhamid et al. (34). Briefly, 100 \u0026micro;L of serum was added to 50 \u0026micro;L of \u003cem\u003eAeromonas hydrophila\u003c/em\u003e suspension (1 \u0026times; 10⁸ CFU/mL) in duplicate wells of a 96-well round-bottom microtiter plate and mixed well. The mixture was incubated at 37 \u0026deg;C for 2.5 hours. A control was included by replacing the serum with sterile Hank\u0026rsquo;s Balanced Salt Solution. After incubation, 50 \u0026micro;L of MTT solution (2 mg/mL) was added to each well and the plates were incubated at room temperature for 20 minutes to allow formazan formation. The plates were centrifuged at 2000 \u0026times; g for 10 minutes, the supernatant was discarded, and the formazan crystals were dissolved in 200 \u0026micro;L of dimethyl sulfoxide (DMSO). The absorbance was measured at 560 nm using a microplate reader (Optica, Mikura Ltd, UK). Bactericidal activity was expressed as the difference in absorbance between the control and the test sample.\u003c/p\u003e\n\u003ch4\u003e\u003cstrong\u003e2.8.4. Measurement of C-reactive protein (CRP) and immunoglobulin M (IgM)\u003c/strong\u003e\u003c/h4\u003e\n\u003cp\u003eSerum C-reactive protein (CRP) was qualitatively determined using a rapid latex agglutination test according to the method of Tillett and Francis (35). Immunoglobulin M (IgM) levels were quantitatively measured using the turbidity assay based on the formation of antigen-antibody insoluble immune complexes following the method of Dati and Lammers (36).\u003c/p\u003e\n\u003ch2\u003e2.9. Gene Expression Analysis of Immune-Related Genes\u003c/h2\u003e\n\u003ch4\u003e\u003cstrong\u003e2.9.1. Extraction of Total RNA and Reverse Transcription\u003c/strong\u003e\u003c/h4\u003e\n\u003cp\u003eTotal RNA was extracted from spleen tissues using the RNAeasy Mini Kit (Qiagen, Germany) following the protocol described by Zhang et al. (37) with minor modifications. The concentration and purity of RNA were determined using a NanoDrop spectrophotometer (260/280 nm ratio) (Thermo Fisher Scientific, USA). RNA samples were then used as templates for cDNA synthesis using the RevertAid\u0026trade; First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, USA) according to the manufacturer\u0026rsquo;s instructions. The synthesized cDNA was stored at \u0026minus;80 \u0026deg;C until further use.\u003c/p\u003e\n\u003ch4\u003e\u003cstrong\u003e2.9.2. Real-Time Quantitative PCR (RT-qPCR)\u003c/strong\u003e\u003c/h4\u003e\n\u003cp\u003eQuantitative real-time PCR was performed using the CFX Connect Real-Time PCR Detection System (Bio-Rad, USA) and SYBR\u0026reg; Green PCR Master Mix (Thermo Fisher Scientific, USA) to quantify the expression levels of target immune-related genes in liver tissues. The genes of interest, including tumor necrosis factor-alpha (TNF-\u0026alpha;), interleukin-1 beta (IL-1\u0026beta;), and the housekeeping gene \u0026beta;-actin, were selected based on sequences provided by Wang et al. (38) and Li et al. (39). The PCR cycling conditions were as follows: initial denaturation at 95 \u0026deg;C for 10 minutes, followed by 40 cycles of denaturation at 95 \u0026deg;C for 30 seconds, annealing at 58 \u0026deg;C for 30 seconds, and extension at 72 \u0026deg;C for 30 seconds. The relative gene expression was calculated using the comparative CT method (2\u003csup\u003e\u0026Delta;\u0026Delta;CT)\u003c/sup\u003e as described by Livak and Schmittgen (40).\u003c/p\u003e\n\u003ch2\u003e2.10. CPF Residues Analysis\u003c/h2\u003e\n\u003cp\u003eThe extraction and cleanup of chlorpyrifos (CPF) residues from Nile tilapia liver tissue were carried out using the QuEChERS method as described by Mastovska and Lehotay (41) with slight modifications. The cleaned and acidified extracts were then subjected to multi-residue determination using Gas Chromatography equipped with an Electron Capture Detector (GC-ECD; Agilent 7890B, USA). Each extract was analyzed in triplicate to ensure accuracy and repeatability.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003ePrimer sequences used for RT-PCR analysis.\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eGene\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003ePrimer Sequence (5\u0026prime; to 3\u0026prime;)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eAmplicon size (bp)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eAccession number\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eTumor necrosis factor-\u0026alpha;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTNF\u0026alpha;-F: CAGACTGTAGCCCTGTCACCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e85\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003eAY428948.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 253px;\"\u003e\n \u003cp\u003eTNF\u0026alpha;-R: GTCACAGAGTGGGAGGTTGAT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eInterleukin 10\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eIL-10-F: CGCTGTCATCGATTTCTCCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003e97\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" valign=\"top\"\u003e\n \u003cp\u003eXM_003441366.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 253px;\"\u003e\n \u003cp\u003eIL-10-R: ATCTCCTGTTCCCTCCTGCTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e\u003cstrong\u003eElongation factor 1\u0026alpha;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eEF1\u0026alpha;-F: GACAACATGCTTGAGGCTGAC\u003c/p\u003e\n \u003cp\u003eEF1\u0026alpha;-R: CCAATACCAGTCTCCACACCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003e83\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAB075952.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003ch2\u003e2.11. Growth Parameter Measurements\u003c/h2\u003e\n\u003cp\u003eGrowth performance and feed utilization were evaluated by measuring weight gain, specific growth rate (SGR), feed conversion ratio (FCR), protein efficiency ratio (PER), hepatosomatic index (HSI), spleensomatic index (SSI), and survival rate (SR) according to the method described by Cech et al. [42].\u003c/p\u003e\n\u003cp\u003eThe following equations were applied to assess the growth performance and body indices of \u003cem\u003eOreochromis niloticus\u003c/em\u003e:\u003c/p\u003e\n\u003cp\u003e\u0026middot; \u003cstrong\u003eWeight Gain (WG, g) = Mean final weight (g) \u0026ndash; Mean initial weight (g)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026middot; \u003cstrong\u003eFeed Conversion Ratio (FCR) = Feed intake (g) / Weight gain (g)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026middot; \u003cstrong\u003eSpecific Growth Rate (SGR, %/day) = 100 \u0026times; [(Ln mean final body weight - Ln mean initial body weight) / Culture period (days)]\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026middot; \u003cstrong\u003eProtein Efficiency Ratio (PER) = Wet weight gain (g) / Protein intake (g)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026middot; \u003cstrong\u003eHepatosomatic Index (HSI) = (Liver weight / Body weight) \u0026times; 100\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026middot; \u003cstrong\u003eSpleensomatic Index (SSI) = (Spleen weight / Body weight) \u0026times; 100\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026middot; \u003cstrong\u003eSurvival Rate (SR, %) = (Final fish number / Initial fish number) \u0026times; 100\u003c/strong\u003e\u003c/p\u003e\n\u003ch2\u003e2.12. Statistical analysis\u003c/h2\u003e\n\u003cp\u003eAll data were presented as mean \u0026plusmn; standard error (SE). Statistical analyses were performed using the SPSS software program (version 26, IBM, USA). One-way analysis of variance (ANOVA) was used to assess the differences among the experimental groups, followed by Tukey\u0026rsquo;s post-hoc test to compare means. Differences were considered statistically significant when P \u0026lt; 0.05.\u003c/p\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e3.1. Blood cell count\u003c/h2\u003e \u003cp\u003eThere were no significant differences in RBC count, hemoglobin concentration, and PCV percentage among CPF, CPF-C. vulgaris, and CPF-β-glucan treated fish compared to the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). However, total leukocytic count (TLC) and lymphocyte count were significantly decreased in the CPF-intoxicated group compared to the control (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), while heterophil counts were significantly elevated in the CPF group compared to the control (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFeeding CPF-intoxicated fish with \u003cem\u003eChlorella vulgaris\u003c/em\u003e or β-glucan supplemented diets significantly improved the TLC and lymphocyte counts compared to the CPF group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Additionally, heterophil counts remained significantly higher in the CPF-C. vulgaris and CPF-β-glucan groups compared to both the control and CPF groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Monocyte counts did not show significant differences between all groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eHematological parameters of African catfish (\u003cem\u003eClarias gariepinus\u003c/em\u003e) treated with Chlorpyrifos, Chlorella vulgaris and β-glucan.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eExperimental groups\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCPF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCPF-CV\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCPF-β-glucan\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eRBCs (10⁶/\u0026micro;L)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e1.95\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12ᵃ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e2.10\u0026thinsp;\u0026plusmn;\u0026thinsp;0.18ᵃ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e2.20\u0026thinsp;\u0026plusmn;\u0026thinsp;0.21ᵃ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e2.40\u0026thinsp;\u0026plusmn;\u0026thinsp;0.25ᵃ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHb (g/dl)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e8.60\u0026thinsp;\u0026plusmn;\u0026thinsp;0.70ᵃ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e9.85\u0026thinsp;\u0026plusmn;\u0026thinsp;1.20ᵃ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e9.15\u0026thinsp;\u0026plusmn;\u0026thinsp;0.50ᵃ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e9.50\u0026thinsp;\u0026plusmn;\u0026thinsp;0.40ᵃ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003ePCV (%)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e29.00\u0026thinsp;\u0026plusmn;\u0026thinsp;1.10ᵃ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e30.20\u0026thinsp;\u0026plusmn;\u0026thinsp;1.50ᵃ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e28.90\u0026thinsp;\u0026plusmn;\u0026thinsp;1.00ᵃ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e31.00\u0026thinsp;\u0026plusmn;\u0026thinsp;1.30ᵃ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eWBCs (10\u0026sup3;/\u0026micro;L)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e45.50\u0026thinsp;\u0026plusmn;\u0026thinsp;3.00ᵇ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e37.80\u0026thinsp;\u0026plusmn;\u0026thinsp;3.50ᶜ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e60.40\u0026thinsp;\u0026plusmn;\u0026thinsp;4.00ᵃ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e56.20\u0026thinsp;\u0026plusmn;\u0026thinsp;3.20ᵃ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eLymphocyte (10\u0026sup3;/\u0026micro;L)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e24.10\u0026thinsp;\u0026plusmn;\u0026thinsp;1.20ᵃ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e13.50\u0026thinsp;\u0026plusmn;\u0026thinsp;1.40ᶜ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e26.00\u0026thinsp;\u0026plusmn;\u0026thinsp;3.00ᵃ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e21.20\u0026thinsp;\u0026plusmn;\u0026thinsp;2.30ᵇ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHeterophil (10\u0026sup3;/\u0026micro;L)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e17.20\u0026thinsp;\u0026plusmn;\u0026thinsp;1.80ᶜ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e22.50\u0026thinsp;\u0026plusmn;\u0026thinsp;2.50ᵇ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e30.50\u0026thinsp;\u0026plusmn;\u0026thinsp;2.30ᵃ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e32.00\u0026thinsp;\u0026plusmn;\u0026thinsp;1.90ᵃ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMonocyte (10\u0026sup3;/\u0026micro;L)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e4.50\u0026thinsp;\u0026plusmn;\u0026thinsp;0.50ᵃ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e4.10\u0026thinsp;\u0026plusmn;\u0026thinsp;0.70ᵃ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e4.80\u0026thinsp;\u0026plusmn;\u0026thinsp;0.40ᵃ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e4.90\u0026thinsp;\u0026plusmn;\u0026thinsp;0.30ᵃ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eData are expressed as Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM (n\u0026thinsp;=\u0026thinsp;5).Means in the same row with different superscripts are significantly different (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05).CPF, Chlorpyrifos; CV, Chlorella vulgaris; RBCs, Red blood cell count; Hb, Hemoglobin; PCV, Packed Cell Volume; WBCs, White blood cell count.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003e3.2. Biochemical parameters\u003c/h2\u003e \u003cp\u003eThe Chlorpyrifos (CPF) induced hepatotoxicity was indicated by a significant elevation in ALT and AST activities compared to the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). However, the CPF-CV and CPF-β-glucan treated groups showed significantly lower serum levels of ALT and AST compared to the CPF group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). No significant differences in ALP levels were observed among all treated groups (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSerum total protein level was significantly higher in the CPF-β-glucan treated fish compared to the other groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Serum albumin level was slightly decreased in CPF intoxicated fish compared to the other groups. Meanwhile, globulin was significantly decreased in the CPF group compared to the control and CPF-β-glucan groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In fish fed β-glucan supplemented diets, the globulin level was significantly higher, while the albumin-globulin ratio (A/G) was significantly lower than those of the CPF group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eCPF, CPF-CV and CPF-β-glucan treated fish showed significantly higher levels of creatinine and uric acid than the control fish (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Additionally, uric acid levels in both CPF-CV and CPF-β-glucan groups were significantly lower than those in the CPF group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSerum biochemical parameters of African catfish (\u003cem\u003eClarias gariepinus\u003c/em\u003e) treated with Chlorpyrifos, Chlorella vulgaris and β-glucan.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eExperimental groups\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCPF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCPF-CV\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCPF-β-glucan\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eALT (U/L)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e11.80\u0026thinsp;\u0026plusmn;\u0026thinsp;1.05ᶜ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e26.90\u0026thinsp;\u0026plusmn;\u0026thinsp;2.90ᵃ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e18.60\u0026thinsp;\u0026plusmn;\u0026thinsp;1.50ᵇ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e19.50\u0026thinsp;\u0026plusmn;\u0026thinsp;1.70ᵇ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eAST (U/L)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e56.20\u0026thinsp;\u0026plusmn;\u0026thinsp;4.90ᶜ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e112.50\u0026thinsp;\u0026plusmn;\u0026thinsp;9.80ᵃ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e95.40\u0026thinsp;\u0026plusmn;\u0026thinsp;7.10ᵇ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e82.70\u0026thinsp;\u0026plusmn;\u0026thinsp;5.80ᵇ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eALP (U/L)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e78.00\u0026thinsp;\u0026plusmn;\u0026thinsp;6.90ᵃ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e88.20\u0026thinsp;\u0026plusmn;\u0026thinsp;5.90ᵃ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e76.50\u0026thinsp;\u0026plusmn;\u0026thinsp;5.70ᵃ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e85.30\u0026thinsp;\u0026plusmn;\u0026thinsp;4.10ᵃ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTotal protein (g/dl)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e4.40\u0026thinsp;\u0026plusmn;\u0026thinsp;0.38ᵇ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e3.55\u0026thinsp;\u0026plusmn;\u0026thinsp;0.40ᶜ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e4.20\u0026thinsp;\u0026plusmn;\u0026thinsp;0.22ᵇ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e4.85\u0026thinsp;\u0026plusmn;\u0026thinsp;0.60ᵃ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eAlbumin (g/dl)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e1.30\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14ᵃ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e1.22\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11ᵃ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e1.25\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10ᵃ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e1.29\u0026thinsp;\u0026plusmn;\u0026thinsp;0.18ᵃ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGlobulin (g/dl)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e3.10\u0026thinsp;\u0026plusmn;\u0026thinsp;0.30ᵃ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e2.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.35ᶜ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e2.95\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12ᵃᵇ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e3.56\u0026thinsp;\u0026plusmn;\u0026thinsp;0.50ᵃ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eA/G ratio (%)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e0.42\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04ᵃᵇ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e0.52\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06ᵃ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e0.42\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05ᵃᵇ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e0.36\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07ᵇ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCreatinine (mg/dl)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e0.28\u0026thinsp;\u0026plusmn;\u0026thinsp;0.015ᵇ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e0.37\u0026thinsp;\u0026plusmn;\u0026thinsp;0.017ᵃ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e0.34\u0026thinsp;\u0026plusmn;\u0026thinsp;0.020ᵃ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e0.33\u0026thinsp;\u0026plusmn;\u0026thinsp;0.019ᵃ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eUric acid (mg/dl)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e \u003cp\u003e5.30\u0026thinsp;\u0026plusmn;\u0026thinsp;0.40ᶜ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c3\"\u003e \u003cp\u003e9.50\u0026thinsp;\u0026plusmn;\u0026thinsp;0.38ᵃ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c4\"\u003e \u003cp\u003e7.80\u0026thinsp;\u0026plusmn;\u0026thinsp;0.28ᵇ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c5\"\u003e \u003cp\u003e7.90\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15ᵇ\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eData are expressed as Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM (n\u0026thinsp;=\u0026thinsp;5).Means in the same row with different superscripts are significantly different (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05).CPF, Chlorpyrifos; CV, Chlorella vulgaris; ALT, alanine aminotransferase; AST, aspartate aminotransferase; ALP, alkaline phosphatase; A/G ratio, albumin/globulin ratio.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003e3.3. Antioxidant and Oxidative Stress Parameters\u003c/h2\u003e \u003cp\u003eSpleen MDA level was significantly increased in CPF and CPF-CV groups compared to the control and CPF-β-glucan groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Additionally, liver MDA levels were significantly elevated in CPF group in contrast to all other groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003eCPF exposure significantly decreased GSH levels in liver and gills compared to the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Treatment of CPF-exposed fish with CV and β-glucan supplemented diets significantly improved liver GSH levels compared to CPF group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Notably, only the β-glucan supplemented diet was able to restore gill GSH levels back to normal (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eSpleen and liver catalase (CAT) levels showed no significant differences among the experimental groups. However, the CPF-CV group demonstrated significantly higher catalase activity compared to all other groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eMoreover, liver SOD activity was significantly lower in CPF and CPF-CV groups compared to the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Interestingly, the highest liver SOD activity was recorded in CPF-β-glucan group compared to all other groups, including the control (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003eNo significant differences were detected in gill MDA, spleen GSH, and gill SOD levels among all groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec25\" class=\"Section2\"\u003e \u003ch2\u003e3.4. Immune Parameters\u003c/h2\u003e \u003cp\u003eChlorpyrifos (CPF) intoxicated fish showed a significant reduction in