Decoding In-Cell Respiratory Enzyme Dynamics by Label-Free In-situ Electrochemistry | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Decoding In-Cell Respiratory Enzyme Dynamics by Label-Free In-situ Electrochemistry Yoshihide Tokunou, Tomohiko Yamazaki, Akihiro Okamoto This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4306846/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Deciphering metabolic enzyme catalysis in living cells remains a formidable challenge due to the limitations of in vivo assays, which focus on enzymes isolated from respiration. This study introduces an innovative whole-cell electrochemical assay to reveal the Michaelis-Menten landscape of metabolic enzymes amid complex molecular interactions. We controlled the microbial current generation's rate-limiting step, extracting in vivo kinetic parameters ( K m , K i , and k cat ) for the periplasmic nitrite and fumarate (FccA) reductases. Despite deleting CymA, a key electron donor, alternative electron transfer pathways sustained the FccA activity. This enabled direct observation of FccA-CymA interaction, uncovering the pivotal role of CymA in altering the post-binding dynamics of FccA, such as catalysis and product release. This finding challenges the long-held belief that the molecular crowding effect primarily drives discrepancies between in vivo and in vitro kinetics. This work offers significant leap in understanding cellular enzymatic processes and opens avenues for future biochemical research. Biological sciences/Biochemistry/Biophysical chemistry Biological sciences/Biochemistry/Biocatalysis Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Electron transfer in cellular respiration, vital to all living organisms, operates through a complex and synchronized network of molecular interactions. Traditional in vitro experiments have provided substantial insights into enzymatic reaction kinetics and protein structures, yet often fall short of replicating the intricate in vivo cellular milieu 1–3 . This discrepancy has fueled ongoing debates in enzymology regarding the impact of physiological states and macromolecular crowding on enzymatic behavior 4, 5 . Techniques to characterize in vivo enzymatic reaction kinetics have evolved, yet their application remains limited, often restricted to specific proteins and hindered by the complexities of cellular environments 6–9 . A particularly challenging aspect is the elucidation of inter-protein interactions within the respiratory electron transfer chain, which is pivotal for biological energy generation. Existing methods struggle to capture the enzyme catalysis in the presence of specific inter-protein interactions without potentially altering enzymatic functions or associated electron and cation kinetics 6–9 . In the present study, we develop a groundbreaking label-free electrochemical approach to directly observe respiratory enzyme kinetics within intact bacteria. This method circumvents the limitations of traditional bioelectrochemical techniques, which, despite their sensitivity and resolution, are impeded by the insulating properties of cellular membranes when applied to intracellular enzymes. Employing Shewanella oneidensis MR-1, renowned for its c -type cytochrome complexes (Cyts) on the outer membrane that facilitate electron transfer between intracellular enzymes and extracellular electrodes 10, 11 , we developed a protocol for quantifying intracellular enzyme kinetics. Specifically, we utilized riboflavin to enhance electron transport through these cytochrome complexes to set the rate-limiting step as the intracellular enzymatic reaction 12, 13 . By focusing on nitrite reductase (NrfA) and fumarate reductase (FccA), and examining their interactions with the electron donor hub protein CymA, we elucidate how these interactions influence their Michaelis Menten kinetics. Through this platform, we offer a first-of-its-kind insight into the in vivo kinetics of respiratory enzymes and their inter-protein interactions, significantly advancing our methodology for understanding the complex symphony of cellular respiration. Results Shifting rate-limiting step to couple the current generation with metabolic enzymatic reactions We first elucidated the direct correlation between intracellular enzymatic reactions and current production in Shewanella oneidensis MR-1, focusing on the nitrite (NO 2 − ) reduction. Utilizing a whole-cell electrochemical setup with MR-1 cells adsorbed on an indium tin-doped oxide (ITO) electrode within a three-electrode system (see experimental) 14 , we aimed to monitor the kinetics of nitrite reduction mediated by the NrfA protein, the sole nitrite reductase in the periplasmic space (Fig. 1 a) 15, 16 . Under anaerobic conditions, in the presence of nitrite and 10 µM riboflavin, we observed a stable microbe-electrode interface, with no significant change in the number of viable MR-1 cells over an hour (Figs. 1 b and Figure S1 ). The addition of 10 µM riboflavin was chosen based on its proven efficacy in significantly enhancing electron transfer through outer-membrane Cyts, particularly OmcA, by facilitating bound hydroquinone formation 12 . The effect of riboflavin was validated in our electrochemical setup, where it was observed to markedly accelerate the cathodic current upon the introduction of 0.1 mM nitrite under a constant potential of − 0.45 V vs. standard hydrogen electrode, SHE (Fig. 1 c). This effect was absent without riboflavin, where the cathodic current remained minimal. The linear relationship between the number of electrons delivered and nitrite consumed, with a correlation coefficient (R 2 ) of 0.99 (Fig. 1 e), underscores the role of riboflavin in coupling cathodic current to the nitrite reduction reaction. Accordingly, the delivered electron and consumed nitrite ratio were compared, representing 5.92 ± 0.40 e − /nitrite, which is stoichiometrically relevant with NrfA catalysis reducing nitrite to ammonia (6 e − /1 nitrite) (Figs. 1 e and S2). Notably, the Δ nrfA mutant exhibited negligible current upon nitrite addition, affirming NrfA's attribution for the observed cathodic current increase (Figs. 1 c and S3). Further, cyclic voltammetry (CV) revealed that the rate-limiting step shifted to nitrite reduction following riboflavin addition, with a clear cathodic current increase at an onset potential of − 0.23 V (vs. SHE) in the presence of nitrite and riboflavin (Fig. 2 a). This onset potential aligns with the enhanced electron transfer capabilities of cytochromes mediated by riboflavin 12 . The concentration-dependent increase in cathodic current with nitrite in the presence of riboflavin (Fig. 2 a), versus the absence of such dependency without riboflavin (Fig. 2 a inset), illustrates that nitrite reduction at NrfA limits the cathodic current in the presence of riboflavin. Similarly, the addition of 1.0 mM fumarate in the presence of 10 µM riboflavin resulted in an immediate cathodic current increase of about − 115 µA, a response absent in the Δ fccA mutant (Figs. 1 d and S3), indicating FccA's role in fumarate reduction. The stoichiometric correlation between cathodic current and fumarate consumption (2.06 ± 0.33 e − /fumarate) closely matches the theoretical reduction ratio (Figs. 1 e and S2). Furthermore, the cathodic current in CV also increased with fumarate concentration in the presence of riboflavin (Fig. 2 b), demonstrating the coupling of microbial current production with intracellular enzyme catalysis in the presence of riboflavin. This coupling was not observed without riboflavin (Fig. 2 b inset), highlighting the essential role of riboflavin in facilitating intracellular enzymatic reactions and their corresponding electrochemical signatures. Michaelis-Menten analysis of intracellular NrfA and FccA catalysis To characterize the kinetic properties of intracellular NrfA using whole-cell electrochemistry, we analyzed the cathodic current at various concentrations as reported for purified NrfA with the Michaelis-Menten Eq. 1 7 . The cathodic current in the presence of riboflavin gradually decreased at higher concentrations than 400 µM (Figure S4), characteristic of purified NrfA protein exhibiting substrate inhibition at high nitrite concentration 17 . This trend is evident by plotting the nitrite reduction kinetics against the concentration of nitrite (Fig. 3 a). Nitrite reduction kinetics is calculated from the limiting current (the cathodic current at − 0.80 V vs. SHE in CV following subtraction by the cathodic currents in the absence of nitrite) and the amount of NrfA present in the MR-1 cells attached on each ITO electrode quantified by liquid chromatography-mass spectrometry (LC-MS) analysis (4.63 ± 0.55 pmol). $$\text{v}=\frac{{\text{V}}_{\text{m}\text{a}\text{x}}\left[\text{S}\right]}{{K}_{m}+\left[\text{S}\right](1+[\text{S}]/{K}_{i})} \left(\text{E}\text{q} 1\right)$$ Equation 1 is a Michaelis-Menten model in which a second substrate molecule binds to inhibit the enzyme that applies to purified NrfA protein 17 . K m and K i are Michaelis constant and inhibition constant, and V max and [S] are maximum turnover rate and nitrite concentration, respectively. The plots of nitrite reduction kinetics were fitted with this model (Fig. 3 a), demonstrating that intracellular NrfA shows reaction kinetics following the Michaelis-Menten equation as with the purified one. K m , K i , and V max were determined to be 63.0 ± 13.7 µM, 19.7 ± 3.2 mM, and 94.5 ± 16.8 pmol s − 1 , respectively (Figs. 3 b and 3 c). k cat (turnover number) of NrfA was calculated to be 20.4 ± 4.37 s − 1 (Table 1 ). The K m and K i of NrfA in an intact cell were almost identical to those of purified NrfA protein immobilized on electrodes: 54 ± 12 µM for K m and 18 ± 4 mM for K i (Figs. 3 b and 3 c) 17 . In contrast, the kinetics of FccA differed significantly from analogous purified proteins. The plot of fumarate reduction kinetics against fumarate concentration showed non-proportional relationships following a Michaelis-Menten curve (Fig. 3 d). Hanes-Woolf plots were made to quantify K m of intracellular FccA (Fig. 3 e). $$\text{v}=\frac{{\text{V}}_{\text{m}\text{a}\text{x}}\left[\text{S}\right]}{{K}_{m}+\left[\text{S}\right]} (\text{E}\text{q} 2, \text{M}\text{i}\text{c}\text{h}\text{a}\text{e}\text{l}\text{i}\text{s}-\text{M}\text{e}\text{n}\text{t}\text{e}\text{n} \text{e}\text{q}\text{u}\text{a}\text{t}\text{i}\text{o}\text{n})$$ $$\frac{\left[\text{S}\right]}{\text{v}}=\frac{\left[\text{S}\right]}{{\text{V}}_{\text{m}\text{a}\text{x}}}+\frac{{K}_{m}}{{\text{V}}_{\text{m}\text{a}\text{x}}} (\text{E}\text{q} 3, \text{H}\text{a}\text{n}\text{e}\text{s}-\text{W}\text{o}\text{o}\text{l}\text{f} \text{p}\text{l}\text{o}\text{t}\text{s})$$ K m and V max were revealed to be 161 ± 23.6 µM and 751 ± 72.0 pmol s − 1 via the linear regression of Hanes-Woolf plots (Figs. 3 f). k cat of FccA was 182 ± 37.4 s − 1 (Table 1 ). The K m value of purified FccA protein has been reported to be below 50 µM 18 and analogous fumarate reductase from Shewanella frigidimarina (with 59% amino acid sequence identity 19 ) showed K m of 21 µM or 6 µM 20, 21 . These values are significantly lower than the K m of FccA in the cells (Fig. 3 f). The potential discrepancy between the bulk and the periplasmic fumarate concentration was investigated by increasing the membrane permeability with polymyxin B. This substance creates pores in the cell’s outer membrane, allowing polypeptides to pass through 22 . In our study, MR-1 cells supplemented with riboflavin were treated with 6.0 mg L − 1 polymyxin B, a dose known to increase their membrane permeability 23 . CV showed that the cathodic current response to fumarate was similar, regardless of polymyxin B treatment until 900 µM (Figure S5). The antibiotic effect of polymyxin B may explain the current reduction at the higher concentrations. Analysis of the data, including linear regression of Hanes-Woolf plots, yielded a K m of 179 ± 14.0 µM (Figs. 3 e and f), suggesting that differences in enzyme kinetics between in vivo and purified conditions are not primarily due to the periplasmic space effects on localized substrate concentration. This indicates that factors other than the periplasmic concentration contribute to the kinetic discrepancies observed between purified enzymes and those functioning within cellular environments. The impact of inter-protein interaction on K m in intact cells Despite previous reports suggesting crowding effects on the periplasmic enzyme reactions 24 , our observations indicate that such effects are minimal for FccA. This inference is supported by the consistent kinetics between NrfA in its purified form and within the cell, and the action of polymyxin B, which also releases polynucleotides, suggesting a negligible impact of crowding on FccA activity. Crucially, FccA is known for its specific and strong interaction with CymA 25–27 , a distinct factor with the nonspecific nature of crowding effects. To elucidate the influence of inter-protein interactions on in vivo enzyme kinetics, we investigated the Δ cymA mutant strain, which lacks the CymA protein, a key component in the electron transfer chain. Upon the addition of nitrite, the Δ cymA mutant strain exhibited an increase in cathodic current similar to that observed in the wild type strain, indicating that the electron transfer mechanism compensates for the absence of CymA in nitrite reduction (Fig. 1 c). However, upon introducing 1.0 mM fumarate, the cathodic current observed in the Δ cymA strain was notably 10–20% lower than that in the wild type (Fig. 1 d), despite similar fumarate reductase FccA levels in both strains (Table 1 ). This discrepancy underscores a specific limitation in the fumarate reduction pathway attributable to the absence of CymA. Further analysis revealed a concentration-dependent effect of nitrite or fumarate on the cathodic limiting current, confirming FccA and the nitrite reductase NrfA as limiting factors in their respective reduction reactions (Figure S6). While the CymA protein is essential electron donor for FccA under lactate feeding condition in MR-1 25–27 , these data strongly suggest that FccA and NrfA appear to receive electrons more readily from the outer-membrane cytochrome complex MtrCAB or the periplasmic c -type cytochromes such as STC and CcpA, bypassing the need for direct interaction with CymA during the reduction of fumarate and nitrite in the absence of CymA (Fig. 3 g) 28 . Kinetic analysis of the cathodic response to fumarate addition, following Michaelis-Menten kinetics, revealed a significant alteration in the catalytic efficiency of FccA in the Δ cymA strain (Fig. 3 d), with a K m value approximately half that of the wild type (Figs. 3 f and S6). The observed changes in the k cat for fumarate reduction, which decreased by about 47% in the Δ cymA strain (Table 1 ), further emphasize the critical role of the FccA-CymA complex in modulating fumarate reduction kinetics. Conversely, the kinetic parameters, K m and K i , for NrfA in the Δ cymA strain remained nearly identical to those of the wild type (Figs. 3 b and 3 c) and, the k cat for nitrite reduction in the Δ cymA strain was comparable to that of the wild type (Table 1 ), reinforcing the differential impact of CymA on the kinetics of FccA and NrfA. Taken together, these results demonstrate that the formation of the FccA-CymA complex has a critical role in regulating fumarate