Cross-species incompatibility between a DNA satellite and the Drosophila Spartan homolog poisons germline genome integrity

Cross-species incompatibility between a DNA satellite and the Drosophila Spartan homolog poisons germline genome integrity | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Cross-species incompatibility between a DNA satellite and the Drosophila Spartan homolog poisons germline genome integrity Cara L. Brand , Mia T. Levine doi: https://doi.org/10.1101/2021.08.13.455988 Cara L. Brand Department of Biology and Epigenetics Institute, University of Pennsylvania , Philadelphia, PA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Mia T. Levine Department of Biology and Epigenetics Institute, University of Pennsylvania , Philadelphia, PA Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: m.levine{at}sas.upenn.edu Abstract Full Text Info/History Metrics Preview PDF ABSTRACT Satellite DNA spans megabases of eukaryotic sequence and evolves rapidly. Paradoxically, satellite-rich genomic regions mediate strictly conserved, essential processes like chromosome segregation and nuclear structure. A leading resolution to this paradox posits that satellite DNA and satellite-associated chromosomal proteins coevolve to preserve these essential functions. We experimentally test this model of intra-genomic coevolution by conducting the first evolution-guided manipulation of both chromosomal protein and DNA satellite. The 359bp satellite spans an 11Mb array in D. melanogaster that is absent from its sister species, D. simulans . This species-specific DNA satellite colocalizes with the adaptively evolving, ovary-enriched protein, Maternal Haploid (MH)–the Drosophila homolog of Spartan. To determine if MH and 359 coevolve, we swapped the D. simulans version of MH (“MH[sim]”) into D. melanogaster . MH[sim] triggers ovarian cell death, reduced ovary size, and loss of mature eggs. Surprisingly, the D. melanogaster mh null mutant has no such ovary phenotypes, suggesting that MH[sim] is toxic in a D. melanogaster background. Using both cell biology and genetics, we discovered that MH[sim] poisons oogenesis through a DNA damage pathway. Remarkably, deleting the D. melanogaster -specific 359 satellite array completely restores mh[sim] germline genome integrity and fertility, consistent with a history of coevolution between these two fast-evolving loci. Germline genome integrity and fertility are also restored by overexpressing Topoisomerase II (Top2), suggesting that MH[sim] interferes with Top2-mediated processing of 359. The observed 359-MH[sim] cross-species incompatibility supports a model under which ostensibly inert repetitive DNA and essential chromosomal proteins must coevolve to preserve germline genome integrity. RESULTS AND DISCUSSION DNA satellite-enriched genomic regions evolve rapidly and yet support strictly conserved nuclear functions. 1 – 9 A classic resolution to this paradox posits that DNA satellite-associated proteins evolve adaptively to mitigate deleterious proliferation of DNA satellite sequence variants. 10 Repeated bouts of DNA satellite evolution and chromosomal protein adaptation result in exquisitely coevolved satellites and satellite-associated proteins. This model of coevolution predicts pervasive incompatibilities between satellite DNA and chromosomal proteins from closely related species: adaptively evolving chromosomal proteins from one species should fail to package or process DNA satellites from another. 10 – 12 Evidence for this coevolution model has emerged from engineering “evolutionary mismatches” between the adaptively evolving chromosomal protein(s) of one species and the DNA satellite landscape of a close relative. Under one approach, a diverged chromosomal protein is introduced into a closely related species, generating an evolutionary mismatch between the manipulated protein and one or more DNA satellites. 12 – 15 Consistent with disrupted DNA satellite:chromosomal protein coevolution, the naïve protein typically perturbs a satellite-mediated function, such as chromosome segregation or nuclear organization. 12 , 14 , 15 In these cases, however, the incompatible DNA satellites are unknown. A second approach crosses sister species to generate evolutionary mismatches between chromosomal proteins and DNA satellites in hybrid progeny. Consistent with disrupted DNA satellite:chromosomal protein coevolution, interspecies hybrid inviability has been linked to satellite-rich genomic loci. 16 , 17 In these systems, however, the incompatible chromosomal proteins are unknown. To date, there are no cases of experimental identification of both chromosomal protein and satellite engaged in coevolution. To experimentally probe both sides of the coevolution model, we searched for a rapidly evolving DNA satellite associated with an adaptively evolving chromosomal protein. In Drosophila melanogaster , the 359bp satellite spans an 11Mb array at the base of the X chromosome. 18 , 19 Close relatives of D. melanogaster , including D. simulans and D. erecta , lack this X -linked satellite array. 20 Instead, these species have shorter arrays of “359-like” sequence dispersed throughout heterochromatin and euchromatin. 9 , 21 , 22 Such extreme lineage-restriction to D. melanogaster makes this DNA satellite array an ideal locus for testing the coevolution model. On the protein side, we identified from the literature Maternal Haploid (MH), an ovary-enriched protein that is maternally provisioned to the embryo and colocalizes with the 359 satellite. 23 , 24 Embryos of mh null mothers suffer paternal chromosome mis-segregation at the very first mitosis, suggesting that the maternally-provisioned MH prepares the otherwise inert, sperm-deposited paternal chromosomes for participation in embryonic mitosis. 23 , 24 Most of these embryos arrest around the first mitotic division. A smaller fraction develop beyond the first division, cycling only the “maternal haploid” complement of chromosomes until arrest prior to hatching. 