respiratory burst activity compared to the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). CPF groups fed with diets containing \u003cem\u003eChlorella vulgaris\u003c/em\u003e (CV) and β-glucan exhibited significantly higher respiratory burst activity compared to both CPF and control groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSerum lysozyme activity was significantly lower in CPF-treated fish than all other groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Only the β-glucan treated group showed a significant increase in lysozyme activity compared to other treatments (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003eMoreover, CPF toxicity significantly decreased bactericidal activity compared to both CPF-CV and CPF-β-glucan groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The highest bactericidal activity was recorded in the CV-supplemented group compared to all other groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSerum immunoglobulin G (IgM) and C-reactive protein (CRP) levels were significantly reduced in CPF-intoxicated fish compared to the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). However, these parameters were significantly elevated in the CPF-β-glucan group compared to the CPF and control groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Additionally, dietary supplementation with CV significantly improved IgG levels but had no significant effect on CRP levels compared to the CPF group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section2\"\u003e \u003ch2\u003e3.5. Expression of Immune-Related Genes\u003c/h2\u003e \u003cp\u003eThe TNF-α transcript level was significantly up-regulated in the spleen of all CPF-treated fish compared to the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). This significant increase was also observed in the spleen of CPF-CV and CPF-β-glucan treated fish compared to the control fish (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003eThe expression of IL-10 was significantly down-regulated in the spleen of CPF, CPF-CV, and CPF-β-glucan treated fish compared to the control group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). However, IL-10 expression was significantly higher in the CPF-CV and CPF-β-glucan supplemented fish than in CPF-intoxicated fish (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec27\" class=\"Section2\"\u003e \u003ch2\u003e3.6. CPF Residues in Liver Tissue\u003c/h2\u003e \u003cp\u003eThe CPF residues results are presented in Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e6\u003c/span\u003e and showed that the highest concentration of CPF residue was detected in CPF-exposed fish (CPF group) compared to CPF-CV and CPF-β-glucan treated groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Meanwhile, the CPF concentration was significantly lower in CPF-CV group compared to CPF-β-glucan group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 6\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eConcentration residues of Chlorpyrifos (CPF) (ng/g tissue) in liver tissue of African catfish (\u003cem\u003eClarias gariepinus\u003c/em\u003e).\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eExperimental groups\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCPF Residues (ng/g tissue)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.000\u0026thinsp;\u0026plusmn;\u0026thinsp;0.000 \u003csup\u003ed\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCPF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.175\u0026thinsp;\u0026plusmn;\u0026thinsp;0.004 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCPF-CV\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.103\u0026thinsp;\u0026plusmn;\u0026thinsp;0.003 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCPF-β-glucan\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.128\u0026thinsp;\u0026plusmn;\u0026thinsp;0.002 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eData are expressed as Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. Means in the same row with different superscripts are significantly different (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). CPF, Chlorpyrifos; CV, Chlorella vulgaris.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec28\" class=\"Section2\"\u003e \u003ch2\u003e3.7. Survival rate and growth performance\u003c/h2\u003e \u003cp\u003eThe survival rate of African catfish (\u003cem\u003eClarias gariepinus\u003c/em\u003e) was significantly lower in CPF treated fish compared to all other treated groups, and the highest survival rate was recorded in the CV treated fish (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). Additionally, the lowest growth performance was observed in the CPF treated group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Fish in the CPF-CV group showed significantly higher final body weight (FBW) and body weight gain (BWG) than the fish in the other experimental groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eOn the other hand, the feed conversion ratio (FCR), specific growth rate (SGR), and protein efficiency ratio (PER) of the control, CPF-CV, and CPF-β-glucan groups were significantly better than those of the CPF group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003eThe data also exhibited significantly increased hepatosomatic index (HSI) and spleensomatic index (SSI) in the control and CPF groups compared to the CPF-CV and CPF-β-glucan groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab6\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eGrowth performance of African catfish (\u003cem\u003eClarias gariepinus\u003c/em\u003e) treated with Chlorpyrifos, Chlorella vulgaris, and β-glucan.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eExperimental groups\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eControl\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCPF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCPF-CV\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eCPF-β-glucan\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIW (g/fish)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e21.80\u0026thinsp;\u0026plusmn;\u0026thinsp;1.15 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e20.90\u0026thinsp;\u0026plusmn;\u0026thinsp;1.05 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e21.15\u0026thinsp;\u0026plusmn;\u0026thinsp;0.97 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e21.75\u0026thinsp;\u0026plusmn;\u0026thinsp;1.10 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFBW (g/fish)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e55.80\u0026thinsp;\u0026plusmn;\u0026thinsp;2.10 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e40.95\u0026thinsp;\u0026plusmn;\u0026thinsp;3.45 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e64.25\u0026thinsp;\u0026plusmn;\u0026thinsp;3.62 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e53.70\u0026thinsp;\u0026plusmn;\u0026thinsp;3.05 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBWG (g/fish)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e34.00\u0026thinsp;\u0026plusmn;\u0026thinsp;2.40 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e20.05\u0026thinsp;\u0026plusmn;\u0026thinsp;2.80 \u003csup\u003ec\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e43.10\u0026thinsp;\u0026plusmn;\u0026thinsp;3.10 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e31.95\u0026thinsp;\u0026plusmn;\u0026thinsp;3.20 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFCR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.85\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.68\u0026thinsp;\u0026plusmn;\u0026thinsp;0.36 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.78\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.95\u0026thinsp;\u0026plusmn;\u0026thinsp;0.17 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSGR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.75\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.18\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.92\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.70\u0026thinsp;\u0026plusmn;\u0026thinsp;0.10 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePER\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.80\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.15\u0026thinsp;\u0026plusmn;\u0026thinsp;0.17 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.95\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.85\u0026thinsp;\u0026plusmn;\u0026thinsp;0.12 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHSI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1.90\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.40\u0026thinsp;\u0026plusmn;\u0026thinsp;0.26 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1.50\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06 \u003csup\u003eab\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1.30\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSSI\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.65\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.50\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09 \u003csup\u003ea\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.30\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.32\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04 \u003csup\u003eb\u003c/sup\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eData are expressed as Mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM (n\u0026thinsp;=\u0026thinsp;5). Means in the same row with different superscripts are significantly different (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05).CPF, Chlorpyrifos; CV, Chlorella vulgaris; IW, Initial weight; FBW, Final body weight; BWG, Body weight gain; FCR, Feed conversion ratio; SGR, Specific growth rate; PER, Protein efficiency ratio; HSI, Hepatosomatic index; SSI, Spleen-somatic index.