reduction kinetics. Such a clear indication of FccA activity and FccA-CymA interaction was not visible in conventional metabolite analysis. By measuring fumarate consumption under anaerobic conditions with lactate as the electron donor, without the use of electrodes, we observed significant fumarate reduction in wild type cells (Figure S7). In contrast, the Δ cymA mutant exhibited minimal fumarate reduction over 90 min, whereas the wild type strain nearly exhausted its fumarate supply (Figure S7). This stark difference underscores the critical role of CymA as an essential electron donor for FccA activity when lactate serves as the electron source 29 . Furthermore, the estimated K m value for fumarate reduction in wild type cells (50.4 ± 31.0 µM) was distinct from that determined electrochemically (Figs. 3 f and h). This discrepancy likely stems from the inability of traditional metabolite analysis to precisely identify rate-limiting steps among sequential multiple metabolic reactions, resulting in a less detailed understanding of enzyme kinetics. These findings highlight the superior precision and specificity of electrochemical assays in elucidating intracellular enzyme kinetics. Investigating the impact of CymA on the binding affinity of FccA-fumarate in intact cells To further explore the mechanism for CymA to impact the FccA kinetics, we examined the fumarate binding affinity. K m decreases when k cat decreases or the binding affinity between enzyme and substrate increases (Fig. 4 a). Because the gene deletion of cymA decreased k cat associated with the decrease of K m , it is unclear whether the binding affinity of FccA with fumarate is altered by the interaction with CymA. To test this point, we measured the K i for the fumarate reduction using mesaconic acid as a competitive inhibitor 20 . Because mesaconic acid binds with FccA to block fumarate reduction, K i excludes the information about the turnover rate and reflects the affinity of fumarate to the binding site in FccA. We added a variety of concentrations of mesaconic acid to MR-1 cells on the electrode in the presence of 5.0 mM fumarate and 10 µM riboflavin. The addition of mesaconic acid decreased the cathodic limiting current as shown in the CV in Figure S8a. To quantify the inhibition effect, K i was calculated following the Michaels-Menten equation. $$\text{v}=\frac{{\text{V}}_{\text{m}\text{a}\text{x}}\left[\text{S}\right]}{{K}_{m}(1+[\text{I}]/{K}_{i})+\left[\text{S}\right]} \left(\text{E}\text{q} 4\right)$$ where [I] and K i represent the concentration of mesaconic acid and constant for competitive inhibition, respectively. Eq. 4 provides Eq. 5 as follows. $$\frac{{\text{V}}_{\text{m}\text{a}\text{x}}}{\text{v}}=\frac{{K}_{m}}{{K}_{i}\left[\text{S}\right]}\left[\text{I}\right]+\frac{{K}_{m}+\left[\text{S}\right]}{\left[\text{S}\right]} \left(\text{E}\text{q} 5\right)$$ According to Eq. 5, V max /v linearly increases with [I], providing K m / K i [S] as a slope. Consistently, the plots of V max /v against [I] showed a linear relationship with the squares of the correlation coefficient (R 2 ) of 0.97 (Figs. 4 b and S8), further supporting that mesaconic acid inhibits intracellular FccA. From the slope, K i was revealed to be 583 ± 147 µM (Fig. 4 c). This K i value is slightly larger than that of Δ cymA , 419 ± 150 µM, but Student’s t-tests confirmed no significant difference, while the distinct K i in the purified enzyme suggests the flexible fumarate binding affinity (Fig. 4 c). These data indicate that FccA-CymA interaction likely affects the steps along the reaction pathway after substrate binding, such as product release or a conformational change during catalysis (Fig. 4 d). Purified CymA binds with FccA near a heme that does not directly contact the active site to convert fumarate into succinate 28, 30 . Thus, it is reasonable that the FccA-CymA interaction scarcely affects the binding affinity and influences the post-binding process, including conformational change. Discussion The exploration of electron transfer in respiration, a cornerstone of living systems, has historically been studied through the extraction and separation of partner enzymes 31 . This approach has significantly contributed to our understanding of biochemical reaction mechanisms, yet the analysis of respiratory enzymatic kinetics, especially within living cells, has remained elusive due to methodological limitations, including the absence of systems capable of monitoring electron flux without the need for labeling. In microbial electrochemistry, studying bacteria that can exchange electrons with electrodes—acting as living electrochemical catalysts—has been ongoing for over two decades, primarily within the energy and environmental sectors 32, 33 . These studies have largely focused on the mechanisms of interfacial electron transfer and the elucidation of respiratory pathways, with less attention given to the kinetics of intracellular enzymes. Our research pivots this focus towards in vivo monitoring of the periplasmic enzyme kinetics in the model electrogenic bacterium, Shewanella oneidensis MR-1. By facilitating electron uptake from a negatively poised electrode through Cyts, we redirected the rate-limiting step from interfacial electron uptake to the reduction of nitrite or fumarate. This innovative approach allowed us to determine in vivo kinetic parameters, including K m , K i , and k cat , for the periplasmic enzymes NrfA and FccA for the first time, revealing similar and distinct kinetics, respectively, between the purified and cellular states of these enzymes. Our findings highlight the profound impact of specific inter-protein interactions on enzyme kinetics, particularly demonstrated by the significant changes in K m and k cat for FccA, but not NrfA, following the deletion of the cymA gene. Because the gene deletion scarcely influenced the K i of FccA with a competitive inhibitor, the interaction between FccA and CymA would primarily accelerate the post-binding process, of which dynamic is difficult to monitor in purified protein systems. This highlights that the transient complex formation of proteins in respiratory electron transfer is pivotal in defining enzymatic catalysis within the cellular context. Furthermore, our study challenges the conventional belief that macromolecular crowding is the primary cause for the difference between in vivo and in vitro enzyme kinetics 4, 5 . By modulating the macromolecular concentration within the periplasmic space using polymyxin B, which allows for the permeation of both fumarate and polypeptides across the outer membrane 22 , we observed that changes in macromolecular crowding did not notably affect enzyme kinetics. This was in stark contrast to the effects seen with the deletion of the cymA gene, which led to a significant decrease in the K m values for FccA, suggesting that the deletion of cymA rather not impact macromolecular crowding but significantly alters enzyme kinetics through changes in inter-protein interactions. The relatively minor abundance of CymA compared to the total biomolecular content within cells 34 , and its capacity to interact flexibly with various proteins in the periplasm 35 further support the conclusion that inter-protein interactions exert a more substantial influence on the kinetics of FccA than previously recognized effects of macromolecular crowding. Whereas the K i of FccA in wild type was almost identical to that in Δ cymA , but was largely different from those for purified fumarate reductase from Shewanella frigidimarina (Fig. 4 c). This reveals that interactions with proteins other than CymA can modulate K i , indicating a complex network of protein interactions affecting FccA's activity. The dual functionality of FccA further illustrates this complexity within cells, which, in association with CymA, may serve not only in its canonical role in fumarate reduction but also as an electron storage mechanism within the periplasmic space (Figure S9) 36 . These dual roles facilitate the temporary storage of respiratory electrons, contributing to forming a proton motive force and transmitting electrons to other enzymes, thereby terminating the reduction reactions of various substrates 36 . This could indicate the importance of specific interprotein interactions in shaping the functional landscape of enzymes within the complex cellular environment. Previous methods for measuring enzymes within cells required the enzymes to function independently to obtain kinetic parameters 6–9 . However, our study has successfully tracked enzyme reactions within the complex network of the respiratory chain at the same level, significantly broadening the range of targets measurable within cells. In this method, we leveraged riboflavin to significantly enhance electron transfer via Cyts. The specificity and high binding affinity of riboflavin to Cyts not only accelerate electron transfer but also enable the quantification of reaction kinetics for enzymes interacting with these proteins. This methodological innovation opens the door to a broader application spectrum by incorporating various redox-active molecules, potentially expanding the range of enzymes amenable to this assay 37 . The integration of synthetic biology, particularly the expression of MR-1 Cyts in alternative bacterial hosts like Escherichia coli 33, 38 , further broadens the scope of observable intracellular electron transfer reactions. However, the current technique may have limitations in monitoring the cytoplasmic enzyme reactions, especially those involving the NAD + /NADH cycle, due to the thermodynamic challenges posed by external electrode-driven reactions 39 . A promising solution lies in the synthetic biology strategy of expressing light-driven proton pumps to facilitate electron input into the cytoplasm, as evidenced in acetoin reduction reactions 39 , suggesting a synergistic potential between electrochemical methods and synthetic biology to explore a wide array of intracellular respiratory enzyme kinetics. Additionally, our research underscores the critical role of the interprotein interaction network in understanding enzymes vital for various applications, from medical drug design to biocatalysis in the food industry, energy devices, and environmental technologies 32, 40, 41 . A notable application of this technique is in quantifying intracellular inhibition or inactivation by antibacterial drugs, offering a more precise assessment than traditional cell viability and growth metrics 42 . This distinction is crucial for minimizing undesirable side effects by accurately identifying drug cytotoxicity versus enzyme inhibition 43 . Moreover, the high time resolution of this enzyme kinetics assay 44 , coupled with the development of high-throughput systems and data-driven approaches 45, 46 , presents a significant improvement over conventional substrate quantification methods, promising a robust framework for evaluating antibacterial drugs efficiently. In conclusion, our study introduces an electrochemical method that captures enzymatic kinetics and interprotein interactions within their cellular context. We've charted the catalytic mechanism landscape in its native environment, offering profound insights into enzyme function and cellular biochemistry. This breakthrough is a significant stride in unraveling the complex symphony of electron transport in cellular respiration. Our approach refines biochemical analysis, improving precision while closely reflecting physiological states, and expands our grasp of biological processes. This sets a new foundation for future research to further elucidate the subtle interplay of enzymes and their networks, offering valuable insights for the broader field of biological sciences. Materials and methods Culture conditions of Shewanella oneidensis MR-1 S. oneidensis MR-1 has grown aerobically in 15 mL Luria-Bertani (LB) medium (20 g L − 1 , Becton Dickinson, Sparks, MD, USA) at 303 K for 24 h. The culture was then centrifuged at 6,000 × g for 10 minutes, and the resultant cell pellet was resuspended in a 15 mL defined medium (DM) supplemented with 10 mM lactate as the sole carbon source. The cells were further cultivated aerobically at 303 K for 12 h. After centrifugation at 6,000 × g for 10 min, the resultant cell pellet was washed once with DM before electrochemical measurement. Electrochemical measurement of Shewanella oneidensis MR-1 cells on ITO electrodes Enzyme redox kinetics was monitored using a single-chamber three-electrode system 14 . The reactor comprised an ITO substrate (surface area of 3.1 cm 2 ) located at the bottom of the reactor, Ag/AgCl (KCl saturated), and a platinum wire, which were used as working, reference, and counter electrodes, respectively. Four milliliters of DM containing lactate (10 mM) was deaerated by bubbling with N 2 in the reactor and then maintained at 303 K without agitation. A cell suspension of S. oneidensis MR-1 with an optical density at λ = 600 nm (OD 600 ) of 0.1 was inoculated into the reactor. The constant potential was applied at + 0.40 V (vs. SHE) for 25 h using automatic polarization systems (PS-08, TOHO Technical Research Co., Ltd.). After confirming that S. oneidensis MR-1 cells are adsorbed on the ITO electrode as described previously 14 , the supernatant in the reactor was replaced, and the ITO electrode was washed with anaerobic DM twice. Cathodic current from S. oneidensis MR-1 cells was monitored at − 0.45 V vs. SHE, and cyclic voltammetry was conducted at a scan rate of 10 mVs − 1 . Confocal fluorescence microscopy For visualization of the cells attached to an ITO electrode ex-situ, we used a confocal laser scanning microscope (LS880, Carl Zeiss) with a 63× water-dipping objective lens. After gently rinsing the surface of the ITO electrodes with PBS buffer, we stained the cells with SYTO 9 and propidium iodide. Finally, we obtained confocal fluorescence images of the stained cells. The excitation and emission wavelengths are 488 nm and 505–545 nm for SYTO 9, and 543 nm and 620–660 nm for propidium iodide. Metabolite analysis 200 µL of supernatant in the electrochemical reactor was collected during constant potential application at − 0.45 V (vs. SHE) in the presence of 0.1 mM nitrite or 1.0 mM fumarate and was subsequently filtered. The concentration of nitrite and fumarate in the supernatant was quantified using an ion chromatograph system (Shimadzu, HIC-20Asuper). Shim-pack IC-A3 (Shimadzu) was used as the column for analysis in anion chromatography kept at 40°C with a flow rate of 1.2 mL/min. The mobile phase comprised 1.11 gL − 1 p -hydroxy benzoic acid, 0.67 gL − 1 Bis-Tris, and 3.09 gL − 1 boric acid. The number of electrons was calculated by subtracting the baseline cathodic current (current without nitrite/fumarate) from the cathodic current in the presence of nitrite/fumarate. Preparation of FccA and NrfA by cell-free protein synthesis FccA (NC_004347.2:c1003324-1001534) and NrfA (AE014299.2:c4117617-4116214) fused with a histidine tag at the C-terminus were expressed by the cell-free protein synthesis system, PUREfrex 2.0, (GeneFrontier, Chiba, Japan) according to the manufacturer’s instructions. The template DNA sequences for cell-free protein synthesis were designed using CodHonEditor (Supplementary Data 1 and 2) to optimize codon usage to E. coli. and synthesized by Eurofins Genomics (Tokyo, Japan). The template DNA contained the 5′-UTR (5′-GAAAT TAATACGACTCACTATA GGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTT AAGAAG GAGATATACCA-structure gene-3′), including the T7 promoter (underlined) and Shine–Dalgarno sequence (double underlined), and the 3′-UTR (5′-structure gene-TAATGAATAACTAATCC-3′). The template DNA was amplified by PCR using primers 5′-GAAATTAATACGACTCACTATAG-3′ and 5′-GGATTAGTTATTCATTAACCAG-3.’ Proteins were synthesized by mixing the template DNA with the PUREfrex reaction mixture at 37°C for 4 h. Synthesized proteins were purified using Ni-Sepharose 6 FF (Cytiva, Marlborough, MA, USA). Purified protein was dialyzed against 50 mM Tris-HCl buffer (pH 8.0). To confirm the purity of the synthesized proteins, the samples were subjected to reduced SDS-PAGE (10–20% w/v gradient gel; ATTO, Tokyo, Japan) and stained with Rapid Stain CBB (Nacalai Tesque, Kyoto Japan). Protein concentrations were quantified using the Micro BCA Protein Assay Kit (Thermo Scientific, Waltham, MA, USA). Quantification of NrfA and FccA in MR-1 cells on ITO electrodes S. oneidensis MR-1 cells were collected from ITO electrodes and washed using 100 mM ammonium bicarbonate buffer. The cells were then homogenized, and the proteins in the lysate were extracted with methanol and chloroform and subsequently solubilized with 8 M urea. The synthesized FccA and NrfA, along with these samples, were subjected to reductive alkylation and trypsin digestion. In the case of NrfA, the fractions corresponding to 45–60 kDa were extracted before reductive alkylation and trypsin digestion, and then the samples were applied to sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The liquid chromatography/mass spectrometry analysis was performed using a nanoadvance LC system (Bruker Daltonics, Bremen, Germany) interfaced with a Q-Exactive Plus Orbitrap mass spectrometer (Thermo Fisher Scientific) via an Advance Captive Spray ionization source (AMR, Tokyo, Japan), as reported previously 47 . The LC process involved loading the peptides onto a trap column (L-column ODS 5µm, Chemical Evaluation and Research Institute Japan, Tokyo, Japan) with Buffer A for concentration and desalting. The samples were then eluted from the trap column and the analytical column (Zaplous α-Pep C18 nano high-performance liquid chromatography [HPLC] column, AMR) with a linear gradient of Buffer B from 5–45% at a flow rate of 500 nL min − 1 (Buffer A: 99.9% distilled water and 0.1% formic acid; Buffer B: 100% acetonitrile). The gradient time for Buffer A to B was 20 and 40 min for FccA and NrfA, respectively. The MS parameters were set as follows: electrospray voltage, 1.2 kV; temperature of the ion transfer tube, 150 ℃; collision energy, 27; threshold of ion selection for MS/MS, 1700 count; mass range at 350 to 2000 m/z, resolution at 70000, and a maximum acquisition time of 60 ms. MS/MS scanning was performed on the top 10 abundant precursor ions with dynamic exclusion for 20 seconds after selection. The raw data was analyzed using Proteome Discoverer 2.4 software (Thermo Fisher Scientific) with an in-house Mascotv.2.5 search engine (Matrix Science, London, UK). The following parameters were used: maximum missed cleavage sites, 2; instrument type; ESI-TRAP, precursor mass tolerance, ten ppm; fragment mass tolerance, 0.02 Da; dynamic modifications, methionine oxidation, static modification, and cysteine carbamidomethyl. All proteins were identified with a false discovery rate of < 1% based on a decoy database search. The amount of NrfA and FccA in each sample was quantified by averaging the abundances of four to six peptide groups, which were quantified using LC-MS (Table S1 ). A calibration curve was created for each peptide group using the synthesized NrfA and FccA, and the abundance of peptide groups contained in each sample was quantified. The average abundance of these four to six peptide groups was taken as the amount of NrfA and FccA in each sample. Estimation of fumarate reduction rate by supernatant sampling S. oneidensis MR-1 cells at OD 600 of 0.2 were inoculated in a sealed bottle containing anaerobic DM with 10 mM lactate and 0 ~ 1.0 mM fumarate. Fumarate in the supernatant was quantified by ion chromatography before and after 10 min incubation. The fumarate consumption rate was approximated as the extent of fumarate decreased during 10 min. Declarations Acknowledgement We thank Prof. Dr. Nobuhiko Nomura for helpful advice. This work was financially supported by JSPS KAKENHI (20K15428), JST ACT-X (JPMJAX211C), JST GteX (JPMJGX23B2), ARIM of MEXT (JPMXP1223NM5212), and the Program for Weaving Diverse Research Skills into an Orchestrated Action to Design Jubilant 100-year Lifetime Society in University of Tsukuba. Author Contributions Y.T. and A.O. designed the study, and Y.T. conducted the experiments. T.Y. synthesized NrfA and FccA. All authors prepared the manuscript and have approved the final version of the manuscript. Ethics declarations Competing interests The authors declare no competing financial interests. References Hartl, F.U. & Hayer-Hartl, M. Converging concepts of protein folding in vitro and in vivo . Nat. Struct. Mol. Biol. 16 , 574-581 (2009). Chen, Y. & Nielsen, J. In vitro turnover numbers do not reflect in vivo activities of yeast enzymes. Proc. Natl. Acad. Sci. U.S.A. 118 , e2108391118 (2021). Minton, A.P. How can biochemical reactions within cells differ from those in test tubes? J. Cell. Sci. 119 , 2863-2869 (2006). McGuffee, S.R. & Elcock, A.H. Diffusion, Crowding & Protein Stability in a Dynamic Molecular Model of the Bacterial Cytoplasm. PLoS Comput. Biol. 6 (3), e1000694 (2010). Zhou, H.X., Rivas, G.N. & Minton, A.P. Macromolecular crowding and confinement: Biochemical, biophysical, and potential physiological consequences. Annu. Rev. Biophys. 37 , 375-397 (2008). Zhang, Y.J. et al. Real-Time Monitoring of NDM-1 Activity in Live Bacterial Cells by Isothermal Titration Calorimetry: A New Approach To Measure Inhibition of Antibiotic-Resistant Bacteria. ACS Infect. Dis. 4 , 1671-1678 (2018). Lv, M. et al. Real-time monitoring of D-Ala-D-Ala dipeptidase activity of VanX in living bacteria by isothermal titration calorimetry. Anal. Biochem. 578 , 29-35 (2019). Huebner, A. et al. Development of quantitative cell-based enzyme assays in microdroplets. Anal. Chem. 80 , 3890-3896 (2008). Zotter, A., Bauerle, F., Dey, D., Kiss, V. & Schreiber, G. Quantifying enzyme activity in living cells. J. Biol. Chem. 292 , 15838-15848 (2017). Hartshorne, R.S. et al. Characterization of an electron conduit between bacteria and the extracellular environment. Proc. Natl. Acad. Sci. U.S.A. 106 , 22169-22174 (2009). Edwards, M.J., White, G.F., Butt, J.N., Richardson, D.J. & Clarke, T.A. The Crystal Structure of a Biological Insulated Transmembrane Molecular Wire. Cell 181 , 665-673 (2020). Okamoto, A., Hashimoto, K. & Nealson, K.H. Flavin Redox Bifurcation as a Mechanism for Controlling the Direction of Electron Flow during Extracellular Electron Transfer. Angew. Chem. Int. Ed. 53 , 10988-10991 (2014). Tokunou, Y., Hashimoto, K. & Okamoto, A. Acceleration of Extracellular Electron Transfer by Alternative Redox-Active Molecules to Riboflavin for Outer-Membrane Cytochrome c of Shewanella oneidensis MR-1. J. Phys. Chem. C 120 , 16168-16173 (2016). Tokunou, Y., Hashimoto, K. & Okamoto, A. Electrochemical Detection of Deuterium Kinetic Isotope Effect on Extracellular Electron Transport in Shewanella oneidensis MR-1. J. Visual. Exp. 134 , 57584 (2018). Heidelberg, J.F. et al. Genome sequence of the dissimilatory metal ion-reducing bacterium Shewanella oneidensis . Nat. Biotechnol. 20 , 1118-1123 (2002). Cruz-Garcia, C., Murray, A.E., Klappenbach, J.A., Stewart, V. & Tiedje, J.M. Respiratory nitrate ammonification by Shewanella oneidensis MR-1. J. Bacteriol. 189 , 656-662 (2007). Judd, E.T., Youngblut, M., Pacheco, A.A. & Elliott, S.J. Direct Electrochemistry of Shewanella oneidensis Cytochrome c Nitrite Reductase: Evidence of Interactions across the Dimeric Interface. Biochemistry 51 , 10175-10185 (2012). Paquete, C.M., Saraiva, I.H. & Louro, R.O. Redox tuning of the catalytic activity of soluble fumarate reductases from Shewanella . Biochim. Biophys. Acta Bioener. 1837 , 717-725 (2014). Tsapin, A.I. et al. Identification of a small tetraheme cytochrome c and a flavocytochrome c as two of the principal soluble cytochromes c in Shewanella oneidensis strain MR-1. Appl. Environ. Microb. 67 , 3236-3244 (2001). Morris, C.J. et al. Purification and properties of a novel cytochrome: flavocytochrome c from Shewanella putrefaciens . Biochem. J. 302 , 587-593 (1994). Pealing, S.L. et al. Spectroscopic and Kinetic Studies of the Tetraheme Flavocytochrome C from Shewanella putrefaciens NCIMB400. Biochemistry 34 , 6153-6158 (1995). Donohuerolfe, A. & Keusch, G.T. Shigella Dysenteriae 1 Cyto Toxin: Periplasmic Protein Releasable by Polymyxin-B and Osmotic Shock. Infect. Immun. 39 , 270-274 (1983). Tokunou, Y., Hashimoto, K. & Okamoto, A. Extracellular Electron Transport Scarcely Accumulates Proton Motive Force in Shewanella oneidensis MR-1. Bull. Chem. Soc. Jpn. 88 , 690-692 (2015). McNulty, B.C., Young, G.B. & Pielak, G.J. Macromolecular crowding in the periplasm maintains α-synuclein disorder. J. Mol. Biol. 355 , 893-897 (2006). Ross, D.E., Flynn, J.M., Baron, D.B., Gralnick, J.A. & Bond, D.R. Towards Electrosynthesis in Shewanella : Energetics of Reversing the Mtr Pathway for Reductive Metabolism. PLoS One 6 (2), e16649 (2011). Marritt, S.J. et al. The roles of CymA in support of the respiratory flexibility of Shewanella oneidensis MR-1. Biochem. Soc. Trans. 40 , 1217-1221 (2012). McMillan, D.G.G. et al. Protein-Protein Interaction Regulates the Direction of Catalysis and Electron Transfer in a Redox Enzyme Complex. J. Am. Chem. Soc. 135 , 10550-10556 (2013). Fonseca, B.M. et al. Mind the gap: cytochrome interactions reveal electron pathways across the periplasm of Shewanella oneidensis MR-1. Biochem. J. 449 , 101-108 (2013). Myers, C.R. & Myers, J.M. Cloning and sequence of cymA , a gene encoding a tetraheme cytochrome c required for reduction of iron(III), fumarate, and nitrate by Shewanella putrefaciens MR-1. J. Bacteriol. 179 , 1143-1152 (1997). Leys, D. et al. Structure and mechanism of the flavocytochrome c fumarate reductase of Shewanella putrefaciens MR-1. Nat. Struct. Biol. 6 , 1113-1117 (1999). Hirst, J. Mitochondrial Complex I. Annu. Rev. Biochem., 82 , 551-575 (2013). Logan, B.E. et al. Microbial fuel cells: Methodology and technology. Environ. Sci. Technol. 40 , 5181-5192 (2006). Atkinson, J.T. et al. Real-time bioelectronic sensing of environmental contaminants. Nature 611 , 548-553 (2022). Vellingiri, A. et al. Overexpression of c -type cytochrome, CymA in MR-1 for enhanced bioelectricity generation and cell growth in a microbial fuel cell. J. Chem. Technol. Biotechnol. 94 , 2115-2122 (2019). Marritt, S.J. et al. A functional description of CymA, an electron-transfer hub supporting anaerobic respiratory flexibility in Shewanella . Biochem. J. 444 , 465-474 (2012). Schuetz, B., Schicklberger, M., Kuermann, J., Spormann, A.M. & Gescher, J. Periplasmic Electron Transfer via the c -Type Cytochromes MtrA and FccA of Shewanella oneidensis MR-1. Appl. Environ. Microb. 75 , 7789-7796 (2009). Ciemniecki, J.A. & Newman, D.K. NADH dehydrogenases are the predominant phenazine reductases in the electron transport chain of Pseudomonas aeruginosa . Mol. Microbiol. 119 (5), 560-573 (2023). Baruch, M., Tejedor-Sanz, S., Su, L. & Ajo-Franklin, C.M. Electronic control of redox reactions inside using a genetic module. PLoS One 16 (11), e0258380 (2021). Tefft, N.M. & TerAvest, M.A. Reversing an Extracellular Electron Transfer Pathway for Electrode Driven Acetoin Reduction. ACS Synth. Biol. 8 , 1590-1600 (2019). Pedersen, M.B., Gaudu, P., Lechardeur, D., Petit, M.A. & Gruss, A. Aerobic Respiration Metabolism in Lactic Acid Bacteria and Uses in Biotechnology. Annu. Rev. Food Sci. T 3 , 37-58 (2012). Lobritz, M.A. et al. Antibiotic efficacy is linked to bacterial cellular respiration. Proc. Natl. Acad. Sci. U.S.A. 112 , 8173-8180 (2015). Mouton, J.W. et al. MIC-based dose adjustment: facts and fables. J. Antimicrob. Chemoth. 73 , 564-568 (2018). Greis, K.D. et al. Development and validation of a whole-cell inhibition assay for bacterial methionine aminopeptidase by surface-enhanced laser desorption ionization-time of flight mass spectrometry. Antimicrob. Agents Chemother. 49 , 3428-3434 (2005). Leger, C. & Bertrand, P. Direct electrochemistry of redox enzymes as a tool for mechanistic studies. Chem. Rev. 108 , 2379-2438 (2008). Tahernia, M. et al. A 96-well high-throughput, rapid-screening platform of extracellular electron transfer in microbial fuel cells. Biosens. Bioelectron. 162 (15), 112259 (2020). Miran, W., Huang, W., Long, X., Imamura, G. & Okamoto, A. Multivariate landscapes constructed by Bayesian estimation over five hundred microbial electrochemical time profiles. Patterns 3 , 100610 (2022). Yabe, Y. et al. Comparative proteome analysis of the ligamentum flavum of patients with lumbar spinal canal stenosis. JOR Spine. 5 (4), e1210 (2022). Table Table 1 Turnover number ( k cat ) of NrfA and FccA in MR-1 cells on ITO electrodes. V max / pmol s − 1 The amount of proteins on an ITO electrode /pmol k cat /s − 1 NrfA in wild-type 94.5 ± 16.8 4.12 ± 0.75 20.4 ± 4.37 NrfA in Δ cymA 97.8 ± 13.6 5.00 ± 0.66 16.3 ± 2.46 Purified NrfA - - 7 ± 2 FccA in wild-type 751 ± 72.0 4.63 ± 0.55 182 ± 37.4 FccA in Δ cymA 484 ± 128 6.01 ± 0.35 96.9 ± 28.6 Purified FccA - - 250 The k cat of purified NrfA and FccA were cited from ref. 17 and ref. 20 respectively. Additional Declarations There is NO Competing Interest. Supplementary Files SupplementaryData1templateDNAsequenceNrfAHistag.pdf Dataset 1 SupplementaryData2templateDNAsequenceFccAHistag.pdf Dataset 2 SI.docx Supplementary information Graphicalabstract.png Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4306846","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":297353123,"identity":"b574e8b3-0951-4115-9874-ab5ee8c792c4","order_by":0,"name":"Yoshihide Tokunou","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABS0lEQVRIie2RMUvDQBiGv1BIltOuF0KNPyGhoJa09K8kBC6LQkGQDlIyXZZi1uu/yOhmIBCXQ3ALdKkImQVBFEG8JLXGNoOjYJ7p4948995dAFpa/iRybXJ8LPnF+LRe6KwjuyagRkViAPh3ivi+VDpoS6kzVijRJtMEjNsgXz1cn/RCUO6fRxRmOiMiugS960O+qrWgNNUYFwrnx4bDcX/ho3PtjAI2MiKiFEwWg2fUFOxRbY8KJTuVsUOxE8XIrpQiQuK0EQDBjYqXl8pNjNz3gVB0VigfMN5RRHul2EdVCyipJgkFsjICZ1vhqWsh7iGV81LpswTJg/kdViOeu9biCrss+XEXJaDmEk2tg33xYuobnfXCIHjMXi+GXT0g5nLyMhyFwZzUXmzTdhh/jR1UbLk5CS5WSMP/Ad3/bt7ZUkmblJaWlpb/wicCxHVOrqnSOwAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0002-0983-6176","institution":"Faculty of Life and Environmental Sciences, University of Tsukuba","correspondingAuthor":true,"prefix":"","firstName":"Yoshihide","middleName":"","lastName":"Tokunou","suffix":""},{"id":297353125,"identity":"ec2af12d-b346-4015-bd4b-458133b0545d","order_by":1,"name":"Tomohiko Yamazaki","email":"","orcid":"","institution":"Research Center for Macromolecules and Biomaterials, National Institute for Materials Science","correspondingAuthor":false,"prefix":"","firstName":"Tomohiko","middleName":"","lastName":"Yamazaki","suffix":""},{"id":297353127,"identity":"5f7a774e-0824-4f37-9f08-5d66bee71b5b","order_by":2,"name":"Akihiro Okamoto","email":"","orcid":"https://orcid.org/0000-0002-8102-4316","institution":"National Institute for Materials Science","correspondingAuthor":false,"prefix":"","firstName":"Akihiro","middleName":"","lastName":"Okamoto","suffix":""}],"badges":[],"createdAt":"2024-04-22 15:21:18","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4306846/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4306846/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":55711533,"identity":"cab62c89-1c61-4f8c-b21c-faf5806e8dcd","added_by":"auto","created_at":"2024-05-02 06:35:05","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2276947,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe microbe-electrode system couples electrical current with nitrite and fumarate reduction. \u003c/strong\u003e(a) Schematic illustration of electrochemical assay for respiratory enzyme kinetics. (b) A representative confocal microscopic image of \u003cem\u003eS. oneidensis\u003c/em\u003e MR-1 cells on ITO electrodes subjected to electrochemical assay, which is stained with SYTO 9 (green) and propidium iodide (magenta). (c, d) Representative time courses for cathodic current under potential application at −0.45 V (vs. SHE). Blue and black lines represent the cathodic current production from electrode-attached \u003cem\u003eS. oneidensis\u003c/em\u003e MR-1 cells in the presence and absence of 10 μM riboflavin, respectively, and the dashed line is the current of 10 μM riboflavin without MR-1 cells. The red lines show the data of Δ\u003cem\u003ecymA\u003c/em\u003e with 10 μM riboflavin. The green lines show the data of (c) Δ\u003cem\u003enrfA\u003c/em\u003e and (d) Δ\u003cem\u003efccA\u003c/em\u003e in the presence of 10 μM riboflavin. Arrows indicate the point at which (c) 0.1 mM nitrite and (d) 1.0 mM fumarate were added to each batch. The same tendency was reproduced in at least three separate experiments. (e) Representative plots of the number of electrons delivered to MR-1 cells against nitrite or fumarate consumption at an electrode potential of −0.45 V (vs. SHE). The baseline current was subtracted from the electron number. The squares of the correlation coefficients (R\u003csup\u003e2\u003c/sup\u003e) include the point of origin.