23 – 25 If the D. melanogaster -specific 359 proliferation triggered mh to innovate, we should detect evidence of positive selection at mh between D. melanogaster and D. simulans . To determine if mh evolves adaptively, we conducted a McDonald-Kreitman test 26 using polymorphism within D. melanogaster and D. simulans populations and divergence between D. melanogaster and D. simulans (2.5 million years diverged 27 ). This comparison revealed an excess of nonsynonymous fixations, consistent with a history of adaptive evolution ( Figure 1A ). The dynamic evolution of the 359 satellite and adaptive evolution of a 359-associated protein, MH, raises the possibility that mh recurrently evolves to preserve a biological function compromised by 359 satellite proliferation. Download figure Open in new tab Figure 1. MH evolves adaptively to preserve female fertility. (A) Counts of synonymous and nonsynonymous polymorphic and fixed sites within and between D. melanogaster and D. simulans; χ 2 test, p = 0.04. (B) Swap strategy: the D. melanogaster (“ D. mel ”, blue) or D. simulans (“ D. sim ,” yellow) mh coding sequence, codon-optimized for D. melanogaster and 3xFLAG-tagged, replaced the native mh gene on the X chromosome. (C) Total offspring from mh[mel] or mh[sim] females crossed to wildtype ( w 1118 ) males. (D) Frequency distribution of embryos at increasing mitotic cycle numbers collected for 70 minutes from mh[mel] , mh[sim] , and mh 1 females. Dashed bars from mh 1 females correspond to embryos undergoing mitotic catastrophe likely triggered at the first mitosis. Solid gray bars representing mh 1 -derived embryos are presumed to be maternal haploid. (E) Representative images and ovary size estimates from mh[mel] and mh[sim] females. (F) Number of mature eggs per ovary pair from mh[mel] and mh[sim] females. ( t -test: “***” = p < 0.001, scale bar = 100μm) To test the possibility of MH:359 coevolution, we first conducted an evolution-guided manipulation of mh to generate an “evolutionary mismatch” between protein and satellite. We used CRISPR/Cas9 to integrate into the native mh locus of D. melanogaster either a 3xFLAG-tagged mh coding sequence from D. melanogaster (our control fly, “ mh[mel] ”) or a 3xFLAG-tagged mh coding sequence from D. simulans (our experimental fly, “ mh[sim] ”, Figure 1B ). Both the D. melanogaster and the D. simulans coding sequences were codon-optimized for D. melanogaster. We observed equivalent expression of the two transgenes ( Figure S1A ). The mh null mutant phenotype in the early embryo motivated our prediction that an evolutionary mismatch between the D. simulans mh and the D. melanogaster 359 X -linked array would compromise paternal chromosome segregation during the first mitotic division. Specifically, we predicted that MH[sim] would fail to recognize and process 359, triggering mis-segregation of the paternal X -chromosome. This defect would result in reduced female fertility and a dearth of female progeny. We discovered that mh[sim] females produced significantly fewer progeny than control mh[mel] females ( Figure 1C ); however, contrary to our prediction, the progeny sex ratio did not deviate from 50/50 ( Figure S1B ). These data suggest that paternal 359 is not uniquely vulnerable to the presence of MH[sim] during the first mitotic division. Consistent with this inference, we observed that mh[sim] completely rescues the first mitotic division: embryos from mh[mel] and mh[sim] mothers show equivalent, normal distributions of embryonic stages from a 70-minute collection ( Figure 1D ). In contrast, embryos produced by mh null mothers typically arrest during the first division ( Figure 1D ). Moreover, we observed no evidence of elevated maternal haploid embryos from mh[sim] mothers ( Figure S1C ). These data suggest that mh[sim] does not phenocopy the mh null early embryonic phenotype. To uncover an alternative source of the mh[sim] fertility defect, we looked at the developmental stage just before the first embryonic mitosis: oogenesis. Although mh is highly expressed during oogenesis, previous reports suggested that mh null alone yields no ovary phenotype 23 , 24 . We similarly detected no difference in ovary size or mature egg number of mh null mothers compared to heterozygous controls ( Figure S1D,E ). In contrast, mh[sim] ovaries are significantly smaller than mh[mel] ovaries and are depleted of the most mature egg stages ( Figure 1E,F ). This unexpected mh[sim] ovary phenotype, combined with the complete rescue of the first embryonic division by mh[sim] , suggests that mh[sim] does not behave as a loss-of-function allele. Instead, MH[sim] might be toxic. To explore the possibility that MH[sim] is toxic, we first asked if MH[sim] localizes aberrantly in the ovary. We visualized MH[mel] and MH[sim] by staining ovaries with anti-FLAG. We discovered that MH[mel] localized primarily in the earliest stages of oogenesis (the germarium, Figure 2A,B ). MH[sim] localized not only in these early stages of oogenesis but also on the “nurse cell” nuclei of later stage egg chambers and weakly on the somatic follicle cell nuclei ( Figure 2A,B ). The aberrant persistence of MH[sim] during oogenesis, combined with compromised mh[sim] ovary development, raised the possibility that MH mislocalization alone might be toxic. To test this hypothesis, we used the UAS/GAL4 system to overexpress MH[mel] in the female germline (driver nos-Gal4-VP16). In ovaries overexpressing MH[mel], we indeed observed elevated levels and aberrant persistence of the protein in later stage egg chambers ( Figure S2A ). Nevertheless, these females gave rise to abundant progeny ( Figure S2B ), suggesting that mislocalization alone cannot explain the compromised ovary development of mh[sim] females. In contrast, overexpression of MH[sim] in otherwise wildtype ovaries resulted in a complete absence of mature eggs (nosGAL4 > UASp- mh[sim] : μ = 0 eggs/ovary pair versus native > mh[sim] : μ = 15 eggs/ovary pair, n = 63 ovary pairs/genotype). Consequently, these females were completely sterile ( Figure. S2B ). These data suggest that MH[sim] – which functions normally in its native D. simulans genome – is toxic to oogenesis in D. melanogaster . This toxicity appears to be dose-dependent. Heterozygous mh[mel]/mh[sim] females give rise to progeny counts similar to mh[mel] homozygotes ( Figure S2C ). Download figure Open in new tab Figure 2. MH[sim] poisons oogenesis through a DNA damage pathway. (A) Diagram of a Drosophila ovary (above) and a single ovariole (below) with the germline stem cells in the germarium at the anterior (left) position and the mature eggs at the posterior position (right). The dashed box shows the developmental stages shown in images 2B-2D (Created using BioRender.com ). (B) mh[mel] and mh[sim] ovaries stained with anti-FLAG to visualize MH localization (left). Merged images of single nuclei (*) show no MH foci on the DNA (dashed inset boxes). Merged images of enlarged egg chambers imaged under higher laser power reveal that MH[sim] but not MH[mel] localizes to the peripheral follicle cells (right). (C) Incidence of cell death captured by the fraction of ovarioles with condensed nuclei (arrowheads) in mh[mel] and mh[sim] ovaries. (D) γH2Av signal in mh[mel] and mh[sim] ovaries and the quantification of normalized fluorescent signal intensity. Note that the expected γH2Av-positive cells in the germarium in mh[mel] are absent under the imaging parameters used but are indeed present, see Figure S2D . (E) Ovary size estimates from mh[mel];Chk2 -/- and mh[sim];Chk2 -/- females. (F) Number of mature eggs per ovary pair from mh[mel];Chk2 -/- and mh[sim];Chk2 -/- females. In panels E and F, dotted lines correspond to mh[mel] and mh[sim] averages reported in Figure 1E and F , respectively. ( t -test: “***” = p 0.05, scale bar = 25μm) To study the cell biological basis of this block to oogenesis, we turned back to ovaries of females expressing the CRISPR-introduced mh[mel] or mh[sim] transgene under the native promoter ( Figure 1B ). We observed an excess of hyper-condensed nuclei in mh[sim] ovaries, consistent with elevated cell death ( Figure 2C 28 , 29 ). A classic trigger of cell death is the accumulation of DNA damage. 