Fibroblast-derived CCL2 orchestrates immune responses and defends against Staphylococcus aureus skin infection

Fibroblast-derived CCL2 orchestrates immune responses and defends against Staphylococcus aureus skin infection | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Fibroblast-derived CCL2 orchestrates immune responses and defends against Staphylococcus aureus skin infection Tatsuya dokoshi, Marta Palomo-Irigoyen, Michelle Bagood, Hung Chan, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7559111/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 12 You are reading this latest preprint version Abstract Host defense against invasive bacterial infections of the skin is essential for survival. It involves a complex yet incompletely understood process of microbial recognition followed by innate and adaptive systems for communication between resident and recruited cells to mount an effective defense. Stromal fibroblasts have not been classically considered immunocytes, yet are gaining recognition for their critical roles in inflammation. Here, we identify fibroblast-derived C-C motif chemokine ligand 2 (CCL2) produced by stromal fibroblasts as a key mediator in host defense against invasive Staphylococcus aureus infection. Single-cell RNA sequencing revealed that fibroblasts predominantly express CCL2 under steady-state conditions in human and mouse tissues. Use of mice with a conditional deletion of CCL2 in fibroblasts demonstrates that the expression of CCL2 by fibroblasts alters macrophage cytokine production and antigen presentation and is important for monocyte recruitment. Additionally, we uncover a novel role for fibroblast-derived CCL2 in promoting fibroblast-to-adipocyte differentiation via ERK and P38 signaling, leading to reactive adipogenesis and enhanced production of the antimicrobial peptide cathelicidin. In mice with targeted deletion of CCL2 in fibroblasts, these host immune responses are impaired and S. aureus infection of the skin is greatly increased. These findings highlight fibroblast-derived CCL2 as a critical regulator of immunity and suggest its broader implications in inflammatory and infectious diseases. Biological sciences/Immunology/Innate immunity Biological sciences/Immunology/Infectious diseases/Bacterial infection Biological sciences/Immunology/Antimicrobial responses Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Introduction Recent studies have highlighted the significant role of transcriptionally distinct fibroblast subsets in regulating immune responses in barrier tissues by: 1) producing antimicrobial molecules, 2) recruiting immune cells, and 3) organizing the extracellular matrix (1–4). However, despite these emerging insights, the precise mechanisms by which fibroblasts regulate immune responses, especially during infection, remain incompletely understood (5). In particular, the interactions between fibroblasts and macrophages in the context of infection are not well characterized. Fibroblasts express and produce a variety of cytokines and chemokines in response to inflammation, such as IL-1, IL-6, CCL2, and CCL7, indicating strong interactions between fibroblasts and immune cells(6–9). Previous research demonstrated that dermal fibroblasts in the preadipocyte lineage act to resist Staphylococcus aureus ( S. aureus ) infection in the skin through the production of cathelicidin antimicrobial peptide (Camp)(2). More recently, fibroblasts were identified to be required for normal neutrophil recruitment in response to IL-17 and TNFα, also an essential innate immune response to infection (9). Additionally, while fibroblast-macrophage interactions have been explored in the contexts of tissue repair, fibrosis, and tumor microenvironments (10–12), the mechanism by which fibroblasts influence macrophage functions during infection is unclear. In this study, we sought to identify critical communication events that enable fibroblasts to contribute to host defense against S. aureus infection in the skin. An important chemokine for control of infection is CCL2, also known as MCP-1, that recruits CCR2 + monocytes/macrophages (13, 14). CCL2 is produced by various cell types during inflammation and has been shown to influence monocyte recruitment, polarization, and macrophage activation, promoting phagocytosis and production of interleukins such as IL-1b and IL-10 (15, 16). In the bone marrow, CCL2 retains monocytes, whereas in epithelial tissues, it activates monocytes/macrophages, enhancing immune responses such as phagocytosis and cytokine expression. These events are relevant in vivo as the administration of recombinant CCL2 or bone marrow-derived CCL2 + mesenchymal stromal