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4306846/v1/b9e42e9e548d2ebc68615d96.png"},{"id":55711532,"identity":"ca7dfba6-2c3a-449e-ac5a-eb0354074ff1","added_by":"auto","created_at":"2024-05-02 06:35:05","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":529579,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRiboflavin shifts the rate-limiting step of current production from electron uptake to the enzymatic reaction. \u003c/strong\u003e(a) Cyclic voltammograms of \u003cem\u003eS. oneidensis\u003c/em\u003e MR-1 cells with 0.1 mM nitrite (a) and 1.0 mM fumarate (b) in the presence of 10 μM riboflavin. The dashed lines represent the data without nitrite and fumarate. The data with 1.5 mM and 3.0 mM fumarate are overlapping. The scan rate is 10 mVs\u003csup\u003e-1\u003c/sup\u003e. The same tendency was reproduced in at least three separate experiments. Inset: Data of \u003cem\u003eS. oneidensis\u003c/em\u003e MR-1 cells without riboflavin.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4306846/v1/bf48c15b3a1d66bf744c84dd.png"},{"id":55712048,"identity":"460ca211-5f60-44d2-b9a8-b9a83e7250f4","added_by":"auto","created_at":"2024-05-02 06:43:05","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1153508,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMichaelis-Menten analysis for electrochemical nitrite and fumarate reduction in intact cells.\u003c/strong\u003e (a) Representative plots of nitrite reduction rate against the concentration of nitrite. The black square and black circle plots represent the data in the presence and absence of 10 μM riboflavin, respectively. Red plots are the data for Δ\u003cem\u003ecymA\u003c/em\u003e cells with 10 μM riboflavin. The error bars represent the mean±SEM (standard error of the mean) obtained from three times CV scans using the same reactor. The same tendency was reproduced in at least three separate experiments. The solid line represents a fitting line based on the Michaelis-Menten equation. \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003em\u003c/em\u003e\u003c/sub\u003e (b) and \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e (c) of nitrite reduction in MR-1 cells. White and red bars represent the data for wild type and Δ\u003cem\u003ecymA\u003c/em\u003e, respectively. Gray bars represent the data for purified homologous proteins ([a]: ref \u003csup\u003e17\u003c/sup\u003e). Numerical data are indicated above the bars. The error bars represent the mean±SEM obtained from at least three separate experiments. Statistical significance is determined by P-values from two-sided Student’s t-tests compared to the wild type. (d) Representative plots of reaction kinetics against the concentration of fumarate. The black square and black circle plots represent the data in the presence and absence of 10 μM riboflavin, respectively. Red plots are the data for Δ\u003cem\u003ecymA\u003c/em\u003e cells with 10 μM riboflavin. Blue plots are the data with 6.0 mg L\u003csup\u003e-1\u003c/sup\u003e polymyxin B and 10 μM riboflavin. The error bars represent the mean±SEM obtained from three times CV scans using the same reactor. The same tendency was reproduced in at least three separate experiments. (e) Representative Hanes-Woolf plots for fumarate reduction kinetics in the absence (black plots) and presence (blue plots) of 6.0 mg L\u003csup\u003e-1\u003c/sup\u003e polymyxin B. Red plots represent the data of Δ\u003cem\u003ecymA\u003c/em\u003e cells. The error bars represent the mean±SEM obtained from three times CV scans using the same reactor. The same tendency was reproduced in at least three separate experiments. (f) \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003em\u003c/em\u003e\u003c/sub\u003e of fumarate reduction reaction in MR-1 cells. Blue bars represent the data for wild type in the presence of 6.0 mg L\u003csup\u003e-1\u003c/sup\u003e polymyxin B and light blue bar represents \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003em\u003c/em\u003e\u003c/sub\u003e of fumarate reduction in sealed bottles without electrodes (details are described in the panel h). Gray bars represent the data for purified proteins ([b]: ref \u003csup\u003e20\u003c/sup\u003e, and [c]: ref \u003csup\u003e21\u003c/sup\u003e). (g) An illustration of FccA accepting electrons from the periplasmic proteins in MR-1 cells. (h) Plots of fumarate consumption rate by MR-1 cells against fumarate concentration in sealed bottles without electrodes from three independent experiments.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4306846/v1/621426456f1b399590f208be.png"},{"id":55711536,"identity":"cf3284c2-bd5a-4b2c-88c1-d9e04f589ab6","added_by":"auto","created_at":"2024-05-02 06:35:05","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":388607,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe impact of CymA on fumarate reduction kinetics.\u003c/strong\u003e (a) Michaelis-Menten reaction scheme and the definition of \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003em\u003c/em\u003e\u003c/sub\u003e. E, enzyme; S, substrate; ES, complex of enzyme-substrate; P, product; \u003cem\u003ek\u003c/em\u003e, rate constant. (b) Representative plots of V\u003csub\u003emax\u003c/sub\u003e/v against the concentration of mesaconic acid for wild type (black) and Δ\u003cem\u003ecymA\u003c/em\u003e (red). v was obtained from the cathodic limiting current and the amount of FccA in the MR-1 cells attached to each ITO electrode. The error bars represent the mean±SEM obtained from three times CV scans using the same reactor. The same tendency was reproduced in three separate experiments. (c) \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e for fumarate reduction. The white and red bars represent the data for wild type and Δ\u003cem\u003ecymA\u003c/em\u003e, respectively, measured by whole-cell electrochemical assay, and the gray bar represents the data for purified protein (ref \u003csup\u003e20\u003c/sup\u003e). Numerical data are indicated above the bars. The error bars represent the mean±SEM obtained from three separate experiments. Statistical significance is determined by P-values from two-sided Student’s t-tests compared to wild type. (d) An illustration of FccA-fumarate reaction coordinates in the presence and absence of CymA.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4306846/v1/5726822af107334b1fbdf2c5.png"},{"id":55713360,"identity":"0fb09030-1845-417c-bd52-42212d85deba","added_by":"auto","created_at":"2024-05-02 06:59:08","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1935250,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4306846/v1/dd8e029c-9f5d-4ccb-a3c9-bee86bb9f753.pdf"},{"id":55711538,"identity":"e0d6abd7-fc8f-4115-aa28-30ae5a5702ef","added_by":"auto","created_at":"2024-05-02 06:35:05","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":295907,"visible":true,"origin":"","legend":"Dataset 1","description":"","filename":"SupplementaryData1templateDNAsequenceNrfAHistag.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4306846/v1/644e69339a283b9767cff018.pdf"},{"id":55711534,"identity":"226beb1e-d9e4-469c-8a16-95d5878754c2","added_by":"auto","created_at":"2024-05-02 06:35:05","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":373681,"visible":true,"origin":"","legend":"Dataset 2","description":"","filename":"SupplementaryData2templateDNAsequenceFccAHistag.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4306846/v1/cc3351c996b604329584e7f2.pdf"},{"id":55712047,"identity":"e01205e8-dbde-4a20-8313-0d69dd8c6a9a","added_by":"auto","created_at":"2024-05-02 06:43:05","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":1690009,"visible":true,"origin":"","legend":"\u003cp\u003eSupplementary information\u003c/p\u003e","description":"","filename":"SI.docx","url":"https://assets-eu.researchsquare.com/files/rs-4306846/v1/200db55f3e480d8f35f121e7.docx"},{"id":55711535,"identity":"db5ddf16-2de8-4d70-b5c2-b09a3c6f3ec0","added_by":"auto","created_at":"2024-05-02 06:35:05","extension":"png","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":762398,"visible":true,"origin":"","legend":"","description":"","filename":"Graphicalabstract.png","url":"https://assets-eu.researchsquare.com/files/rs-4306846/v1/749d8a39eea63ced09e38728.png"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"Decoding In-Cell Respiratory Enzyme Dynamics by Label-Free In-situ Electrochemistry","fulltext":[{"header":"Introduction","content":"\u003cp\u003eElectron transfer in cellular respiration, vital to all living organisms, operates through a complex and synchronized network of molecular interactions. Traditional \u003cem\u003ein vitro\u003c/em\u003e experiments have provided substantial insights into enzymatic reaction kinetics and protein structures, yet often fall short of replicating the intricate \u003cem\u003ein vivo\u003c/em\u003e cellular milieu \u003csup\u003e1\u0026ndash;3\u003c/sup\u003e. This discrepancy has fueled ongoing debates in enzymology regarding the impact of physiological states and macromolecular crowding on enzymatic behavior \u003csup\u003e4, 5\u003c/sup\u003e. Techniques to characterize \u003cem\u003ein vivo\u003c/em\u003e enzymatic reaction kinetics have evolved, yet their application remains limited, often restricted to specific proteins and hindered by the complexities of cellular environments \u003csup\u003e6\u0026ndash;9\u003c/sup\u003e. A particularly challenging aspect is the elucidation of inter-protein interactions within the respiratory electron transfer chain, which is pivotal for biological energy generation. Existing methods struggle to capture the enzyme catalysis in the presence of specific inter-protein interactions without potentially altering enzymatic functions or associated electron and cation kinetics \u003csup\u003e6\u0026ndash;9\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn the present study, we develop a groundbreaking label-free electrochemical approach to directly observe respiratory enzyme kinetics within intact bacteria. This method circumvents the limitations of traditional bioelectrochemical techniques, which, despite their sensitivity and resolution, are impeded by the insulating properties of cellular membranes when applied to intracellular enzymes. Employing \u003cem\u003eShewanella oneidensis\u003c/em\u003e MR-1, renowned for its \u003cem\u003ec\u003c/em\u003e-type cytochrome complexes (Cyts) on the outer membrane that facilitate electron transfer between intracellular enzymes and extracellular electrodes\u003csup\u003e10, 11\u003c/sup\u003e, we developed a protocol for quantifying intracellular enzyme kinetics. Specifically, we utilized riboflavin to enhance electron transport through these cytochrome complexes to set the rate-limiting step as the intracellular enzymatic reaction\u003csup\u003e12, 13\u003c/sup\u003e. By focusing on nitrite reductase (NrfA) and fumarate reductase (FccA), and examining their interactions with the electron donor hub protein CymA, we elucidate how these interactions influence their Michaelis Menten kinetics. Through this platform, we offer a first-of-its-kind insight into the \u003cem\u003ein vivo\u003c/em\u003e kinetics of respiratory enzymes and their inter-protein interactions, significantly advancing our methodology for understanding the complex symphony of cellular respiration.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eShifting rate-limiting step to couple the current generation with metabolic enzymatic reactions\u003c/h2\u003e \u003cp\u003eWe first elucidated the direct correlation between intracellular enzymatic reactions and current production in \u003cem\u003eShewanella oneidensis\u003c/em\u003e MR-1, focusing on the nitrite (NO\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e) reduction. Utilizing a whole-cell electrochemical setup with MR-1 cells adsorbed on an indium tin-doped oxide (ITO) electrode within a three-electrode system (see experimental)\u003csup\u003e14\u003c/sup\u003e, we aimed to monitor the kinetics of nitrite reduction mediated by the NrfA protein, the sole nitrite reductase in the periplasmic space (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea)\u003csup\u003e15, 16\u003c/sup\u003e. Under anaerobic conditions, in the presence of nitrite and 10 \u0026micro;M riboflavin, we observed a stable microbe-electrode interface, with no significant change in the number of viable MR-1 cells over an hour (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb and Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe addition of 10 \u0026micro;M riboflavin was chosen based on its proven efficacy in significantly enhancing electron transfer through outer-membrane Cyts, particularly OmcA, by facilitating bound hydroquinone formation\u003csup\u003e12\u003c/sup\u003e. The effect of riboflavin was validated in our electrochemical setup, where it was observed to markedly accelerate the cathodic current upon the introduction of 0.1 mM nitrite under a constant potential of \u0026minus;\u0026thinsp;0.45 V vs. standard hydrogen electrode, SHE (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec). This effect was absent without riboflavin, where the cathodic current remained minimal. The linear relationship between the number of electrons delivered and nitrite consumed, with a correlation coefficient (R\u003csup\u003e2\u003c/sup\u003e) of 0.99 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ee), underscores the role of riboflavin in coupling cathodic current to the nitrite reduction reaction. Accordingly, the delivered electron and consumed nitrite ratio were compared, representing 5.92\u0026thinsp;\u0026plusmn;\u0026thinsp;0.40 e\u003csup\u003e\u0026minus;\u003c/sup\u003e/nitrite, which is stoichiometrically relevant with NrfA catalysis reducing nitrite to ammonia (6 e\u003csup\u003e\u0026minus;\u003c/sup\u003e/1 nitrite) (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ee and S2). Notably, the Δ\u003cem\u003enrfA\u003c/em\u003e mutant exhibited negligible current upon nitrite addition, affirming NrfA's attribution for the observed cathodic current increase (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec and S3).