30 To visualize DNA damage, we stained mh[mel] and mh[sim] ovaries for the double-stranded break marker, γH2Av. 31 , 32 We observed elevated DNA damage signaling in mh[sim] ovaries ( Figure 2D , S2D ). This phenotype further distinguishes mh[sim] from mh null ovaries – the latter show no evidence of elevated DNA damage ( Figure S2E ). To address the hypothesis that MH[sim] compromises oogenesis through a DNA repair pathway, we combined mh[sim] with a null mutation in a DNA damage checkpoint gene. The gene, Chk2 (also known as mnk ), normally blocks egg production in the presence of DNA damage. 33 , 34 Chk2 -/- ovaries bypass this checkpoint, allowing a female to make mature but damaged eggs in the presence of elevated DNA damage. We discovered that Chk2 -/- restores mh[sim] ovaries to mh[mel] -like ovary size and mh[mel] -like egg production ( Figure 2E,F ). However, the mh[sim ]; Chk2 -/- females are sterile while mh[mel] ]; Chk -/- females retain fertility ( Figure S2F ). These data suggest that MH[sim] compromises oogenesis by triggering DNA damage. Applying these phenotypic data to the coevolution model, we hypothesized that MH[sim]-induced DNA damage depends on the 11Mb array of 359 satellite in D. melanogaster . Under this model, MH[sim]-specific residues are incompatible with 359. Removing 359 should restore germline genome integrity and fertility of mh[sim] females. To directly test this prediction, we took advantage of a fly strain that lacks the 11Mb array of X -linked 359 satellite ( Figure 3A 35 ). We recombined this 359-deletion, called Zygotic hybrid rescue , or “ Zhr ,” onto both the mh[mel] and the mh[sim] X chromosomes ( Figure 3A ). If MH[sim]-induced toxicity depends on the presence of the 359 expansion, mh[sim],Zhr females should have minimal DNA damage and recover fertility. Remarkably, the 359-deletion completely restores the DNA damage marker, γH2Av, to wildtype (low) levels ( Figure 3B ). Consistent with restored germline genome integrity of mh[sim] females, we observed no difference in ovary size and no difference in egg production between mh[mel] and mh[sim] females that lack 359 ( Figure 3C,D ). Finally, the 359-deletion completely restores mh[sim] fertility to mh[mel] levels ( Figure 3E ). These data reveal that MH[sim] toxicity depends on 359, consistent with a history of coevolution between these two fast-evolving components of the Drosophila genome. Download figure Open in new tab Figure 3. The 359 satellite deletion rescues mh[sim] genome integrity and fertility. (A) The Zhr X chromosome lacks the 11Mb pericentromeric 359 satellite array (left). A 10-cycle PCR distinguishes between wildtype 359 copy number and the 359-deletion ( Zhr ) and validates the recombined mh[mel],Zhr and recombined mh[sim],Zhr X chromosomes (right). (B) γH2Av signal in mh[mel],Zhr and mh[sim],Zhr ovaries and the quantification of normalized fluorescent signal intensity. (C) Ovary size of mh[mel],Zhr and mh[sim],Zhr females. (D) Number of mature eggs per ovary pair from mh[mel],Zhr and mh[sim],Zhr females. (E) Progeny counts from mh[mel],Zhr and mh[sim],Zhr females crossed to wildtype ( w 1118 ) males. In panel B, dotted lines correspond to mh[mel] and mh[sim] averages reported in Figure 2D . In panels C, D, and E, dotted lines correspond to mh[mel] and mh[sim] averages reported in Figure 1E, F , and C , respectively. ( t -test: “n.s.” p > 0.05, scale bar = 25μm) The observed 359-dependent toxicity rather than loss of function suggests that MH[sim] may interfere with the preservation of 359 integrity. To define a molecular basis for this interference, we used two, well-characterized MH homologs as guides. The MH homologs in worm (DVC-1) and human (Spartan) use the conserved Spartan metalloprotease domain to cleave DNA-protein crosslinks that form between DNA and Topoisomerase II (Top2 36 – 38 ). These crosslinks dock Top2 at DNA entanglements, which Top2 resolves by inducing double strand breaks followed by re-ligation. 39 – 41 In D. melanogaster , Top2 specifically cleaves 359 42 and resolves DNA entanglements involving 359 during female meiosis. 43 We hypothesized that MH[sim] interferes with Top2 resolution of 359 entanglements. This interference model predicts that Top2 is limiting in the presence of MH[sim]. To test this prediction, we reduced Top2 using a heterozygous loss of function mutant and overexpressed Top2 in the ovary using the UAS/ GAL4 system in an mh[mel] or mh[sim] background. Reduction of Top2 exacerbates mh[sim] -dependent subfertility ( Figure 4A ) while Top2 overexpression in the ovary completely rescues mh[sim] fertility ( Figure 4B ). The rescued mh[sim] ovaries also showed restored genome integrity ( Figure 4C ). Excess Top2 appears to overcome MH[sim] interference. Combined with the literature on DNA-Top2 crosslink cleavage by MH homologs DVC-1 and Spartan, these data raise the possibility that MH[sim] over-actively clears the 359-Top2 crosslinks necessary to resolve 359 entanglements in the female germline. Persistent DNA entanglements would trigger the observed DNA damage that blocks oogenesis progression ( Figure 4D ). Download figure Open in new tab Figure 4. MH[sim] interferes with Top2 processing of 359 entanglements. (A) Progeny counts from mh[mel];Top2 − /+ and mh[sim];Top2 − /+ females crossed to wildtype ( w 1118 ) males. (B) Progeny counts from nos-Gal4-VP16 (female germline GAL4) driven mh[mel]; UAS -Top2 or mh[sim]; UAS -Top2 females crossed to wildtype ( w 1118 ) males. (C) γH2Av signal from ovaries of nos-Gal4-VP16 driven mh[mel]; UAS -Top2 or mh[sim]; UAS -Top2 females and quantification of normalized fluorescent signal intensity. (D) Model of MH[sim] interference with Top2 processing of 359 entanglements. These entanglements threaten genome integrity and ultimately, fertility. MH[mel], in contrast, has no measurable function in the ovaries, suggesting that it avoids interfering with 359 processing by Top2. (E) Model of MH evolution tracking 359 satellite proliferation. In panel A, dotted lines correspond to mh[mel] and mh[sim] averages reported in Figure 1C . In panel C, dotted lines correspond to mh[mel] and mh[sim] averages reported in Figure 2D . ( t -test: “***” = p 0.05, scale bar = 25μm) Our model is motivated in part by the observation that repeat-rich heterochromatin, but especially the 11Mb array of 359, is uniquely vulnerable to DNA entanglements. 16 , 43 , 44 If 359 is so deleterious, how could it have proliferated? DNA satellites can behave selfishly, gaining a transmission advantage from one generation to the next. 45 , 46 We suspect that such non-Mendelian segregation led to 359 proliferation, triggering MH to evolve adaptively ( Figure 4E ). However, we cannot formally rule out the possibility that a selection pressure distinct from 359 proliferation triggered MH adaptive evolution. Under this alternative model, the D. melanogaster version of MH evolved first, releasing constraint on 359 copy number. Most likely, both selection and loss of constraint operate cyclically. Regardless of the force(s) that promoted 359 proliferation, the 359:MH system offers an important elaboration of the canonical model of intra-genomic coevolution. 