cells (MSCs) has been shown to improve wound healing in the skin and colon (17, 18). While epithelial-derived CCL2 has been implicated in wound healing by modulating IL-10 production from macrophages, the role of fibroblast-derived CCL2 in infection and inflammation remains unexplored. In this study, we investigate the role of fibroblast-derived chemokines in defense against S. aureus infection. We found that fibroblasts predominantly express CCL2 in both human and mouse single-cell RNA sequencing (scRNA-seq) datasets under steady-state conditions. Using a fibroblast-specific Ccl2 knockout mouse model, we show that these mice exhibit increased susceptibility to S. aureus infection. scRNA-seq and spatial sequencing show that increased susceptibility to infection associates with the combined activity of Ccl2 to modulate macrophage function and promote differentiation of fibroblasts into mature adipocytes via activation of the ERK and p38 pathways. Taken together, our findings show how fibroblasts in the dermis play a critical role in defense against S. aureus infection through their capacity to express CCL2. Materials and Methods Animals and animal care All animal experiments were approved by the University of California, San Diego, Institutional Animal Care and Use committee (Protocol No. S09074). For all animal studies, animals were randomly selected without formal pre-randomization and quantitative measurements were done without the opportunity for bias. C57BL/6 mice were purchased from The Jackson Laboratory. Pdgfra/Ccl2 mice on the C57BL/6 background were cross bred and maintained at UCSD. Mice were housed under a specific pathogen–free conditions with 12-h light and 12-h dark cycle at 20–22°C and 30–70% humidity with unrestricted access to water and standard chow. Experimental and littermate control animals were age- and sex-matched 7–9-wk-old males and females. Bacterial strains S. aureus strain USA300 is a predominant community-associated Methicillin-resistant S. aureus (MRSA) strain and AH4807, a USA300 MRSA strain containing the phage11::LL29luxCDABEG reporter plasmid was tested in a manner that was similar to previously described (19, 20), was kindly provided by Alexander Horswill (Deprtment of Immunology & Microbiology at the University of Colorado). Mouse model of S. aureus skin infection Skin infection experiments were done as described before (21). S. aureus strain USA300/MRSA was used for infection. In brief, the backs of sex-matched and age-matched (8 week to 12 week) adult wildtype or Pdgfra/Ccl2 fl/fl mice were shaved and hair removed by chemical depilation (Nair) then injected intradermaly with 100 µl of a mid-logarithmic growth phase of S. aureus (2x 10 6 CFU of bacteria) in PBS. Mice were sacrificed after day 3 and 8 mm skin punch biopsy comprising the center of the injection site was harvested. Infected skin surrounding the infection center (6–8 mm) void of center abscess was carefully dissected out for RNA extraction. Skin biopsies were homogenized in 1 ml Trizol with 2 mm zirconia beads in a mini-bead beater 16 (Biospect, Bartlesville, OK). For in vivo live bacterial imaging, mice were imaged under isoflurane inhalation anesthesia (2%). Photons emitted from luminescent bacteria were collected during a 1 min exposure using the Xenogen IVIS Imaging System and living image software (Xenogen, Alameda, CA). Bioluminescent image data are presented on a pseudocolor scale (blue representing least intense and red representing the most intense signal) overlaid onto a gray-scale photographic image. Using the image analysis tools in living image software, circular analysis windows (of uniform area) were overlaid onto regions of interest and the corresponding bioluminescence values (total flux) were measured. Cell culture For primary fibroblast studies, neonatal (P1) cells were used unless otherwise noted. Primary dermal fibroblasts were isolated by our laboratory as previously described (Zhang et al., 2019) and used in passage 1. Cells were grown in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% FBS, Glutamax (35050061; Thermo Fisher Scientific), and antibiotic–antimycotic (15240062; Thermo Fisher Scientific). 