\u003c/p\u003e \u003cp\u003eFurther, cyclic voltammetry (CV) revealed that the rate-limiting step shifted to nitrite reduction following riboflavin addition, with a clear cathodic current increase at an onset potential of \u0026minus;\u0026thinsp;0.23 V (vs. SHE) in the presence of nitrite and riboflavin (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). This onset potential aligns with the enhanced electron transfer capabilities of cytochromes mediated by riboflavin\u003csup\u003e12\u003c/sup\u003e. The concentration-dependent increase in cathodic current with nitrite in the presence of riboflavin (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea), versus the absence of such dependency without riboflavin (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea inset), illustrates that nitrite reduction at NrfA limits the cathodic current in the presence of riboflavin.\u003c/p\u003e \u003cp\u003eSimilarly, the addition of 1.0 mM fumarate in the presence of 10 \u0026micro;M riboflavin resulted in an immediate cathodic current increase of about \u0026minus;\u0026thinsp;115 \u0026micro;A, a response absent in the Δ\u003cem\u003efccA\u003c/em\u003e mutant (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed and S3), indicating FccA's role in fumarate reduction. The stoichiometric correlation between cathodic current and fumarate consumption (2.06\u0026thinsp;\u0026plusmn;\u0026thinsp;0.33 e\u003csup\u003e\u0026minus;\u003c/sup\u003e/fumarate) closely matches the theoretical reduction ratio (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ee and S2). Furthermore, the cathodic current in CV also increased with fumarate concentration in the presence of riboflavin (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb), demonstrating the coupling of microbial current production with intracellular enzyme catalysis in the presence of riboflavin. This coupling was not observed without riboflavin (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb inset), highlighting the essential role of riboflavin in facilitating intracellular enzymatic reactions and their corresponding electrochemical signatures.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eMichaelis-Menten analysis of intracellular NrfA and FccA catalysis\u003c/h2\u003e \u003cp\u003eTo characterize the kinetic properties of intracellular NrfA using whole-cell electrochemistry, we analyzed the cathodic current at various concentrations as reported for purified NrfA with the Michaelis-Menten Eq.\u0026nbsp;1\u003csup\u003e7\u003c/sup\u003e. The cathodic current in the presence of riboflavin gradually decreased at higher concentrations than 400 \u0026micro;M (Figure S4), characteristic of purified NrfA protein exhibiting substrate inhibition at high nitrite concentration \u003csup\u003e17\u003c/sup\u003e. This trend is evident by plotting the nitrite reduction kinetics against the concentration of nitrite (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). Nitrite reduction kinetics is calculated from the limiting current (the cathodic current at \u0026minus;\u0026thinsp;0.80 V vs. SHE in CV following subtraction by the cathodic currents in the absence of nitrite) and the amount of NrfA present in the MR-1 cells attached on each ITO electrode quantified by liquid chromatography-mass spectrometry (LC-MS) analysis (4.63\u0026thinsp;\u0026plusmn;\u0026thinsp;0.55 pmol).\u003cdiv id=\"Equa\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equa\" name=\"EquationSource\"\u003e\n$$\\text{v}=\\frac{{\\text{V}}_{\\text{m}\\text{a}\\text{x}}\\left[\\text{S}\\right]}{{K}_{m}+\\left[\\text{S}\\right](1+[\\text{S}]/{K}_{i})} \\left(\\text{E}\\text{q} 1\\right)$$\u003c/div\u003e\u003c/div\u003e\u003c/p\u003e \u003cp\u003eEquation 1 is a Michaelis-Menten model in which a second substrate molecule binds to inhibit the enzyme that applies to purified NrfA protein \u003csup\u003e17\u003c/sup\u003e. \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003em\u003c/em\u003e\u003c/sub\u003e and \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e are Michaelis constant and inhibition constant, and V\u003csub\u003emax\u003c/sub\u003e and [S] are maximum turnover rate and nitrite concentration, respectively. The plots of nitrite reduction kinetics were fitted with this model (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea), demonstrating that intracellular NrfA shows reaction kinetics following the Michaelis-Menten equation as with the purified one. \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003em\u003c/em\u003e\u003c/sub\u003e, \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e, and V\u003csub\u003emax\u003c/sub\u003e were determined to be 63.0\u0026thinsp;\u0026plusmn;\u0026thinsp;13.7 \u0026micro;M, 19.7\u0026thinsp;\u0026plusmn;\u0026thinsp;3.2 mM, and 94.5\u0026thinsp;\u0026plusmn;\u0026thinsp;16.8 pmol s\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, respectively (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec). \u003cem\u003ek\u003c/em\u003e\u003csub\u003e\u003cem\u003ecat\u003c/em\u003e\u003c/sub\u003e (turnover number) of NrfA was calculated to be 20.4\u0026thinsp;\u0026plusmn;\u0026thinsp;4.37 s\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003em\u003c/em\u003e\u003c/sub\u003e and \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e of NrfA in an intact cell were almost identical to those of purified NrfA protein immobilized on electrodes: 54\u0026thinsp;\u0026plusmn;\u0026thinsp;12 \u0026micro;M for \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003em\u003c/em\u003e\u003c/sub\u003e and 18\u0026thinsp;\u0026plusmn;\u0026thinsp;4 mM for \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec) \u003csup\u003e17\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIn contrast, the kinetics of FccA differed significantly from analogous purified proteins. The plot of fumarate reduction kinetics against fumarate concentration showed non-proportional relationships following a Michaelis-Menten curve (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed). Hanes-Woolf plots were made to quantify \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003em\u003c/em\u003e\u003c/sub\u003e of intracellular FccA (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ee).\u003cdiv id=\"Equb\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equb\" name=\"EquationSource\"\u003e\n$$\\text{v}=\\frac{{\\text{V}}_{\\text{m}\\text{a}\\text{x}}\\left[\\text{S}\\right]}{{K}_{m}+\\left[\\text{S}\\right]} (\\text{E}\\text{q} 2, \\text{M}\\text{i}\\text{c}\\text{h}\\text{a}\\text{e}\\text{l}\\text{i}\\text{s}-\\text{M}\\text{e}\\text{n}\\text{t}\\text{e}\\text{n} \\text{e}\\text{q}\\text{u}\\text{a}\\text{t}\\text{i}\\text{o}\\text{n})$$\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Equc\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equc\" name=\"EquationSource\"\u003e\n$$\\frac{\\left[\\text{S}\\right]}{\\text{v}}=\\frac{\\left[\\text{S}\\right]}{{\\text{V}}_{\\text{m}\\text{a}\\text{x}}}+\\frac{{K}_{m}}{{\\text{V}}_{\\text{m}\\text{a}\\text{x}}} (\\text{E}\\text{q} 3, \\text{H}\\text{a}\\text{n}\\text{e}\\text{s}-\\text{W}\\text{o}\\text{o}\\text{l}\\text{f} \\text{p}\\text{l}\\text{o}\\text{t}\\text{s})$$\u003c/div\u003e\u003c/div\u003e\u003c/p\u003e \u003cp\u003e \u003cem\u003eK\u003c/em\u003e \u003csub\u003e \u003cem\u003em\u003c/em\u003e \u003c/sub\u003e and V\u003csub\u003emax\u003c/sub\u003e were revealed to be 161\u0026thinsp;\u0026plusmn;\u0026thinsp;23.6 \u0026micro;M and 751\u0026thinsp;\u0026plusmn;\u0026thinsp;72.0 pmol s\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e via the linear regression of Hanes-Woolf plots (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ef). \u003cem\u003ek\u003c/em\u003e\u003csub\u003e\u003cem\u003ecat\u003c/em\u003e\u003c/sub\u003e of FccA was 182\u0026thinsp;\u0026plusmn;\u0026thinsp;37.4 s\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003em\u003c/em\u003e\u003c/sub\u003e value of purified FccA protein has been reported to be below 50 \u0026micro;M \u003csup\u003e18\u003c/sup\u003e and analogous fumarate reductase from \u003cem\u003eShewanella frigidimarina\u003c/em\u003e (with 59% amino acid sequence identity \u003csup\u003e19\u003c/sup\u003e) showed \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003em\u003c/em\u003e\u003c/sub\u003e of 21 \u0026micro;M or 6 \u0026micro;M \u003csup\u003e20, 21\u003c/sup\u003e. These values are significantly lower than the \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003em\u003c/em\u003e\u003c/sub\u003e of FccA in the cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ef).\u003c/p\u003e \u003cp\u003eThe potential discrepancy between the bulk and the periplasmic fumarate concentration was investigated by increasing the membrane permeability with polymyxin B. This substance creates pores in the cell\u0026rsquo;s outer membrane, allowing polypeptides to pass through \u003csup\u003e22\u003c/sup\u003e. In our study, MR-1 cells supplemented with riboflavin were treated with 6.0 mg L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e polymyxin B, a dose known to increase their membrane permeability \u003csup\u003e23\u003c/sup\u003e. CV showed that the cathodic current response to fumarate was similar, regardless of polymyxin B treatment until 900 \u0026micro;M (Figure S5). The antibiotic effect of polymyxin B may explain the current reduction at the higher concentrations. Analysis of the data, including linear regression of Hanes-Woolf plots, yielded a \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003em\u003c/em\u003e\u003c/sub\u003e of 179\u0026thinsp;\u0026plusmn;\u0026thinsp;14.0 \u0026micro;M (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ee and f), suggesting that differences in enzyme kinetics between \u003cem\u003ein vivo\u003c/em\u003e and purified conditions are not primarily due to the periplasmic space effects on localized substrate concentration. This indicates that factors other than the periplasmic concentration contribute to the kinetic discrepancies observed between purified enzymes and those functioning within cellular environments.\u003c/p\u003e \u003cp\u003e \u003cem\u003eThe impact of inter-protein interaction on\u003c/em\u003e K\u003csub\u003em\u003c/sub\u003e \u003cem\u003ein intact cells\u003c/em\u003e\u003c/p\u003e \u003cp\u003eDespite previous reports suggesting crowding effects on the periplasmic enzyme reactions \u003csup\u003e24\u003c/sup\u003e, our observations indicate that such effects are minimal for FccA. This inference is supported by the consistent kinetics between NrfA in its purified form and within the cell, and the action of polymyxin B, which also releases polynucleotides, suggesting a negligible impact of crowding on FccA activity. Crucially, FccA is known for its specific and strong interaction with CymA\u003csup\u003e25\u0026ndash;27\u003c/sup\u003e, a distinct factor with the nonspecific nature of crowding effects. To elucidate the influence of inter-protein interactions on \u003cem\u003ein vivo\u003c/em\u003e enzyme kinetics, we investigated the Δ\u003cem\u003ecymA\u003c/em\u003e mutant strain, which lacks the CymA protein, a key component in the electron transfer chain. Upon the addition of nitrite, the Δ\u003cem\u003ecymA\u003c/em\u003e mutant strain exhibited an increase in cathodic current similar to that observed in the wild type strain, indicating that the electron transfer mechanism compensates for the absence of CymA in nitrite reduction (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec). However, upon introducing 1.0 mM fumarate, the cathodic current observed in the Δ\u003cem\u003ecymA\u003c/em\u003e strain was notably 10\u0026ndash;20% lower than that in the wild type (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed), despite similar fumarate reductase FccA levels in both strains (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). This discrepancy underscores a specific limitation in the fumarate reduction pathway attributable to the absence of CymA.\u003c/p\u003e \u003cp\u003eFurther analysis revealed a concentration-dependent effect of nitrite or fumarate on the cathodic limiting current, confirming FccA and the nitrite reductase NrfA as limiting factors in their respective reduction reactions (Figure S6). While the CymA protein is essential electron donor for FccA under lactate feeding condition in MR-1 \u003csup\u003e25\u0026ndash;27\u003c/sup\u003e, these data strongly suggest that FccA and NrfA appear to receive electrons more readily from the outer-membrane cytochrome complex MtrCAB or the periplasmic \u003cem\u003ec\u003c/em\u003e-type cytochromes such as STC and CcpA, bypassing the need for direct interaction with CymA during the reduction of fumarate and nitrite in the absence of CymA (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eg) \u003csup\u003e28\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eKinetic analysis of the cathodic response to fumarate addition, following Michaelis-Menten kinetics, revealed a significant alteration in the catalytic efficiency of FccA in the Δ\u003cem\u003ecymA\u003c/em\u003e strain (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed), with a \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003em\u003c/em\u003e\u003c/sub\u003e value approximately half that of the wild type (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ef and S6). The observed changes in the \u003cem\u003ek\u003c/em\u003e\u003csub\u003e\u003cem\u003ecat\u003c/em\u003e\u003c/sub\u003e for fumarate reduction, which decreased by about 47% in the Δ\u003cem\u003ecymA\u003c/em\u003e strain (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), further emphasize the critical role of the FccA-CymA complex in modulating fumarate reduction kinetics. Conversely, the kinetic parameters, \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003em\u003c/em\u003e\u003c/sub\u003e and \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e, for NrfA in the Δ\u003cem\u003ecymA\u003c/em\u003e strain remained nearly identical to those of the wild type (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec) and, the \u003cem\u003ek\u003c/em\u003e\u003csub\u003e\u003cem\u003ecat\u003c/em\u003e\u003c/sub\u003e for nitrite reduction in the Δ\u003cem\u003ecymA\u003c/em\u003e strain was comparable to that of the wild type (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), reinforcing the differential impact of CymA on the kinetics of FccA and NrfA. Taken together, these results demonstrate that the formation of the FccA-CymA complex has a critical role in regulating fumarate reduction kinetics.