LncIMF1 promotes adipogenesis of porcine intramuscular preadipocyte by sponging miR-187

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Intramuscular fat, which is closely related to the traits of tenderness, juiciness, and flavor of pork, was regulated by numerous molecular regulatory mechanisms that have been regarded as an important agricultural research area. Long noncoding RNAs (lncRNAs) are emerging regulators involved in adipogenesis due to their functional diversity. In this study, we identified a novel lncRNA related to porcine adipogenesis, named lncIMF1, based on previous RNA sequencing results. Our results suggested that lncIMF1 was most abundantly expressed in adipose tissue and located in both the cytoplasm and nucleus. Besides, lncIMF1 promoted the proliferation and differentiation, while inhibited apoptosis of intramuscular preadipocytes. Moreover, lncIMF1 could act as a molecular sponge for miR-187, inhibiting the binding of miR-187 and SMAD1, thereby promoting the expression of SMAD1 and enhancing the adipogenic differentiation of intramuscular preadipocytes. Additionally, we found that lncIMF1-miR187-SMAD1 axis could activate the p38-MAPK pathway. Taken together, our study provided new insights into the role of lncRNAs in the regulation of pork quality.
Full text 139,672 characters · extracted from preprint-html · click to expand
LncIMF1 promotes adipogenesis of porcine intramuscular preadipocyte by sponging miR-187 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article LncIMF1 promotes adipogenesis of porcine intramuscular preadipocyte by sponging miR-187 Ming Feng, Xudong Yi, Ziyi Zhang, Jiahua Zhu, He Yu, Lianxi Ming, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4629942/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 17 Feb, 2025 Read the published version in Biochemical Genetics → Version 1 posted 23 You are reading this latest preprint version Abstract Intramuscular fat, which is closely related to the traits of tenderness, juiciness, and flavor of pork, was regulated by numerous molecular regulatory mechanisms that have been regarded as an important agricultural research area. Long noncoding RNAs (lncRNAs) are emerging regulators involved in adipogenesis due to their functional diversity. In this study, we identified a novel lncRNA related to porcine adipogenesis, named lncIMF1, based on previous RNA sequencing results. Our results suggested that lncIMF1 was most abundantly expressed in adipose tissue and located in both the cytoplasm and nucleus. Besides, lncIMF1 promoted the proliferation and differentiation, while inhibited apoptosis of intramuscular preadipocytes. Moreover, lncIMF1 could act as a molecular sponge for miR-187, inhibiting the binding of miR-187 and SMAD1 , thereby promoting the expression of SMAD1 and enhancing the adipogenic differentiation of intramuscular preadipocytes. Additionally, we found that lncIMF1-miR187-SMAD1 axis could activate the p38-MAPK pathway. Taken together, our study provided new insights into the role of lncRNAs in the regulation of pork quality. Pig LncIMF1 miR-187 Intramuscular fat Adipogenesis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Adipose tissue is indispensable for animals, owing to its diverse functions (Zhu et al. 2019 ). Within the various adipose tissue depots, intramuscular fat, a specialized form located between the skeletal myofibers, holds particular significance for meat quality, such as juiciness, tenderness, and flavor of pork (Wood et al. 2008 ). The content of intramuscular fat is subject to several factors (Park et al. 2018 ), including the differentiation level of preadipocytes into mature adipocytes and the size of lipid droplets within adipocytes. In recent years, numerous studies have been conducted on the molecular mechanisms that regulate intramuscular fat deposition (Cesar et al. 2015 ; Zhou et al. 2021 ). However, given the intricate nature of adipogenesis, further exploration into more granular mechanisms is imperative. Long non-coding RNAs (lncRNAs), defined as transcripts of more than 200 nucleotides without the ability to encode proteins (Zhou et al. 2021 ), have been reported playing an important role in regulating cell proliferation, differentiation, apoptosis, and cellular metabolism by participating in multiple signaling pathways (Statello et al. 2021 ; Zuo et al. 2022 ). lncRNAs can regulate the function of DNAs, RNAs, and proteins, especially microRNAs (miRNAs), through multiple pathways. It has been demonstrated that lncRNAs could bind to miRNA recognition elements to regulate protein translation (Bartel 2009 ), while lncRNAs can also bind to mRNAs because of their structural similarity to mRNAs (Dykes and Emanueli 2017). Currently, most studies have focused on the theory that lncRNAs act as molecular sponges for miRNAs. More specifically, lncRNAs could directly target miRNAs and inhibit their binding to target genes, resulting in expression changes of those genes. Some researchers defined this regulation mode as lncRNA/miRNA/mRNA axis (Song et al. 2019 ; Xu et al. 2017 ). With the application of bioinformatics to lncRNA research, an increasing number of lncRNAs with regulatory adipogenic functions have been identified, such as lncIMF2 (Yi et al. 2023 ), lncPRDM16(Chen et al. 2022 ), IRlnc (Wang et al. 2021 ), lncAD (Zhang et al. 2020 ), etc. Despite these findings, the regulatory mechanisms of lncRNAs in adipogenesis are far from understood. In our previous study (Sun et al. 2018 ), we isolated intramuscular preadipocytes from the longissimus dorsi muscle of both Bamei and Large White piglets, respectively, and conducted RNA-sequencing during intramuscular preadipocyte differentiation. Herein, we focus on a novel lncRNA, lncIMF1, based on the variations in its expression during adipogenic differentiation. Overexpression and knockdown of lncIMF1 were performed in isolated intramuscular preadipocytes, revealing that lncIMF1 significantly promoted cell proliferation and differentiation. Additionally, we discovered that lncIMF1 could act as a molecular sponge for miR-187 to relieve the inhibition of SMAD1 gene by miR-187, thus facilitating its regulatory effect on adipogenesis. Taken together, this research contributes valuable insights to the exploration of lncRNA-mediated regulation in enhancing pork muscle quality. Materials and methods Animals and animal care The Bamei piglets (three-days-old) were purchased from a Bamei original breeding field in Huzhu, Gansu, and the Large White piglets (three-days-old) were purchased from the Experimental Farm of Northwest A&F University. To investigate the expression of lncIMF1, heart, liver, spleen, lung, kidney, subcutaneous fat, and muscle tissues were collected. All samples for expression analysis were promptly frozen in liquid nitrogen at -196℃ after sampling and stored until RNA extraction. All animal tissue samples used in our study were approved by the Animal Care and Use Committee of Northwest A&F University (Approval No. 201705A299). RNA Sequencing and data analysis Total RNA was extracted from cell samples of longissimus dorsi muscle using TRIzol reagent (Invitrogen, USA) following the manufacturer’s instructions. The quantity and quality of RNA were detected by NanoDrop 2000 instrument (Thermo Scientific, Waltham, MA, USA). Subsequently, RNA-sequencing libraries were constructed using an Illumina TruSeq Kit (encompassing mRNA purification, fragmentation, cDNA synthesis, end repair, A-tailing, adapter ligation, and PCR enrichment) according to the instructions. Libraries were sequenced on an Illumina HiSeq 2000 platform. After quality control of the raw reads, clean reads were obtained, and only these were used for subsequent analysis. Heatmap was created with pheatmap R package. Cell culture Intramuscular preadipocytes were extracted from the longissimus dorsi muscle. Initially, a 0.2% solution of collagenase I (Gibco, Carlsbad, CA, United States) was used to digest the samples in a water bath shaker for 2 h at 37℃. Subsequently, the debris was filtered out to isolate the cells using 70 and 200 mesh filters sequentially. The samples were then rinsed twice with DMEM/F12 (Procell, Wuhan, China), and subsequently seeded in DMEM/F12 (Procell, Wuhan, China) medium that contained 10% fetal bovine serum (Gibco, Carlsbad, CA, United States). The preadipocyte cultures were maintained at 37℃ under a 5% CO 2 atmosphere in humidified air. Following this, the medium of the intramuscular preadipocytes was sequentially changed to differentiation medium which containing 0.5 mM IBMX (Solarbio, Beijing, China), 1 µM DEX (Solarbio, Beijing, China), 5 µg/ml insulin (Solarbio, Beijing, China) to induce differentiation. Finally, the medium was replaced every two days. Cell transfection To conduct research on proliferation, cells were transfected with 50 nM siRNA or negative control (NC) using X-tremeGENE siRNA Transfection Reagent (Roche, San Francisco, United States) and Opti-MEM (Gibco, Grand Island, United States) when the cell density was at 40%. After 24 h of transfection, the cells were harvested. For differentiation, siRNA or NC was transfected when the cell density reached 80%, followed by differentiation. When the cells reached fusion, the medium was replaced with growth medium. The siRNA and NC were obtained from RiboBio (Guangzhou, China). Cell counting kit assays (CCK-8) Cell count kit 8 (CCK-8) assays were performed according to the previous method (Zhao et al. 2022 ). Briefly, preadipocytes were seeded in 96-well plates at a density of 2.5×10 3 cells per well and then transfected with siRNA, overexpression plasmid, or negative control. Proliferation rates were assessed 24 h post-treatment using the CCK-8 (Beyotime, Shanghai, China), following the manufacturer's instructions. EdU assays The EdU assays followed a previously published method (Qimuge et al. 2019 ). Briefly, cells were incubated with EdU for 2 h after transfection with siRNA, overexpression plasmid, or negative control. Preadipocytes were stained with Apollo reaction solution after they were fixed with 4% paraformaldehyde. Nuclei were subsequently counterstained with Hoechst for 15 minutes. Finally, sample images were captured using a Nikon TE2000 microscope (Nikon, Tokyo, Japan), and data analysis was performed using Image J. Cytoplasmic and nuclear RNA extraction Cytoplasmic and nuclear RNA extractions were performed based on a previous article (Xiong et al. 2018 ). Briefly, intramuscular adipocytes were collected and washed with PBS after a 6-day differentiation period. They were then suspended in lysis buffer (10 mM NaCl, 2 mM MgCl2, 10 mM pH 7.8 Tris-HCL, 5 mM DTT, and 0.5% Igepal CA 630) and incubated on ice for 5 minutes. After centrifugation at 8000 rpm for 5 minutes, the supernatant was transferred to a fresh microcentrifuge tube for cytoplasmic RNA extraction. Concurrently, the pellet was resuspended in lysis buffer and subjected to nuclear RNA extraction. In the RNA extraction process, the fractions were initially incubated with Proteinase K (10 mg/mL) at 37℃ for 20 minutes, followed by mixing with TRIzol (Takara, Otsu, Japan). The RNA was then separated using chloroform and precipitated with ethanol in conjunction with 3 M sodium acetate (pH 5.2, 1/10 volume). The extracted RNA was subsequently dissolved in ddH2O and utilized for reverse transcription and real-time PCR analysis. RNA extraction and Real-Time PCR Total RNA was extracted using TRIzol reagent (Takara, Otsu, Japan) following the manufacturer's instructions. The RNA was then reverse transcribed into cDNA for quantitative PCR analysis. Quantitative RT-PCR was performed using Bio-Rad iQTM5 (Bio-Rad, Hercules, CA, United States), and the expression levels of the target genes and lncIMF1 were normalized to the expression of β-tubulin. The primers used in the quantitative Real-Time PCR are listed in Table 1 . Table 1 Primers used for real-time quantitative PCR in this study. Gene Primer sequence (5’ to 3’) Primer length (nt) PPARγ F: AGGACTACCAAAGTGCCATCAAA R: GAGGCTTTATCCCCACAGACAC 23 22 FABP4 F: GAGCACCATAACCTTAGATGGA R: AAATTCTGGTAGCCGTGACA 22 20 C/EBPα F: CGATGCTCTTAGCTGAGTGT R: GGTCCAAGAATTTCACCTCT 20 20 C/EBPβ F: CACCACGACTTCCTCTCCGA R: ATCCACGGTCTTCTTGGTCTTA 20 22 ATGL F: TCACCAACACCAGCATCCA R: GCACATCTCTCGAAGCACCA 19 20 HSL F: CACTGACTGCTGACCCCAAG R: TCCTCACTGTCCTGTCCTTCAC 20 22 SCD F: GGAGAGAGGAAGGGAAAACAGAG R: AGACCGACCAATAAACTGCAAAG 23 23 Cyclin B F: AATCCCTTCTTGTGGTTA R: CTTAGATGTGGCATACTTG 18 19 Cyclin D F: TACACCGACAACTCCATCCG R: GAGGGCGGGTTGGAAATGAA 20 20 Cyclin E F: CAGAGCAGCGAGCAGGAGC 19 R: GCAAGCTGCTTCCACACCACAT 22 FAS F: CCCCGAATCTGCACTACCAC 20 R: AGTTGGGCTGAAGGATGACG 20 P21 F: ACGTCTCAGGAGGACCATGT R: AGAAGATCAGCCGGCGTTTG 20 20 GAPDH F: AGGTCGGAGTGAACGGATTTG R: ACCATGTAGTGGAGGTCAATGAAG 21 24 Caspase-3 F: TCTAACTGGCAAACCCAAACTT 22 R: CCAGGAATAGTAACCAGGTGCT 22 BCL2 F: ATGTGTGTGGAGAGCGTCAAC 21 R: AGAGACAGCCAGGAGAAATCAA 22 SMAD1 F: CCTGGACAGCCGAGTAACTG 20 R: ACTCACAGCATTCCAGAGGC 20 miR-187 F: TCGTGGGGTCGTGTCTTGTGTTGC 24 R: GCAGGGTCCGAGGTATTC 18 LncIMF1 F: GCAGCCGTGAGGTAAAACAC 20 R: CTGTTCCAGGCAAACCAAGC 20 BAX F: GGCCTCCTCTCCTACTTTGG 20 R: CTCAGCCCATCTTCTTCCAG 20 Protein extraction and Western Blotting Firstly, tissues and cells were lysed using a RIPA lysis buffer (Appligen, China), supplemented with a protease inhibitor cocktail (Cwbiotech, China). Subsequently, the total protein sample was isolated from the SDS-polyacrylamide gel and transferred onto a PVDF membrane (Millipore, Bedford, MA, United States). After blocking with 5% nonfat milk, the membrane was incubated with primary antibodies overnight at 4℃. Secondary antibodies were then added and incubated at room temperature for 1.5 h. Finally, the bands were visualized using a chemiluminescent peroxidase substrate. The associated proteins were detected using the Gel Doc XR System (Bio-Rad, Hercules, CA, United States). Information regarding the primary and secondary antibodies is provided in Table 2 and Table 3 . Table 2 Primary antibodies used in this study. Antibody Host dilution source PPARγ Rabbit 1:1 000 Abcam FABP4 Mouse 1:500 Santa Cruz C/EBPβ Rabbit 1:500 Santa Cruz ATGL Rabbit 1:500 Santa Cruz PCNA Rabbit 1:500 Santa Cruz HSL Rabbit 1:500 Santa Cruz Cyclin B Rabbit 1:500 Abways Cyclin D Rabbit 1:500 Santa Cruz Cyclin E Rabbit 1:500 Santa Cruz P21 Rabbit 1:500 CST p38-MAPK Rabbit 1:1 000 CST Caspase-3 Mouse 1:500 Santa Cruz BAX Rabbit 1:100 Santa Cruz BCL2 Rabbit 1:200 Santa Cruz β-tubulin Mouse 1:2 000 Santa Cruz Table 3 Secondary antibodies used in this study. Antibody dilution source Anti-rabbit-HRP 1:2 000 Santa Cruz Anti-mouse-HRP 1:2 000 Santa Cruz Flow Cytometry Intramuscular preadipocytes were initially seeded in 6-well plates at a density of 4 × 10 5 cells per well. After a 24-h incubation, the cells underwent transfection with either NC or pcDNA3.1-lncIMF1. Subsequently, the