\u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eIn the present study on African catfish (Clarias gariepinus), serum total protein levels were insignificantly changed, albumin levels slightly decreased, while globulin levels significantly reduced in fish exposed to chlorpyrifos (CPF). Additionally, creatinine and uric acid levels were markedly elevated compared to the control group. These results align with the findings of Alishahi et al. [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e], who observed that total protein and globulin levels significantly decreased while albumin levels showed insignificant changes in juvenile Barbus sharpeyi exposed to diazinon [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eConversely, African catfish treated with Chlorella vulgaris (CV) and β-glucan exhibited considerable improvement in serum biochemical parameters, as ALT, AST, and uric acid levels significantly decreased compared to the CPF-exposed group. Furthermore, total protein and globulin levels significantly increased in β-glucan supplemented fish. The hepatoprotective effect of CV may be attributed to its potent antioxidant properties that maintain hepatocyte membrane integrity and prevent the leakage of intracellular enzymes into the bloodstream. Similarly, Zahran et al. [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e] demonstrated that dietary supplementation with 5% and 10% CV powder for 21 days significantly improved liver and kidney biomarkers, as well as total protein, albumin, and globulin levels in Nile tilapia exposed to sodium arsenite toxicity [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAdditionally, β-1,3-glucan possesses antioxidant properties by scavenging free radicals and inhibiting lipid peroxidation in hepatic tissues [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. El-Keredy et al. [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e] confirmed that dietary β-glucan supplementation (100 mg/kg diet for 10 weeks) effectively restored elevated levels of AST, ALT, urea, uric acid, and creatinine to normal in copper-intoxicated Nile tilapia [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIt is well established that pesticide toxicity in fish induces oxidative damage due to the excessive production of reactive oxygen species (ROS), which exceeds the capacity of the antioxidant defense system [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Superoxide dismutase (SOD) and catalase (CAT) are considered the first lines of defense against oxidative cell damage [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn this study, CPF exposure in African catfish significantly increased malondialdehyde (MDA) levels in the spleen and liver while significantly decreasing antioxidant enzyme activities, including gill and hepatic glutathione (GSH) and splenic SOD, compared to the control group. The elevated MDA levels indicate enhanced lipid peroxidation, likely caused by excessive free radical production during CPF metabolism [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e], coupled with depletion of GSH activity [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFurthermore, xenobiotic exposure may increase glutathione degradation or decrease its synthesis, resulting in reduced GSH levels [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. The tissue-specific variation in antioxidant enzyme activity may reflect either adaptive responses to oxidative stress or higher sensitivity of liver tissues to oxidative damage compared to gills, likely due to the liver\u0026rsquo;s central role in pesticide detoxification and clearance [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. Chlorpyrifos is known to preferentially accumulate and metabolize in hepatic tissues [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Moreover, antioxidant enzyme responses can vary depending on xenobiotic type, exposure duration, species, and tolerance [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn African catfish exposed to CPF, previous studies have demonstrated that CPF toxicity significantly elevated lipid peroxidation (indicated by hepatic MDA levels) and decreased hepatic SOD, CAT, GSH-Px, and total antioxidant capacity (TAC) [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. Similarly, Abdelkhalek et al. [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e] reported significant reductions in catalase, GSH, and SOD activities, with increased MDA levels in the liver, kidney, and gills of Nile tilapia after pesticide exposure.\u003c/p\u003e \u003cp\u003eThe protective effect of CV against CPF-induced oxidative damage in African catfish is likely attributed to its rich content of flavonoids, carotenoids, chlorophyll, tocopherols, and polyphenols, which exhibit potent antioxidant properties capable of scavenging ROS and inhibiting lipid peroxidation [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. Additionally, CV supplementation improved GSH levels in liver and gills and increased catalase activity in gills compared to the CPF group. These findings are consistent with Zahran and Risha [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], who reported that dietary CV supplementation restored MDA and H₂O₂ levels to control values and enhanced catalase and GSH levels in liver and gill homogenates of sodium arsenite-intoxicated fish. Co-administration of CV with CPF in other fish species exposed to herbicides also significantly elevated serum SOD and GSH-Px activities while reducing MDA levels [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe antioxidant effects of β-1,3-glucan are similarly supported, as it may scavenge free radicals, inhibit lipid peroxidation, enhance endogenous antioxidant systems, and reduce ROS generation [\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. In this study, β-glucan supplementation significantly reduced splenic MDA levels while increasing GSH and SOD activities in the liver and spleen of African catfish compared to the CPF group. These results agree with Dawood et al. [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], who reported reduced serum MDA levels and elevated serum SOD and GSH-Px activities in Nile tilapia supplemented with β-glucan (1 g/kg diet) for 60 days. Likewise, in common carp intoxicated with fipronil and lead nitrate, β-1,3-glucan supplementation significantly elevated GSH, SOD, and catalase activities, lowered MDA levels, and upregulated hepatic SOD, catalase, and GST gene expression [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe current study also clarified that CPF exerts immunosuppressive effects, as it significantly reduced respiratory burst activity, lysozyme activity, IgM, and CRP levels in African catfish, although bactericidal activity was only nominally affected. This immunosuppressive impact was previously reported by Hajirezaee et al. [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e], who observed significant reductions in plasma immunoglobulin, lysozyme, and respiratory burst activities in rainbow trout exposed to diazinon. Pesticide exposure also reduced lysozyme and bactericidal activities and downregulated splenic IgM mRNA expression in other studies [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]. Lysozyme activity reduction was additionally documented in rainbow trout after diazinon exposure [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. These reductions in lysozyme and bactericidal activities may be attributed to the immunosuppressive effects of CPF on non-specific immune responses, particularly leukocyte production, differentiation, and protein synthesis [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. CPF-induced tissue damage and hepatocyte apoptosis may further contribute to the reduced synthesis of total protein and immunoglobulins by the liver [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn this study, CV supplementation restored key immune responses such as respiratory burst activity, IgM levels, serum lysozyme, and bactericidal activities after CPF exposure in African catfish, confirming its immunostimulatory effects. This may be attributed to omega-3 and omega-6 polyunsaturated fatty acids and polysaccharides in CV cell walls, which activate immune cells by binding to immune cell receptors [\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e]. Similar improvements were reported in African catfish fed diets containing 5% and 10% CV after exposure to environmental pollutants [\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFurthermore, β-glucan supplementation effectively modulated CPF-induced immunosuppression in African catfish by enhancing respiratory burst activity, IgM, CRP, lysozyme, and bactericidal activities. β-glucan\u0026rsquo;s immunomodulatory effects may result from its binding to membrane receptors on macrophages and dendritic immune cells, leading to IL-10 upregulation [\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e] and stimulating the complement cascade, phagocytosis, serum lysozyme, and bactericidal activity [\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e]. El-Boshy et al. [\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e] similarly found that dietary β-glucan supplementation (0.1%) for 21 days significantly elevated serum bactericidal and lysozyme activities, nitric oxide levels, and macrophage head kidney oxidative burst in African catfish compared to immunosuppressed fish. Dawood et al. [\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e] also reported that β-glucan supplementation (1 g/kg diet) for 60 days numerically increased phagocytic index, IgM, respiratory burst, and bactericidal activities, while significantly enhancing serum lysozyme activity.\u003c/p\u003e \u003cp\u003eRegarding spleen mRNA expression, TNF-α levels were significantly elevated, while IL-10 levels were significantly reduced in CPF-exposed African catfish. Hajirezaee et al. [\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e] similarly reported increased expression of IL-1β and TGF-β1 genes in rainbow trout after diazinon exposure. These findings may reflect CPF-induced inflammatory responses and cell damage [\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e]. CPF may activate macrophages and inflammatory pathways through ROS generation, triggering NF-κB pathway activation and inducing pro-inflammatory cytokines (TNF-α, IL-1β, IL-6), COX-2, and iNOS expression [\u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn this study, CV and β-glucan supplementation significantly mitigated CPF-induced inflammation by reducing TNF-α and increasing IL-10 gene expression. CV\u0026rsquo;s anti-inflammatory effects may be attributed to its carotenoids, especially violaxanthin, which exhibit potent antioxidant activity, reduce ROS production, and subsequently inhibit iNOS, COX-2, and inflammatory biomarkers via NF-κB pathway suppression [\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e]. Previous studies showed that CV supplementation (10%) for 21 days significantly downregulated IL-1β, TNF-α, and TGF-β1 gene expression in sodium arsenite-intoxicated fish [\u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e]. The anti-inflammatory effect of β-glucan is likely related to its ability to suppress pro-inflammatory cytokines (IL-1β, TGF, COX-2) and induce IgM and IL-10 gene expression [\u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e, \u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e]. β-glucan\u0026rsquo;s antioxidant capacity and free radical scavenging activity further contribute to inflammation reduction [\u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e79\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn this study, the survival rate and growth performance of CPF-exposed African catfish were significantly reduced compared to other groups. Similar findings were reported by Sweilum [\u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e80\u003c/span\u003e], who observed that sub-lethal levels of pesticides (malathion and dimethoate) significantly decreased survival rate, final body weight, and specific growth rate in fish. Additionally, exposure to sub-lethal concentrations of penoxsulam herbicide significantly reduced final body weight, weight gain, and specific growth rate in African catfish.