\u003c/p\u003e \u003cp\u003eSuch a clear indication of FccA activity and FccA-CymA interaction was not visible in conventional metabolite analysis. By measuring fumarate consumption under anaerobic conditions with lactate as the electron donor, without the use of electrodes, we observed significant fumarate reduction in wild type cells (Figure S7). In contrast, the Δ\u003cem\u003ecymA\u003c/em\u003e mutant exhibited minimal fumarate reduction over 90 min, whereas the wild type strain nearly exhausted its fumarate supply (Figure S7). This stark difference underscores the critical role of CymA as an essential electron donor for FccA activity when lactate serves as the electron source \u003csup\u003e29\u003c/sup\u003e. Furthermore, the estimated \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003em\u003c/em\u003e\u003c/sub\u003e value for fumarate reduction in wild type cells (50.4\u0026thinsp;\u0026plusmn;\u0026thinsp;31.0 \u0026micro;M) was distinct from that determined electrochemically (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ef and h). This discrepancy likely stems from the inability of traditional metabolite analysis to precisely identify rate-limiting steps among sequential multiple metabolic reactions, resulting in a less detailed understanding of enzyme kinetics. These findings highlight the superior precision and specificity of electrochemical assays in elucidating intracellular enzyme kinetics.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eInvestigating the impact of CymA on the binding affinity of FccA-fumarate in intact cells\u003c/h2\u003e \u003cp\u003eTo further explore the mechanism for CymA to impact the FccA kinetics, we examined the fumarate binding affinity. \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003em\u003c/em\u003e\u003c/sub\u003e decreases when \u003cem\u003ek\u003c/em\u003e\u003csub\u003e\u003cem\u003ecat\u003c/em\u003e\u003c/sub\u003e decreases or the binding affinity between enzyme and substrate increases (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). Because the gene deletion of \u003cem\u003ecymA\u003c/em\u003e decreased \u003cem\u003ek\u003c/em\u003e\u003csub\u003e\u003cem\u003ecat\u003c/em\u003e\u003c/sub\u003e associated with the decrease of \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003em\u003c/em\u003e\u003c/sub\u003e, it is unclear whether the binding affinity of FccA with fumarate is altered by the interaction with CymA. To test this point, we measured the \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e for the fumarate reduction using mesaconic acid as a competitive inhibitor \u003csup\u003e20\u003c/sup\u003e. Because mesaconic acid binds with FccA to block fumarate reduction, \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e excludes the information about the turnover rate and reflects the affinity of fumarate to the binding site in FccA. We added a variety of concentrations of mesaconic acid to MR-1 cells on the electrode in the presence of 5.0 mM fumarate and 10 \u0026micro;M riboflavin. The addition of mesaconic acid decreased the cathodic limiting current as shown in the CV in Figure S8a. To quantify the inhibition effect, \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e was calculated following the Michaels-Menten equation.\u003cdiv id=\"Equd\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Equd\" name=\"EquationSource\"\u003e\n$$\\text{v}=\\frac{{\\text{V}}_{\\text{m}\\text{a}\\text{x}}\\left[\\text{S}\\right]}{{K}_{m}(1+[\\text{I}]/{K}_{i})+\\left[\\text{S}\\right]} \\left(\\text{E}\\text{q} 4\\right)$$\u003c/div\u003e\u003c/div\u003e\u003c/p\u003e \u003cp\u003ewhere [I] and \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e represent the concentration of mesaconic acid and constant for competitive inhibition, respectively. Eq.\u0026nbsp;4 provides Eq.\u0026nbsp;5 as follows.\u003cdiv id=\"Eque\" class=\"Equation\"\u003e\u003cdiv format=\"TEX\" class=\"mathdisplay\" id=\"FileID_Eque\" name=\"EquationSource\"\u003e\n$$\\frac{{\\text{V}}_{\\text{m}\\text{a}\\text{x}}}{\\text{v}}=\\frac{{K}_{m}}{{K}_{i}\\left[\\text{S}\\right]}\\left[\\text{I}\\right]+\\frac{{K}_{m}+\\left[\\text{S}\\right]}{\\left[\\text{S}\\right]} \\left(\\text{E}\\text{q} 5\\right)$$\u003c/div\u003e\u003c/div\u003e\u003c/p\u003e \u003cp\u003eAccording to Eq.\u0026nbsp;5, V\u003csub\u003emax\u003c/sub\u003e/v linearly increases with [I], providing \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003em\u003c/em\u003e\u003c/sub\u003e/\u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e[S] as a slope. Consistently, the plots of V\u003csub\u003emax\u003c/sub\u003e/v against [I] showed a linear relationship with the squares of the correlation coefficient (R\u003csup\u003e2\u003c/sup\u003e) of 0.97 (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb and S8), further supporting that mesaconic acid inhibits intracellular FccA. From the slope, \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e was revealed to be 583\u0026thinsp;\u0026plusmn;\u0026thinsp;147 \u0026micro;M (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec). This \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e value is slightly larger than that of Δ\u003cem\u003ecymA\u003c/em\u003e, 419\u0026thinsp;\u0026plusmn;\u0026thinsp;150 \u0026micro;M, but Student\u0026rsquo;s t-tests confirmed no significant difference, while the distinct \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e in the purified enzyme suggests the flexible fumarate binding affinity (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec). These data indicate that FccA-CymA interaction likely affects the steps along the reaction pathway after substrate binding, such as product release or a conformational change during catalysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed). Purified CymA binds with FccA near a heme that does not directly contact the active site to convert fumarate into succinate\u003csup\u003e28, 30\u003c/sup\u003e. Thus, it is reasonable that the FccA-CymA interaction scarcely affects the binding affinity and influences the post-binding process, including conformational change.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe exploration of electron transfer in respiration, a cornerstone of living systems, has historically been studied through the extraction and separation of partner enzymes \u003csup\u003e31\u003c/sup\u003e. This approach has significantly contributed to our understanding of biochemical reaction mechanisms, yet the analysis of respiratory enzymatic kinetics, especially within living cells, has remained elusive due to methodological limitations, including the absence of systems capable of monitoring electron flux without the need for labeling.\u003c/p\u003e \u003cp\u003eIn microbial electrochemistry, studying bacteria that can exchange electrons with electrodes\u0026mdash;acting as living electrochemical catalysts\u0026mdash;has been ongoing for over two decades, primarily within the energy and environmental sectors \u003csup\u003e32, 33\u003c/sup\u003e. These studies have largely focused on the mechanisms of interfacial electron transfer and the elucidation of respiratory pathways, with less attention given to the kinetics of intracellular enzymes. Our research pivots this focus towards \u003cem\u003ein vivo\u003c/em\u003e monitoring of the periplasmic enzyme kinetics in the model electrogenic bacterium, \u003cem\u003eShewanella oneidensis\u003c/em\u003e MR-1. By facilitating electron uptake from a negatively poised electrode through Cyts, we redirected the rate-limiting step from interfacial electron uptake to the reduction of nitrite or fumarate. This innovative approach allowed us to determine \u003cem\u003ein vivo\u003c/em\u003e kinetic parameters, including \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003em\u003c/em\u003e\u003c/sub\u003e, \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e, and \u003cem\u003ek\u003c/em\u003e\u003csub\u003e\u003cem\u003ecat\u003c/em\u003e\u003c/sub\u003e, for the periplasmic enzymes NrfA and FccA for the first time, revealing similar and distinct kinetics, respectively, between the purified and cellular states of these enzymes.\u003c/p\u003e \u003cp\u003eOur findings highlight the profound impact of specific inter-protein interactions on enzyme kinetics, particularly demonstrated by the significant changes in \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003em\u003c/em\u003e\u003c/sub\u003e and \u003cem\u003ek\u003c/em\u003e\u003csub\u003e\u003cem\u003ecat\u003c/em\u003e\u003c/sub\u003e for FccA, but not NrfA, following the deletion of the \u003cem\u003ecymA\u003c/em\u003e gene. Because the gene deletion scarcely influenced the \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e of FccA with a competitive inhibitor, the interaction between FccA and CymA would primarily accelerate the post-binding process, of which dynamic is difficult to monitor in purified protein systems. This highlights that the transient complex formation of proteins in respiratory electron transfer is pivotal in defining enzymatic catalysis within the cellular context.\u003c/p\u003e \u003cp\u003eFurthermore, our study challenges the conventional belief that macromolecular crowding is the primary cause for the difference between \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e enzyme kinetics\u003csup\u003e4, 5\u003c/sup\u003e. By modulating the macromolecular concentration within the periplasmic space using polymyxin B, which allows for the permeation of both fumarate and polypeptides across the outer membrane\u003csup\u003e22\u003c/sup\u003e, we observed that changes in macromolecular crowding did not notably affect enzyme kinetics. This was in stark contrast to the effects seen with the deletion of the \u003cem\u003ecymA\u003c/em\u003e gene, which led to a significant decrease in the \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003em\u003c/em\u003e\u003c/sub\u003e values for FccA, suggesting that the deletion of \u003cem\u003ecymA\u003c/em\u003e rather not impact macromolecular crowding but significantly alters enzyme kinetics through changes in inter-protein interactions. The relatively minor abundance of CymA compared to the total biomolecular content within cells\u003csup\u003e34\u003c/sup\u003e, and its capacity to interact flexibly with various proteins in the periplasm \u003csup\u003e35\u003c/sup\u003e further support the conclusion that inter-protein interactions exert a more substantial influence on the kinetics of FccA than previously recognized effects of macromolecular crowding.\u003c/p\u003e \u003cp\u003eWhereas the \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e of FccA in wild type was almost identical to that in Δ\u003cem\u003ecymA\u003c/em\u003e, but was largely different from those for purified fumarate reductase from \u003cem\u003eShewanella frigidimarina\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec). This reveals that interactions with proteins other than CymA can modulate \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e, indicating a complex network of protein interactions affecting FccA's activity. The dual functionality of FccA further illustrates this complexity within cells, which, in association with CymA, may serve not only in its canonical role in fumarate reduction but also as an electron storage mechanism within the periplasmic space (Figure S9) \u003csup\u003e36\u003c/sup\u003e. These dual roles facilitate the temporary storage of respiratory electrons, contributing to forming a proton motive force and transmitting electrons to other enzymes, thereby terminating the reduction reactions of various substrates\u003csup\u003e36\u003c/sup\u003e. This could indicate the importance of specific interprotein interactions in shaping the functional landscape of enzymes within the complex cellular environment.\u003c/p\u003e \u003cp\u003ePrevious methods for measuring enzymes within cells required the enzymes to function independently to obtain kinetic parameters \u003csup\u003e6\u0026ndash;9\u003c/sup\u003e. However, our study has successfully tracked enzyme reactions within the complex network of the respiratory chain at the same level, significantly broadening the range of targets measurable within cells. In this method, we leveraged riboflavin to significantly enhance electron transfer via Cyts. The specificity and high binding affinity of riboflavin to Cyts not only accelerate electron transfer but also enable the quantification of reaction kinetics for enzymes interacting with these proteins. This methodological innovation opens the door to a broader application spectrum by incorporating various redox-active molecules, potentially expanding the range of enzymes amenable to this assay \u003csup\u003e37\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eThe integration of synthetic biology, particularly the expression of MR-1 Cyts in alternative bacterial hosts like \u003cem\u003eEscherichia coli\u003c/em\u003e \u003csup\u003e33, 38\u003c/sup\u003e, further broadens the scope of observable intracellular electron transfer reactions. However, the current technique may have limitations in monitoring the cytoplasmic enzyme reactions, especially those involving the NAD\u003csup\u003e+\u003c/sup\u003e/NADH cycle, due to the thermodynamic challenges posed by external electrode-driven reactions \u003csup\u003e39\u003c/sup\u003e. A promising solution lies in the synthetic biology strategy of expressing light-driven proton pumps to facilitate electron input into the cytoplasm, as evidenced in acetoin reduction reactions \u003csup\u003e39\u003c/sup\u003e, suggesting a synergistic potential between electrochemical methods and synthetic biology to explore a wide array of intracellular respiratory enzyme kinetics.\u003c/p\u003e \u003cp\u003eAdditionally, our research underscores the critical role of the interprotein interaction network in understanding enzymes vital for various applications, from medical drug design to biocatalysis in the food industry, energy devices, and environmental technologies \u003csup\u003e32, 40, 41\u003c/sup\u003e. A notable application of this technique is in quantifying intracellular inhibition or inactivation by antibacterial drugs, offering a more precise assessment than traditional cell viability and growth metrics \u003csup\u003e42\u003c/sup\u003e. This distinction is crucial for minimizing undesirable side effects by accurately identifying drug cytotoxicity versus enzyme inhibition\u003csup\u003e43\u003c/sup\u003e. Moreover, the high time resolution of this enzyme kinetics assay \u003csup\u003e44\u003c/sup\u003e, coupled with the development of high-throughput systems and data-driven approaches \u003csup\u003e45, 46\u003c/sup\u003e, presents a significant improvement over conventional substrate quantification methods, promising a robust framework for evaluating antibacterial drugs efficiently.\u003c/p\u003e \u003cp\u003eIn conclusion, our study introduces an electrochemical method that captures enzymatic kinetics and interprotein interactions within their cellular context. We've charted the catalytic mechanism landscape in its native environment, offering profound insights into enzyme function and cellular biochemistry. This breakthrough is a significant stride in unraveling the complex symphony of electron transport in cellular respiration. Our approach refines biochemical analysis, improving precision while closely reflecting physiological states, and expands our grasp of biological processes. This sets a new foundation for future research to further elucidate the subtle interplay of enzymes and their networks, offering valuable insights for the broader field of biological sciences.