cells were washed three times with PBS, fixed with 70% alcohol, and left overnight at -20℃. The cells were then treated with 1 mg/mL RNase at 37℃ for 40 minutes, followed by staining with 50 mg/mL propidium iodide (PI) at 4℃ for 1 h. Finally, the samples were analyzed using FACS Calibur flow cytometry (Franklin Lakes, NJ, United States). Oil Red O Staining Initially, cells were incubated with 0.5% Oil Red O for 30 minutes, followed by fixation with a 4% paraformaldehyde solution for 30 minutes. The cells were then washed three times with PBS and visualized with a phase-contrast microscope (assisted by IS-Elements software, Nikon ECLIPSE, Tokyo, Japan). Subsequently, 100% isopropanol was used to extract Oil Red O, and the relative concentration was determined by measuring the absorbance at 510 nm. Luciferase reporter assays The luciferase reporter assays were performed in accordance with previous research (Qin et al. 2019 ). In brief, the wild-type (WT) and mutant‐type 3′‐UTR of SMAD1 were amplified from 293T cells complementary DNA and then cloned into the psiCHECK2‐reporter vector (GENERALBIOL, Anhui, China). For luciferase reporter analysis, miR‐187 mimics and negative or NC were co-transfected with the WT or mutant‐type 3′‐UTRs into 293T cells, respectively. Luciferase reporter assays were performed to measure the relative luciferase activity after transfection for 48 h. Bioinformatics analysis The lncIMF1 sequences were analyzed in Coding Potential Calculator (CPC) ( http://cpc2.cbi.pku.edu.cn/ ) and Coding-Potential Assessment Tool (CPAT) ( http://lilab.research.bcm.edu/ ). Gene Ontology (GO) terms and Kyoto Encyclopedia of Genes and Genomes (KEGG) terms were analyzed by KEGG Orthology Based Annotation System (KOBAS) ( http://kobas.cbi.pku.edu.cn/kobas3/ ). LncIMF1 binding sites for adipogenesis-related miRNAs were predicted by RegRNA 2.0 ( http://regrna2.mbc.nctu.edu.tw/ ). The target gene of mi-R217 was predicted using miRbase ( http://www.mirbase.org ) and TargetscanHuman 7.2( http://www.targetscan.org/vert_72/ ). Statistical Analysis The diagrams were created by GraphPad Prism 8.5.0. Student’s t-test and one-way ANOVA were used to analyze group differences using SPSS Statistical software (Version 22.0; SPSS, Chicago, IL, United States)(*, p <0.05, **, p <0.01). The experimental data were obtained from three independent experiments and all results were presented as means ± SD. Results lncIMF1 is a novel lncRNA involved in the proliferation and differentiation of porcine intramuscular preadipocytes The previous RNA-sequencing results (Sun et al. 2018 ) showed that the expression of Lnc_000037 in Bamei pig was significantly different during differentiation (Fig. 1A). Therefore, Lnc_000037 was researched in this experiment and named lncIMF1. The Coding Potential Calculator (CPC) and Coding-Potential Assessment Tool (CPAT) results showed that lncIMF1 lacks the capacity to code proteins (Fig. 1B and 1C). Furthermore, GO terms and the KEGG pathway analysis results indicated that lncIMF1 may participate in various biological processes, such as cell proliferation, differentiation, and apoptosis, and it has a close association with lipid metabolism pathways and adipocytokine (Fig. 1D and 1E). In addition, it was noticed that the highest abundance of lncIMF1 was expressed in adipose tissues (Fig. 1F). Analysis revealed that lncIMF1 is present in both the nucleus and cytoplasm of cells. Specifically, cytoplasmic expression accounted for approximately 70% of total expression, while nuclear expression constituted the remaining 30% (Fig. 1G). LncIMF1 expression showed a tendency to increase gradually during the proliferation (Fig. 1H) and differentiation stage (Fig. 1I) of intramuscular preadipocytes, which conform to sequencing results. Taken together, it is hypothesized that lncIMF1 is implicated in the proliferation and differentiation of preadipocytes, and further research is being carried out following these pathways. LncIMF1 promotes porcine intramuscular preadipocytes proliferation Based on the results of the previous KEGG enrichment analysis, the function of lncIMF1 in the proliferation of intramuscular preadipocytes was investigated. Firstly, lncIMF1 siRNA was transfected into intramuscular preadipocytes and the knockdown efficiency met the requirements for subsequent experiments (Fig. 2A). The EdU assays results showed that the percentage of EdU positive adipocytes was reduced after the knockdown of lncIMF1 (Fig. 2B), which was consistent with the results of CCK-8 (Fig. 2C). Furthermore, the results of the cell cycle assay also indicated that the knockdown of lncIMF1 inhibited the proliferation of intramuscular preadipocytes (Fig. 2D). Meanwhile, the expression of the cell cycle marker genes CyclinB, CyclinD, and CyclinE, PCNA was decreased after knockdown lncIMF1, while the expression of the negative regulator of cell proliferation, P21, was significantly increased (Fig. 2E, 2F). Simultaneously, the effect of lncIMF1 overexpression on the proliferation of intramuscular preadipocytes was examined. The overexpression efficiency of lncIMF1 meets the requirements of the subsequent experiments (Fig. 2G). The results of EdU and CCK-8 assays showed that the percentage of preadipocytes increased with overexpression of lncIMF1 (Fig. 2H, 2I). And the results of the cell cycle assay also indicated that overexpression of lncIMF1 promote the proliferation of intramuscular preadipocytes (Fig. 2J). Meanwhile, the expression of CyclinB, CyclinD, CyclinE and the pro-proliferative gene PCNA all increased after overexpression of lncIMF1, while the expression of P21 decreased (Fig. 2K, 2L). These results collectively suggested that lncIMF1 promotes the proliferation of intramuscular preadipocytes. LncIMF1 promotes porcine intramuscular preadipocytes differentiation The role of lncIMF1 in the differentiation of porcine intramuscular preadipocytes was also investigated. Firstly, lncIMF1 siRNA was transfected into intramuscular preadipocytes to knockdown lncIMF1 (Fig. 3A). BODIPY and Oil Red O staining results showed that knockdown of lncIMF1 suppressed the differentiation ability(Fig. 3B, 3C). Meanwhile, the expression of key genes for differentiation were significantly decreased after transfection with siRNA, while the expression of lipolysis-related genes was increased (Fig. 3D, 3E). Subsequently, pcDNA3.1-lncIMF1was transfected into intramuscular preadipocytes to overexpress lncIMF1 (Fig. 3G). BODIPY and Oil Red O staining results showed that overexpression of lncIMF1 promoted the differentiation of intramuscular preadipocytes (Fig. 3F, 3H). Meanwhile, overexpression of lncIMF1 significantly increased the expression of key genes for differentiation and decreased the expression of lipolysis-related genes (Fig. 3I, 3J). These results suggested that lncIMF1 promoted the differentiation of intramuscular preadipocytes. LncIMF1 inhibits apoptosis of porcine intramuscular adipocytes The effect of lncIMF1 in apoptosis was examined due to its correlation with apoptosis observed in previous pathway enrichment results. LncIMF1 was overexpressed in the late stage of differentiation stage using pcDNA3.1-lncIMF1 transfection. Flow cytometry analysis revealed a significant increase in the proportion of viable adipocytes, alongside a corresponding decrease in apoptotic cells, indicating enhanced cell survival (Fig. 4A, 4B). Meanwhile, the expression of pro-apoptotic genes Caspase-3, BAX and p53 was decreased, while the expression of anti-apoptotic gene BCL - 2 was increased, which was consistent with the Western blot results (Fig. 4C, 4D). LncIMF1 sponges miR-187 to promote intramuscular preadipocyte adipogenic differentiation The subcellular localization results led us to hypothesize that lncIMF1 may serve as a molecular sponge for microRNAs, specifically miR-187, regulating adipogenic differentiation. Firstly, the result of online software RNA g2.0 showed that lncIMF1 has a binding site with miR-187. Accordingly, a dual-luciferase reporter vector was constructed to verify the binding ability (Fig. 5A) and the results demonstrated their interaction (Fig. 5B). Meanwhile, the expression level of miR-187 during differentiation of intramuscular preadipocytes was decreased (Fig. 5C), which was opposite to the trend of increased expression of lncIMF1 during differentiation. Following this, we overexpressed miR-187 in intramuscular preadipocytes (Fig. 5D). By the sixth day of differentiation, Bright field microscopy analysis indicated that miR-187 overexpression significantly inhibited adipogenic differentiation (Fig. 5E). RT-qPCR and Western blot results showed that overexpression of miR-187 promoted the expression of lipolytic genes and proteins, and inhibited the expression of key adipogenic genes and proteins (Fig. 5F, 5G). The miR-187 inhibitor was also transfected into intramuscular preadipocytes (Fig. 5I). The Bright field microscopy results on the 6th day of differentiation showed that the adipogenic ability of intramuscular preadipocytes was enhanced after inhibiting miR-187 (Fig. 5H). RT-qPCR and Western blot results also showed that the expression of key adipogenic genes and proteins significantly increased after inhibiting miR-187, while the expression of lipolytic genes showed a downward trend (Fig. 5J, 5K). These results demonstrated that miR-187 could inhibit the adipogenic differentiation of intramuscular preadipocytes. Subsequently, we separately transfected the lncIMF1 overexpression vector alone and the lncIMF1 overexpression vector with miR-187 mimics together into intramuscular preadipocytes. Oil red O staining results demonstrated that overexpression of lncIMF1 significantly promoted adipogenic differentiation. Conversely, overexpression of miR-187 inhibited the adipogenic promoting effect of lncIMF1 (Fig. 5l), which was consistent with the BODIPY staining results (Fig. 5M, 5N). Additionally, RT-qPCR analysis corroborated these findings, showing similar trends (Fig. 5O). MiR-187 targets SMAD1 to regulate adipogenic differentiation of porcine intramuscular preadipocytes SMAD1 was identified as the target gene of miR-187 through online software prediction. To confirm their binding, dual-luciferase reporter vector was constructed (Fig. 6A) and co-transfected with miR-187 mimics into 293T cells. After 24 h of incubation, the assay results confirmed that SMAD1 could bind to miR-187 (Fig. 6B). Furthermore, the expression of SMAD1 was significantly reduced when miR-187 mimics were transfected into intramuscular preadipocytes (Fig. 5C), indicating that miR-187 can bind to SMAD1. Accordingly, miR-187 mimics and the SMAD1 overexpression vector were co-transfected into cells to investigate whether miR-187 is involved in the adipogenic differentiation of intramuscular preadipocytes through SMAD1 . The Oil Red O staining results showed that miR-187 transfection alone reduced adipogenic differentiation of porcine intramuscular preadipocytes, while miR-187 mimics and SMAD1 overexpression vector were co-transfected, the adipogenic differentiation capacity was significantly restored. (Fig. 6D). The RT-qPCR assay revealed that transfection of miR-187 mimics alone suppressed the expression of PPARγ and FABP4 and increased the expression of the ATGL. However, this effect was reversed by transfection of miR-187 mimics and overexpression of SMAD1 (Fig. 6E). In addition, a recovery assay was designed in which lncIMF1 siRNA was co-transfected with the SMAD1 overexpression vector. As expected, RT-qPCR results showed that the expression levels of PPARγ and FABP4 decreased while ATGL increased when cells were transfected with lncIMF1 siRNA alone. Conversely, PPARγ and FABP4 levels increased while ATGL decreased when lncIMF1 siRNA was co-transfected with the SMAD1 overexpression vector (Fig. 6F). And the Oil red O staining results showed the same results, the adipogenic differentiation ability of intramuscular preadipocytes was inhibited by transfecting lncIMF1 siRNA into 293T cells alone while the adipogenic differentiation ability was restored when siRNA was transfected with concomitant overexpression of SMAD1 (Fig. 6G). Having established that lncIMF1 facilitates intramuscular preadipocyte differentiation by acting as a miR-187 sponge, thereby mitigating its inhibitory effect on SMAD1, the downstream pathway of SMAD1 was further explored. Based on the results of previous pathway enrichment (Fig. 1D, 1E) and the pathways involved with SMAD1 , the p38-MAPK pathway was considered to participate in SMAD1 downstream. Western blot results demonstrated that overexpression of lncIMF1 promotes the expression of the p38-MAPK pathway, which is inhibited after overexpressing miR-187 (Fig. 6H). Discussion Intramuscular fat content is closely related to pork quality traits, and the intramuscular fat deposition is regulated by a variety of factors, including genetics, environment, nutrition, and epigenetics. The regulatory role of lncRNAs is an important part of epigenetics, and several lncRNAs have been shown to be linked to intramuscular fat accumulation in poultry and livestock (Chen et al. 2018 ; Chen et al. 2019 ; Chen et al. 2022 ). In our previous study, we identified numerous lncRNAs associated with intramuscular fat deposition. For instance, lncIMF4 could inhibit lipolysis by attenuating autophagy and lncIMF2 could act as a molecular sponge that binds to miR-217 to regulate adipogenesis (Sun et al. 2020 ; Yi et al. 2023 ). Despite these discoveries, adipogenesis in porcine intramuscular fat is an extremely complex process, regulated by a multitude of lncRNAs and genes. Further research is needed to fully elucidate the mechanisms involved. This study centers on the newly identified lncRNA, lncIMF1, unveiling its pivotal roles and mechanisms in adipogenesis, explored its functions and specific mechanisms. We noticed that lncIMF1 promotes proliferation and differentiation while inhibiting apoptosis. This is consistent with previous studies, which have shown lncRNAs to have multiple functions (Zhang et al. 2022 ). As more functions are identified, lncRNAs have become a new target for elucidating the molecular mechanisms of economically important traits in livestock. LncRNAs can be transcribed from either the sense or antisense strand of DNA and located in either the nucleus or cytoplasm, where they play important biological roles. The regulatory mechanisms of lncRNAs are complex, involving post-transcriptional regulation of target genes, transcriptional regulation, and modification of RNA-binding proteins (Liu et al. 2021 ; Oo et al. 2022 ). These mechanisms likely depend on the subcellular localization of lncRNAs (Bridges et al. 2021 ). Based on our experiments, it appeared that lncIMF1 was primarily located in the cytoplasm. Therefore, we used bioinformatics tools to analyze the potential miRNA targets of lncIMF1 