10 , 47 – 49 This canonical model posits that chromosomal proteins evolve adaptively to recognize and process novel satellite repeat variants. Under this model, the mismatched mh[sim] allele should fail to perform an mh function; that is, act as a loss of function allele. Instead, we demonstrate that mh[sim] is toxic, suggesting that mh[mel] instead evolved adaptively to avoid interfering with 359 processing, and likely 359 processing by Top2. The observed colocalization of MH[mel] foci with Top2 and 359 in the embryo ( 24 , many cycles after the first mitosis) motivates future work dissecting the functional consequences of MH adaptive evolution during this distinct developmental stage. 359-mediated toxicity to oogenesis highlights the catastrophic functional consequences of DNA satellite evolution. Importantly, 359-mediated toxicity is also apparent in D. melanogaster-D. simulans hybrid embryos: a distinct, unmapped gene on D. simulans chromosome 2 50 – 53 interacts deleteriously with 359 to cause embryonic chromosome mis-segregation, genome instability, and lethality. 16 , 35 , 54 This interspecies hybrid dysfunction in the embryo, together with the 359: mh[sim] toxicity in the ovary reported here, suggests that recurrent bouts of coevolution not only shape essential genome functions within species but also can trigger hybrid incompatibilities between species. AUTHOR CONTRIBUTIONS Conceptualization, M.T.L and C.L.B.; Methodology, M.T.L and C.L.B.; Investigation, M.T.L and C.L.B; Writing M.T.L and C.L.B; Funding Acquisition, M.T.L and C.L.B. DECLARATION OF INTERESTS The authors declare no competing interests. STAR METHODS Key resources table View this table: View inline View popup Contact for reagent and resource sharing Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Mia Levine ( m.levine{at}sas.upenn.edu ). Population genetic and molecular evolution analyses We conducted population genetic analysis of mh using multiple alleles from both D. melanogaster and D. simulans . We obtained eight D. melanogaster mh alleles (coordinates X :15472804-15475400, dmel r6.4) from lines collected in Lyon, France. 56 We amplified seven D. simulans mh alleles from lines collected in Nairobi, Kenya (Accession OL546458 - OL546464 ) 57 . Importantly, a duplication event occurred along the D. simulans lineage, resulting in a full-length copy of the mh ortholog, and a tandem partial duplicate. 58 To specifically amplify the full length mh ortholog, we designed primers that anneal to unique genomic sequence ( Table S1 ). We then prepared genomic DNA and conducted PCR amplification followed by Sanger sequencing using standard protocols. We aligned the sequences in Geneious using the Geneious Alignment algorithm with default settings (Geneious v11.1.5, Biomatters, Auckland, New Zealand) and confirmed alignment quality by eye. We performed a McDonald-Kreitman test 26 with the D. melanogaster and D. simulans mh coding sequences. Fly stock construction and husbandry Constructing gene swaps We used CRISPR/Cas9 to generate D. melanogaster flies that encode a transgenic D. melanogaster allele or a D. simulans allele of mh, integrated into the native location. We first generated a U6 promoter-driven guide RNA construct by cloning sgRNAs flanking the coding sequence of mh (5’: GGATTGGCCCAGGATCAACA, 3’: CGTGGAGAGCTTCTGCCGCG) into pBFv-U6.2 and pBFv-U6.2B backbones. We shuttled the 3’ sgRNA into pBFv-U6.2 to create a dual sgRNA vector (University of Utah Mutagenesis Core). In parallel, we constructed homology directed repair (HDR) plasmids encoding one kilobase homology arms 5’ and 3’ of their respective guide RNAs. Between the homology arms we synthesized a codon-optimized (for D. melanogaster ) mh coding sequence from either D. melanogaster or D. simulans (GenScript, Piscataway, NJ). We N-terminally tagged each sequence with 3xFLAG along with a linker sequence (GGTGGTTCATCA). We injected the dual sgRNA vector and a single HDR plasmid into the Cas9-expressing line, yw; nos-Cas9(II-attP40) (BestGene Inc, Chino Hills, CA). We crossed single males, injected as embryos, to FM7 ( X -chromosome balancer) females. We screened F 1 females to identify positive transformants using forward primer 5’-AAGTGTCGCGCTATTTCACC-3’ and reverse primer 5’-TCACCGTCATGGTCTTTGTAGTCCAT-3’. We then backcrossed the positive F 1 females to FM7 males and self-crossed the balanced F 2 progeny to generate lines homozygous for either mh[mel] or mh[sim] allele. To confirm that the introduced alleles encoded the expected sequence and in the expected location, we amplified the entire region from homozygous flies using primers that anneal outside of the homology arms (5’-AATGGATTTCGGCAAATGAG-3’, 5’-GTCGTTGTAGGAGCCCATGT-3’) and then sequenced across the entire region. We also designed primers that amplified the native mh locus (5’-GGCCCTGCTCATATCGTATC-3’, 5’-AAGAACCTTACTGCGTGCAAC-3’) to confirm that our final genotypes were true replacements. Primers can be found in Table S1 . Constructing UAS-mh and UAS-Top2 lines We used the ϕC31 integrase-mediated transgenesis system to introduce into the same landing site mh from D. melanogaster or D. simulans downstream of an “upstream activating sequence” or “UAS” 59 . Using the HDR plasmids as a template (see above), we PCR-amplified the 3xFLAG-tagged mh coding sequence (either D. melanogaster or D. simulans) using Phusion High-Fidelity DNA Polymerase (NEB, Ipswich, MA). We cloned the resulting PCR products into NotI/XbaI sites of the pUASp-attB vector ( Drosophila Genomics Resource Center, Bloomington, IN). We confirmed the absence of PCR-introduced mutations in the cloned UAS- mh[mel] and UAS- mh[sim] alleles by direct Sanger sequencing of the constructs ( Table S1 ). We introduced the constructs into D. melanogaster yw; PBac[y + - attP-9A]VK00018 flies, which have an attP transgene landing site at cytological position 75A10 on chromosome 3L (BestGene Inc, Chino Hills, CA). We next made each transgene homozygous. To overexpress the transgenic alleles, we crossed these stocks to Gal4::VP16-nos (BDSC #64277), which drives germline expression of transgenes downstream of UAS. Similarly, we used the ϕC31 integrase-mediated transgenesis system to introduce Top2 from D. melanogaster downstream of an UAS promoter. 