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e\u003cem\u003eCulture conditions of\u003c/em\u003e Shewanella oneidensis \u003cem\u003eMR-1\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eS. oneidensis\u003c/em\u003e MR-1 has grown aerobically in 15 mL Luria-Bertani (LB) medium (20 g L\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, Becton Dickinson, Sparks, MD, USA) at 303 K for 24 h. The culture was then centrifuged at 6,000 \u0026times; g for 10 minutes, and the resultant cell pellet was resuspended in a 15 mL defined medium (DM) supplemented with 10 mM lactate as the sole carbon source. The cells were further cultivated aerobically at 303 K for 12 h. After centrifugation at 6,000 \u0026times; g for 10 min, the resultant cell pellet was washed once with DM before electrochemical measurement.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eElectrochemical measurement of\u003c/em\u003e Shewanella oneidensis \u003cem\u003eMR-1 cells on ITO electrodes\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eEnzyme redox kinetics was monitored using a single-chamber three-electrode system \u003csup\u003e14\u003c/sup\u003e. The reactor comprised an ITO substrate (surface area of 3.1 cm\u003csup\u003e2\u003c/sup\u003e) located at the bottom of the reactor, Ag/AgCl (KCl saturated), and a platinum wire, which were used as working, reference, and counter electrodes, respectively. Four milliliters of DM containing lactate (10 mM) was deaerated by bubbling with N\u003csub\u003e2\u003c/sub\u003e in the reactor and then maintained at 303 K without agitation. A cell suspension of \u003cem\u003eS. oneidensis\u003c/em\u003e MR-1 with an optical density at \u0026lambda;\u0026thinsp;=\u0026thinsp;600 nm (OD\u003csub\u003e600\u003c/sub\u003e) of 0.1 was inoculated into the reactor. The constant potential was applied at +\u0026thinsp;0.40 V (vs. SHE) for 25 h using automatic polarization systems (PS-08, TOHO Technical Research Co., Ltd.). After confirming that \u003cem\u003eS. oneidensis\u003c/em\u003e MR-1 cells are adsorbed on the ITO electrode as described previously \u003csup\u003e14\u003c/sup\u003e, the supernatant in the reactor was replaced, and the ITO electrode was washed with anaerobic DM twice. Cathodic current from \u003cem\u003eS. oneidensis\u003c/em\u003e MR-1 cells was monitored at \u0026minus;\u0026thinsp;0.45 V vs. SHE, and cyclic voltammetry was conducted at a scan rate of 10 mVs\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e.\u003c/p\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n \u003ch2\u003eConfocal fluorescence microscopy\u003c/h2\u003e\n \u003cp\u003eFor visualization of the cells attached to an ITO electrode ex-situ, we used a confocal laser scanning microscope (LS880, Carl Zeiss) with a 63\u0026times; water-dipping objective lens. After gently rinsing the surface of the ITO electrodes with PBS buffer, we stained the cells with SYTO 9 and propidium iodide. Finally, we obtained confocal fluorescence images of the stained cells. The excitation and emission wavelengths are 488 nm and 505\u0026ndash;545 nm for SYTO 9, and 543 nm and 620\u0026ndash;660 nm for propidium iodide.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\n \u003ch2\u003eMetabolite analysis\u003c/h2\u003e\n \u003cp\u003e200 \u0026micro;L of supernatant in the electrochemical reactor was collected during constant potential application at \u0026minus;\u0026thinsp;0.45 V (vs. SHE) in the presence of 0.1 mM nitrite or 1.0 mM fumarate and was subsequently filtered. The concentration of nitrite and fumarate in the supernatant was quantified using an ion chromatograph system (Shimadzu, HIC-20Asuper). Shim-pack IC-A3 (Shimadzu) was used as the column for analysis in anion chromatography kept at 40\u0026deg;C with a flow rate of 1.2 mL/min. The mobile phase comprised 1.11 gL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e \u003cem\u003ep\u003c/em\u003e-hydroxy benzoic acid, 0.67 gL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e Bis-Tris, and 3.09 gL\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e boric acid. The number of electrons was calculated by subtracting the baseline cathodic current (current without nitrite/fumarate) from the cathodic current in the presence of nitrite/fumarate.\u003c/p\u003e\n\u003c/div\u003e\n\u003ch2\u003ePreparation of FccA and NrfA by cell-free protein synthesis\u003c/h2\u003e\n\u003cp\u003eFccA (NC_004347.2:c1003324-1001534) and NrfA (AE014299.2:c4117617-4116214) fused with a histidine tag at the C-terminus were expressed by the cell-free protein synthesis system, PUREfrex 2.0, (GeneFrontier, Chiba, Japan) according to the manufacturer\u0026rsquo;s instructions. The template DNA sequences for cell-free protein synthesis were designed using CodHonEditor (Supplementary Data 1 and 2) to optimize codon usage to \u003cem\u003eE. coli.\u003c/em\u003e and synthesized by Eurofins Genomics (Tokyo, Japan). The template DNA contained the 5\u0026prime;-UTR (5\u0026prime;-GAAAT\u003cspan class=\"Underline\"\u003eTAATACGACTCACTATA\u003c/span\u003eGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTT\u003cspan class=\"DoubleUnderline\"\u003eAAGAAG\u003c/span\u003eGAGATATACCA-structure gene-3\u0026prime;), including the T7 promoter (underlined) and Shine\u0026ndash;Dalgarno sequence (double underlined), and the 3\u0026prime;-UTR (5\u0026prime;-structure gene-TAATGAATAACTAATCC-3\u0026prime;). The template DNA was amplified by PCR using primers 5\u0026prime;-GAAATTAATACGACTCACTATAG-3\u0026prime; and 5\u0026prime;-GGATTAGTTATTCATTAACCAG-3.\u0026rsquo; Proteins were synthesized by mixing the template DNA with the PUREfrex reaction mixture at 37\u0026deg;C for 4 h. Synthesized proteins were purified using Ni-Sepharose 6 FF (Cytiva, Marlborough, MA, USA). Purified protein was dialyzed against 50 mM Tris-HCl buffer (pH 8.0). To confirm the purity of the synthesized proteins, the samples were subjected to reduced SDS-PAGE (10\u0026ndash;20% w/v gradient gel; ATTO, Tokyo, Japan) and stained with Rapid Stain CBB (Nacalai Tesque, Kyoto Japan). Protein concentrations were quantified using the Micro BCA Protein Assay Kit (Thermo Scientific, Waltham, MA, USA).\u003c/p\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003eQuantification of NrfA and FccA in MR-1 cells on ITO electrodes\u003c/h2\u003e\n \u003cp\u003e\u003cem\u003eS. oneidensis\u003c/em\u003e MR-1 cells were collected from ITO electrodes and washed using 100 mM ammonium bicarbonate buffer. The cells were then homogenized, and the proteins in the lysate were extracted with methanol and chloroform and subsequently solubilized with 8 M urea. The synthesized FccA and NrfA, along with these samples, were subjected to reductive alkylation and trypsin digestion. In the case of NrfA, the fractions corresponding to 45\u0026ndash;60 kDa were extracted before reductive alkylation and trypsin digestion, and then the samples were applied to sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The liquid chromatography/mass spectrometry analysis was performed using a nanoadvance LC system (Bruker Daltonics, Bremen, Germany) interfaced with a Q-Exactive Plus Orbitrap mass spectrometer (Thermo Fisher Scientific) via an Advance Captive Spray ionization source (AMR, Tokyo, Japan), as reported previously \u003csup\u003e47\u003c/sup\u003e. The LC process involved loading the peptides onto a trap column (L-column ODS 5\u0026micro;m, Chemical Evaluation and Research Institute Japan, Tokyo, Japan) with Buffer A for concentration and desalting. The samples were then eluted from the trap column and the analytical column (Zaplous \u0026alpha;-Pep C18 nano high-performance liquid chromatography [HPLC] column, AMR) with a linear gradient of Buffer B from 5\u0026ndash;45% at a flow rate of 500 nL min\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e (Buffer A: 99.9% distilled water and 0.1% formic acid; Buffer B: 100% acetonitrile). The gradient time for Buffer A to B was 20 and 40 min for FccA and NrfA, respectively. The MS parameters were set as follows: electrospray voltage, 1.2 kV; temperature of the ion transfer tube, 150 ℃; collision energy, 27; threshold of ion selection for MS/MS, 1700 count; mass range at 350 to 2000 m/z, resolution at 70000, and a maximum acquisition time of 60 ms. MS/MS scanning was performed on the top 10 abundant precursor ions with dynamic exclusion for 20 seconds after selection. The raw data was analyzed using Proteome Discoverer 2.4 software (Thermo Fisher Scientific) with an in-house Mascotv.2.5 search engine (Matrix Science, London, UK). The following parameters were used: maximum missed cleavage sites, 2; instrument type; ESI-TRAP, precursor mass tolerance, ten ppm; fragment mass tolerance, 0.02 Da; dynamic modifications, methionine oxidation, static modification, and cysteine carbamidomethyl. All proteins were identified with a false discovery rate of \u0026lt;\u0026thinsp;1% based on a decoy database search. The amount of NrfA and FccA in each sample was quantified by averaging the abundances of four to six peptide groups, which were quantified using LC-MS (Table \u003cspan class=\"InternalRef\"\u003eS1\u003c/span\u003e). A calibration curve was created for each peptide group using the synthesized NrfA and FccA, and the abundance of peptide groups contained in each sample was quantified. The average abundance of these four to six peptide groups was taken as the amount of NrfA and FccA in each sample.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003eEstimation of fumarate reduction rate by supernatant sampling\u003c/h2\u003e\n \u003cp\u003e\u003cem\u003eS. oneidensis\u003c/em\u003e MR-1 cells at OD\u003csub\u003e600\u003c/sub\u003e of 0.2 were inoculated in a sealed bottle containing anaerobic DM with 10 mM lactate and 0\u0026thinsp;~\u0026thinsp;1.0 mM fumarate. Fumarate in the supernatant was quantified by ion chromatography before and after 10 min incubation. The fumarate consumption rate was approximated as the extent of fumarate decreased during 10 min.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Prof. Dr. Nobuhiko Nomura for helpful advice. This work was financially supported by JSPS KAKENHI (20K15428), JST ACT-X (JPMJAX211C), JST GteX (JPMJGX23B2), ARIM of MEXT (JPMXP1223NM5212), and the Program for Weaving Diverse Research Skills into an Orchestrated Action to Design Jubilant 100-year Lifetime Society in University of Tsukuba.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eY.T. and A.O. designed the study, and Y.T. conducted the experiments. T.Y. synthesized NrfA and FccA. All authors prepared the manuscript and have approved the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics declarations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing financial interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eHartl, F.U. \u0026amp; Hayer-Hartl, M. Converging concepts of protein folding \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e. \u003cem\u003eNat. Struct. Mol. Biol.\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 574-581 (2009).\u003c/li\u003e\n\u003cli\u003eChen, Y. \u0026amp; Nielsen, J. In vitro turnover numbers do not reflect in vivo activities of yeast enzymes. \u003cem\u003eProc. Natl. Acad. Sci. U.S.A.\u003c/em\u003e \u003cstrong\u003e118\u003c/strong\u003e, e2108391118 (2021).\u003c/li\u003e\n\u003cli\u003eMinton, A.P. How can biochemical reactions within cells differ from those in test tubes? \u003cem\u003eJ. Cell. Sci.\u003c/em\u003e \u003cstrong\u003e119\u003c/strong\u003e, 2863-2869 (2006).\u003c/li\u003e\n\u003cli\u003eMcGuffee, S.R. \u0026amp; Elcock, A.H. Diffusion, Crowding \u0026amp; Protein Stability in a Dynamic Molecular Model of the Bacterial Cytoplasm. \u003cem\u003ePLoS Comput. Biol.\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e(3), e1000694 (2010).\u003c/li\u003e\n\u003cli\u003eZhou, H.X., Rivas, G.N. \u0026amp; Minton, A.P. Macromolecular crowding and confinement: Biochemical, biophysical, and potential physiological consequences. \u003cem\u003eAnnu. Rev. Biophys.\u003c/em\u003e \u003cstrong\u003e37\u003c/strong\u003e, 375-397 (2008).\u003c/li\u003e\n\u003cli\u003eZhang, Y.J.\u003cem\u003e et al.\u003c/em\u003e Real-Time Monitoring of NDM-1 Activity in Live Bacterial Cells by Isothermal Titration Calorimetry: A New Approach To Measure Inhibition of Antibiotic-Resistant Bacteria. \u003cem\u003eACS Infect. Dis.\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, 1671-1678 (2018).\u003c/li\u003e\n\u003cli\u003eLv, M.\u003cem\u003e et al.\u003c/em\u003e Real-time monitoring of D-Ala-D-Ala dipeptidase activity of VanX in living bacteria by isothermal titration calorimetry. \u003cem\u003eAnal. Biochem.\u003c/em\u003e \u003cstrong\u003e578\u003c/strong\u003e, 29-35 (2019).\u003c/li\u003e\n\u003cli\u003eHuebner, A.\u003cem\u003e et al.\u003c/em\u003e Development of quantitative cell-based enzyme assays in microdroplets. \u003cem\u003eAnal. Chem.\u003c/em\u003e \u003cstrong\u003e80\u003c/strong\u003e, 3890-3896 (2008).\u003c/li\u003e\n\u003cli\u003eZotter, A., Bauerle, F., Dey, D., Kiss, V. \u0026amp; Schreiber, G. Quantifying enzyme activity in living cells. \u003cem\u003eJ. Biol. Chem.\u003c/em\u003e \u003cstrong\u003e292\u003c/strong\u003e, 15838-15848 (2017).\u003c/li\u003e\n\u003cli\u003eHartshorne, R.S.\u003cem\u003e et al.\u003c/em\u003e Characterization of an electron conduit between bacteria and the extracellular environment. \u003cem\u003eProc. Natl. Acad. Sci. U.S.A.\u003c/em\u003e \u003cstrong\u003e106\u003c/strong\u003e, 22169-22174 (2009).\u003c/li\u003e\n\u003cli\u003eEdwards, M.J., White, G.F., Butt, J.N., Richardson, D.J. \u0026amp; Clarke, T.A. The Crystal Structure of a Biological Insulated Transmembrane Molecular Wire. \u003cem\u003eCell\u003c/em\u003e \u003cstrong\u003e181\u003c/strong\u003e, 665-673 (2020).\u003c/li\u003e\n\u003cli\u003eOkamoto, A., Hashimoto, K. \u0026amp; Nealson, K.H. Flavin Redox Bifurcation as a Mechanism for Controlling the Direction of Electron Flow during Extracellular Electron Transfer. \u003cem\u003eAngew. Chem. Int. Ed.\u003c/em\u003e \u003cstrong\u003e53\u003c/strong\u003e, 10988-10991 (2014).\u003c/li\u003e\n\u003cli\u003eTokunou, Y., Hashimoto, K. \u0026amp; Okamoto, A. Acceleration of Extracellular Electron Transfer by Alternative Redox-Active Molecules to Riboflavin for Outer-Membrane Cytochrome \u003cem\u003ec\u003c/em\u003e of \u003cem\u003eShewanella oneidensis\u003c/em\u003e MR-1. \u003cem\u003eJ. Phys. Chem. C\u003c/em\u003e \u003cstrong\u003e120\u003c/strong\u003e, 16168-16173 (2016).\u003c/li\u003e\n\u003cli\u003eTokunou, Y., Hashimoto, K. \u0026amp; Okamoto, A. Electrochemical Detection of Deuterium Kinetic Isotope Effect on Extracellular Electron Transport in \u003cem\u003eShewanella oneidensis\u003c/em\u003e MR-1. \u003cem\u003eJ. Visual. Exp.\u003c/em\u003e \u003cstrong\u003e134\u003c/strong\u003e, 57584 (2018).\u003c/li\u003e\n\u003cli\u003eHeidelberg, J.F.\u003cem\u003e et al.\u003c/em\u003e Genome sequence of the dissimilatory metal ion-reducing bacterium \u003cem\u003eShewanella oneidensis\u003c/em\u003e. \u003cem\u003eNat. Biotechnol.