and confirmed that it directly adsorbs miR-187 using the dual-luciferase reporting system, indicating that lncIMF1 can act as a 'sponge' for miR-187. MiRNAs are highly conserved, endogenous, non-coding short RNAs of approximately 19–25 nucleotides in length. Their function is to inhibit gene expression by binding to complementary sites in the 3' untranslated region (3'UTR) of target genes, thereby inhibiting protein translation or inducing degradation of the target mRNA (Papaconstantinou et al. 2012 ). Several miRNAs have been identified in the field of adipogenesis, including oar-miR-432 (Fei et al. 2023 ), miR-376a (Chen et al. 2020 ), and miR-378 (Liu et al. 2021 ). In our study, we found that miR-187 could bind to lncIMF1, therefore, we initially conducted independent investigations into the functions of miR-187 and found that miR-187 could inhibited differentiation of intramuscular preadipocytes. Subsequently, we devised co-transfection experiments to elucidate the functional relationship between lncIMF1 and miRNA. Currently, miR-187 is mainly studied in the context of tumors and cancer, where it is considered as an important miRNA related to the proliferation and apoptosis of tumor cells (Chen et al. 2022 ; Lou et al. 2016 ; Peng et al. 2020 ). Collectively, this is the first study to identify miR-187 as a potential miRNA that can negatively regulate adipogenesis of intramuscular preadipocytes. Given the classical functions of miRNA in binding to target mRNA, we further examined the target genes of miR-187 using online software prediction and dual-luciferase reporting system, which found that SMAD1 is the target gene. The SMAD1 protein has been reported to be a transcriptional modulator of multiple pathways (Liao et al. 2024 ; Murugaiyan et al. 2023 ). Analysis of the human transcriptome revealed high expression of SMAD1 in adipose tissue Fagerberg et al. 2014 ). Furthermore, activation of SMAD1 induced the expression of PPARγ and upregulated its transcriptional activity by activating p38 kinase, which in turn induced the differentiation of undifferentiated mesenchymal stromal cells into adipocytes (Hata et al. 2003 ). Although no studies have been conducted on the effect of SMAD1 on intramuscular fat deposition, the transcriptome sequencing of the longissimus dorsi muscle of Iberian pigs, known for their high intramuscular fat and high-quality pork, revealed high expression of SMAD1 (Muñoz et al. 2018 ). However, research into the impact of SMAD1 on intramuscular fat deposition remains unexplored. Based on the above researches, it is hypothesized that there may be a correlation between SMAD1 and intramuscular fat deposition in pigs. Our analysis highlights the enrichment of the MAPK signaling pathway, known for its role in adipogenesis (Bost et al. 2005). Additionally, SMAD1 has been identified as a regulator within this pathway (Aubin et al. 2004 ). Our findings confirm the involvement of lncIMF1-miR-187 in regulating intramuscular adipocytes differentiation in pigs through the MAPK pathway. In summary, we identified a novel long non-coding RNA, named lncIMF1, which plays a crucial role in the adipogenesis process. The expression of lncIMF1 increases progressively during the proliferation and differentiation of intramuscular adipocytes, predominantly in the cytoplasm. Specifically, lncIMF1 promotes the proliferation and differentiation of intramuscular preadipocytes while inhibiting apoptosis, ultimately leading to lipid accumulation. Furthermore, lncIMF1 regulates SMAD1 expression by sponging miR-187 and activates the p38-MAPK pathway. These findings provide new insights into the biological functions of lncRNA in porcine adipogenesis and present a potential target for enhancing pork quality. Declarations Funding This work was funded by the National Natural Science Foundation of China (32272847), the China Agriculture Research System (CARS-PIG) and the Key Research and Development Program of Shaanxi Province (2022ZDLNY01-04). Competing interests: The authors declare that they have no conflict of interest associated with the work described in this manuscript. Author contributions M.F. and X. D. wrote the main manuscript text and analyzed the data, Z. Y. reviewed the manuscript and revised a lot, J. H. and H. Y. prepared the figures, L. X. revised the document format, W. J. supervised the process. All authors reviewed the manuscript and approve its submission in the current form. References Aubin J, Davy A, Soriano P (2004) In vivo convergence of BMP and MAPK signaling pathways: impact of differential Smad1 phosphorylation on development and homeostasis. Genes Dev 18:1482-1494. http://www.genesdev.org/cgi/doi/10.1101/gad.1202604 Bartel DP (2009) MicroRNAs: target recognition and regulatory functions. Cell 136:215-233. http://doi.org/10.1016/j.cell.2009.01.002 Bridges MC, Daulagala AC, Kourtidis A (2021) LNCcation: lncRNA localization and function. The Journal of Cell Biology 220(2). http://doi.org/10.1083/jcb.202009045 Cesar ASM, Regitano LCA, Koltes JE, Fritz-Waters ER, Lanna DPD, Gasparin G, Mourão GB, Oliveira PSN, Reecy JM, Coutinho LL (2015) Putative regulatory factors associated with intramuscular fat content. Plos One 10(6): e0128350. http://doi.org/10.1371/journal.pone.0128350 Chen C, Cui Q, Zhang X, Luo X, Liu Y, Zuo J, Peng Y (2018) Long non-coding RNAs regulation in adipogenesis and lipid metabolism: Emerging insights in obesity. Cell Signal 51:47-58. http://doi.org/10.1016/j.cellsig.2018.07.012 Chen K, Xie S, Jin W (2019) Crucial lncRNAs associated with adipocyte differentiation from human adipose-derived stem cells based on co-expression and ceRNA network analyses. Peerj 7:e7544. http://doi.org/10.7717/peerj.7544 Chen X, Raza SHA, Cheng G, Ma X, Wang J, Zan L (2020) Bta-miR-376a Targeting KLF15 Interferes with Adipogenesis Signaling Pathway to Promote Differentiation of Qinchuan Beef Cattle Preadipocytes. Animals: An Open Access Journal From MDPI 10(12). http://doi.org/10.3390/ ani10122362 Chen X, Song QL, Ji R, Wang JY, Li ZH, Guo D, Yin TL, Wang SJ, Yang J (2022) MiR-187 regulates the proliferation, migration and invasion of human trophoblast cells by repressing BCL6-mediated activation of PI3K/AKT signaling. Placenta 118:20-31. http://doi.org/10.1016/j.placenta.2022.01. 001 Chen Y, Zhao S, Ding R, Li H, Yang C, Du Z (2022) Identification of a Long Noncoding RNA (lncPRDM16) Inhibiting Preadipocyte Proliferation in the Chicken. J Agr Food Chem 70(4):1335-1345. http://doi.org/10.1021/acs.jafc.1c05554 Dykes IM, Emanueli C (2017) Transcriptional and Post-transcriptional Gene Regulation by Long Non-coding RNA. Genomics, Proteomics & Bioinformatics 15(3):177-186. http://doi.org/10.1016/j.gpb. 2016. 12.005 Fagerberg L, Hallström BM, Oksvold P et al (2014) Analysis of the human tissue-specific expression by genome-wide integration of transcriptomics and antibody-based proteomics. Molecular & Cellular Proteomics : MCP 13:397-406. http://doi.org/10.1074/mcp.M113.035600 Fei X, Jin M, Yuan Z, Li T, Lu Z, Wang H, Lu J, Quan K, Yang J, He M, Wang T, Wang Y, Wei C (2023) MiRNA-Seq reveals key MicroRNAs involved in fat metabolism of sheep liver. Front Genet 14:985764. http://doi.org/10.3389/fgene.2023.985764 Hata K, Nishimura R, Ikeda F et al (2003) Differential roles of Smad1 and p38 kinase in regulation of peroxisome proliferator-activating receptor gamma during bone morphogenetic protein 2-induced adipogenesis. Mol Biol Cell 14:545-555. https://doi.org/10.1091/mbc.e02-06-0356 Liao Z, Tang S, Nozawa K, Shimada K, Ikawa M, Monsivais D, Matzuk M (2024) Affinity-tagged SMAD1 and SMAD5 mouse lines reveal transcriptional reprogramming mechanisms during early pregnancy. Elife 12. https://doi.org/10.7554/eLife.91434 Liu Y, Ding W, Yu W, Zhang Y, Ao X, Wang J (2021) Long non-coding RNAs: Biogenesis, functions, and clinical significance in gastric cancer. Molecular Therapy Oncolytics 23:458-476. https:// doi.org/ 10.1016/j.omto.2021.11.005 Lou Y, Liu L, Zhan L, Wang X, Fan H (2016) miR-187-5p Regulates Cell Growth and Apoptosis in Acute Lymphoblastic Leukemia via DKK2. Oncol Res 24(2):89-97. https://doi.org/10.3727/096504016 X14597766487753 Muñoz M, García-Casco JM, Caraballo C, Fernández-Barroso MÁ, Sánchez-Esquiliche F, Gómez F, Rodríguez MDC, Silió L (2018) Identification of Candidate Genes and Regulatory Factors Underlying Intramuscular Fat Content Through Longissimus Dorsi Transcriptome Analyses in Heavy Iberian Pigs. Front Genet 9:608. https://doi.org/10.3389/fgene.2018.00608 Murugaiyan K, Amirthalingam S, Hwang NS, Jayakumar R (2023) Role of FGF-18 in Bone Regeneration. J Funct Biomater 14(1). https://doi.org/10.3390/jfb14010036 Oo JA, Brandes RP, Leisegang MS (2022) Long non-coding RNAs: novel regulators of cellular physiology and function. Pflugers Archiv: European Journal of Physiology 474(2):191-204. https://doi.org/10.1007/s00424-021-02641-z Papaconstantinou I, Karakatsanis A, Gazouli M, Polymeneas G, Voros D (2012) The role of microRNAs in liver cancer. Eur J Gastroen Hepat 24(3):223-228. https://doi.org/10.1097/MEG.0b013e328 3505063 Park SJ, Beak S, Jung DJS, Kim SY, Jeong IH, Piao MY, Kang HJ, Fassah DM, Na SW, Yoo SP, Baik M (2018) Genetic, management, and nutritional factors affecting intramuscular fat deposition in beef cattle - A review. Asian Austral J Anim 31(7):1043-1061. https://doi.org/10.5713/ajas.18.0310 Peng W, Sha H, Sun X, Zou R, Zhu Y, Zhou G, Feng J (2020) Role and mechanism of miR-187 in human cancer. Am J Transl Res 12(9):4873-4884 Qimuge N, He Z, Qin J, Sun Y, Wang X, Yu T, Dong W, Yang G, Pang W (2019) Overexpression of DNMT3A promotes proliferation and inhibits differentiation of porcine intramuscular preadipocytes by methylating p21 and PPARg promoters. Gene 696:54-62. https://doi.org/10.1016/ j.gene.2019.02.029 Qin J, Sun Y, Liu S, Zhao R, Zhang Q, Pang W (2019) MicroRNA-323-3p promotes myogenesis by targeting Smad2. J Cell Biochem 120(11):18751-18761. https://doi.org/10.1002/jcb.29187 Song E, Xing L, Wang L, Song W, Li D, Wang Y, Gu Y, Liu M, Ni W, Zhang P, Ma X, Zhang X, Yao J, Chen Y, An R (2019) LncRNA ADAMTS9-AS2 inhibits cell proliferation and decreases chemoresistance in clear cell renal cell carcinoma via the miR-27a-3p/FOXO1 axis. Aging 11(15):5705-5725. https://doi.org/10.18632/aging.102154 Statello L, Guo C, Chen L, Huarte M (2021) Gene regulation by long non-coding RNAs and its biological functions. Nature Reviews. Molecular Cell Biology 22(2):96-118. https://doi.org/10.1038/s41580-020-00315-9 Sun Y, Cai R, Wang Y, Zhao R, Qin J, Pang W (2020) A Newly Identified LncRNA LncIMF4 Controls Adipogenesis of Porcine Intramuscular Preadipocyte through Attenuating Autophagy to Inhibit Lipolysis. Animals : An Open Access Journal From MDPI 10(6). https://doi.org/10.3390/ ani10060926 Sun Y, Chen X, Qin J, Liu S, Zhao R, Yu T, Chu G, Yang G, Pang W (2018) Comparative Analysis of Long Noncoding RNAs Expressed during Intramuscular Adipocytes Adipogenesis in Fat-Type and Lean-Type Pigs. J Agr Food Chem 66(45):12122-12130. https://doi.org/10.1021/acs.jafc.8b04243 Wang L, Zhou Z, Zhang T, Zhang L, Hou X, Yan H, Wang L (2021) IRLnc: a novel functional noncoding RNA contributes to intramuscular fat deposition. Bmc Genomics 22(1):95. https://doi.org/10.1186/ s12864-020-07349-5 Wood JD, Enser M, Fisher AV, Nute GR, Sheard PR, Richardson RI, Hughes SI, Whittington FM (2008) Fat deposition, fatty acid composition and meat quality: A review. Meat Sci 78(4):343-358. https://doi.org/10.1016/j.meatsci.2007.07.019 Xiong Y, Yue F, Jia Z, Gao Y, Jin W, Hu K, Zhang Y, Zhu D, Yang G, Kuang S (2018) A novel brown adipocyte-enriched long non-coding RNA that is required for brown adipocyte differentiation and sufficient to drive thermogenic gene program in white adipocytes. Biochimica Et Biophysica Acta. Molecular and Cell Biology of Lipids 1863(4):409-419. https://doi.org/10.1016/j.bbalip. 2018.01.008 Xu Z, Yang F, Wei D, Liu B, Chen C, Bao Y, Wu Z, Wu D, Tan H, Li J, Wang J, Liu J, Sun S, Qu L, Wang L (2017) Long noncoding RNA-SRLR elicits intrinsic sorafenib resistance via evoking IL-6/STAT3 axis in renal cell carcinoma. Oncogene 36(14):1965-1977. https://doi.org/10.1038/onc.2016.356 Yi X, He Z, Tian T, Kou Z, Pang W (2023) LncIMF2 promotes adipogenesis in porcine intramuscular preadipocyte through sponging MiR-217. Anim Biotechnol 34(2):268-279. https://doi.org/10.1080/ 10495398.2021.1956509 Zhang M, Ma X, Zhai Y, Zhang D, Sui L, Li W, Jiang R, Han R, Li G, Li Z, Wang Y, Tian Y, Kang X, Sun G (2020) Comprehensive Transcriptome Analysis of lncRNAs Reveals the Role of lncAD in Chicken Intramuscular and Abdominal Adipogenesis. J Agr Food Chem 68(11):3678-3688. https://doi.org/10.1021/acs.jafc.9b07405 Zhang P, Wu S, He Y, Li X, Zhu Y, Lin X, Chen L, Zhao Y, Niu L, Zhang S, Li X, Zhu L, Shen L (2022) LncRNA-Mediated Adipogenesis in Different Adipocytes. International Journal of Molecular Sciences 23(13). https://doi.org/10.3390/ijms23137488 Zhao T, Zhao R, Yi X, Cai R, Pang W (2022) METTL3 promotes proliferation and myogenic differentiation through m6A RNA methylation/YTHDF1/2 signaling axis in myoblasts. Life Sci 298:120496. https://doi.org/10.1016/j.lfs.2022.120496 Zhou J, Zhang Y, Wu J, Qiao M, Xu Z, Peng X, Mei S (2021) Proteomic and lipidomic analyses reveal saturated fatty acids, phosphatidylinositol, phosphatidylserine, and associated proteins contributing to intramuscular fat deposition. J Proteomics 241:104235. https://doi.org/10.1016/j.jprot.2021. 