59 We synthesized a codon-optimized (for D. melanogaster ) Top2 coding sequence from D. melanogaster (Twist, South San Francisco, CA). We N-terminally tagged each sequence with 3xHA along with a linker sequence (GGTGGTTCATCA). We introduced the constructs into D. melanogaster yw; PBac[y + - attP-9A]VK00018 flies (see above, BestGene Inc, Chino Hills, CA). We next constructed either mh[mel] ; UAS- Top2[mel] or mh[sim] ; UAS- Top2[mel] stocks using balancer chromosomes. To overexpress the transgenic Top2 allele, we crossed either mh[mel] ; UAS- Top2[mel] or mh[sim] ; UAS- Top2[mel] males to either mh[mel] ; Gal4::VP16-nos or mh[sim] ; Gal4::VP16-nos females, respectively. Zhr rescue stocks To generate stocks that encode both the X- linked mh -transgene and the X- linked 359 satellite deletion ( Zhr 1 , BDSC #25140), we first generated trans-heterozygote females. We crossed these trans-heterozygote females to FM7 males and used PCR to assay individual recombinant male progeny for the presence of both the mh transgene and Zhr. We detected the mh transgenes with forward primer 5’-AAGTGTCGCGCTATTTCACC-3’ and reverse primer 5’-TCACCGTCATGGTCTTTGTAGTCCAT-3’. To detect the Zhr mutation ( i.e. , 359 satellite deletion), we used forward primer 5’-TATTCTTACATCTATGTGACC-3’ and reverse primer 5’-GTTTTGAGCAGCTAATTACC-3’. 6 Performing a 10-cycle PCR at an annealing temperature of 52C yields a band only in the presence of the 11Mb 359 satellite array ( Figure 3A ). We backcrossed males positive for both the mh transgene and Zhr mutation to FM7 females to generate a permanent stock. Additional stocks Heterozygote mh[mel]/mh[sim] females were generated by crossing mh[mel] females to mh[sim] males. We used a +/FM7; +/CyO stock to generate flies encoding both the mh transgene at the native locus (chromosome X ) and the Chk -/- ( mnk ) mutation (chromosome 2 ). The mnk l6 stock 34 was a gift from N. Phadnis. To generate heterozygous Top2 hypomorph females, we also used a +/FM7; +/CyO stock to generate flies encoding both the mh transgene at the native locus (chromosome X ) and a heterozygous Top2 176 /CyO mutation (chromosome 2 ). The Top2 176 stock 60 was a gift from P. Geyer. Immunoblotting To assay 3x-FLAG MH protein abundance in the ovary, we dissected 20 ovary pairs in 1X PBS and ground the material in RIPA buffer (Cell Signaling Technology, Danvers, MA), Protease Inhibitor Cocktail (Roche, Basel, Switzerland), and 2X PMSF (Cell Signaling Technology, Danvers, MA). To promote solubility, we incubated the lysate in benzonase (Sigma Aldrich, St. Louis, MO) for 1hr at 4C. We used 20µg of lysate and probed with 1:10,000 anti-FLAG (M2, Sigma Aldrich, St. Louis, MO) or 1:1000 anti-αTubulin (Developmental Studies Hybridoma Bank, Iowa City, IA) and 1:1000 anti-mouse HRP secondaries (Kindle Biosciences, Greenwich, CT). We exposed blots with Kwikquant Western Blot detection kit and imaged with a Kwikquant imager (Kindle Biosciences, Greenwich, CT). Fertility assays Female fertility To assay female fertility, we first aged virgin females 3-5 days. For each replicate vial, we crossed four virgin females to four w 1118 males. We conducted all crosses on molasses food at 24C. We flipped the parents onto new food every three days over the course of nine days and counted all progeny that emerged. Ovary size and mature egg counts To determine the number of mature eggs and ovary size from focal genotypes, we first dissected ovary pairs in 1X PBS and imaged at 8X magnification with a Leica DFC7000 T camera. We quantified the area of each ovary using the polygon tool in FIJI 61 to define the borders of the tissue. For each ovary pair, we used the Freehand tool in FIJI to calculate the area (mm 2 ) within these boundaries for each individual ovary. After imaging, we counted the number of eggs that contain elongated dorsal appendages (stages 13 and 14). Immunofluorescence We conducted immunofluorescence on ovaries following the protocol described in. 62 We stained ovaries with anti-FLAG (1:3000, M2, Sigma Aldrich, St. Louis, MO) and anti-γH2Av (1:1000, a gift from R. S. Hawley). We mounted ovaries with ProLong Gold Antifade Reagent with DAPI (Thermo Fisher Scientific, Waltham, MA). We imaged slides at 63X magnification on a Leica TCS SP8 Four Channel Spectral Confocal System. For each experiment, we used the same imaging parameters across genotypes. We conducted immunofluorescence on embryos collected in a 0-70 minute window from mh[mel] , mh[sim] , or mh 1 females crossed to males homozygous for P{gcid.EGFP.cid}III.2 ( 55 , a gift from K. McKim). We followed the protocol described in 63 to fix and stain the embryos with anti-GFP (1:1000, Aves Labs, Tigard, OR). We mounted and imaged the embryos as described above. Analysis of cytological data Cell death quantification To quantify the incidence of cell death, we mounted fixed whole ovaries with ProLong Gold Antifade Reagent with DAPI (Thermo Fisher Scientific, Waltham, MA) and imaged at 63X magnification on a Leica TCS SP8 Four Channel Spectral Confocal System using the tile scanning and merging feature. We identified the number of ovarioles that contained egg chambers with >1 condensed, signal-saturated nurse cell nuclei. We then divided this number by the total number of ovarioles present in each ovary to determine the fraction of cell death incidence in mh[mel] and mh[sim] ovaries. Immunofluorescence quantification To quantify the average fluorescence of γH2Av in mh[mel] and mh[sim] ovaries we outlined a representative stage four egg chamber with the Freehand tool in FIJI 61 . We calculated the fluorescent signal intensity using the polygon tool in FIJI to define the borders of the tissue. We used the Measure tool in FIJI to calculate the mean pixels within these boundaries. We normalized the fluorescent signal intensity of mh[mel] , mh[sim], and mh 1 to the mean intensity signal of the mh[mel] . Similarly, the fluorescent signal intensity of mh[mel],Zhr and mh[sim],Zhr Was normalized to the mean intensity signal of mh[mel],Zhr . Finally, the fluorescent signal intensity of mh[mel] ; UAS- Top2[mel] and mh[sim] ; UAS- Top2[mel] was normalized to the mean intensity signal of mh[mel] ; UAS- Top2[mel] . SUPPLEMENTARY FIGURE LEGENDS Download figure Open in new tab Figure S1. MH[sim] is expressed at comparable levels to MH[mel] and does not phenocopy mh null. (A) Western Blot of mh[mel] and mh[sim] ovaries probed with anti-FLAG and anti-αTubulin. (B) Proportion of female progeny from mh[mel] and mh[sim] females. (C) Representative images of diploid embryos from crosses between EGFP-cid fathers and mh[mel] or mh[sim] mothers stained with anti-GFP. Diploid embryos are GFP-positive and haploid embryos are GFP-negative. (D) Ovary size estimates from mh 1 homozygous and mh 1 / + heterozygous females. (F) Number of mature eggs per ovary pair from mh 1 homozygous and mh 1 /+ heterozygous females. In panel B, dotted lines correspond to mh[mel] and mh[sim] averages reported in Figure 1C . ( t -test: “n.s.” p > 0.05, scale bar = 25μm) Download figure Open in new tab Figure S2. MH[sim] toxicity is dose-dependent, phenotypically distinct from mh null, and acts through a DNA damage pathway to block oogenesis. (A) Anti-FLAG staining of mh[mel] and mh[sim] upon overexpression under the UAS-GAL4 system. The driver nos-GAL4-VP16 expresses the mh transgene in the female germline only. Corresponding chromosome X (wildtype) and chromosome 3 are shown above images. (B) Progeny counts of the nos-Gal4-VP16 driven UASp- mh[mel] or