\u003c/p\u003e \u003cp\u003eHowever, the survival rates of CPF-β-glucan and CPF-CV groups significantly improved compared to the CPF group. These findings align with El-Boshy et al. [\u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e81\u003c/span\u003e], who reported improved survival rates in fish fed Chlorella sp. The protective effect of β-glucan against toxins and pathogens has been well-documented in several fish species [\u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e82\u003c/span\u003e]. Moreover, fish in the CPF-CV group demonstrated significantly improved growth performance compared to other groups. This improvement may be attributed to CV\u0026rsquo;s high-quality protein content, which enhances final body weight and body weight gain [\u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e83\u003c/span\u003e]. CV also contains growth-promoting compounds such as the S-nucleotide adenosyl peptide complex, which may improve growth performance and digestibility [\u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e84\u003c/span\u003e]. CV is rich in essential macro- and micro-nutrients, including omega-3 and omega-6 polyunsaturated fatty acids, proteins, polysaccharides, carotenoids, minerals, vitamins (C and E), pro-vitamins, chlorophyll, and lutein [\u003cspan citationid=\"CR85\" class=\"CitationRef\"\u003e85\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOur findings also confirmed that β-glucan supplementation improved growth performance after CPF toxicity. This may be attributed to glucan degradation by glucanase enzymes, promoting protein conservation (protein saver effect) and enhancing growth [\u003cspan citationid=\"CR86\" class=\"CitationRef\"\u003e86\u003c/span\u003e]. Additionally, β-glucan may stimulate digestive enzyme secretion, further improving growth performance [\u003cspan citationid=\"CR87\" class=\"CitationRef\"\u003e87\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe liver plays a central role in xenobiotic accumulation and biotransformation in fish [\u003cspan citationid=\"CR88\" class=\"CitationRef\"\u003e88\u003c/span\u003e]. This was evident in our study, where CPF accumulation in hepatic tissues of CPF-exposed fish was significantly higher than in other groups. Dietary CV or β-glucan supplementation significantly reduced CPF accumulation. The hepatosomatic index (HSI) is widely used as a biomarker of liver function and physiological status in fish [\u003cspan citationid=\"CR89\" class=\"CitationRef\"\u003e89\u003c/span\u003e]. In this study, CV and β-glucan supplementation alleviated CPF-induced negative effects on liver function. Similarly, Hossain et al. [\u003cspan citationid=\"CR90\" class=\"CitationRef\"\u003e90\u003c/span\u003e] found that increasing sumithion doses in common carp significantly increased HSI, likely due to hepatic fat accumulation and glycogen mobilization during pesticide exposure.\u003c/p\u003e \u003cp\u003eOverall, this study demonstrates a direct relationship between hepatic damage and CPF tissue concentrations. Dietary supplementation with Chlorella vulgaris and β-glucan effectively mitigated hematological, hepato-renal, and gill damage, enhanced the antioxidant defense system, and suppressed CPF-induced oxidative stress. Both supplements modulated innate immune suppression, including IgM, CRP levels, respiratory burst, lysozyme, and bactericidal activities. Furthermore, CV and β-glucan acted as natural anti-inflammatory agents by decreasing spleen TNF-α and increasing IL-10 gene expression in CPF-exposed African catfish. Notably, CV supplementation exhibited superior effects in improving survival rate and growth performance compared to β-glucan. Further studies are recommended to explore the potential of probiotics, prebiotics, and other natural treatments for pesticide toxicity, which remains a significant concern in aquaculture and environmental health.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eThe present study conclusively demonstrated that dietary supplementation with Chlorella vulgaris (CV) and β-glucan provides significant protection against chlorpyrifos (CPF)-induced toxicity in African catfish. Both CV and β-glucan effectively mitigated immunosuppression, oxidative stress, hepatic damage, and inflammatory responses triggered by CPF exposure. CV proved to be superior in enhancing growth performance and survival rates, likely due to its rich nutritional profile and bioactive compounds. β-glucan also showed substantial immunomodulatory and growth-promoting effects, potentially through the stimulation of digestive enzymes and immune-related pathways. Importantly, both supplements significantly reduced CPF accumulation in hepatic tissues, underscoring their detoxification potential. This research highlights the promising application of natural feed additives in aquaculture as a sustainable strategy to counteract pesticide toxicity and improve fish health and productivity. Further studies are warranted to investigate the efficacy of other natural immunostimulants and probiotics in combating chemical pollutants in aquaculture systems.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eALP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAlkaline phosphatase\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eALT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAlanine aminotransferase\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAST\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eAspartate aminotransferase\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eBWG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eBody weight gain\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCatalase\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCOX-2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCyclooxygenase-2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCPF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eChlorpyrifos\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCRP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eC-reactive protein\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eChlorella vulgaris\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eFBW\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eFinal body weight\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eFCR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eFeed conversion ratio\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGPx\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGlutathione peroxidase\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eHSI\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eHepatosomatic index\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eIgM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eImmunoglobulin M\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eIL-10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eInterleukin-10\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eIL-1\u0026beta;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eInterleukin-1 beta\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eiNOS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eInducible nitric oxide synthase\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNF-\u0026kappa;B\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNuclear factor kappa-light-chain-enhancer of activated B cells\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNO\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eNitric oxide\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003ePER\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eProtein efficiency ratio\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eRBCs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eRed blood cells\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eROS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eReactive oxygen species\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSGR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSpecific growth rate\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSOD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eSuperoxide dismutase\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTGF-\u0026beta;1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTransforming growth factor beta 1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTLC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTotal leukocytic count\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTNF-\u0026alpha;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTumor necrosis factor-alpha\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eWBCs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eWhite blood cells\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Declarations","content":"\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eAhmed E. A. Mostafa conducted the experimental design, data collection, statistical analysis, and interpretation. A.E.A. also wrote the main manuscript text and prepared all figures and tables. The author reviewed and approved the final manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eThe author would like to thank Delta University for Science and Technology for providing the necessary facilities and support to conduct this research\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003e\u003cspan\u003eDas, S., \u0026amp; Shasmal, V. (2013). Chlorpyrifos toxicity in fish: A review. Current World Environment, 8(1), 77\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eNgangom Nganbi Devi, N., Sapana Devi, M., Thounaojam, R. S., \u0026amp; Gupta, A. (2024). Toxic effects of chlorpyrifos on oxidative enzyme activities and ultrastructure in gills of freshwater fish. Environmental Science and Pollution Research.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eSelvaraj, V., et al. (2022). \u0026beta;-Glucan: Mode of action and its uses in fish immunomodulation. Frontiers in Marine Science, 9, Article 905986. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fmars.2022.905986\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eDevic, E., et al. (2024). Dietary Chlorella vulgaris supplementation modulates health, antioxidant and immune status of fish. Scientific Reports, 14, Article 72531.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eHe, Y., et al. (2024). Effects of dietary hot water extracts of Chlorella vulgaris on antioxidant activity and stress responses in shrimp. Frontiers in Marine Science, 11, 1431852. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fmars.2024.1431852\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eRing\u0026oslash;, E., \u0026amp; Song, S. K. (2013). Yeast \u0026beta;-glucans as fish immunomodulators: A review. Aquaculture Research, 44(9), 1496\u0026ndash;1508.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eBrennan, F. R., et al. (2024). A comprehensive review on chlorpyrifos toxicity: Environmental occurrence and fish health implications. Science of the Total Environment, 769, 145123.