104235 Zhou Z, Qi D, Gan Q, Wang F, Qin B, Li J, Wang H, Wang D (2021) Studies on the Regulatory Roles and Related Mechanisms of lncRNAs in the Nervous System. Oxid Med Cell Longev 2021:6657944. https://doi.org/10.1155/2021/6657944 Zhu W, Zhang M, Chang L, Zhu W, Li C, Xie F, Zhang H, Zhao T, Jiang J (2019) Characterizing the composition, metabolism and physiological functions of the fatty liver in Rana omeimontis tadpoles. Front Zool 16:42. https://doi.org/10.1186/s12983-019-0341-x Zuo Y, Zhang Y, Zhang R, Tian J, Lv X, Li R, Li S, Cheng M, Shan J, Zhao Z, Xin H (2022) Ferroptosis in Cancer Progression: Role of Noncoding RNAs. Int J Biol Sci 18(5):1829-1843. https://doi.org/10.7150/ijbs.66917 Additional Declarations No competing interests reported. Supplementary Files Graphicalabtract.tif Cite Share Download PDF Status: Published Journal Publication published 17 Feb, 2025 Read the published version in Biochemical Genetics → Version 1 posted Editorial decision: Revision requested 03 Nov, 2024 Reviews received at journal 03 Nov, 2024 Reviews received at journal 02 Nov, 2024 Reviews received at journal 01 Nov, 2024 Reviews received at journal 31 Oct, 2024 Reviews received at journal 30 Oct, 2024 Reviewers agreed at journal 26 Oct, 2024 Reviewers agreed at journal 25 Oct, 2024 Reviewers agreed at journal 24 Oct, 2024 Reviewers agreed at journal 24 Oct, 2024 Reviewers agreed at journal 24 Oct, 2024 Reviews received at journal 23 Oct, 2024 Reviewers agreed at journal 23 Oct, 2024 Reviewers agreed at journal 23 Oct, 2024 Reviewers agreed at journal 23 Oct, 2024 Reviewers agreed at journal 23 Oct, 2024 Reviewers agreed at journal 23 Oct, 2024 Reviewers agreed at journal 22 Oct, 2024 Reviewers agreed at journal 22 Oct, 2024 Reviewers invited by journal 17 Jul, 2024 Editor assigned by journal 25 Jun, 2024 Submission checks completed at journal 25 Jun, 2024 First submitted to journal 24 Jun, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4629942","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":326729853,"identity":"d084563b-c3b8-4516-a37f-8b2620fee631","order_by":0,"name":"Ming Feng","email":"","orcid":"","institution":"Northwest A\u0026F University","correspondingAuthor":false,"prefix":"","firstName":"Ming","middleName":"","lastName":"Feng","suffix":""},{"id":326729854,"identity":"b75d7866-fcdb-42c7-a0c5-8cc9e3901b40","order_by":1,"name":"Xudong Yi","email":"","orcid":"","institution":"Northwest A\u0026F University","correspondingAuthor":false,"prefix":"","firstName":"Xudong","middleName":"","lastName":"Yi","suffix":""},{"id":326729855,"identity":"48fb1e39-4922-49a3-871c-fbe90707fc9c","order_by":2,"name":"Ziyi Zhang","email":"","orcid":"","institution":"Northwest A\u0026F University","correspondingAuthor":false,"prefix":"","firstName":"Ziyi","middleName":"","lastName":"Zhang","suffix":""},{"id":326729856,"identity":"b23ae20c-3805-45e9-af2e-38ee349187a2","order_by":3,"name":"Jiahua Zhu","email":"","orcid":"","institution":"Northwest A\u0026F University","correspondingAuthor":false,"prefix":"","firstName":"Jiahua","middleName":"","lastName":"Zhu","suffix":""},{"id":326729857,"identity":"3408e87b-75ce-429e-9175-9eec2831cb77","order_by":4,"name":"He Yu","email":"","orcid":"","institution":"Northwest A\u0026F University","correspondingAuthor":false,"prefix":"","firstName":"He","middleName":"","lastName":"Yu","suffix":""},{"id":326729858,"identity":"cb0e41a9-9d4c-4c47-9deb-f744256ea25e","order_by":5,"name":"Lianxi Ming","email":"","orcid":"","institution":"Northwest A\u0026F University","correspondingAuthor":false,"prefix":"","firstName":"Lianxi","middleName":"","lastName":"Ming","suffix":""},{"id":326729860,"identity":"c688ddc6-b872-4241-9702-4779256cc3a0","order_by":6,"name":"Weijun Pang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA5klEQVRIiWNgGAWjYHCChAMfKmzkQKwPQMzYQISWxIMzzqQZg1TPIFYL82HetkOJDURrMZdIeHCAh+1A+naJ5IfNPAw2shsOMD97gE+L5YyEhAMSPHdyd85IMwRqSTPecIDN3ACfFoPbQC0GEs9yN9xOMH/Mw3A4cQPQUgmCWhIMDqcb3E7/CLTlP5FaDiQcTjC4nQNy2AHCWiznP0g42HAgzXDD/TeFjXMMko1nHmYzw6vFnOdM8ue//2zkDc4c39jwpsJOtu948zP8DmPgSUDhAuMJn3qwGvYDBJSMglEwCkbBiAcAyvdWKbNzwtoAAAAASUVORK5CYII=","orcid":"","institution":"Northwest A\u0026F University","correspondingAuthor":true,"prefix":"","firstName":"Weijun","middleName":"","lastName":"Pang","suffix":""}],"badges":[],"createdAt":"2024-06-24 11:47:20","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4629942/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4629942/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s10528-025-11061-y","type":"published","date":"2025-02-17T15:57:58+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":60496522,"identity":"f9b13934-4c71-4b72-bbe4-18f990ef0804","added_by":"auto","created_at":"2024-07-17 11:46:54","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":3454050,"visible":true,"origin":"","legend":"\u003cp\u003eLncIMF1 is a novel lncRNA involved in the proliferation and differentiation of porcine intramuscular preadipocytes. \u003cstrong\u003eA\u003c/strong\u003e Heatmap depicting LNC_000037 having apparently change in intramuscular adipocytes between Bamei pig (B) and Large White pig (L) at two differentiation stages, 0: day 0 of differentiation, 8: day 8 of differentiation, red fragment denotes lncIMF1. Coding potential predicted by CPC (\u003cstrong\u003eB\u003c/strong\u003e) and CPAT (\u003cstrong\u003eC\u003c/strong\u003e) of lncIMF1. \u003cstrong\u003eD\u003c/strong\u003e GO terms analysis of lncIMF1. \u003cstrong\u003eE\u003c/strong\u003e KEGG pathway analysis of lncIMF1. F lncIMF1 expression characteristic in various tissue of 3-day-old piglets. \u003cstrong\u003eG\u003c/strong\u003e Relative expression level of lncIMF1 in the nucleus and cytoplasm. Relative expression level of lncIMF1 during the proliferation (\u003cstrong\u003eH\u003c/strong\u003e) and differentiation (\u003cstrong\u003eI\u003c/strong\u003e) of intramuscular adipocytes. The results were representative of means ± SD of three independent experiments.\u003c/p\u003e","description":"","filename":"fig1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4629942/v1/2ae97d92f7604666259668fa.jpg"},{"id":60495417,"identity":"c5538108-0135-4239-84ff-11ac7f8c74b6","added_by":"auto","created_at":"2024-07-17 11:38:54","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":3283892,"visible":true,"origin":"","legend":"\u003cp\u003eLncIMF1 promotes porcine intramuscular preadipocytes proliferation. \u003cstrong\u003eA\u003c/strong\u003eThe knockdown efficiency of lncIMF1 siRNA. \u003cstrong\u003eB\u003c/strong\u003e EdU assays results after transfection for 24 h, with statistics of EdU positive cells. Scale bar, 100 μm. C CCK-8 assays result after transfection for 24 h. \u003cstrong\u003eD\u003c/strong\u003e Cell-cycle analysis after transfecting siRNA and the statistics results of flow cytometry. Relative mRNA expression level (\u003cstrong\u003eE\u003c/strong\u003e) and relative protein expression level (\u003cstrong\u003eF\u003c/strong\u003e) of cell cycle genes were detected after transfection for 24 h. \u003cstrong\u003eG\u003c/strong\u003e The overexpression efficiency of lncIMF1. H EdU assays results after overexpression of lncIMF1 for 24 h. Scale bar, 100 μm. \u003cstrong\u003eI\u003c/strong\u003eCCK-8 results after overexpression for 24 h. \u003cstrong\u003eJ\u003c/strong\u003e Cell-cycle analysis after overexpression for 24 h. Relative mRNA expression level (\u003cstrong\u003eK\u003c/strong\u003e) and relative protein expression level (\u003cstrong\u003eL\u003c/strong\u003e) of cell cycle genes were detected after transfection for 24 h. The results were representative of means ± SD of three independent experiments. *, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"fig2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4629942/v1/7bd48d92325fd4cb567aa7b5.jpg"},{"id":60495415,"identity":"54401440-1801-48ac-bc6b-17325154c812","added_by":"auto","created_at":"2024-07-17 11:38:54","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":3353520,"visible":true,"origin":"","legend":"\u003cp\u003eLncIMF1 promotes porcine intramuscular preadipocytes differentiation. \u003cstrong\u003eA\u003c/strong\u003e The knockdown efficiency of lncIMF1 siRNA. \u003cstrong\u003eB\u003c/strong\u003e BODIPY fluorescent staining on the 6th day of differentiation after transfection of lncIMF1 siRNA and the statistic results. scale bar, 100 μm. \u003cstrong\u003eC\u003c/strong\u003e Oil Red O staining on the 6th day of differentiation after transfection and the absorbance value at 510 nm, scale bar, 100 μm. Relative mRNA expression level (\u003cstrong\u003eD\u003c/strong\u003e) and relative protein expression level (\u003cstrong\u003eE\u003c/strong\u003e) of cell cycle adipogenic and lipolytic genes were detected the 6th day of differentiation after transfection. \u003cstrong\u003eF\u003c/strong\u003e Oil Red O staining on the 6th day of differentiation after overexpression lncIMF1 and the absorbance value at 510 nm. scale bar,100 µm. \u003cstrong\u003eG\u003c/strong\u003eThe overexpression efficiency of lncIMF1. \u003cstrong\u003eH\u003c/strong\u003e BODIPY fluorescent staining on the 6th day of differentiation after overexpression lncIMF1 and the statistic results. scale bar,100 µm. Relative mRNA expression level (\u003cstrong\u003eI\u003c/strong\u003e) and relative protein expression level (\u003cstrong\u003eJ\u003c/strong\u003e) of cell cycle adipogenic and lipolytic genes were detected the 6th day of differentiation after overexpression lncIMF1. The results were representative of means ± SD of three independent experiments. *, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"fig3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4629942/v1/150e43ac72b1e701db7ffdbc.jpg"},{"id":60495418,"identity":"90c9c0d7-cd13-4ae6-9cc5-d2b74129b01e","added_by":"auto","created_at":"2024-07-17 11:38:54","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1501293,"visible":true,"origin":"","legend":"\u003cp\u003eLncIMF1 inhibits apoptosis of porcine intramuscular preadipocytes. \u003cstrong\u003eA\u003c/strong\u003eFlow cytometric detection of apoptosis at the 6th day of intramuscular preadipocytes after overexpression of lncIMF1. \u003cstrong\u003eB\u003c/strong\u003e Analysis of flow cytometry results, X-axis denotes the different phases of the cell cycle. Relative mRNA expression level (\u003cstrong\u003eC\u003c/strong\u003e) and relative protein expression level (\u003cstrong\u003eD\u003c/strong\u003e) of apoptosis gene. The results were representative of means ± SD of three independent experiments. *, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"fig4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4629942/v1/fd0cbbd6cf273bf181f94c9e.jpg"},{"id":60495421,"identity":"c8db8be0-bba1-4eff-b2e3-7f2c55180017","added_by":"auto","created_at":"2024-07-17 11:38:55","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":4596121,"visible":true,"origin":"","legend":"\u003cp\u003eLncIMF1 sponges miR-187 to regulate intramuscular preadipocyte adipogenic differentiation. \u003cstrong\u003eA\u003c/strong\u003e Construction of lncIMF1 dual-luciferase reporter vector. \u003cstrong\u003eB\u003c/strong\u003e The results of lncIMF1 dual-luciferase report experiment.\u003cstrong\u003e C\u003c/strong\u003eThe expression of miR-187 during the differentiation of porcine intramuscular adipocytes. \u003cstrong\u003eD\u003c/strong\u003e The overexpression efficiency of miR-187. \u003cstrong\u003eE\u003c/strong\u003e Bright field microscopy results of intramuscular adipocytes and analysis of results after transfection with miR-187 mimics. scale bar, 100 µm. Relative mRNA expression level (\u003cstrong\u003eF\u003c/strong\u003e) and relative protein (\u003cstrong\u003eG\u003c/strong\u003e) expression level of key genes related to adipogenesis after transfection with miR-187 mimics. \u003cstrong\u003eH\u003c/strong\u003eBright field microscopy results of intramuscular adipocytes and analysis after transfection with miR-187 inhibitor. scale bar, 100 µm. \u003cstrong\u003eI\u003c/strong\u003e The knockdown efficiency of miR-187. Relative mRNA expression level J and relative protein expression level (\u003cstrong\u003eK\u003c/strong\u003e) of key genes related to lipid metabolism after transfection with miR-187 inhibitor. (\u003cstrong\u003eL\u003c/strong\u003e) Oil red O staining results and the absorbance value analysis. (\u003cstrong\u003eM\u003c/strong\u003e) BODIPY staining results after co-transfection. scale bar, 100 µm. (\u003cstrong\u003eN\u003c/strong\u003e) The fluorescence intensity statistics of BODIPY staining results. (\u003cstrong\u003eO\u003c/strong\u003e) RT-qPCR of adipogenesis genes after co-transfection. The results were representative of means ± SD of three independent experiments. *, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"fig5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4629942/v1/04b6bd9e11bb11b5b73b54ec.jpg"},{"id":60495420,"identity":"e4ba698b-8f3c-4e2e-a804-581cf63c530e","added_by":"auto","created_at":"2024-07-17 11:38:54","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":3147134,"visible":true,"origin":"","legend":"\u003cp\u003eMiR-187 targets SMAD1 to regulate adipogenic differentiation of porcine intramuscular preadipocytes.\u003cstrong\u003e A\u003c/strong\u003eConstruction of SMAD1 dual-luciferase reporter vector. \u003cstrong\u003eB\u003c/strong\u003e Results of lncIMF1 dual-luciferase report experiment. \u003cstrong\u003eC\u003c/strong\u003e Relative mRNA expression level of SMAD1 after transfection of miR-187 mimics. \u003cstrong\u003eD\u003c/strong\u003e The staining results of Oil Red O after co-transfection of miR-187 mimics and SMAD1 overexpression vector and the absorbance value at 510 nm. scale bar, 100 µm. \u003cstrong\u003eE\u003c/strong\u003e The detection of key adipogenic genes after co-transfection of miR-187 mimics and SMAD1 overexpression vector. \u003cstrong\u003eF\u003c/strong\u003e The detection of key genes of adipogenic after co-transfection of lncIMF1 siRNA and SMAD1 overexpression vector. \u003cstrong\u003eG\u003c/strong\u003e The staining results of Oil Red O after co-transfection of lncIMF1 siRNA and SMAD1 overexpression vector and the absorbance value at 510 nm. scale bar, 100 µm. \u003cstrong\u003eH\u003c/strong\u003e LncIMF1 promotes the adipogenic genes and p38-MAPK pathway by sponging miR-187. The results were representative of means ± SD of three independent experiments. *, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05; **, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"fig6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4629942/v1/29897bcdfba6444c6b377ffa.jpg"},{"id":77052684,"identity":"15adb227-c909-4a7b-9c54-c7dede9db0e7","added_by":"auto","created_at":"2025-02-24 16:23:11","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":20362518,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4629942/v1/b7fbfe19-5c06-4e3b-8dd9-f133673fd67c.pdf"},{"id":60495419,"identity":"e4e15c75-5f77-4d84-b42a-359f50458140","added_by":"auto","created_at":"2024-07-17 11:38:54","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":336098,"visible":true,"origin":"","legend":"","description":"","filename":"Graphicalabtract.tif","url":"https://assets-eu.researchsquare.com/files/rs-4629942/v1/c3386e3dee34f23702087fc4.tif"}],"financialInterests":"No competing interests reported.","formattedTitle":"LncIMF1 promotes adipogenesis of porcine intramuscular preadipocyte by sponging miR-187","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAdipose tissue is indispensable for animals, owing to its diverse functions (Zhu et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Within the various adipose tissue depots, intramuscular fat, a specialized form located between the skeletal myofibers, holds particular significance for meat quality, such as juiciness, tenderness, and flavor of pork (Wood et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). The content of intramuscular fat is subject to several factors (Park et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), including the differentiation level of preadipocytes into mature adipocytes and the size of lipid droplets within adipocytes. In recent years, numerous studies have been conducted on the molecular mechanisms that regulate intramuscular fat deposition (Cesar et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Zhou et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). However, given the intricate nature of adipogenesis, further exploration into more granular mechanisms is imperative.