UASp- mh[sim] females crossed to wildtype ( w 1118 ) males. Note that wildtype mh is present in these genotypes. (C) Total offspring of mh[mel], mh[sim], and mh[mel]/mh[sim] heterozygous females crossed to wildtype ( w 1118 ) males. (D) Drosophila ovariole (above) showing the germarium where meiotic recombination occurs. Germarium of an mh[mel] female (below) showing programmed double stranded breaks (arrowheads) occurring in “region 2A” of the germarium detected under higher laser power relative to images displayed in Figure 3B . These double stranded breaks are repaired via meiotic recombination pathways. (E) γH2Av signal in mh 1 ovaries and quantification of normalized fluorescent signal intensity. (F) Progeny counts from mh[mel];Chk2 -/- and mh[sim];Chk2 -/- females crossed to wildtype ( w 1118 ) males. Note that mh[mel];Chk2 -/- reduced progeny counts are due to the Chk2 -/- mutation 64 . In panel E, dotted lines correspond to mh[mel] and mh[sim] averages reported in Figure 2D . ( t -test: “***” = p 0.05, scale bar = 25μm) SUPPLEMENTARY TABLE LEGEND View this table: View inline View popup Download powerpoint Table S1. Primers used in this study. ACKNOWLEDGEMENTS We thank Isabella Farkas and Courtney Christopher for technical assistance. We also thank the Levine Lab, M. Patel, N. Phadnis, A. Das, and D. Dudka for feedback on the manuscript and the Levine Lab, P. Geyer, H. Malik, R.S. Hawley, and M. Buszczak for discussions about the project. This work was supported by a Life Sciences Research Foundation fellowship to C.L.B. and National Institutes of Health (NIH) NIGMS grant R35GM124684 to M.T.L. LITERATURE CITED 1. ↵ Cechova , M. , Harris , R.S. , Tomaszkiewicz , M. , Arbeithuber , B. , Chiaromonte , F. , and Makova , K.D. ( 2019 ). High satellite repeat turnover in great apes studied with short- and long-read technologies . Mol Biol Evol 36 , 2415 – 2431 . doi: 10.1093/molbev/msz156 . OpenUrl CrossRef PubMed 2. ↵ Jagannathan , M. , Cummings , R. , and Yamashita , Y.M. ( 2018 ). A conserved function for pericentromeric satellite DNA . Elife 7 , e34122 . doi: 10.7554/eLife.34122 . OpenUrl CrossRef 3. Jagannathan , M. , Warsinger-Pepe , N. , Watase , G.J. , and Yamashita , Y.M. ( 2017 ). Comparative Analysis of Satellite DNA in the Drosophila melanogaster Species Complex . G3 (Bethesda) 7 , 693 – 704 . doi: 10.1534/g3.116.035352 . OpenUrl Abstract / FREE Full Text 4. Joshi , S.S. , and Meller , V.H. ( 2017 ). Satellite Repeats Identify X Chromatin for Dosage Compensation in Drosophila melanogaster Males . Curr Biol 27 , 1393 – 1402 . doi: 10.1016/j.cub.2017.03.078 . OpenUrl CrossRef 5. Kipling , D. , Ackford , H.E. , Taylor , B.A. , and Cooke , H.J. ( 1991 ). Mouse minor satellite DNA genetically maps to the centromere and is physically linked to the proximal telomere . Genomics 11 , 235 – 241 . doi: 10.1016/0888-7543(91)90128-2 . OpenUrl CrossRef PubMed Web of Science 6. ↵ Rosic , S. , Kohler , F. , and Erhardt , S. ( 2014 ). Repetitive centromeric satellite RNA is essential for kinetochore formation and cell division . J Cell Biol 207 , 335 – 349 . doi: 10.1083/jcb.201404097 . OpenUrl Abstract / FREE Full Text 7. Round , E.K. , Flowers , S.K. , and Richards , E.J. ( 1997 ). Arabidopsis thaliana centromere regions: genetic map positions and repetitive DNA structure . Genome Res 7 , 1045 – 1053 . doi: 10.1101/gr.7.11.1045 . OpenUrl Abstract / FREE Full Text 8. Rudd , M.K. , and Willard , H.F. ( 2004 ). Analysis of the centromeric regions of the human genome assembly . Trends Genet 20 , 529 – 533 . doi: 10.1016/j.tig.2004.08.008 . OpenUrl CrossRef PubMed Web of Science 9. ↵ Sproul , J.S. , Khost , D.E. , Eickbush , D.G. , Negm , S. , Wei , X. , Wong , I. , and Larracuente , A.M. ( 2020 ). Dynamic Evolution of Euchromatic Satellites on the X Chromosome in Drosophila melanogaster and the simulans Clade . Mol Biol Evol 37 , 2241 – 2256 . doi: 10.1093/molbev/msaa078 . OpenUrl CrossRef 10. ↵ Henikoff , S. , Ahmad , K. , and Malik , H.S. ( 2001 ). The centromere paradox: stable inheritance with rapidly evolving DNA . Science 293 , 1098 – 1102 . doi: 10.1126/science.1062939 . OpenUrl Abstract / FREE Full Text 11. Ferree , P.M. , and Prasad , S. ( 2012 ). How can satellite DNA divergence cause reproductive isolation? Let us count the chromosomal ways . Genet Res Int 2012 , 430136 . doi: 10.1155/2012/430136 . OpenUrl CrossRef PubMed 12. ↵ Jagannathan , M. , and Yamashita , Y.M. ( 2021 ). Defective Satellite DNA Clustering into Chromocenters Underlies Hybrid Incompatibility in Drosophila . Mol Biol Evol 38 , 4977 – 4986 . doi: 10.1093/molbev/msab221 . OpenUrl CrossRef 13. Bayes , J.J. , and Malik , H.S. ( 2009 ). Altered heterochromatin binding by a hybrid sterility protein in Drosophila sibling species . Science 326 , 1538 – 1541 . doi: 10.1126/science.1181756 . OpenUrl Abstract / FREE Full Text 14. ↵ Kumon , T. , Ma , J. , Akins , R.B. , Stefanik , D. , Nordgren , C.E. , Kim , J. , Levine , M.T. , and Lampson , M.A. ( 2021 ). Parallel pathways for recruiting effector proteins determine centromere drive and suppression . Cell 184 , 4904 – 4918 e4911 . doi: 10.1016/j.cell.2021.07.037 . OpenUrl CrossRef 15. ↵ Maheshwari , S. , Tan , E.H. , West , A. , Franklin , F.C.H. , Comai , L. , and Chan , S.W.L. ( 2015 ). Naturally occurring differences in CENH3 affect chromosome segregation in zygotic mitosis of hybrids . PLoS Genet 11 , e1004970 . doi: 10.1371/journal.pgen.1004970 . OpenUrl CrossRef PubMed 16. ↵ Ferree , P.M. , and Barbash , D.A. ( 2009 ). Species-specific heterochromatin prevents mitotic chromosome segregation to cause hybrid lethality in Drosophila . PLoS Biol 7 , e1000234 . doi: 10.1371/journal.pbio.1000234 . OpenUrl CrossRef PubMed 17. ↵ Gibeaux , R. , Acker , R. , Kitaoka , M. , Georgiou , G. , van Kruijsbergen , I. , Ford , B. , Marcotte , E.M. , Nomura , D.K. , Kwon , T. , Veenstra , G.J.C. , and Heald , R. ( 2018 ). Paternal chromosome loss and metabolic crisis contribute to hybrid inviability in Xenopus . Nature 553 , 337 – 341 . doi: 10.1038/nature25188 . OpenUrl CrossRef 18. ↵ Lohe , A.R. , Hilliker , A.J. , and Roberts , P.A. ( 1993 ). Mapping simple repeated DNA sequences in heterochromatin of Drosophila melanogaster . Genetics 134 , 1149 – 1174 . doi: 101093/genetics.134.4.1149 . OpenUrl Abstract / FREE Full Text 19. ↵ Brutlag , D.L. ( 1980 ). Molecular arrangement and evolution of heterochromatic DNA . Annu Rev Genet 14 , 121 – 144 . doi: 10.1146/annurev.ge.14.120180.001005 . OpenUrl CrossRef PubMed Web of Science 20. ↵ de Lima , L.G. , Hanlon , S.L. , and Gerton , J.L. ( 2020 ). Origins and Evolutionary Patterns of the 1.688 Satellite DNA Family in Drosophila Phylogeny . G3 (Bethesda) 10 , 4129 – 4146 . doi: 10.1534/g3.120.401727 . OpenUrl Abstract / FREE Full Text 21. ↵ Abad , J.P. , Agudo , M. , Molina , I. , Losada , A. , Ripoll , P. , and Villasante , A. ( 2000 ). Pericentromeric regions containing 1.688 satellite DNA sequences show anti-kinetochore antibody staining in prometaphase chromosomes of Drosophila melanogaster . Mol