\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e, 1118-1123 (2002).\u003c/li\u003e\n\u003cli\u003eCruz-Garcia, C., Murray, A.E., Klappenbach, J.A., Stewart, V. \u0026amp; Tiedje, J.M. Respiratory nitrate ammonification by \u003cem\u003eShewanella oneidensis\u003c/em\u003e MR-1. \u003cem\u003eJ. Bacteriol.\u003c/em\u003e \u003cstrong\u003e189\u003c/strong\u003e, 656-662 (2007).\u003c/li\u003e\n\u003cli\u003eJudd, E.T., Youngblut, M., Pacheco, A.A. \u0026amp; Elliott, S.J. Direct Electrochemistry of \u003cem\u003eShewanella oneidensis\u003c/em\u003e Cytochrome \u003cem\u003ec\u003c/em\u003e Nitrite Reductase: Evidence of Interactions across the Dimeric Interface. \u003cem\u003eBiochemistry\u003c/em\u003e \u003cstrong\u003e51\u003c/strong\u003e, 10175-10185 (2012).\u003c/li\u003e\n\u003cli\u003ePaquete, C.M., Saraiva, I.H. \u0026amp; Louro, R.O. Redox tuning of the catalytic activity of soluble fumarate reductases from \u003cem\u003eShewanella\u003c/em\u003e. \u003cem\u003eBiochim. Biophys. Acta Bioener.\u003c/em\u003e \u003cstrong\u003e1837\u003c/strong\u003e, 717-725 (2014).\u003c/li\u003e\n\u003cli\u003eTsapin, A.I.\u003cem\u003e et al.\u003c/em\u003e Identification of a small tetraheme cytochrome \u003cem\u003ec\u003c/em\u003e and a flavocytochrome \u003cem\u003ec\u003c/em\u003e as two of the principal soluble cytochromes \u003cem\u003ec\u003c/em\u003e in \u003cem\u003eShewanella oneidensis\u003c/em\u003e strain MR-1. \u003cem\u003eAppl. Environ. Microb.\u003c/em\u003e \u003cstrong\u003e67\u003c/strong\u003e, 3236-3244 (2001).\u003c/li\u003e\n\u003cli\u003eMorris, C.J.\u003cem\u003e et al.\u003c/em\u003e Purification and properties of a novel cytochrome: flavocytochrome\u003cem\u003e c\u003c/em\u003e from \u003cem\u003eShewanella putrefaciens\u003c/em\u003e. \u003cem\u003eBiochem. J.\u003c/em\u003e \u003cstrong\u003e302\u003c/strong\u003e, 587-593 (1994).\u003c/li\u003e\n\u003cli\u003ePealing, S.L.\u003cem\u003e et al.\u003c/em\u003e Spectroscopic and Kinetic Studies of the Tetraheme Flavocytochrome \u003cem\u003eC\u003c/em\u003e from \u003cem\u003eShewanella putrefaciens\u003c/em\u003e NCIMB400. \u003cem\u003eBiochemistry\u003c/em\u003e \u003cstrong\u003e34\u003c/strong\u003e, 6153-6158 (1995).\u003c/li\u003e\n\u003cli\u003eDonohuerolfe, A. \u0026amp; Keusch, G.T. Shigella Dysenteriae 1 Cyto Toxin: Periplasmic Protein Releasable by Polymyxin-B and Osmotic Shock. \u003cem\u003eInfect. Immun.\u003c/em\u003e \u003cstrong\u003e39\u003c/strong\u003e, 270-274 (1983).\u003c/li\u003e\n\u003cli\u003eTokunou, Y., Hashimoto, K. \u0026amp; Okamoto, A. Extracellular Electron Transport Scarcely Accumulates Proton Motive Force in \u003cem\u003eShewanella oneidensis\u003c/em\u003e MR-1. \u003cem\u003eBull. Chem. Soc. Jpn.\u003c/em\u003e \u003cstrong\u003e88\u003c/strong\u003e, 690-692 (2015).\u003c/li\u003e\n\u003cli\u003eMcNulty, B.C., Young, G.B. \u0026amp; Pielak, G.J. Macromolecular crowding in the periplasm maintains \u0026alpha;-synuclein disorder. \u003cem\u003eJ. Mol. Biol.\u003c/em\u003e \u003cstrong\u003e355\u003c/strong\u003e, 893-897 (2006).\u003c/li\u003e\n\u003cli\u003eRoss, D.E., Flynn, J.M., Baron, D.B., Gralnick, J.A. \u0026amp; Bond, D.R. Towards Electrosynthesis in \u003cem\u003eShewanella\u003c/em\u003e: Energetics of Reversing the Mtr Pathway for Reductive Metabolism. \u003cem\u003ePLoS One\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e(2), e16649 (2011).\u003c/li\u003e\n\u003cli\u003eMarritt, S.J.\u003cem\u003e et al.\u003c/em\u003e The roles of CymA in support of the respiratory flexibility of \u003cem\u003eShewanella oneidensis\u003c/em\u003e MR-1. \u003cem\u003eBiochem. Soc. Trans.\u003c/em\u003e \u003cstrong\u003e40\u003c/strong\u003e, 1217-1221 (2012).\u003c/li\u003e\n\u003cli\u003eMcMillan, D.G.G.\u003cem\u003e et al.\u003c/em\u003e Protein-Protein Interaction Regulates the Direction of Catalysis and Electron Transfer in a Redox Enzyme Complex. \u003cem\u003eJ. Am. Chem. Soc.\u003c/em\u003e \u003cstrong\u003e135\u003c/strong\u003e, 10550-10556 (2013).\u003c/li\u003e\n\u003cli\u003eFonseca, B.M.\u003cem\u003e et al.\u003c/em\u003e Mind the gap: cytochrome interactions reveal electron pathways across the periplasm of \u003cem\u003eShewanella oneidensis\u003c/em\u003e MR-1. \u003cem\u003eBiochem. J.\u003c/em\u003e \u003cstrong\u003e449\u003c/strong\u003e, 101-108 (2013).\u003c/li\u003e\n\u003cli\u003eMyers, C.R. \u0026amp; Myers, J.M. Cloning and sequence of \u003cem\u003ecymA\u003c/em\u003e, a gene encoding a tetraheme cytochrome \u003cem\u003ec\u003c/em\u003e required for reduction of iron(III), fumarate, and nitrate by \u003cem\u003eShewanella putrefaciens\u003c/em\u003e MR-1. \u003cem\u003eJ. Bacteriol.\u003c/em\u003e \u003cstrong\u003e179\u003c/strong\u003e, 1143-1152 (1997).\u003c/li\u003e\n\u003cli\u003eLeys, D.\u003cem\u003e et al.\u003c/em\u003e Structure and mechanism of the flavocytochrome \u003cem\u003ec\u003c/em\u003e fumarate reductase of \u003cem\u003eShewanella putrefaciens\u003c/em\u003e MR-1. \u003cem\u003eNat. Struct. Biol.\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 1113-1117 (1999).\u003c/li\u003e\n\u003cli\u003eHirst, J. Mitochondrial Complex I. \u003cem\u003eAnnu. Rev. Biochem., \u003c/em\u003e\u003cstrong\u003e82\u003c/strong\u003e, 551-575 (2013).\u003c/li\u003e\n\u003cli\u003eLogan, B.E.\u003cem\u003e et al.\u003c/em\u003e Microbial fuel cells: Methodology and technology. \u003cem\u003eEnviron. Sci. Technol.\u003c/em\u003e \u003cstrong\u003e40\u003c/strong\u003e, 5181-5192 (2006).\u003c/li\u003e\n\u003cli\u003eAtkinson, J.T.\u003cem\u003e et al.\u003c/em\u003e Real-time bioelectronic sensing of environmental contaminants. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e611\u003c/strong\u003e, 548-553 (2022).\u003c/li\u003e\n\u003cli\u003eVellingiri, A.\u003cem\u003e et al.\u003c/em\u003e Overexpression of \u003cem\u003ec\u003c/em\u003e-type cytochrome, CymA in MR-1 for enhanced bioelectricity generation and cell growth in a microbial fuel cell. \u003cem\u003eJ. Chem. Technol. Biotechnol.\u003c/em\u003e \u003cstrong\u003e94\u003c/strong\u003e, 2115-2122 (2019).\u003c/li\u003e\n\u003cli\u003eMarritt, S.J.\u003cem\u003e et al.\u003c/em\u003e A functional description of CymA, an electron-transfer hub supporting anaerobic respiratory flexibility in \u003cem\u003eShewanella\u003c/em\u003e. \u003cem\u003eBiochem. J.\u003c/em\u003e \u003cstrong\u003e444\u003c/strong\u003e, 465-474 (2012).\u003c/li\u003e\n\u003cli\u003eSchuetz, B., Schicklberger, M., Kuermann, J., Spormann, A.M. \u0026amp; Gescher, J. Periplasmic Electron Transfer via the \u003cem\u003ec\u003c/em\u003e-Type Cytochromes MtrA and FccA of \u003cem\u003eShewanella oneidensis\u003c/em\u003e MR-1. \u003cem\u003eAppl. Environ. Microb.\u003c/em\u003e \u003cstrong\u003e75\u003c/strong\u003e, 7789-7796 (2009).\u003c/li\u003e\n\u003cli\u003eCiemniecki, J.A. \u0026amp; Newman, D.K. NADH dehydrogenases are the predominant phenazine reductases in the electron transport chain of \u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e. \u003cem\u003eMol. Microbiol.\u003c/em\u003e \u003cstrong\u003e119\u003c/strong\u003e(5), 560-573 (2023).\u003c/li\u003e\n\u003cli\u003eBaruch, M., Tejedor-Sanz, S., Su, L. \u0026amp; Ajo-Franklin, C.M. Electronic control of redox reactions inside using a genetic module. \u003cem\u003ePLoS One\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e(11), e0258380 (2021).\u003c/li\u003e\n\u003cli\u003eTefft, N.M. \u0026amp; TerAvest, M.A. Reversing an Extracellular Electron Transfer Pathway for Electrode Driven Acetoin Reduction. \u003cem\u003eACS Synth. Biol.\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 1590-1600 (2019).\u003c/li\u003e\n\u003cli\u003ePedersen, M.B., Gaudu, P., Lechardeur, D., Petit, M.A. \u0026amp; Gruss, A. Aerobic Respiration Metabolism in Lactic Acid Bacteria and Uses in Biotechnology. \u003cem\u003eAnnu. Rev. Food Sci. T\u003c/em\u003e \u003cstrong\u003e3\u003c/strong\u003e, 37-58 (2012).\u003c/li\u003e\n\u003cli\u003eLobritz, M.A.\u003cem\u003e et al.\u003c/em\u003e Antibiotic efficacy is linked to bacterial cellular respiration. \u003cem\u003eProc. Natl. Acad. Sci. U.S.A.\u003c/em\u003e \u003cstrong\u003e112\u003c/strong\u003e, 8173-8180 (2015).\u003c/li\u003e\n\u003cli\u003eMouton, J.W.\u003cem\u003e et al.\u003c/em\u003e MIC-based dose adjustment: facts and fables. \u003cem\u003eJ. Antimicrob. Chemoth.\u003c/em\u003e \u003cstrong\u003e73\u003c/strong\u003e, 564-568 (2018).\u003c/li\u003e\n\u003cli\u003eGreis, K.D.\u003cem\u003e et al.\u003c/em\u003e Development and validation of a whole-cell inhibition assay for bacterial methionine aminopeptidase by surface-enhanced laser desorption ionization-time of flight mass spectrometry. \u003cem\u003eAntimicrob. Agents Chemother.\u003c/em\u003e \u003cstrong\u003e49\u003c/strong\u003e, 3428-3434 (2005).\u003c/li\u003e\n\u003cli\u003eLeger, C. \u0026amp; Bertrand, P. Direct electrochemistry of redox enzymes as a tool for mechanistic studies. \u003cem\u003eChem. Rev.\u003c/em\u003e \u003cstrong\u003e108\u003c/strong\u003e, 2379-2438 (2008).\u003c/li\u003e\n\u003cli\u003eTahernia, M.\u003cem\u003e et al.\u003c/em\u003e A 96-well high-throughput, rapid-screening platform of extracellular electron transfer in microbial fuel cells. \u003cem\u003eBiosens. Bioelectron.\u003c/em\u003e \u003cstrong\u003e162\u003c/strong\u003e(15), 112259 (2020).\u003c/li\u003e\n\u003cli\u003eMiran, W., Huang, W., Long, X., Imamura, G. \u0026amp; Okamoto, A. Multivariate landscapes constructed by Bayesian estimation over five hundred microbial electrochemical time profiles. \u003cem\u003ePatterns\u003c/em\u003e \u003cstrong\u003e3\u003c/strong\u003e, 100610 (2022).\u003c/li\u003e\n\u003cli\u003eYabe, Y.\u003cem\u003e et al.\u003c/em\u003e Comparative proteome analysis of the ligamentum flavum of patients with lumbar spinal canal stenosis. \u003cem\u003eJOR Spine.\u003c/em\u003e \u003cstrong\u003e5\u003c/strong\u003e(4), e1210 (2022).\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Table","content":"\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eTurnover number (\u003cem\u003ek\u003c/em\u003e\u003csub\u003e\u003cem\u003ecat\u003c/em\u003e\u003c/sub\u003e) of NrfA and FccA in MR-1 cells on ITO electrodes.\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\u0026nbsp;\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eV\u003csub\u003emax\u003c/sub\u003e / pmol s\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eThe amount of proteins on an ITO electrode /pmol\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003ek\u003c/em\u003e\u003csub\u003e\u003cem\u003ecat\u003c/em\u003e\u003c/sub\u003e /s\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eNrfA in wild-type\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e94.5\u0026thinsp;\u0026plusmn;\u0026thinsp;16.8\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e4.12\u0026thinsp;\u0026plusmn;\u0026thinsp;0.75\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e20.4\u0026thinsp;\u0026plusmn;\u0026thinsp;4.37\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eNrfA in \u0026Delta;\u003cem\u003ecymA\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e97.8\u0026thinsp;\u0026plusmn;\u0026thinsp;13.6\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.66\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e16.3\u0026thinsp;\u0026plusmn;\u0026thinsp;2.46\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePurified NrfA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e-\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e-\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e7\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eFccA in wild-type\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e751\u0026thinsp;\u0026plusmn;\u0026thinsp;72.0\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e4.63\u0026thinsp;\u0026plusmn;\u0026thinsp;0.55\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e182\u0026thinsp;\u0026plusmn;\u0026thinsp;37.4\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eFccA in \u0026Delta;\u003cem\u003ecymA\u003c/em\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e484\u0026thinsp;\u0026plusmn;\u0026thinsp;128\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e6.01\u0026thinsp;\u0026plusmn;\u0026thinsp;0.35\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e96.9\u0026thinsp;\u0026plusmn;\u0026thinsp;28.6\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePurified FccA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e-\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e-\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e250\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eThe \u003cem\u003ek\u003c/em\u003e\u003csub\u003e\u003cem\u003ecat\u003c/em\u003e\u003c/sub\u003e of purified NrfA and FccA were cited from ref. \u003csup\u003e17\u003c/sup\u003e and ref. \u003csup\u003e20\u003c/sup\u003e respectively.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-4306846/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4306846/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eDeciphering metabolic enzyme catalysis in living cells remains a formidable challenge due to the limitations of \u003cem\u003ein vivo\u003c/em\u003e assays, which focus on enzymes isolated from respiration. This study introduces an innovative whole-cell electrochemical assay to reveal the Michaelis-Menten landscape of metabolic enzymes amid complex molecular interactions. We controlled the microbial current generation's rate-limiting step, extracting \u003cem\u003ein vivo\u003c/em\u003e kinetic parameters (\u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003em\u003c/em\u003e\u003c/sub\u003e, \u003cem\u003eK\u003c/em\u003e\u003csub\u003e\u003cem\u003ei\u003c/em\u003e\u003c/sub\u003e, and \u003cem\u003ek\u003c/em\u003e\u003csub\u003e\u003cem\u003ecat\u003c/em\u003e\u003c/sub\u003e) for the periplasmic nitrite and fumarate (FccA) reductases. Despite deleting CymA, a key electron donor, alternative electron transfer pathways sustained the FccA activity. This enabled direct observation of FccA-CymA interaction, uncovering the pivotal role of CymA in altering the post-binding dynamics of FccA, such as catalysis and product release. This finding challenges the long-held belief that the molecular crowding effect primarily drives discrepancies between \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e kinetics. This work offers significant leap in understanding cellular enzymatic processes and opens avenues for future biochemical research.\u003c/p\u003e","manuscriptTitle":"Decoding In-Cell Respiratory Enzyme Dynamics by Label-Free In-situ Electrochemistry","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-05-02 06:35:00","doi":"10.21203/rs.3.rs-4306846/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"8be671cf-6f94-4934-b5d7-326761a0d9d3","owner":[],"postedDate":"May 2nd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":31370609,"name":"Biological sciences/Biochemistry/Biophysical chemistry"},{"id":31370610,"name":"Biological sciences/Biochemistry/Biocatalysis"}],"tags":[],"updatedAt":"2024-05-02T06:43:02+00:00","versionOfRecord":[],"versionCreatedAt":"2024-05-02 06:35:00","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4306846","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4306846","identity":"rs-4306846","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.