\u003c/p\u003e \u003cp\u003eLong non-coding RNAs (lncRNAs), defined as transcripts of more than 200 nucleotides without the ability to encode proteins (Zhou et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), have been reported playing an important role in regulating cell proliferation, differentiation, apoptosis, and cellular metabolism by participating in multiple signaling pathways (Statello et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Zuo et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). lncRNAs can regulate the function of DNAs, RNAs, and proteins, especially microRNAs (miRNAs), through multiple pathways. It has been demonstrated that lncRNAs could bind to miRNA recognition elements to regulate protein translation (Bartel \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2009\u003c/span\u003e), while lncRNAs can also bind to mRNAs because of their structural similarity to mRNAs (Dykes and Emanueli 2017). Currently, most studies have focused on the theory that lncRNAs act as molecular sponges for miRNAs. More specifically, lncRNAs could directly target miRNAs and inhibit their binding to target genes, resulting in expression changes of those genes. Some researchers defined this regulation mode as lncRNA/miRNA/mRNA axis (Song et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Xu et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). With the application of bioinformatics to lncRNA research, an increasing number of lncRNAs with regulatory adipogenic functions have been identified, such as lncIMF2 (Yi et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), lncPRDM16(Chen et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2022\u003c/span\u003e), IRlnc (Wang et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), lncAD (Zhang et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), etc. Despite these findings, the regulatory mechanisms of lncRNAs in adipogenesis are far from understood.\u003c/p\u003e \u003cp\u003eIn our previous study (Sun et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2018\u003c/span\u003e), we isolated intramuscular preadipocytes from the \u003cem\u003elongissimus dorsi\u003c/em\u003e muscle of both Bamei and Large White piglets, respectively, and conducted RNA-sequencing during intramuscular preadipocyte differentiation. Herein, we focus on a novel lncRNA, lncIMF1, based on the variations in its expression during adipogenic differentiation. Overexpression and knockdown of lncIMF1 were performed in isolated intramuscular preadipocytes, revealing that lncIMF1 significantly promoted cell proliferation and differentiation. Additionally, we discovered that lncIMF1 could act as a molecular sponge for miR-187 to relieve the inhibition of \u003cem\u003eSMAD1\u003c/em\u003e gene by miR-187, thus facilitating its regulatory effect on adipogenesis. Taken together, this research contributes valuable insights to the exploration of lncRNA-mediated regulation in enhancing pork muscle quality.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAnimals and animal care\u003c/h2\u003e \u003cp\u003eThe Bamei piglets (three-days-old) were purchased from a Bamei original breeding field in Huzhu, Gansu, and the Large White piglets (three-days-old) were purchased from the Experimental Farm of Northwest A\u0026amp;F University. To investigate the expression of lncIMF1, heart, liver, spleen, lung, kidney, subcutaneous fat, and muscle tissues were collected. All samples for expression analysis were promptly frozen in liquid nitrogen at -196℃ after sampling and stored until RNA extraction. All animal tissue samples used in our study were approved by the Animal Care and Use Committee of Northwest A\u0026amp;F University (Approval No. 201705A299).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eRNA Sequencing and data analysis\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from cell samples of \u003cem\u003elongissimus dorsi\u003c/em\u003e muscle using TRIzol reagent (Invitrogen, USA) following the manufacturer\u0026rsquo;s instructions. The quantity and quality of RNA were detected by NanoDrop 2000 instrument (Thermo Scientific, Waltham, MA, USA). Subsequently, RNA-sequencing libraries were constructed using an Illumina TruSeq Kit (encompassing mRNA purification, fragmentation, cDNA synthesis, end repair, A-tailing, adapter ligation, and PCR enrichment) according to the instructions. Libraries were sequenced on an Illumina HiSeq 2000 platform. After quality control of the raw reads, clean reads were obtained, and only these were used for subsequent analysis. Heatmap was created with pheatmap R package.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eCell culture\u003c/h2\u003e \u003cp\u003eIntramuscular preadipocytes were extracted from the \u003cem\u003elongissimus dorsi\u003c/em\u003e muscle. Initially, a 0.2% solution of collagenase I (Gibco, Carlsbad, CA, United States) was used to digest the samples in a water bath shaker for 2 h at 37℃. Subsequently, the debris was filtered out to isolate the cells using 70 and 200 mesh filters sequentially. The samples were then rinsed twice with DMEM/F12 (Procell, Wuhan, China), and subsequently seeded in DMEM/F12 (Procell, Wuhan, China) medium that contained 10% fetal bovine serum (Gibco, Carlsbad, CA, United States). The preadipocyte cultures were maintained at 37℃ under a 5% CO\u003csub\u003e2\u003c/sub\u003e atmosphere in humidified air. Following this, the medium of the intramuscular preadipocytes was sequentially changed to differentiation medium which containing 0.5 mM IBMX (Solarbio, Beijing, China), 1 \u0026micro;M DEX (Solarbio, Beijing, China), 5 \u0026micro;g/ml insulin (Solarbio, Beijing, China) to induce differentiation. Finally, the medium was replaced every two days.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eCell transfection\u003c/h2\u003e \u003cp\u003eTo conduct research on proliferation, cells were transfected with 50 nM siRNA or negative control (NC) using X-tremeGENE siRNA Transfection Reagent (Roche, San Francisco, United States) and Opti-MEM (Gibco, Grand Island, United States) when the cell density was at 40%. After 24 h of transfection, the cells were harvested. For differentiation, siRNA or NC was transfected when the cell density reached 80%, followed by differentiation. When the cells reached fusion, the medium was replaced with growth medium. The siRNA and NC were obtained from RiboBio (Guangzhou, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eCell counting kit assays (CCK-8)\u003c/h2\u003e \u003cp\u003eCell count kit 8 (CCK-8) assays were performed according to the previous method (Zhao et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Briefly, preadipocytes were seeded in 96-well plates at a density of 2.5\u0026times;10\u003csup\u003e3\u003c/sup\u003e cells per well and then transfected with siRNA, overexpression plasmid, or negative control. Proliferation rates were assessed 24 h post-treatment using the CCK-8 (Beyotime, Shanghai, China), following the manufacturer's instructions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eEdU assays\u003c/h2\u003e \u003cp\u003e The EdU assays followed a previously published method (Qimuge et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Briefly, cells were incubated with EdU for 2 h after transfection with siRNA, overexpression plasmid, or negative control. Preadipocytes were stained with Apollo reaction solution after they were fixed with 4% paraformaldehyde. Nuclei were subsequently counterstained with Hoechst for 15 minutes. Finally, sample images were captured using a Nikon TE2000 microscope (Nikon, Tokyo, Japan), and data analysis was performed using Image J.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eCytoplasmic and nuclear RNA extraction\u003c/h2\u003e \u003cp\u003eCytoplasmic and nuclear RNA extractions were performed based on a previous article (Xiong et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Briefly, intramuscular adipocytes were collected and washed with PBS after a 6-day differentiation period. They were then suspended in lysis buffer (10 mM NaCl, 2 mM MgCl2, 10 mM pH 7.8 Tris-HCL, 5 mM DTT, and 0.5% Igepal CA 630) and incubated on ice for 5 minutes. After centrifugation at 8000 rpm for 5 minutes, the supernatant was transferred to a fresh microcentrifuge tube for cytoplasmic RNA extraction. Concurrently, the pellet was resuspended in lysis buffer and subjected to nuclear RNA extraction. In the RNA extraction process, the fractions were initially incubated with Proteinase K (10 mg/mL) at 37℃ for 20 minutes, followed by mixing with TRIzol (Takara, Otsu, Japan). The RNA was then separated using chloroform and precipitated with ethanol in conjunction with 3 M sodium acetate (pH 5.2, 1/10 volume). The extracted RNA was subsequently dissolved in ddH2O and utilized for reverse transcription and real-time PCR analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eRNA extraction and Real-Time PCR\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted using TRIzol reagent (Takara, Otsu, Japan) following the manufacturer's instructions. The RNA was then reverse transcribed into cDNA for quantitative PCR analysis. Quantitative RT-PCR was performed using Bio-Rad iQTM5 (Bio-Rad, Hercules, CA, United States), and the expression levels of the target genes and lncIMF1 were normalized to the expression of β-tubulin. The primers used in the quantitative Real-Time PCR are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used for real-time quantitative PCR in this study.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequence (5\u0026rsquo; to 3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePrimer length (nt)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003ePPARγ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eF: AGGACTACCAAAGTGCCATCAAA\u003c/p\u003e \u003cp\u003eR: GAGGCTTTATCCCCACAGACAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eFABP4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eF: GAGCACCATAACCTTAGATGGA\u003c/p\u003e \u003cp\u003eR: AAATTCTGGTAGCCGTGACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eC/EBPα\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eF: CGATGCTCTTAGCTGAGTGT\u003c/p\u003e \u003cp\u003eR: GGTCCAAGAATTTCACCTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eC/EBPβ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eF: CACCACGACTTCCTCTCCGA\u003c/p\u003e \u003cp\u003eR: ATCCACGGTCTTCTTGGTCTTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eATGL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eF: TCACCAACACCAGCATCCA\u003c/p\u003e \u003cp\u003eR: GCACATCTCTCGAAGCACCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eHSL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eF: CACTGACTGCTGACCCCAAG\u003c/p\u003e \u003cp\u003eR: TCCTCACTGTCCTGTCCTTCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eSCD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eF: GGAGAGAGGAAGGGAAAACAGAG\u003c/p\u003e \u003cp\u003eR: AGACCGACCAATAAACTGCAAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCyclin B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eF: AATCCCTTCTTGTGGTTA\u003c/p\u003e \u003cp\u003eR: CTTAGATGTGGCATACTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCyclin D\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eF: TACACCGACAACTCCATCCG\u003c/p\u003e \u003cp\u003eR: GAGGGCGGGTTGGAAATGAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCyclin E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CAGAGCAGCGAGCAGGAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: GCAAGCTGCTTCCACACCACAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eFAS\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CCCCGAATCTGCACTACCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: AGTTGGGCTGAAGGATGACG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eP21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eF: ACGTCTCAGGAGGACCATGT\u003c/p\u003e \u003cp\u003eR: AGAAGATCAGCCGGCGTTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eF: AGGTCGGAGTGAACGGATTTG\u003c/p\u003e \u003cp\u003eR: ACCATGTAGTGGAGGTCAATGAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eCaspase-3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TCTAACTGGCAAACCCAAACTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: CCAGGAATAGTAACCAGGTGCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eBCL2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: ATGTGTGTGGAGAGCGTCAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: AGAGACAGCCAGGAGAAATCAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eSMAD1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: CCTGGACAGCCGAGTAACTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: ACTCACAGCATTCCAGAGGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003emiR-187\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TCGTGGGGTCGTGTCTTGTGTTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: GCAGGGTCCGAGGTATTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eLncIMF1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GCAGCCGTGAGGTAAAACAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: CTGTTCCAGGCAAACCAAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eBAX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: GGCCTCCTCTCCTACTTTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: CTCAGCCCATCTTCTTCCAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eProtein extraction and Western Blotting\u003c/h2\u003e \u003cp\u003eFirstly, tissues and cells were lysed using a RIPA lysis buffer (Appligen, China), supplemented with a protease inhibitor cocktail (Cwbiotech, China). Subsequently, the total protein sample was isolated from the SDS-polyacrylamide gel and transferred onto a PVDF membrane (Millipore, Bedford, MA, United States). After blocking with 5% nonfat milk, the membrane was incubated with primary antibodies overnight at 4℃. Secondary antibodies were then added and incubated at room temperature for 1.5 h. Finally, the bands were visualized using a chemiluminescent peroxidase substrate. The associated proteins were detected using the Gel Doc XR System (Bio-Rad, Hercules, CA, United States). Information regarding the primary and secondary antibodies is provided in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e and Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimary antibodies used in this study.