Gen Genet 264 , 371 – 377 . doi: 10.1007/s004380000331 . OpenUrl CrossRef PubMed Web of Science 22. ↵ Losada , A. , and Villasante , A. ( 1996 ). Autosomal location of a new subtype of 1.688 satellite DNA of Drosophila melanogaster . Chromosome Res 4 , 372 – 383 . doi: 10.1007/BF02257273 . OpenUrl CrossRef PubMed Web of Science 23. ↵ Delabaere , L. , Orsi , G.A. , Sapey-Triomphe , L. , Horard , B. , Couble , P. , and Loppin , B. ( 2014 ). The Spartan ortholog maternal haploid is required for paternal chromosome integrity in the Drosophila zygote . Curr Biol 24 , 2281 – 2287 . doi: 10.1016/j.cub.2014.08.010 . OpenUrl CrossRef PubMed 24. ↵ Tang , X. , Cao , J. , Zhang , L. , Huang , Y. , Zhang , Q. , and Rong , Y.S. ( 2017 ). Maternal Haploid, a Metalloprotease Enriched at the Largest Satellite Repeat and Essential for Genome Integrity in Drosophila Embryos . Genetics 206 , 1829 – 1839 . doi: 10.1534/genetics.117.200949 . OpenUrl Abstract / FREE Full Text 25. ↵ Loppin , B. , Berger , F. , and Couble , P. ( 2001 ). Paternal chromosome incorporation into the zygote nucleus is controlled by maternal haploid in Drosophila . Dev Biol 231 , 383 – 396 . doi: 10.1006/dbio.2000.0152 . OpenUrl CrossRef PubMed 26. ↵ McDonald , J.H. , and Kreitman , M. ( 1991 ). Adaptive protein evolution at the Adh locus in Drosophila . Nature 351 , 652 – 654 . doi: 101038/351652a0 . OpenUrl CrossRef PubMed Web of Science 27. ↵ Garrigan , D. , Kingan , S.B. , Geneva , A.J. , Andolfatto , P. , Clark , A.G. , Thornton , K.R. , and Presgraves , D.C. ( 2012 ). Genome sequencing reveals complex speciation in the Drosophila simulans clade . Genome Res 22 , 1499 – 1511 . doi: 10.1101/gr.130922.111 . OpenUrl Abstract / FREE Full Text 28. ↵ Kerr , J.F. , Wyllie , A.H. , and Currie , A.R. ( 1972 ). Apoptosis: a basic biological phenomenon with wide-ranging implications in tissue kinetics . Br J Cancer 26 , 239 – 257 . doi: 10.1038/bjc.1972.33 . OpenUrl CrossRef PubMed Web of Science 29. ↵ McCall , K. ( 2004 ). Eggs over easy: cell death in the Drosophila ovary . Dev Biol 274 , 3 – 14 . doi: 10.1016/j.ydbio.2004.07.017 . OpenUrl CrossRef PubMed Web of Science 30. ↵ Roos , W.P. , Thomas , A.D. , and Kaina , B. ( 2016 ). DNA damage and the balance between survival and death in cancer biology . Nat Rev Cancer 16 , 20 – 33 . doi: 10.1038/nrc.2015.2 . OpenUrl CrossRef PubMed 31. ↵ Jang , J.K. , Sherizen , D.E. , Bhagat , R. , Manheim , E.A. , and McKim , K.S. ( 2003 ). Relationship of DNA double-strand breaks to synapsis in Drosophila . J Cell Sci 116 , 3069 – 3077 . doi: 10.1242/jcs.00614 . OpenUrl Abstract / FREE Full Text 32. ↵ Madigan , J.P. , Chotkowski , H.L. , and Glaser , R.L. ( 2002 ). DNA double-strand break-induced phosphorylation of Drosophila histone variant H2Av helps prevent radiation-induced apoptosis . Nucleic Acids Res 30 , 3698 – 3705 . doi: 10.1093/nar/gkf496 . OpenUrl CrossRef PubMed Web of Science 33. ↵ Bakhrat , A. , Pritchett , T. , Peretz , G. , McCall , K. , and Abdu , U. ( 2010 ). Drosophila Chk2 and p53 proteins induce stage-specific cell death independently during oogenesis . Apoptosis 15 , 1425 – 1434 . doi: 10.1007/s10495-010-0539-z . OpenUrl CrossRef PubMed 34. ↵ Brodsky , M.H. , Weinert , B.T. , Tsang , G. , Rong , Y.S. , McGinnis , N.M. , Golic , K.G. , Rio , D.C. , and Rubin , G.M. ( 2004 ). Drosophila melanogaster MNK/Chk2 and p53 regulate multiple DNA repair and apoptotic pathways following DNA damage . Mol Cell Biol 24 , 1219 – 1231 . doi: 10.1128/MCB.24.3.1219-1231.2004 . OpenUrl Abstract / FREE Full Text 35. ↵ Sawamura , K. , Yamamoto , M.T. , and Watanabe , T.K. ( 1993 ). Hybrid lethal systems in the Drosophila melanogaster species complex. II. The Zygotic hybrid rescue (Zhr) gene of D. melanogaster . Genetics 133 , 307 – 313 . doi: 10.1093/genetics.133.2.307 . OpenUrl Abstract / FREE Full Text 36. ↵ Dokshin , G.A. , Davis , G.M. , Sawle , A.D. , Eldridge , M.D. , Nicholls , P.K. , Gourley , T.E. , Romer , K.A. , Molesworth , L.W. , Tatnell , H.R. , Ozturk , A.R. , et al. ( 2020 ). GCNA Interacts with Spartan and Topoisomerase II to Regulate Genome Stability . Dev Cell 52 , 53 – 68 e56 . doi: 10.1016/j.devcel.2019.11.006 . OpenUrl CrossRef 37. Lopez-Mosqueda , J. , Maddi , K. , Prgomet , S. , Kalayil , S. , Marinovic-Terzic , I. , Terzic , J. , and Dikic , I. ( 2016 ). SPRTN is a mammalian DNA-binding metalloprotease that resolves DNA-protein crosslinks . Elife 5 , e21491 . doi: 10.7554/eLife.21491 . OpenUrl CrossRef 38. ↵ Vaz , B. , Popovic , M. , Newman , J.A. , Fielden , J. , Aitkenhead , H. , Halder , S. , Singh , A.N. , Vendrell , I. , Fischer , R. , Torrecilla , I. , et al. ( 2016 ). Metalloprotease SPRTN/DVC1 Orchestrates Replication-Coupled DNA-Protein Crosslink Repair . Mol Cell 64 , 704 – 719 . doi: 10.1016/j.molcel.2016.09.032 . OpenUrl CrossRef PubMed 39. ↵ Gale , K.C. , and Osheroff , N. ( 1992 ). Intrinsic intermolecular DNA ligation activity of eukaryotic topoisomerase II. Potential roles in recombination . J Biol Chem 267 , 12090 – 12097 . doi: 10.1016/S0021-9258(19)49810-4 . OpenUrl Abstract / FREE Full Text 40. Morimoto , S. , Tsuda , M. , Bunch , H. , Sasanuma , H. , Austin , C. , and Takeda , S. ( 2019 ). Type II DNA Topoisomerases Cause Spontaneous Double-Strand Breaks in Genomic DNA . Genes 10 , 868 . doi: 10.3390/genes10110868 . OpenUrl CrossRef 41. ↵ Pommier , Y. , Sun , Y. , Huang , S.N. , and Nitiss , J.L. ( 2016 ). Roles of eukaryotic topoisomerases in transcription, replication and genomic stability . Nat Rev Mol Cell Biol 17 , 703 – 721 . doi: 10.1038/nrm.2016.111 . OpenUrl CrossRef PubMed 42. ↵ Kas , E. , and Laemmli , U.K. ( 1992 ). In vivo topoisomerase II cleavage of the Drosophila histone and satellite III repeats: DNA sequence and structural characteristics . EMBO J 11 , 705 – 716 . doi: 10.1002/j.1460-2075.1992.tb05103.x . OpenUrl CrossRef PubMed 43. ↵ Hughes , S.E. , and Hawley , R.S. ( 2014 ). Topoisomerase II is required for the proper separation of heterochromatic regions during Drosophila melanogaster female meiosis . PLoS Genet 10 , e1004650 . doi: 10.1371/journal.pgen.1004650 . OpenUrl CrossRef PubMed 44. ↵ Ferree , P.M. , Gomez , K. , Rominger , P. , Howard , D. , Kornfeld , H. , and Barbash , D.A. ( 2014 ). Heterochromatin position effects on circularized sex chromosomes cause filicidal embryonic lethality in Drosophila melanogaster . Genetics 196 , 1001 – 1005 . doi: 10.1534/genetics.113.161075 . OpenUrl Abstract / FREE Full Text 45. ↵ Chmátal , L. , Gabriel , S.I. , Mitsainas , G.P. , Martínez-Vargas , J. , Ventura , J. , Searle , J.B. , Schultz , R.M. , and Lampson , M.A. ( 2014 ). Centromere strength provides the cell biological basis for meiotic drive and karyotype evolution in mice . Curr Biol 24 , 2295 – 2300 . doi: 10.1016/j.cub.2014.08.017 . OpenUrl CrossRef PubMed 46. ↵ Iwata-Otsubo , A. , Dawicki-McKenna , J.M. , Akera , T. , Falk , S.J. , Chmátal , L. , Yang , K. , Sullivan , B.A. , Schultz , R.M. , Lampson , M.A. , and Black , B.E. ( 2017 ). Expanded Satellite Repeats Amplify a Discrete CENP-A