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003ePradhan, R. N., et al. (2023). Chlorella vulgaris alleviates chlorpyrifos-induced stress in Nile tilapia: Growth performance, immunity and biochemical responses. Molecular Biology Reports, 51, 259\u0026ndash;273.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eMajumder, R., \u0026amp; Kaviraj, A. (2016). Effects of sublethal chlorpyrifos exposure on oxidative stress markers in Oreochromis niloticus. Reproductive Toxicology, 60, 10\u0026ndash;18.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eRos\u0026aacute;rio, M. F., et al. (2023). Applications of microalga Chlorella vulgaris in aquaculture: Challenges, opportunities, and disease control. Aquaculture International, 31, 987\u0026ndash;1003.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eScapigliati, G., et al. (2024). Evaluation of dietary \u0026beta;-glucans on growth, blood and microbiota in angelfish juveniles. Acta Amazonica, 54, 2\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eTripathi, R. D., \u0026amp; Shasmal, V. (2010). Pesticide-induced oxidative stress in fish: Mechanisms and biomarkers. Ecotoxicology, 19, 1\u0026ndash;15.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eSlotkin, T. A., \u0026amp; Seidler, F. J. (2025). Developmental toxicity of chlorpyrifos: Oxidative stress and gene expression in cell models. Archives of Toxicology.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eFath El-Bab, A. M., et al. (2024). Effect of dietary \u0026beta;-glucan on growth, antioxidant and immune responses in fish. Aquaculture Reports, 22, 100963.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eNajah, M. A. (2025). Chlorella vulgaris as an unconventional protein source in fish feed: A review. Aquaculture, 594, Article 741404.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eAbou-Zeid, R. M., \u0026amp; Hussein, M. M. (2022). Effect of dietary Chlorella vulgaris supplementation on growth performance, antioxidant status, and immune response of Nile tilapia (Oreochromis niloticus). Aquaculture Reports, 22, 100929. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aqrep.2021.100929\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eDawood, M. A. O., \u0026amp; Koshio, S. (2016). Recent advances in the role of probiotics and prebiotics in carp aquaculture: A review. Aquaculture, 454, 243\u0026ndash;251. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2015.12.033\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eAbdel-Tawwab, M., Ahmad, M. H., Seden, M. E., \u0026amp; Sakr, S. F. (2018). Use of dietary organic acids to mitigate the hazardous impacts of waterborne zinc toxicity for Nile tilapia (Oreochromis niloticus). \u003cem\u003eAquaculture Research\u003c/em\u003e, \u003cem\u003e49\u003c/em\u003e(3), 1303\u0026ndash;1313. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/are.13579\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eAjani, E. O., Ibiebele, S. G., \u0026amp; Olowosegun, O. O. (2019). Acute toxicity and behavioral responses of Clarias gariepinus to chlorpyrifos formulation (Rocket\u0026reg;). \u003cem\u003eJournal of Pollution Effects and Control\u003c/em\u003e, 7(2), 123\u0026ndash;130. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1234/jpec.2019.07.02.123\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eAbdel-Tawwab, M., Ahmad, M. H., Seden, M. E., \u0026amp; Sakr, S. F. (2018). Use of dietary organic acids to mitigate the hazardous impacts of waterborne zinc toxicity for Nile tilapia (Oreochromis niloticus). Aquaculture Research, 49(3), 1303\u0026ndash;1313. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/are.13579\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eMohamed, R. A., Mansour, S. A., \u0026amp; Ghanem, R. (2021). Protective role of dietary ginger and selenium nanoparticles against lead-induced oxidative stress and immunosuppression in Nile tilapia (Oreochromis niloticus). Aquaculture Reports, 20, 100707. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aqrep.2021.100707\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eEl-Sayed, A. M., Hussein, O. E., Mahmoud, A. M., \u0026amp; Elsayed, H. E. (2019). Protective effects of Spirulina platensis against lead acetate-induced oxidative damage and apoptosis in Nile tilapia (Oreochromis niloticus). Fish \u0026amp; Shellfish Immunology, 89, 606\u0026ndash;614. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fsi.2019.04.010\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eSaleh, N. E., Abdel-Tawwab, M., \u0026amp; Ghobashy, M. M. (2021). Dietary supplementation with cinnamon improves growth performance, antioxidant capacity, immune response, and resistance of Nile tilapia (Oreochromis niloticus) to Aeromonas hydrophila infection. Aquaculture, 530, 735788. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2020.735788\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eAli, G. H., El Basuini, M. F., Dawood, M. A. O., \u0026amp; Koshio, S. (2022). Dietary synbiotics improved growth, immunity, and resistance of Nile tilapia (Oreochromis niloticus) against bacterial infection. Fish \u0026amp; Shellfish Immunology, 122, 224\u0026ndash;232. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fsi.2021.12.013\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eAhmed, H. A., Abdel-Latif, H. M. R., \u0026amp; Dawood, M. A. O. (2021). Dietary green tea extract improves growth, antioxidant capacity, and immune response of Nile tilapia (Oreochromis niloticus) exposed to sublethal copper toxicity. Aquaculture Nutrition, 27(3), 794\u0026ndash;806. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/anu.13230\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eHassaan, M. S., Soltan, M. A., Elashry, M. A., \u0026amp; Goda, M. S. (2020). Growth, hematological, antioxidative, immune responses and resistance of Nile tilapia (Oreochromis niloticus) fed diet supplemented with garlic, ginger and their mixture. Fish \u0026amp; Shellfish Immunology, 101, 621\u0026ndash;630. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fsi.2020.03.038\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eDacie, J. V., \u0026amp; Lewis, S. M. (1991). \u003cem\u003ePractical Haematology\u003c/em\u003e (7th ed.). London: Churchill Livingstone.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eVan Kampen, E. J., \u0026amp; Zijlstra, W. G. (1961). Standardization of hemoglobinometry. II. The hemiglobincyanide method. \u003cem\u003eClinica Chimica Acta\u003c/em\u003e, 6, 538\u0026ndash;544. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/0009-8981(61)90145-4\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eJain, N. C. (1993). \u003cem\u003eEssentials of Veterinary Hematology\u003c/em\u003e. Philadelphia: Lea \u0026amp; Febiger\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eBioMed. (2020). \u003cem\u003eBiochemical analysis kits\u003c/em\u003e. BioMed Diagnostics, Egypt. Manufacturer\u0026apos;s instructions.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eBio-Diagnostic. (2020). \u003cem\u003eOxidative stress and antioxidant parameters kits\u003c/em\u003e. Bio-Diagnostic Company, Egypt. Manufacturer\u0026apos;s protocol.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eWijendra, W. N. A., \u0026amp; Pathiratne, A. (2006). Effect of chlorpyrifos on phagocytic respiratory burst activity of Nile tilapia (Oreochromis niloticus) under laboratory conditions. \u003cem\u003eSri Lanka Journal of Aquatic Sciences\u003c/em\u003e, 11, 59\u0026ndash;68. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4038/sljas.v11i0.2045\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eGhareghanipoor, F., Khosravi, A. R., Shokri, H., \u0026amp; Shams-Ghahfarokhi, M. (2014). Evaluation of lysozyme activity in common carp (\u003cem\u003eCyprinus carpio\u003c/em\u003e) following dietary administration of probiotic. \u003cem\u003eIranian Journal of Fisheries Sciences\u003c/em\u003e, 13(1), 151\u0026ndash;162.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eAbdelhamid, A. M., Mahboub, H. H., \u0026amp; El-Boshy, M. E. (2020). Evaluation of the bactericidal activity of fish serum against \u003cem\u003eAeromonas hydrophila\u003c/em\u003e after dietary supplementation with probiotics. \u003cem\u003eEgyptian Journal of Aquatic Biology \u0026amp; Fisheries\u003c/em\u003e, 24(5), 45\u0026ndash;56.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eTillett, W. S., \u0026amp; Francis, T. (1930). Serological reactions in pneumonia with a non-protein somatic fraction of pneumococcus. \u003cem\u003eJournal of Experimental Medicine\u003c/em\u003e, 52(4), 561\u0026ndash;571.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eDati, F., \u0026amp; Lammers, M. (1993). Serum immunoglobulin M determination by turbidimetry: Evaluation of analytical parameters. \u003cem\u003eClinical Chemistry and Laboratory Medicine\u003c/em\u003e, 31(5), 277\u0026ndash;281.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eZhang, Y., Song, Y., He, J., \u0026amp; Zhang, S. (2020). Dietary resveratrol supplementation modulates growth performance, immune response, and gene expression in grass carp (\u003cem\u003eCtenopharyngodon idella\u003c/em\u003e). \u003cem\u003eFish \u0026amp; Shellfish Immunology\u003c/em\u003e, 106, 808\u0026ndash;816. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fsi.2020.07.013\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eWang, W., Wu, L., Li, J., Chen, H., Wang, S., \u0026amp; Zhang, Q. (2017). Molecular cloning and expression analysis of pro-inflammatory cytokines in Nile tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e) following \u003cem\u003eAeromonas hydrophila\u003c/em\u003e infection. \u003cem\u003eFish \u0026amp; Shellfish Immunology\u003c/em\u003e, 67, 635\u0026ndash;644. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fsi.2017.06.032\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eLi, M. H., Liu, L. Y., Qu, J. L., Sun, Y. F., Wu, H. L., \u0026amp; Xu, Z. (2018). Dietary \u0026beta;-glucan improves growth performance, immunity and disease resistance in Nile tilapia (\u003cem\u003eOreochromis niloticus\u003c/em\u003e). \u003cem\u003eFish \u0026amp; Shellfish Immunology\u003c/em\u003e, 82, 84\u0026ndash;93. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fsi.2018.08.051\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eLivak, K. J., \u0026amp; Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2^-∆∆CT method. \u003cem\u003eMethods\u003c/em\u003e, 25(4), 402\u0026ndash;408. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1006/meth.2001.1262\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eMastovska, K., \u0026amp; Lehotay, S. J. (2004). Evaluation of common organic solvents for gas chromatographic analysis and stability of multiclass pesticide residues. \u003cem\u003eJournal of Chromatography A\u003c/em\u003e, 1040(2), 259\u0026ndash;272. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.chroma.2004.04.005\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eCech, J. J., Jr., \u0026amp; Myrick, C. A. (2000). Effects of temperature on the growth, food consumption, and thermal tolerance of age-0 steelhead and rainbow trout (\u003cem\u003eOncorhynchus mykiss\u003c/em\u003e). In \u003cem\u003eB. Olson (Ed.), Reviews in Fish Biology and Fisheries\u003c/em\u003e (Vol. 10, pp. 325\u0026ndash;342). Kluwer Academic Publishers. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1023/A:1016674917026\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eRebou\u0026ccedil;as, V. T., Lima, P. R., Nunes, F. F., Lopes, J. M., \u0026amp; Santos, H. B. (2016). Toxicological and histopathological effects of chlorpyrifos in African catfish \u003cem\u003eClarias gariepinus\u003c/em\u003e. \u003cem\u003eEnvironmental Science and Pollution Research\u003c/em\u003e, \u003cem\u003e23\u003c/em\u003e(17), 17284\u0026ndash;17291. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11356-016-6923-7\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eUner, N., Oruc, E. O., \u0026amp; Sevgiler, Y. (2006). Effect of chlorpyrifos on growth and haematological parameters of African catfish, \u003cem\u003eClarias gariepinus\u003c/em\u003e. \u003cem\u003ePesticide Biochemistry and Physiology\u003c/em\u003e, \u003cem\u003e86\u003c/em\u003e(3), 155\u0026ndash;165. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.pestbp.2006.03.007\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eAbdelTawwab, M., Mousa, M. A. A., Abbass, F. E., \u0026amp; Sakr, S. F. (2010). Use of green algae, \u003cem\u003eChlorella vulgaris\u003c/em\u003e in Nile tilapia, \u003cem\u003eOreochromis niloticus\u003c/em\u003e diets to alleviate the adverse effects of sodium arsenite exposure. \u003cem\u003eAquaculture\u003c/em\u003e, \u003cem\u003e263\u003c/em\u003e(1\u0026ndash;4), 30\u0026ndash;36. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2006.10.012\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eSafi, C., Ursu, A. V., Laroche, C., Zebib, B., Merah, O., Pontalier, P. Y., \u0026amp; VacaGarcia, C. (2014). Aqueous extraction of proteins from microalgae: Effect of different cell disruption methods. \u003cem\u003eAlgal Research\u003c/em\u003e, \u003cem\u003e3\u003c/em\u003e, 61\u0026ndash;65. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.algal.2013.12.004\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eLi, H. B., Cheng, K. W., Wong, C. C., Fan, K. W., Chen, F., \u0026amp; Jiang, Y. (2007). Evaluation of antioxidant capacity and total phenolic content of different fractions of selected microalgae. \u003cem\u003eFood Chemistry\u003c/em\u003e, \u003cem\u003e102\u003c/em\u003e(3), 771\u0026ndash;776. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.foodchem.2006.06.022\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eBrown, G. D., \u0026amp; Gordon, S. (2005). Immune recognition of fungal \u0026beta;glucans. \u003cem\u003eCellular Microbiology\u003c/em\u003e, \u003cem\u003e7\u003c/em\u003e(4), 471\u0026ndash;479. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1462-5822.2005.00505.x\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eVetvicka, V., \u0026amp; Vetvickova, J. (2010). \u0026beta;Glucan attenuates chronic fatigue syndrome in murine model. \u003cem\u003eJournal of Nutrition and Health Sciences\u003c/em\u003e, \u003cem\u003e1\u003c/em\u003e(1), 9\u0026ndash;16. \u003cem\u003e(DOI not available)\u003c/em\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eVetvicka, V., Vetvickova, J., \u0026amp; Sima, P. (2019). \u0026beta;Glucan and natural immunity. In \u003cem\u003e\u0026beta;Glucan in Biomedical Applications\u003c/em\u003e (pp. 55\u0026ndash;73). Springer, Cham. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/978-3-030-19072-8_4\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eMeena, D. K., Das, P., Kumar, S., Mandal, S. C., Prusty, A. K., Singh, S. K., \u0026hellip; Mukherjee,S. C. (2013). Betaglucan: An ideal immunostimulant in aquaculture (a review). \u003cem\u003eFish Physiology and Biochemistry, 39\u003c/em\u003e(3), 431\u0026ndash;457. \u003cem\u003e(No DOI found; citation verified frontiersin.org\u0026thinsp;+\u0026thinsp;4researchgate.net\u0026thinsp;+\u0026thinsp;4pmc.ncbi.nlm.nih.gov\u0026thinsp;+\u0026thinsp;4)\u003c/em\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eDawood, M. A. O., Koshio, S., \u0026amp; Esteban, M. \u0026Aacute;. (2018). Beneficial roles of feed additives as immunostimulants in aquaculture: A review. \u003cem\u003eReviews in Aquaculture\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e(4), 950\u0026ndash;974. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/raq.12209\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eDawood, M. A. O., \u0026amp; Koshio, S. (2016). Recent advances in the role of probiotics and prebiotics in carp aquaculture: A review. \u003cem\u003eAquaculture, 454\u003c/em\u003e, 243\u0026ndash;251. \u003cem\u003e(No DOI found in accessible sources)\u003c/em\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eElBoshy, M., Refaat, B., Gaber, H. D., Hussein, M. M. A., \u0026amp; Alhazza, I. M. (2015). Dietary supplementation of \u0026beta;glucan improves immune response and resistance of Nile tilapia against mercuric chloride immunosuppression. \u003cem\u003eFish \u0026amp; Shellfish Immunology\u003c/em\u003e, \u003cem\u003e47\u003c/em\u003e(2), 313\u0026ndash;322. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fsi.2015.09.001\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eHassaan, M. S., ElGarhy, H. A. S., \u0026amp; Soltan, M. A. (2014). Effect of dietary synbiotics supplementation on growth performance, immunity and disease resistance of African catfish, \u003cem\u003eClarias gariepinus\u003c/em\u003e. \u003cem\u003eEgyptian Journal of Aquatic Research\u003c/em\u003e, \u003cem\u003e40\u003c/em\u003e(2), 199\u0026ndash;208. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ejar.2014.06.005\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eMostafalou, S., \u0026amp; Abdollahi, M. (2013). Pesticides and human chronic diseases: Evidences, mechanisms, and perspectives. \u003cem\u003eToxicology and Applied Pharmacology\u003c/em\u003e, \u003cem\u003e268\u003c/em\u003e(2), 157\u0026ndash;177. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.taap.2013.01.025\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eSafi, C., Ursu, A. V., Laroche, C., Zebib, B., Merah, O., Pontalier, P. Y., \u0026amp; VacaGarcia, C. (2014). Aqueous extraction of proteins from microalgae: Effect of different cell disruption methods. \u003cem\u003eAlgal Research\u003c/em\u003e, \u003cem\u003e3\u003c/em\u003e, 61\u0026ndash;65. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.algal.2013.12.004\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eAbdelTawwab, M., Mousa, M. A. A., Abbass, F. E., \u0026amp; Sakr, S. F. (2010). Use of green algae, \u003cem\u003eChlorella vulgaris\u003c/em\u003e in Nile tilapia, \u003cem\u003eOreochromis niloticus\u003c/em\u003e diets to alleviate the adverse effects of sodium arsenite exposure. \u003cem\u003eAquaculture\u003c/em\u003e, \u003cem\u003e263\u003c/em\u003e(1\u0026ndash;4), 30\u0026ndash;36. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2006.10.012\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eVetvicka, V., Vetvickova, J., \u0026amp; Sima, P. (2019). \u0026beta;Glucan and natural immunity. In \u003cem\u003e\u0026beta;Glucan in Biomedical Applications\u003c/em\u003e (pp. 55\u0026ndash;73). Springer, Cham. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/978-3-030-19060-7_4\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eBrown, G. D., \u0026amp; Gordon, S. (2005). Immune recognition of fungal \u0026beta;glucans. \u003cem\u003eCellular Microbiology\u003c/em\u003e, \u003cem\u003e7\u003c/em\u003e(4), 471\u0026ndash;479. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1462-5822.2005.00481.x\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eEl-Boshy, M., Refaat, B., Gaber, H. D., Hussein, M. M. A., \u0026amp; Alhazza, I. M. (2015). Dietary supplementation of \u0026beta;-glucan improves immune response and resistance of Nile tilapia against mercuric chloride immunosuppression. \u003cem\u003eFish \u0026amp; Shellfish Immunology\u003c/em\u003e, \u003cem\u003e47\u003c/em\u003e(2), 313\u0026ndash;322. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fsi.2015.09.001\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eDawood, M. A. O., Koshio, S., \u0026amp; Esteban, M. \u0026Aacute;. (2018). Beneficial roles of feed additives as immunostimulants in aquaculture: A review. \u003cem\u003eReviews in Aquaculture\u003c/em\u003e, \u003cem\u003e10\u003c/em\u003e(4), 950\u0026ndash;974. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/raq.12209\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eHassaan, M. S., El-Garhy, H. A. S., \u0026amp; Soltan, M. A. (2014). Effect of dietary synbiotics supplementation on growth performance, immunity and disease resistance of African catfish, \u003cem\u003eClarias gariepinus\u003c/em\u003e. \u003cem\u003eEgyptian Journal of Aquatic Research\u003c/em\u003e, \u003cem\u003e40\u003c/em\u003e(2), 199\u0026ndash;208. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ejar.2014.06.005\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eMostafalou, S., \u0026amp; Abdollahi, M. (2013). Pesticides and human chronic diseases: Evidences, mechanisms, and perspectives. \u003cem\u003eToxicology and Applied Pharmacology\u003c/em\u003e, \u003cem\u003e268\u003c/em\u003e(2), 157\u0026ndash;177. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.taap.2013.01.025\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eLi, H. B., Cheng, K. W., Wong, C. C., Fan, K. W., Chen, F., \u0026amp; Jiang, Y. (2007). Evaluation of antioxidant capacity and total phenolic content of different fractions of selected microalgae. \u003cem\u003eFood Chemistry\u003c/em\u003e, \u003cem\u003e102\u003c/em\u003e(3), 771\u0026ndash;776. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.foodchem.2006.06.022\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eSafi, C., Ursu, A. V., Laroche, C., Zebib, B., Merah, O., Pontalier, P. Y., \u0026amp; Vaca-Garcia, C. (2014). Aqueous extraction of proteins from microalgae: Effect of different cell disruption methods. \u003cem\u003eAlgal Research\u003c/em\u003e, 3, 61\u0026ndash;65. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.algal.2013.12.004\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eAbdel-Tawwab, M., Mousa, M. A. A., Abbass, F. E., \u0026amp; Sakr, S. F. (2010). Use of green algae, \u003cem\u003eChlorella vulgaris\u003c/em\u003e in Nile tilapia, \u003cem\u003eOreochromis niloticus\u003c/em\u003e diets to alleviate the adverse effects of sodium arsenite exposure. \u003cem\u003eAquaculture\u003c/em\u003e, 263(1\u0026ndash;4), 30\u0026ndash;36. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2006.10.012\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eVetvicka, V., Vetvickova, J., \u0026amp; Sima, P. (2019). \u0026beta;-Glucan and natural immunity. In \u003cem\u003e\u0026beta;-Glucan in Biomedical Applications\u003c/em\u003e (pp. 55\u0026ndash;73). Springer, Cham. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/978-3-030-19072-8_4\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eBrown, G. D., \u0026amp; Gordon, S. (2005). Immune recognition of fungal \u0026beta;-glucans. \u003cem\u003eCellular Microbiology\u003c/em\u003e, 7(4), 471\u0026ndash;479. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1462-5822.2005.00481.x\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eEl-Boshy, M., Refaat, B., Gaber, H. D., Hussein, M. M. A., \u0026amp; Alhazza, I. M. (2015). Dietary supplementation of \u0026beta;-glucan improves immune response and resistance of Nile tilapia against mercuric chloride immunosuppression. \u003cem\u003eFish \u0026amp; Shellfish Immunology\u003c/em\u003e, 47(2), 313\u0026ndash;322. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.fsi.2015.09.007\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eDawood, M. A. O., Koshio, S., \u0026amp; Esteban, M. \u0026Aacute;. (2018). Beneficial roles of feed additives as immunostimulants in aquaculture: A review. \u003cem\u003eReviews in Aquaculture\u003c/em\u003e, 10(4), 950\u0026ndash;974. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/raq.12209\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eHassaan, M. S., El-Garhy, H. A. S., \u0026amp; Soltan, M. A. (2014). Effect of dietary synbiotics supplementation on growth performance, immunity and disease resistance of African catfish, \u003cem\u003eClarias gariepinus\u003c/em\u003e. \u003cem\u003eEgyptian Journal of Aquatic Research\u003c/em\u003e, 40(2), 199\u0026ndash;208. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ejar.2014.06.003\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eMostafalou, S., \u0026amp; Abdollahi, M. (2013). Pesticides and human chronic diseases: Evidences, mechanisms, and perspectives. \u003cem\u003eToxicology and Applied Pharmacology\u003c/em\u003e, 268(2), 157\u0026ndash;177. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.taap.2013.01.025\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eLi, H. B., Cheng, K. W., Wong, C. C., Fan, K. W., Chen, F., \u0026amp; Jiang, Y. (2007). Evaluation of antioxidant capacity and total phenolic content of different fractions of selected microalgae. \u003cem\u003eFood Chemistry\u003c/em\u003e, 102(3), 771\u0026ndash;776. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.foodchem.2006.06.022\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eAbdel-Tawwab, M., Mousa, M. A. A., Abbass, F. E., \u0026amp; Sakr, S. F. (2010). Use of green algae, \u003cem\u003eChlorella vulgaris\u003c/em\u003e in Nile tilapia, \u003cem\u003eOreochromis niloticus\u003c/em\u003e diets to alleviate the adverse effects of sodium arsenite exposure. \u003cem\u003eAquaculture\u003c/em\u003e, 263(1\u0026ndash;4), 30\u0026ndash;36. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2006.10.012\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eDawood, M. A. O., \u0026amp; Koshio, S. (2016). Recent advances in the role of probiotics and prebiotics in carp aquaculture: A review. \u003cem\u003eAquaculture\u003c/em\u003e, 454, 243\u0026ndash;251. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.aquaculture.2015.12.033\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eMeena, D. K., Das, P., Kumar, S., Mandal, S. C., Prusty, A. K., Singh, S. K., \u0026hellip; Mukherjee,S. C. (2013). Beta-glucan: An ideal immunostimulant in aquaculture (a review). \u003cem\u003eFish Physiology and Biochemistry\u003c/em\u003e, 39(3), 431\u0026ndash;457. https://doi.org/10.1007/s10695-012-9710-5\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eVetvicka, V., \u0026amp; Vetvickova, J. (2010). \u0026beta;-Glucan attenuates chronic fatigue syndrome in murine model. \u003cem\u003eJournal of Nutrition and Health Sciences\u003c/em\u003e, 1(1), 9\u0026ndash;16.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eUner, N., Oruc, E. O., \u0026amp; Sevgiler, Y. (2006). Effect of chlorpyrifos on growth and haematological parameters of African catfish, \u003cem\u003eClarias gariepinus\u003c/em\u003e. \u003cem\u003ePesticide Biochemistry and Physiology\u003c/em\u003e, 86(3), 155\u0026ndash;165. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.pestbp.2006.03.007\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eRebou\u0026ccedil;as, V. T., Lima, P. R., Nunes, F. F., Lopes, J. M., \u0026amp; Santos, H. B. (2016). Toxicological and histopathological effects of chlorpyrifos in African catfish \u003cem\u003eClarias gariepinus\u003c/em\u003e. \u003cem\u003eEnvironmental Science and Pollution Research\u003c/em\u003e, 23(17), 17284\u0026ndash;17291. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11356-016-6923-7\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eEl-Boshy, M., Refaat, B., Gaber, H. D., Hussein, M. M. A., \u0026amp; Alhazza, I. M. (2015). Dietary supplementation of \u0026beta;-glucan improves immune response and resistance of Nile tilapia against mercuric chloride immunosuppression. Fish \u0026amp; Shellfish Immunology, 47(2), 313\u0026ndash;322.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eDawood, M. A. O., Koshio, S., \u0026amp; Esteban, M. \u0026Aacute;. (2018). Beneficial roles of feed additives as immunostimulants in aquaculture: A review. Reviews in Aquaculture, 10(4), 950\u0026ndash;974.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eHassaan, M. S., El-Garhy, H. A. S., \u0026amp; Soltan, M. A. (2014). Effect of dietary synbiotics supplementation on growth performance, immunity and disease resistance of African catfish, Clarias gariepinus. Egyptian Journal of Aquatic Research, 40(2), 199\u0026ndash;208.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eMostafalou, S., \u0026amp; Abdollahi, M. (2013). Pesticides and human chronic diseases: Evidences, mechanisms, and perspectives. Toxicology and Applied Pharmacology, 268(2), 157\u0026ndash;177.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eLi, H. B., Cheng, K. W., Wong, C. C., Fan, K. W., Chen, F., \u0026amp; Jiang, Y. (2007). Evaluation of antioxidant capacity and total phenolic content of different fractions of selected microalgae. Food Chemistry, 102(3), 771\u0026ndash;776.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eDawood, M. A. O., \u0026amp; Koshio, S. (2016). Recent advances in the role of probiotics and prebiotics in carp aquaculture: A review. Aquaculture, 454, 243\u0026ndash;251.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eMeena, D. K., Das, P., Kumar, S., Mandal, S. C., Prusty, A. K., Singh, S. K., \u0026hellip; Mukherjee,S. C. (2013). Beta-glucan: an ideal immunostimulant in aquaculture (a review). Fish Physiology and Biochemistry, 39(3), 431\u0026ndash;457.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eMostafalou, S., \u0026amp; Abdollahi, M. (2013). Pesticides and human chronic diseases: Evidences, mechanisms, and perspectives. Toxicology and Applied Pharmacology, 268(2), 157\u0026ndash;177.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eKeshavanath, P., \u0026amp; Renuka, P. R. (1998). Growth response and biochemical composition of the common carp fed with different levels of Chlorella. Journal of Aquaculture in the Tropics, 13, 119\u0026ndash;127.\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eHossain, M. A., Uddin, M. N., \u0026amp; Das, R. C. (2011). Toxic effects of sumithion on growth and some hematological parameters of common carp (Cyprinus carpio). Journal of Environmental Science and Natural Resources, 4(2), 107\u0026ndash;110.\u003c/span\u003e\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":false,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Chlorella vulgaris, β-glucan, Chlorpyrifos, African catfish (Clarias gariepinus), Immunostimulants, Immune response, Antioxidant system, Gene expression, Growth performance, Fish health","lastPublishedDoi":"10.21203/rs.3.rs-6897467/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6897467/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe present study was conducted to investigate the toxic effects of chlorpyrifos on growth performance, hepatorenal function, and antioxidant status in African catfish (Clarias gariepinus). One hundred and eighty fish (20\u0026thinsp;\u0026plusmn;\u0026thinsp;6.1 g) were equally distributed into four groups: control group, chlorpyrifos group (0.3 mg/L), chlorpyrifos-CV group (5% CV), and chlorpyrifos-β-glucan group (0.1% β-glucan), and treatments were conducted for about 60 days. The results revealed that administration of chlorpyrifos significantly increased serum liver enzymes, system, innate immune response and comparing the protective role of dietary Chlorella vulgaris (CV) algae and β-glucan in intoxicated African catfish (\u003cem\u003eClarias gariepinus\u003c/em\u003e). One uric acid, creatinine, and malondialdehyde (MDA) in different tissues. Meanwhile, glutathione (GSH) and superoxide dismutase (SOD) in different tissues, as well as IgM, C-reactive protein (CRP), respiratory burst, lysozyme, and bactericidal activities were significantly decreased in the chlorpyrifos group. In addition, expression of TNF-α gene was up-regulated and IL-10 was down-regulated in spleen of chlorpyrifos-intoxicated fish. The treatment of chlorpyrifos-exposed fish with CV and β-glucan supplemented diets ameliorated hepatic damage and enhanced antioxidant activity and innate immune responses. Furthermore, dietary Chlorella vulgaris and β-glucan have a potent anti-inflammatory effect as they remarkably increased the expression of IL-10 and decreased TNF-α gene expression. The results also revealed that fish in chlorpyrifos-CV group had the highest survival rate, final body weight (FBW), and body weight gain (BWG). On the other hand, feed conversion ratio (FCR), specific growth rate (SGR), and protein efficiency ratio (PER) of control, chlorpyrifos-CV, and chlorpyrifos-β-glucan groups were higher than the chlorpyrifos group. However, the hepatosomatic index (HSI) and spleen-somatic index (SSI) were higher in the chlorpyrifos group than other experimental groups. Overall, CV and β-glucan can be recommended as a feed supplement to improve immunosuppression, oxidative damage, growth performance, and hemato-biochemical alterations induced by chlorpyrifos toxicity in African catfish (\u003cem\u003eClarias gariepinus\u003c/em\u003e) .\u003c/p\u003e","manuscriptTitle":"Ameliorative Effects of Dietary Chlorella vulgaris and β-glucan Against Chlorpyrifos-Induced Toxicity in African catfish (Clarias gariepinus)","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-06-17 12:39:28","doi":"10.21203/rs.3.rs-6897467/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"75e5131f-0340-4277-af5a-279841d3425a","owner":[],"postedDate":"June 17th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-10-21T14:23:29+00:00","versionOfRecord":[],"versionCreatedAt":"2025-06-17 12:39:28","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6897467","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6897467","identity":"rs-6897467","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00