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAntibody\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eHost\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003edilution\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003esource\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePPARγ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRabbit\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:1 000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAbcam\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFABP4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSanta Cruz\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC/EBPβ\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRabbit\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSanta Cruz\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eATGL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRabbit\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSanta Cruz\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePCNA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRabbit\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSanta Cruz\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHSL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRabbit\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSanta Cruz\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCyclin B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRabbit\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAbways\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCyclin D\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRabbit\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSanta Cruz\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCyclin E\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRabbit\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSanta Cruz\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRabbit\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCST\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ep38-MAPK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRabbit\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:1 000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCST\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCaspase-3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:500\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSanta Cruz\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBAX\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRabbit\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSanta Cruz\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBCL2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRabbit\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:200\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSanta Cruz\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-tubulin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMouse\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1:2 000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSanta Cruz\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSecondary antibodies used in this study.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAntibody\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003edilution\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003esource\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAnti-rabbit-HRP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:2 000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSanta Cruz\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAnti-mouse-HRP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1:2 000\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSanta Cruz\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eFlow Cytometry\u003c/h2\u003e \u003cp\u003eIntramuscular preadipocytes were initially seeded in 6-well plates at a density of 4 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells per well. After a 24-h incubation, the cells underwent transfection with either NC or pcDNA3.1-lncIMF1. Subsequently, the cells were washed three times with PBS, fixed with 70% alcohol, and left overnight at -20℃. The cells were then treated with 1 mg/mL RNase at 37℃ for 40 minutes, followed by staining with 50 mg/mL propidium iodide (PI) at 4℃ for 1 h. Finally, the samples were analyzed using FACS Calibur flow cytometry (Franklin Lakes, NJ, United States).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eOil Red O Staining\u003c/h2\u003e \u003cp\u003eInitially, cells were incubated with 0.5% Oil Red O for 30 minutes, followed by fixation with a 4% paraformaldehyde solution for 30 minutes. The cells were then washed three times with PBS and visualized with a phase-contrast microscope (assisted by IS-Elements software, Nikon ECLIPSE, Tokyo, Japan). Subsequently, 100% isopropanol was used to extract Oil Red O, and the relative concentration was determined by measuring the absorbance at 510 nm.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eLuciferase reporter assays\u003c/h2\u003e \u003cp\u003e The luciferase reporter assays were performed in accordance with previous research (Qin et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). In brief, the wild-type (WT) and mutant‐type 3\u0026prime;‐UTR of \u003cem\u003eSMAD1\u003c/em\u003e were amplified from 293T cells complementary DNA and then cloned into the psiCHECK2‐reporter vector (GENERALBIOL, Anhui, China). For luciferase reporter analysis, miR‐187 mimics and negative or NC were co-transfected with the WT or mutant‐type 3\u0026prime;‐UTRs into 293T cells, respectively. Luciferase reporter assays were performed to measure the relative luciferase activity after transfection for 48 h.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eBioinformatics analysis\u003c/h2\u003e \u003cp\u003eThe lncIMF1 sequences were analyzed in Coding Potential Calculator (CPC) (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://cpc2.cbi.pku.edu.cn/\u003c/span\u003e\u003cspan address=\"http://cpc2.cbi.pku.edu.cn/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and Coding-Potential Assessment Tool (CPAT) (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://lilab.research.bcm.edu/\u003c/span\u003e\u003cspan address=\"http://lilab.research.bcm.edu/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Gene Ontology (GO) terms and Kyoto Encyclopedia of Genes and Genomes (KEGG) terms were analyzed by KEGG Orthology Based Annotation System (KOBAS) (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://kobas.cbi.pku.edu.cn/kobas3/\u003c/span\u003e\u003cspan address=\"http://kobas.cbi.pku.edu.cn/kobas3/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). LncIMF1 binding sites for adipogenesis-related miRNAs were predicted by RegRNA 2.0 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://regrna2.mbc.nctu.edu.tw/\u003c/span\u003e\u003cspan address=\"http://regrna2.mbc.nctu.edu.tw/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The target gene of mi-R217 was predicted using miRbase (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.mirbase.org\u003c/span\u003e\u003cspan address=\"http://www.mirbase.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and TargetscanHuman 7.2(\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.targetscan.org/vert_72/\u003c/span\u003e\u003cspan address=\"http://www.targetscan.org/vert_72/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eThe diagrams were created by GraphPad Prism 8.5.0. Student\u0026rsquo;s t-test and one-way ANOVA were used to analyze group differences using SPSS Statistical software (Version 22.0; SPSS, Chicago, IL, United States)(*, \u003cem\u003ep\u003c/em\u003e \u0026lt;0.05, **, \u003cem\u003ep\u003c/em\u003e \u0026lt;0.01). The experimental data were obtained from three independent experiments and all results were presented as means\u0026thinsp;\u0026plusmn;\u0026thinsp;SD.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003elncIMF1 is a novel lncRNA involved in the proliferation and differentiation of porcine intramuscular preadipocytes\u003c/h2\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe previous RNA-sequencing results (Sun et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) showed that the expression of Lnc_000037 in Bamei pig was significantly different during differentiation (Fig.\u0026nbsp;1A). Therefore, Lnc_000037 was researched in this experiment and named lncIMF1. The Coding Potential Calculator (CPC) and Coding-Potential Assessment Tool (CPAT) results showed that lncIMF1 lacks the capacity to code proteins (Fig.\u0026nbsp;1B and 1C). Furthermore, GO terms and the KEGG pathway analysis results indicated that lncIMF1 may participate in various biological processes, such as cell proliferation, differentiation, and apoptosis, and it has a close association with lipid metabolism pathways and adipocytokine (Fig.\u0026nbsp;1D and 1E). In addition, it was noticed that the highest abundance of lncIMF1 was expressed in adipose tissues (Fig.\u0026nbsp;1F). Analysis revealed that lncIMF1 is present in both the nucleus and cytoplasm of cells. Specifically, cytoplasmic expression accounted for approximately 70% of total expression, while nuclear expression constituted the remaining 30% (Fig.\u0026nbsp;1G). LncIMF1 expression showed a tendency to increase gradually during the proliferation (Fig.\u0026nbsp;1H) and differentiation stage (Fig.\u0026nbsp;1I) of intramuscular preadipocytes, which conform to sequencing results. Taken together, it is hypothesized that lncIMF1 is implicated in the proliferation and differentiation of preadipocytes, and further research is being carried out following these pathways.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eLncIMF1 promotes porcine intramuscular preadipocytes proliferation\u003c/h2\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eBased on the results of the previous KEGG enrichment analysis, the function of lncIMF1 in the proliferation of intramuscular preadipocytes was investigated. Firstly, lncIMF1 siRNA was transfected into intramuscular preadipocytes and the knockdown efficiency met the requirements for subsequent experiments (Fig.\u0026nbsp;2A). The EdU assays results showed that the percentage of EdU positive adipocytes was reduced after the knockdown of lncIMF1 (Fig.\u0026nbsp;2B), which was consistent with the results of CCK-8 (Fig.\u0026nbsp;2C). Furthermore, the results of the cell cycle assay also indicated that the knockdown of lncIMF1 inhibited the proliferation of intramuscular preadipocytes (Fig.\u0026nbsp;2D). Meanwhile, the expression of the cell cycle marker genes CyclinB, CyclinD, and CyclinE, PCNA was decreased after knockdown lncIMF1, while the expression of the negative regulator of cell proliferation, P21, was significantly increased (Fig.\u0026nbsp;2E, 2F).\u003c/p\u003e \u003cp\u003eSimultaneously, the effect of lncIMF1 overexpression on the proliferation of intramuscular preadipocytes was examined. The overexpression efficiency of lncIMF1 meets the requirements of the subsequent experiments (Fig.\u0026nbsp;2G). The results of EdU and CCK-8 assays showed that the percentage of preadipocytes increased with overexpression of lncIMF1 (Fig.\u0026nbsp;2H, 2I). And the results of the cell cycle assay also indicated that overexpression of lncIMF1 promote the proliferation of intramuscular preadipocytes (Fig.\u0026nbsp;2J). Meanwhile, the expression of CyclinB, CyclinD, CyclinE and the pro-proliferative gene PCNA all increased after overexpression of lncIMF1, while the expression of P21 decreased (Fig.\u0026nbsp;2K, 2L). These results collectively suggested that lncIMF1 promotes the proliferation of intramuscular preadipocytes.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eLncIMF1 promotes porcine intramuscular preadipocytes differentiation\u003c/h2\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe role of lncIMF1 in the differentiation of porcine intramuscular preadipocytes was also investigated. Firstly, lncIMF1 siRNA was transfected into intramuscular preadipocytes to knockdown lncIMF1 (Fig.\u0026nbsp;3A). BODIPY and Oil Red O staining results showed that knockdown of lncIMF1 suppressed the differentiation ability(Fig.\u0026nbsp;3B, 3C). Meanwhile, the expression of key genes for differentiation were significantly decreased after transfection with siRNA, while the expression of lipolysis-related genes was increased (Fig.\u0026nbsp;3D, 3E).\u003c/p\u003e \u003cp\u003eSubsequently, pcDNA3.1-lncIMF1was transfected into intramuscular preadipocytes to overexpress lncIMF1 (Fig.\u0026nbsp;3G). BODIPY and Oil Red O staining results showed that overexpression of lncIMF1 promoted the differentiation of intramuscular preadipocytes (Fig.\u0026nbsp;3F, 3H). Meanwhile, overexpression of lncIMF1 significantly increased the expression of key genes for differentiation and decreased the expression of lipolysis-related genes (Fig.\u0026nbsp;3I, 3J). These results suggested that lncIMF1 promoted the differentiation of intramuscular preadipocytes.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eLncIMF1 inhibits apoptosis of porcine intramuscular adipocytes\u003c/h2\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe effect of lncIMF1 in apoptosis was examined due to its correlation with apoptosis observed in previous pathway enrichment results. LncIMF1 was overexpressed in the late stage of differentiation stage using pcDNA3.1-lncIMF1 transfection. Flow cytometry analysis revealed a significant increase in the proportion of viable adipocytes, alongside a corresponding decrease in apoptotic cells, indicating enhanced cell survival (Fig.\u0026nbsp;4A, 4B). Meanwhile, the expression of pro-apoptotic genes Caspase-3, \u003cem\u003eBAX\u003c/em\u003e and p53 was decreased, while the expression of anti-apoptotic gene \u003cem\u003eBCL\u003c/em\u003e-\u003cem\u003e2\u003c/em\u003e was increased, which was consistent with the Western blot results (Fig.\u0026nbsp;4C, 4D).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eLncIMF1 sponges miR-187 to promote intramuscular preadipocyte adipogenic differentiation\u003c/h2\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e The subcellular localization results led us to hypothesize that lncIMF1 may serve as a molecular sponge for microRNAs, specifically miR-187, regulating adipogenic differentiation. Firstly, the result of online software RNA g2.0 showed that lncIMF1 has a binding site with miR-187. Accordingly, a dual-luciferase reporter vector was constructed to verify the binding ability (Fig.\u0026nbsp;5A) and the results demonstrated their interaction (Fig.\u0026nbsp;5B). Meanwhile, the expression level of miR-187 during differentiation of intramuscular preadipocytes was decreased (Fig.\u0026nbsp;5C), which was opposite to the trend of increased expression of lncIMF1 during differentiation.\u003c/p\u003e \u003cp\u003eFollowing this, we overexpressed miR-187 in intramuscular preadipocytes (Fig.\u0026nbsp;5D). By the sixth day of differentiation, Bright field microscopy analysis indicated that miR-187 overexpression significantly inhibited adipogenic differentiation (Fig.