Nucleosome Assembly Site on Chromosomes that Drive in Female Meiosis . Curr Biol 27 , 2365 – 2373.e2368 . doi: 10.1016/j.cub.2017.06.069 . OpenUrl CrossRef PubMed 47. ↵ Malik , H.S. , and Henikoff , S. ( 2001 ). Adaptive evolution of Cid, a centromere-specific histone in Drosophila . Genetics 157 , 1293 – 1298 . doi: 10.1093/genetics/157.3.1293 . OpenUrl Abstract / FREE Full Text 48. Malik , H.S. , and Henikoff , S. ( 2002 ). Conflict begets complexity: the evolution of centromeres . Curr Opin Genet Dev 12 , 711 – 718 . doi: 10.1016/s0959-437x(02)00351-9 . OpenUrl CrossRef PubMed Web of Science 49. ↵ Vermaak , D. , Bayes , J.J. , and Malik , H.S. ( 2009 ). A surrogate approach to study the evolution of noncoding DNA elements that organize eukaryotic genomes . J Hered 100 , 624 – 636 . doi: 10.1093/jhered/esp063 . OpenUrl CrossRef PubMed 50. ↵ Carracedo , M.C. , Asenjo , A. , and Casares , P. ( 2000 ). Location of Shfr, a new gene that rescues hybrid female viability in crosses between Drosophila simulans females and D. melanogaster males . Heredity 84 , 630 – 638 . doi: 10.1046/j.1365-2540.2000.00658.x . OpenUrl CrossRef 51. Gerard , P.R. , and Presgraves , D.C. ( 2012 ). Abundant genetic variability in Drosophila simulans for hybrid female lethality in interspecific crosses to Drosophila melanogaster . Genet Res 94 , 1 – 7 . doi: 10.1017/S0016672312000031 . OpenUrl CrossRef PubMed 52. Orr , H.A. ( 1996 ). The unexpected recovery of hybrids in a Drosophila species cross: a genetic analysis . Genet Res 67 , 11 – 18 . doi: 10.1017/s0016672300033437 . OpenUrl CrossRef PubMed 53. ↵ Sawamura , K. , Taira , T. , and Watanabe , T.K. ( 1993 ). Hybrid lethal systems in the Drosophila melanogaster species complex. I. The maternal hybrid rescue (mhr) gene of Drosophila simulans . Genetics 133 , 299 – 305 . doi: 10.1093/genetics.133.2.307 . OpenUrl Abstract / FREE Full Text 54. ↵ Sawamura , K. , and Yamamoto , M.T. ( 1993 ). Cytogenetical localization of Zygotic hybrid rescue (Zhr), a Drosophila melanogaster gene that rescues interspecific hybrids from embryonic lethality . Mol Gen Genet 239 , 441 – 449 . doi: 10.1007/BF00276943 . OpenUrl CrossRef PubMed Web of Science 55. ↵ Schuh , M. , Lehner , C.F. , and Heidmann , S. ( 2007 ). Incorporation of Drosophila CID/CENP-A and CENP-C into centromeres during early embryonic anaphase . Curr Biol 17 , 237 – 243 . doi: 10.1016/j.cub.2006.11.051 . OpenUrl CrossRef PubMed Web of Science 56. ↵ Pool , J.E. , Corbett-Detig , R.B. , Sugino , R.P. , Stevens , K.A. , Cardeno , C.M. , Crepeau , M.W. , Duchen , P. , Emerson , J.J. , Saelao , P. , Begun , D.J. , and Langley , C.H. ( 2012 ). Population Genomics of sub-saharan Drosophila melanogaster: African diversity and non-African admixture . PLoS Genet 8 , e1003080 . doi: 10.1371/journal.pgen.1003080 . OpenUrl CrossRef PubMed 57. ↵ Rogers , R.L. , Cridland , J.M. , Shao , L. , Hu , T.T. , Andolfatto , P. , and Thornton , K.R. ( 2014 ). Landscape of standing variation for tandem duplications in Drosophila yakuba and Drosophila simulans . Mol Biol Evol 31 , 1750 – 1766 . doi: 10.1093/molbev/msu124 . OpenUrl CrossRef PubMed Web of Science 58. ↵ Chakraborty , M. , Chang , C.H. , Khost , D.E. , Vedanayagam , J. , Adrion , J.R. , Liao , Y. , Montooth , K.L. , Meiklejohn , C.D. , Larracuente , A.M. , and Emerson , J.J. ( 2021 ). Evolution of genome structure in the Drosophila simulans species complex . Genome Res 31 , 380 – 396 . doi: 10.1101/gr.263442.120 . OpenUrl Abstract / FREE Full Text 59. ↵ Venken , K.J. , He , Y. , Hoskins , R.A. , and Bellen , H.J. ( 2006 ). P[acman]: a BAC transgenic platform for targeted insertion of large DNA fragments in D. melanogaster . Science 314 , 1747 – 1751 . doi: 10.1126/science.1134426 . OpenUrl Abstract / FREE Full Text 60. ↵ Hohl , A.M. , Thompson , M. , Soshnev , A.A. , Wu , J. , Morris , J. , Hsieh , T.S. , Wu , C.T. , and Geyer , P.K. ( 2012 ). Restoration of topoisomerase 2 function by complementation of defective monomers in Drosophila . Genetics 192 , 843 – 856 . doi: 10.1534/genetics.112.144006 . OpenUrl Abstract / FREE Full Text 61. ↵ Schindelin , J. , Arganda-Carreras , I. , Frise , E. , Kaynig , V. , Longair , M. , Pietzsch , T. , Preibisch , S. , Rueden , C. , Saalfeld , S. , Schmid , B. , et al. ( 2012 ). Fiji: an open-source platform for biological-image analysis . Nat Methods 9 , 676 – 682 . doi: 10.1038/nmeth.2019 . OpenUrl CrossRef PubMed Web of Science 62. ↵ McKim , K.S. , Joyce , E.F. , and Jang , J.K. ( 2009 ). Cytological analysis of meiosis in fixed Drosophila ovaries . Methods Mol Biol 558 , 197 – 216 . doi: 10.1007/978-1-60761-103-5_12 . OpenUrl CrossRef PubMed 63. ↵ Levine , M.T. , Vander Wende , H.M. , and Malik , H.S. ( 2015 ). Mitotic fidelity requires transgenerational action of a testis-restricted HP1 . Elife 4 , e07378 . doi: 10.7554/eLife.07378 . OpenUrl CrossRef PubMed 64. ↵ Xu , J. , and Du , W. ( 2003 ). Drosophila chk2 plays an important role in a mitotic checkpoint in syncytial embryos . FEBS Lett 545 , 209 – 212 . doi: 10.1016/s0014-5793(03)00536-2 . OpenUrl CrossRef PubMed Web of Science Back to top Previous Next Posted January 04, 2022. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Cross-species incompatibility between a DNA satellite and the Drosophila Spartan homolog poisons germline genome integrity Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Cross-species incompatibility between a DNA satellite and the Drosophila Spartan homolog poisons germline genome integrity Cara L. Brand , Mia T. Levine bioRxiv 2021.08.13.455988; doi: https://doi.org/10.1101/2021.08.13.455988 Share This Article: Copy Citation Tools Cross-species incompatibility between a DNA satellite and the Drosophila Spartan homolog poisons germline genome integrity Cara L. Brand , Mia T. Levine bioRxiv 2021.08.13.455988; doi: https://doi.org/10.1101/2021.08.13.455988 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Evolutionary Biology Subject Areas All Articles Animal Behavior and Cognition (7969) Biochemistry (18623) Bioengineering (14765) Bioinformatics (44155) Biophysics (22458) Cancer Biology (19585) Cell Biology (26737) Clinical Trials (138) Developmental Biology (13900) Ecology (20880) Epidemiology (2067) Evolutionary Biology (25315) Genetics (16100) Genomics (23400) Immunology (18608) Microbiology (42209) Molecular Biology (17939) Neuroscience (92895) Paleontology (693) Pathology (2969) Pharmacology and Toxicology (5063) Physiology (8064) Plant Biology (15901) Scientific Communication and Education (2091) Synthetic Biology (4538) Systems Biology (10184) Zoology (2376) window.__CF$cv$params={r:'a3780aa3ae2273e8',t:'MTc4ODgwODUyMA==',u:'01a07d4bebf87de3b43effb3fd0a0d37',ut:'AoWTfcI8jPg1iVFVQGb7hsPhyUUbkQw3y0Y8gRvUd3M-1788808522-1.2.1.1-uxbazM9wC3O97hlRsZUXH2gk6902uv3aP7YXYhJLx4zjli39QTOYMBaRrw5myEccb98NjM3BwOra0U2ZTUsvOsc5z8S3x70NDyoCYgrhV88',i:60};(function(){if(!document.body)return;var s=document.createElement('script');s.src='/cdn-cgi/challenge-platform/scripts/precursor/main.js';document.head.appendChild(s);})();