\u0026nbsp;5E). RT-qPCR and Western blot results showed that overexpression of miR-187 promoted the expression of lipolytic genes and proteins, and inhibited the expression of key adipogenic genes and proteins (Fig.\u0026nbsp;5F, 5G). The miR-187 inhibitor was also transfected into intramuscular preadipocytes (Fig.\u0026nbsp;5I). The Bright field microscopy results on the 6th day of differentiation showed that the adipogenic ability of intramuscular preadipocytes was enhanced after inhibiting miR-187 (Fig.\u0026nbsp;5H). RT-qPCR and Western blot results also showed that the expression of key adipogenic genes and proteins significantly increased after inhibiting miR-187, while the expression of lipolytic genes showed a downward trend (Fig.\u0026nbsp;5J, 5K). These results demonstrated that miR-187 could inhibit the adipogenic differentiation of intramuscular preadipocytes.\u003c/p\u003e \u003cp\u003eSubsequently, we separately transfected the lncIMF1 overexpression vector alone and the lncIMF1 overexpression vector with miR-187 mimics together into intramuscular preadipocytes. Oil red O staining results demonstrated that overexpression of lncIMF1 significantly promoted adipogenic differentiation. Conversely, overexpression of miR-187 inhibited the adipogenic promoting effect of lncIMF1 (Fig.\u0026nbsp;5l), which was consistent with the BODIPY staining results (Fig.\u0026nbsp;5M, 5N). Additionally, RT-qPCR analysis corroborated these findings, showing similar trends (Fig.\u0026nbsp;5O).\u003c/p\u003e \u003cp\u003e \u003cb\u003eMiR-187 targets\u003c/b\u003e \u003cb\u003eSMAD1\u003c/b\u003e \u003cb\u003eto regulate adipogenic differentiation of porcine intramuscular preadipocytes\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eSMAD1\u003c/em\u003e was identified as the target gene of miR-187 through online software prediction. To confirm their binding, dual-luciferase reporter vector was constructed (Fig.\u0026nbsp;6A) and co-transfected with miR-187 mimics into 293T cells. After 24 h of incubation, the assay results confirmed that \u003cem\u003eSMAD1\u003c/em\u003e could bind to miR-187 (Fig.\u0026nbsp;6B). Furthermore, the expression of \u003cem\u003eSMAD1\u003c/em\u003e was significantly reduced when miR-187 mimics were transfected into intramuscular preadipocytes (Fig.\u0026nbsp;5C), indicating that miR-187 can bind to SMAD1. Accordingly, miR-187 mimics and the \u003cem\u003eSMAD1\u003c/em\u003e overexpression vector were co-transfected into cells to investigate whether miR-187 is involved in the adipogenic differentiation of intramuscular preadipocytes through \u003cem\u003eSMAD1\u003c/em\u003e. The Oil Red O staining results showed that miR-187 transfection alone reduced adipogenic differentiation of porcine intramuscular preadipocytes, while miR-187 mimics and SMAD1 overexpression vector were co-transfected, the adipogenic differentiation capacity was significantly restored. (Fig.\u0026nbsp;6D). The RT-qPCR assay revealed that transfection of miR-187 mimics alone suppressed the expression of PPARγ and FABP4 and increased the expression of the ATGL. However, this effect was reversed by transfection of miR-187 mimics and overexpression of \u003cem\u003eSMAD1\u003c/em\u003e (Fig.\u0026nbsp;6E).\u003c/p\u003e \u003cp\u003eIn addition, a recovery assay was designed in which lncIMF1 siRNA was co-transfected with the \u003cem\u003eSMAD1\u003c/em\u003e overexpression vector. As expected, RT-qPCR results showed that the expression levels of PPARγ and FABP4 decreased while ATGL increased when cells were transfected with lncIMF1 siRNA alone. Conversely, PPARγ and FABP4 levels increased while ATGL decreased when lncIMF1 siRNA was co-transfected with the SMAD1 overexpression vector (Fig.\u0026nbsp;6F). And the Oil red O staining results showed the same results, the adipogenic differentiation ability of intramuscular preadipocytes was inhibited by transfecting lncIMF1 siRNA into 293T cells alone while the adipogenic differentiation ability was restored when siRNA was transfected with concomitant overexpression of \u003cem\u003eSMAD1\u003c/em\u003e (Fig.\u0026nbsp;6G). Having established that lncIMF1 facilitates intramuscular preadipocyte differentiation by acting as a miR-187 sponge, thereby mitigating its inhibitory effect on SMAD1, the downstream pathway of \u003cem\u003eSMAD1\u003c/em\u003e was further explored. Based on the results of previous pathway enrichment (Fig.\u0026nbsp;1D, 1E) and the pathways involved with \u003cem\u003eSMAD1\u003c/em\u003e, the p38-MAPK pathway was considered to participate in \u003cem\u003eSMAD1\u003c/em\u003e downstream. Western blot results demonstrated that overexpression of lncIMF1 promotes the expression of the p38-MAPK pathway, which is inhibited after overexpressing miR-187 (Fig.\u0026nbsp;6H).\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIntramuscular fat content is closely related to pork quality traits, and the intramuscular fat deposition is regulated by a variety of factors, including genetics, environment, nutrition, and epigenetics. The regulatory role of lncRNAs is an important part of epigenetics, and several lncRNAs have been shown to be linked to intramuscular fat accumulation in poultry and livestock (Chen et al. \u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e; Chen et al. \u003cspan class=\"CitationRef\"\u003e2019\u003c/span\u003e; Chen et al. \u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e). In our previous study, we identified numerous lncRNAs associated with intramuscular fat deposition. For instance, lncIMF4 could inhibit lipolysis by attenuating autophagy and lncIMF2 could act as a molecular sponge that binds to miR-217 to regulate adipogenesis (Sun et al. \u003cspan class=\"CitationRef\"\u003e2020\u003c/span\u003e; Yi et al. \u003cspan class=\"CitationRef\"\u003e2023\u003c/span\u003e). Despite these discoveries, adipogenesis in porcine intramuscular fat is an extremely complex process, regulated by a multitude of lncRNAs and genes. Further research is needed to fully elucidate the mechanisms involved.\u003c/p\u003e\n\u003cp\u003eThis study centers on the newly identified lncRNA, lncIMF1, unveiling its pivotal roles and mechanisms in adipogenesis, explored its functions and specific mechanisms. We noticed that lncIMF1 promotes proliferation and differentiation while inhibiting apoptosis. This is consistent with previous studies, which have shown lncRNAs to have multiple functions (Zhang et al. \u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e). As more functions are identified, lncRNAs have become a new target for elucidating the molecular mechanisms of economically important traits in livestock. LncRNAs can be transcribed from either the sense or antisense strand of DNA and located in either the nucleus or cytoplasm, where they play important biological roles. The regulatory mechanisms of lncRNAs are complex, involving post-transcriptional regulation of target genes, transcriptional regulation, and modification of RNA-binding proteins (Liu et al. \u003cspan class=\"CitationRef\"\u003e2021\u003c/span\u003e; Oo et al. \u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e). These mechanisms likely depend on the subcellular localization of lncRNAs (Bridges et al. \u003cspan class=\"CitationRef\"\u003e2021\u003c/span\u003e). Based on our experiments, it appeared that lncIMF1 was primarily located in the cytoplasm. Therefore, we used bioinformatics tools to analyze the potential miRNA targets of lncIMF1 and confirmed that it directly adsorbs miR-187 using the dual-luciferase reporting system, indicating that lncIMF1 can act as a \u0026apos;sponge\u0026apos; for miR-187.\u003c/p\u003e\n\u003cp\u003eMiRNAs are highly conserved, endogenous, non-coding short RNAs of approximately 19\u0026ndash;25 nucleotides in length. Their function is to inhibit gene expression by binding to complementary sites in the 3\u0026apos; untranslated region (3\u0026apos;UTR) of target genes, thereby inhibiting protein translation or inducing degradation of the target mRNA (Papaconstantinou et al. \u003cspan class=\"CitationRef\"\u003e2012\u003c/span\u003e). Several miRNAs have been identified in the field of adipogenesis, including oar-miR-432 (Fei et al. \u003cspan class=\"CitationRef\"\u003e2023\u003c/span\u003e), miR-376a (Chen et al. \u003cspan class=\"CitationRef\"\u003e2020\u003c/span\u003e), and miR-378 (Liu et al. \u003cspan class=\"CitationRef\"\u003e2021\u003c/span\u003e). In our study, we found that miR-187 could bind to lncIMF1, therefore, we initially conducted independent investigations into the functions of miR-187 and found that miR-187 could inhibited differentiation of intramuscular preadipocytes. Subsequently, we devised co-transfection experiments to elucidate the functional relationship between lncIMF1 and miRNA. Currently, miR-187 is mainly studied in the context of tumors and cancer, where it is considered as an important miRNA related to the proliferation and apoptosis of tumor cells (Chen et al. \u003cspan class=\"CitationRef\"\u003e2022\u003c/span\u003e; Lou et al. \u003cspan class=\"CitationRef\"\u003e2016\u003c/span\u003e; Peng et al. \u003cspan class=\"CitationRef\"\u003e2020\u003c/span\u003e). Collectively, this is the first study to identify miR-187 as a potential miRNA that can negatively regulate adipogenesis of intramuscular preadipocytes.\u003c/p\u003e\n\u003cp\u003eGiven the classical functions of miRNA in binding to target mRNA, we further examined the target genes of miR-187 using online software prediction and dual-luciferase reporting system, which found that \u003cem\u003eSMAD1\u003c/em\u003e is the target gene. The \u003cem\u003eSMAD1\u003c/em\u003e protein has been reported to be a transcriptional modulator of multiple pathways (Liao et al. \u003cspan class=\"CitationRef\"\u003e2024\u003c/span\u003e; Murugaiyan et al. \u003cspan class=\"CitationRef\"\u003e2023\u003c/span\u003e). Analysis of the human transcriptome revealed high expression of \u003cem\u003eSMAD1\u003c/em\u003e in adipose tissue Fagerberg et al. \u003cspan class=\"CitationRef\"\u003e2014\u003c/span\u003e). Furthermore, activation of \u003cem\u003eSMAD1\u003c/em\u003e induced the expression of PPAR\u0026gamma; and upregulated its transcriptional activity by activating p38 kinase, which in turn induced the differentiation of undifferentiated mesenchymal stromal cells into adipocytes (Hata et al. \u003cspan class=\"CitationRef\"\u003e2003\u003c/span\u003e). Although no studies have been conducted on the effect of \u003cem\u003eSMAD1\u003c/em\u003e on intramuscular fat deposition, the transcriptome sequencing of the \u003cem\u003elongissimus dorsi\u003c/em\u003e muscle of Iberian pigs, known for their high intramuscular fat and high-quality pork, revealed high expression of \u003cem\u003eSMAD1\u003c/em\u003e (Mu\u0026ntilde;oz et al. \u003cspan class=\"CitationRef\"\u003e2018\u003c/span\u003e). However, research into the impact of \u003cem\u003eSMAD1\u003c/em\u003e on intramuscular fat deposition remains unexplored. Based on the above researches, it is hypothesized that there may be a correlation between \u003cem\u003eSMAD1\u003c/em\u003e and intramuscular fat deposition in pigs. Our analysis highlights the enrichment of the MAPK signaling pathway, known for its role in adipogenesis (Bost et al. 2005). Additionally, \u003cem\u003eSMAD1\u003c/em\u003e has been identified as a regulator within this pathway (Aubin et al. \u003cspan class=\"CitationRef\"\u003e2004\u003c/span\u003e). Our findings confirm the involvement of lncIMF1-miR-187 in regulating intramuscular adipocytes differentiation in pigs through the MAPK pathway.\u003c/p\u003e\n\u003cp\u003eIn summary, we identified a novel long non-coding RNA, named lncIMF1, which plays a crucial role in the adipogenesis process. The expression of lncIMF1 increases progressively during the proliferation and differentiation of intramuscular adipocytes, predominantly in the cytoplasm. Specifically, lncIMF1 promotes the proliferation and differentiation of intramuscular preadipocytes while inhibiting apoptosis, ultimately leading to lipid accumulation. Furthermore, lncIMF1 regulates \u003cem\u003eSMAD1\u003c/em\u003e expression by sponging miR-187 and activates the p38-MAPK pathway. These findings provide new insights into the biological functions of lncRNA in porcine adipogenesis and present a potential target for enhancing pork quality.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was funded by the National Natural Science Foundation of China (32272847), the China Agriculture Research System (CARS-PIG) and the Key Research and Development Program of Shaanxi Province (2022ZDLNY01-04).\u003c/p\u003e\n\u003cp\u003eCompeting interests: The authors declare that they have no conflict of interest associated with the work described in this manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eM.F. and X. D. wrote the main manuscript text and analyzed the data, Z. Y. reviewed the manuscript and revised a lot, J. H. and H. Y. prepared the figures, L. X. revised the document format, W. J. supervised the process. All authors reviewed the manuscript and approve its submission in the current form.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAubin J, Davy A, Soriano P (2004) In vivo convergence of BMP and MAPK signaling pathways: impact of differential Smad1 phosphorylation on development and homeostasis. Genes Dev 18:1482-1494. http://www.genesdev.org/cgi/doi/10.1101/gad.1202604\u003c/li\u003e\n\u003cli\u003eBartel DP (2009) MicroRNAs: target recognition and regulatory functions. Cell 136:215-233. http://doi.org/10.1016/j.cell.2009.01.002\u003c/li\u003e\n\u003cli\u003eBridges MC, Daulagala AC, Kourtidis A (2021) LNCcation: lncRNA localization and function. The Journal of Cell Biology 220(2). http://doi.org/10.1083/jcb.202009045\u003c/li\u003e\n\u003cli\u003eCesar ASM, Regitano LCA, Koltes JE, Fritz-Waters ER, Lanna DPD, Gasparin G, Mour\u0026atilde;o GB, Oliveira PSN, Reecy JM, Coutinho LL (2015) Putative regulatory factors associated with intramuscular fat content. Plos One 10(6): e0128350. http://doi.org/10.1371/journal.pone.0128350\u003c/li\u003e\n\u003cli\u003eChen C, Cui Q, Zhang X, Luo X, Liu Y, Zuo J, Peng Y (2018) Long non-coding RNAs regulation in adipogenesis and lipid metabolism: Emerging insights in obesity. Cell Signal 51:47-58. http://doi.org/10.1016/j.cellsig.2018.07.012\u003c/li\u003e\n\u003cli\u003eChen K, Xie S, Jin W (2019) Crucial lncRNAs associated with adipocyte differentiation from human adipose-derived stem cells based on co-expression and ceRNA network analyses. Peerj 7:e7544. http://doi.org/10.7717/peerj.7544\u003c/li\u003e\n\u003cli\u003eChen X, Raza SHA, Cheng G, Ma X, Wang J, Zan L (2020) Bta-miR-376a Targeting KLF15 Interferes with Adipogenesis Signaling Pathway to Promote Differentiation of Qinchuan Beef Cattle Preadipocytes. Animals: An Open Access Journal From MDPI 10(12). http://doi.org/10.3390/ ani10122362 \u003c/li\u003e\n\u003cli\u003eChen X, Song QL, Ji R, Wang JY, Li ZH, Guo D, Yin TL, Wang SJ, Yang J (2022) MiR-187 regulates the proliferation, migration and invasion of human trophoblast cells by repressing BCL6-mediated activation of PI3K/AKT signaling. Placenta 118:20-31. http://doi.org/10.1016/j.placenta.2022.01. 001\u003c/li\u003e\n\u003cli\u003eChen Y, Zhao S, Ding R, Li H, Yang C, Du Z (2022) Identification of a Long Noncoding RNA (lncPRDM16) Inhibiting Preadipocyte Proliferation in the Chicken. J Agr Food Chem 70(4):1335-1345. http://doi.org/10.1021/acs.jafc.1c05554\u003c/li\u003e\n\u003cli\u003eDykes IM, Emanueli C (2017) Transcriptional and Post-transcriptional Gene Regulation by Long Non-coding RNA. Genomics, Proteomics \u0026amp; Bioinformatics 15(3):177-186. http://doi.org/10.1016/j.gpb. 2016. 12.005\u003c/li\u003e\n\u003cli\u003eFagerberg L, Hallstr\u0026ouml;m BM, Oksvold P et al (2014) Analysis of the human tissue-specific expression by genome-wide integration of transcriptomics and antibody-based proteomics. Molecular \u0026amp; Cellular Proteomics : MCP 13:397-406. http://doi.org/10.1074/mcp.M113.035600\u003c/li\u003e\n\u003cli\u003eFei X, Jin M, Yuan Z, Li T, Lu Z, Wang H, Lu J, Quan K, Yang J, He M, Wang T, Wang Y, Wei C (2023) MiRNA-Seq reveals key MicroRNAs involved in fat metabolism of sheep liver. Front Genet 14:985764. http://doi.org/10.3389/fgene.2023.985764\u003c/li\u003e\n\u003cli\u003eHata K, Nishimura R, Ikeda F et al (2003) Differential roles of Smad1 and p38 kinase in regulation of peroxisome proliferator-activating receptor gamma during bone morphogenetic protein 2-induced adipogenesis. Mol Biol Cell 14:545-555. https://doi.org/10.1091/mbc.e02-06-0356\u003c/li\u003e\n\u003cli\u003eLiao Z, Tang S, Nozawa K, Shimada K, Ikawa M, Monsivais D, Matzuk M (2024) Affinity-tagged SMAD1 and SMAD5 mouse lines reveal transcriptional reprogramming mechanisms during early pregnancy. Elife 12. https://doi.org/10.7554/eLife.91434\u003c/li\u003e\n\u003cli\u003eLiu Y, Ding W, Yu W, Zhang Y, Ao X, Wang J (2021) Long non-coding RNAs: Biogenesis, functions, and clinical significance in gastric cancer. Molecular Therapy Oncolytics 23:458-476. https:// doi.org/ 10.1016/j.omto.2021.11.005\u003c/li\u003e\n\u003cli\u003eLou Y, Liu L, Zhan L, Wang X, Fan H (2016) miR-187-5p Regulates Cell Growth and Apoptosis in Acute Lymphoblastic Leukemia via DKK2. Oncol Res 24(2):89-97. https://doi.org/10.3727/096504016 X14597766487753\u003c/li\u003e\n\u003cli\u003eMu\u0026ntilde;oz M, Garc\u0026iacute;a-Casco JM, Caraballo C, Fern\u0026aacute;ndez-Barroso M\u0026Aacute;, S\u0026aacute;nchez-Esquiliche F, G\u0026oacute;mez F, Rodr\u0026iacute;guez MDC, Sili\u0026oacute; L (2018) Identification of Candidate Genes and Regulatory Factors Underlying Intramuscular Fat Content Through Longissimus Dorsi Transcriptome Analyses in Heavy Iberian Pigs. Front Genet 9:608. https://doi.org/10.3389/fgene.2018.00608\u003c/li\u003e\n\u003cli\u003eMurugaiyan K, Amirthalingam S, Hwang NS, Jayakumar R (2023) Role of FGF-18 in Bone Regeneration. J Funct Biomater 14(1). https://doi.org/10.3390/jfb14010036\u003c/li\u003e\n\u003cli\u003eOo JA, Brandes RP, Leisegang MS (2022) Long non-coding RNAs: novel regulators of cellular physiology and function. Pflugers Archiv: European Journal of Physiology 474(2):191-204. https://doi.org/10.1007/s00424-021-02641-z\u003c/li\u003e\n\u003cli\u003ePapaconstantinou I, Karakatsanis A, Gazouli M, Polymeneas G, Voros D (2012) The role of microRNAs in liver cancer. Eur J Gastroen Hepat 24(3):223-228. https://doi.org/10.1097/MEG.0b013e328 3505063\u003c/li\u003e\n\u003cli\u003ePark SJ, Beak S, Jung DJS, Kim SY, Jeong IH, Piao MY, Kang HJ, Fassah DM, Na SW, Yoo SP, Baik M (2018) Genetic, management, and nutritional factors affecting intramuscular fat deposition in beef cattle - A review. Asian Austral J Anim 31(7):1043-1061. https://doi.org/10.5713/ajas.18.0310\u003c/li\u003e\n\u003cli\u003ePeng W, Sha H, Sun X, Zou R, Zhu Y, Zhou G, Feng J (2020) Role and mechanism of miR-187 in human cancer. Am J Transl Res 12(9):4873-4884\u003c/li\u003e\n\u003cli\u003eQimuge N, He Z, Qin J, Sun Y, Wang X, Yu T, Dong W, Yang G, Pang W (2019) Overexpression of DNMT3A promotes proliferation and inhibits differentiation of porcine intramuscular preadipocytes by methylating p21 and PPARg promoters. Gene 696:54-62. https://doi.org/10.1016/ j.gene.2019.02.029\u003c/li\u003e\n\u003cli\u003eQin J, Sun Y, Liu S, Zhao R, Zhang Q, Pang W (2019) MicroRNA-323-3p promotes myogenesis by targeting Smad2. J Cell Biochem 120(11):18751-18761. https://doi.org/10.1002/jcb.29187\u003c/li\u003e\n\u003cli\u003eSong E, Xing L, Wang L, Song W, Li D, Wang Y, Gu Y, Liu M, Ni W, Zhang P, Ma X, Zhang X, Yao J, Chen Y, An R (2019) LncRNA ADAMTS9-AS2 inhibits cell proliferation and decreases chemoresistance in clear cell renal cell carcinoma via the miR-27a-3p/FOXO1 axis. Aging 11(15):5705-5725. https://doi.org/10.18632/aging.102154\u003c/li\u003e\n\u003cli\u003eStatello L, Guo C, Chen L, Huarte M (2021) Gene regulation by long non-coding RNAs and its biological functions. Nature Reviews. Molecular Cell Biology 22(2):96-118. https://doi.org/10.1038/s41580-020-00315-9\u003c/li\u003e\n\u003cli\u003eSun Y, Cai R, Wang Y, Zhao R, Qin J, Pang W (2020) A Newly Identified LncRNA LncIMF4 Controls Adipogenesis of Porcine Intramuscular Preadipocyte through Attenuating Autophagy to Inhibit Lipolysis. Animals : An Open Access Journal From MDPI 10(6). https://doi.org/10.3390/ ani10060926\u003c/li\u003e\n\u003cli\u003eSun Y, Chen X, Qin J, Liu S, Zhao R, Yu T, Chu G, Yang G, Pang W (2018) Comparative Analysis of Long Noncoding RNAs Expressed during Intramuscular Adipocytes Adipogenesis in Fat-Type and Lean-Type Pigs. J Agr Food Chem 66(45):12122-12130. https://doi.org/10.1021/acs.jafc.8b04243\u003c/li\u003e\n\u003cli\u003eWang L, Zhou Z, Zhang T, Zhang L, Hou X, Yan H, Wang L (2021) IRLnc: a novel functional noncoding RNA contributes to intramuscular fat deposition. Bmc Genomics 22(1):95. https://doi.org/10.1186/ s12864-020-07349-5\u003c/li\u003e\n\u003cli\u003eWood JD, Enser M, Fisher AV, Nute GR, Sheard PR, Richardson RI, Hughes SI, Whittington FM (2008) Fat deposition, fatty acid composition and meat quality: A review. Meat Sci 78(4):343-358. https://doi.org/10.1016/j.meatsci.2007.07.019\u003c/li\u003e\n\u003cli\u003eXiong Y, Yue F, Jia Z, Gao Y, Jin W, Hu K, Zhang Y, Zhu D, Yang G, Kuang S (2018) A novel brown adipocyte-enriched long non-coding RNA that is required for brown adipocyte differentiation and sufficient to drive thermogenic gene program in white adipocytes. Biochimica Et Biophysica Acta. Molecular and Cell Biology of Lipids 1863(4):409-419. https://doi.org/10.1016/j.bbalip. 2018.01.008\u003c/li\u003e\n\u003cli\u003eXu Z, Yang F, Wei D, Liu B, Chen C, Bao Y, Wu Z, Wu D, Tan H, Li J, Wang J, Liu J, Sun S, Qu L, Wang L (2017) Long noncoding RNA-SRLR elicits intrinsic sorafenib resistance via evoking IL-6/STAT3 axis in renal cell carcinoma. Oncogene 36(14):1965-1977. https://doi.org/10.1038/onc.2016.356\u003c/li\u003e\n\u003cli\u003eYi X, He Z, Tian T, Kou Z, Pang W (2023) LncIMF2 promotes adipogenesis in porcine intramuscular preadipocyte through sponging MiR-217. Anim Biotechnol 34(2):268-279. https://doi.org/10.1080/ 10495398.2021.1956509\u003c/li\u003e\n\u003cli\u003eZhang M, Ma X, Zhai Y, Zhang D, Sui L, Li W, Jiang R, Han R, Li G, Li Z, Wang Y, Tian Y, Kang X, Sun G (2020) Comprehensive Transcriptome Analysis of lncRNAs Reveals the Role of lncAD in Chicken Intramuscular and Abdominal Adipogenesis. J Agr Food Chem 68(11):3678-3688. https://doi.org/10.1021/acs.jafc.9b07405\u003c/li\u003e\n\u003cli\u003eZhang P, Wu S, He Y, Li X, Zhu Y, Lin X, Chen L, Zhao Y, Niu L, Zhang S, Li X, Zhu L, Shen L (2022) LncRNA-Mediated Adipogenesis in Different Adipocytes. International Journal of Molecular Sciences 23(13). https://doi.org/10.3390/ijms23137488\u003c/li\u003e\n\u003cli\u003eZhao T, Zhao R, Yi X, Cai R, Pang W (2022) METTL3 promotes proliferation and myogenic differentiation through m6A RNA methylation/YTHDF1/2 signaling axis in myoblasts. Life Sci 298:120496. https://doi.org/10.1016/j.lfs.2022.120496\u003c/li\u003e\n\u003cli\u003eZhou J, Zhang Y, Wu J, Qiao M, Xu Z, Peng X, Mei S (2021) Proteomic and lipidomic analyses reveal saturated fatty acids, phosphatidylinositol, phosphatidylserine, and associated proteins contributing to intramuscular fat deposition. J Proteomics 241:104235. https://doi.org/10.1016/j.jprot.2021. 104235\u003c/li\u003e\n\u003cli\u003eZhou Z, Qi D, Gan Q, Wang F, Qin B, Li J, Wang H, Wang D (2021) Studies on the Regulatory Roles and Related Mechanisms of lncRNAs in the Nervous System. Oxid Med Cell Longev 2021:6657944. https://doi.org/10.1155/2021/6657944\u003c/li\u003e\n\u003cli\u003eZhu W, Zhang M, Chang L, Zhu W, Li C, Xie F, Zhang H, Zhao T, Jiang J (2019) Characterizing the composition, metabolism and physiological functions of the fatty liver in Rana omeimontis tadpoles. Front Zool 16:42. https://doi.org/10.1186/s12983-019-0341-x\u003c/li\u003e\n\u003cli\u003eZuo Y, Zhang Y, Zhang R, Tian J, Lv X, Li R, Li S, Cheng M, Shan J, Zhao Z, Xin H (2022) Ferroptosis in Cancer Progression: Role of Noncoding RNAs. Int J Biol Sci 18(5):1829-1843. https://doi.org/10.7150/ijbs.66917\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"biochemical-genetics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bigi","sideBox":"Learn more about [Biochemical Genetics](http://link.springer.com/journal/10528)","snPcode":"10528","submissionUrl":"https://submission.nature.com/new-submission/10528/3","title":"Biochemical Genetics","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Pig, LncIMF1, miR-187, Intramuscular fat, Adipogenesis","lastPublishedDoi":"10.21203/rs.3.rs-4629942/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4629942/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eIntramuscular fat, which is closely related to the traits of tenderness, juiciness, and flavor of pork, was regulated by numerous molecular regulatory mechanisms that have been regarded as an important agricultural research area. Long noncoding RNAs (lncRNAs) are emerging regulators involved in adipogenesis due to their functional diversity. In this study, we identified a novel lncRNA related to porcine adipogenesis, named lncIMF1, based on previous RNA sequencing results. Our results suggested that lncIMF1 was most abundantly expressed in adipose tissue and located in both the cytoplasm and nucleus. Besides, lncIMF1 promoted the proliferation and differentiation, while inhibited apoptosis of intramuscular preadipocytes. Moreover, lncIMF1 could act as a molecular sponge for miR-187, inhibiting the binding of miR-187 and \u003cem\u003eSMAD1\u003c/em\u003e, thereby promoting the expression of \u003cem\u003eSMAD1\u003c/em\u003e and enhancing the adipogenic differentiation of intramuscular preadipocytes. Additionally, we found that lncIMF1-miR187-SMAD1 axis could activate the p38-MAPK pathway. Taken together, our study provided new insights into the role of lncRNAs in the regulation of pork quality.\u003c/p\u003e","manuscriptTitle":"LncIMF1 promotes adipogenesis of porcine intramuscular preadipocyte by sponging miR-187","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-17 11:38:49","doi":"10.21203/rs.3.rs-4629942/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-11-03T08:09:20+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-11-03T07:38:53+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-11-02T08:39:02+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-11-01T14:10:17+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-11-01T01:51:24+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-10-30T13:47:24+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"196071981348565637841758484894765693990","date":"2024-10-27T02:33:46+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"283889551287260411043713473819801328725","date":"2024-10-25T08:59:30+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"218222106974116372272220951026060347787","date":"2024-10-24T13:34:58+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"107735164028430269208529962932974664198","date":"2024-10-24T11:47:12+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"106605266397031839318196850312592387552","date":"2024-10-24T10:04:19+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-10-24T03:48:08+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"260200034645759320504061441255426377071","date":"2024-10-24T02:10:42+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"157145701165665579601609966421010882385","date":"2024-10-23T15:00:46+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"55097017008078098248716200699486778375","date":"2024-10-23T12:12:27+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"273898961896405179146243677411494958515","date":"2024-10-23T08:43:11+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"319069697295534058795431998825973402830","date":"2024-10-23T08:34:41+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"138774451406670171734947632478305114796","date":"2024-10-22T12:05:46+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"82351996511119088894754675132624348996","date":"2024-10-22T05:52:37+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-07-17T20:13:24+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-06-25T11:55:28+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-06-25T11:54:14+00:00","index":"","fulltext":""},{"type":"submitted","content":"Biochemical Genetics","date":"2024-06-24T11:46:06+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"biochemical-genetics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bigi","sideBox":"Learn more about [Biochemical Genetics](http://link.springer.com/journal/10528)","snPcode":"10528","submissionUrl":"https://submission.nature.com/new-submission/10528/3","title":"Biochemical Genetics","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"e8656a4a-005a-4f05-a39e-bb6cb46990df","owner":[],"postedDate":"July 17th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-02-24T16:04:10+00:00","versionOfRecord":{"articleIdentity":"rs-4629942","link":"https://doi.org/10.1007/s10528-025-11061-y","journal":{"identity":"biochemical-genetics","isVorOnly":false,"title":"Biochemical Genetics"},"publishedOn":"2025-02-17 15:57:58","publishedOnDateReadable":"February 17th, 2025"},"versionCreatedAt":"2024-07-17 11:38:49","video":"","vorDoi":"10.1007/s10528-025-11061-y","vorDoiUrl":"https://doi.org/10.1007/s10528-025-11061-y","workflowStages":[]},"version":"v1","identity":"rs-4629942","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4629942","identity":"rs-4629942","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00