2-day post-confluent cells were stimulated with recombinant cytokines, purified toll ligands, or an adipogenesis-inducing cocktail. Adipogenesis was induced as described previously (Zhang et al., 2015). Fibroblast cell culture supernatant was collected and added to fresh culture medium to achieve a final concentration of 20% for chemotaxis assay and treatment for MHS Macrophage or CD4 + T cells. Chemicals and reagents. anti-CAMP antibodies were made from our lab as described previously (22);; BODIPY® FL dye was purchased from Thermo Fisher (Houston, TX). HA binding protein was purchased from Millipore. Lipopolysaccharide (LPS) Solution (500X) was purchased from eBioscience™, Malp2 was purchased from Enzo biochem Inc, recombinant TNF was purchased from Fisher scientific. Histology and immunohistochemistry (IHC) Tissue biopsies were directly embedded in OCT compound or paraffin. Paraffin embedded tissues were used for Hematoxylin and Eosin (H&E) staining, and frozen sections were fixed in 4% PFA for 20 mins to immunofluorescence staining. For IHC, fixed and permeabilized frozen tissue sections were blocked with Image-iT FX reagent (Invitrogen) before incubating with anti-CAMP. Anti-IL10 and anti-Gr1 antibodies were purchased from Abcam (Cambridge, MA), or anti-Cemip antibody is provided by KAO company. Samples are followed by appropriate 488- or 568-coupled secondary antibodies. Nuclei were counterstained with DAPI. All images were taken with an Olympus BX41 microscope (widefield). Oil Red O staining An Oil Red O stock solution was prepared at 3 mg/ml in 100% isopropanol. Following stimulation, cells were washed three times with phosphate-buffered saline (PBS) and fixed in 10% formalin for 2 hours at room temperature. Cells were then rinsed with 60% isopropanol. Oil Red O working solution (60% diluted in dH 2 O) was then applied to cells for 2 hours and 30 min. Then, cells were again rinsed three times with PBS. Western blotting Mouse colon tissues were homogenized in RIPA buffer (Thermo Fisher). After centrifugation, cell lysates were subjected to SDS gel electrophoresis and transferred onto polyvinylidene difluoride membranes (IPVH 00010, Millipore). In brief, membranes were blocked in blocking buffer(Licor Biosciences) and Abs for p-ERK, p-P38 and Bactin were incubated over night at 4°C. The membranes were analyzed by immunoblotting with the indicated antibodies. Tissue processing for Single Cell RNA Sequencing : Tissue samples from 3 mice in each group were minced with a razor blade into 1 cm fragments, suspended in enzymatic digestion buffer collagenase and DNase I as previously described 3, incubated with frequent agitation at 37°C for 120 min, and triturated briefly with a 5 ml pipet. Cells in a single-cell suspension were then passed through a 100-micron mesh filter. Then, Dead cells were removed using the Dead Cell Removal kit (Miltenyi Biotec, 130-090-101) following the manufacturer’s instructions. Live cells were manually counted using a hemocytometer and resuspended in 0.04% Ultrapure BSA (Thermo Fisher, AM2618). 20,000 live cells were loaded on the 10X Genomics Chromium system. Tissue processing for spatial transcriptomics Skin tissues from untreated and S.aureus infected mice from Control and Pdgfra/CCL2 mouse were fixed in cold 4% PFA, embedded in the paraffin, sectioned in 4um, and placed on the slide glasses. The experimental slide with the tissue was fixed and stained with hematoxylin and eosin (H&E) and imaged using a Keyence BZX-700 Fluorescent Microscopy (Keyence) at 4X magnification and transferred to sequencing slide by the Visium CytAssist. Sequence libraries were then processed according to manufacturer’s instructions (10x Genomics, Visium Spatial Transcriptomic). Library construction protocol: Single cell suspensions were loaded onto the 10X Genomics Chromium Controller instrument to generate single cell GEMs. GEM-RT and library construction were performed following the 10X Genomics Protocol. Library fragment size distributions was determined using an Agilent Bioanalyzer High Sensitivity chip, and library DNA concentrations were determined using a Qubit 2.0 Fluorometer (Invitrogen). Libraries were sequenced using an Illumina NovaSeq. Data analysis : For mouse skin samples, the 10X Genomics Cell Ranger version 7.2 software pipeline with default parameters was used to perform sample demultiplexing, barcode processing, alignment to the mm10 reference genome, and single-cell gene counting. Data were further filtered, processed and analyzed using the Seurat R toolkit version 5. Integration anchors between datasets were identified using the FindIntegrationAnchors function (dims = 50) and integrated using the IntegrateData function (dims = 50). The integrated data was then scaled, and principal component analysis (PCA) was performed on highly variable features. Significant Principal Components (PCs) were identified using a combination of statistical and heuristic methods and were employed to guide clustering. Neighbors and clusters were identified using the FindNeighbors and FindClusters functions, respectively, and visualized using Uniform Manifold Approximation and Projection (UMAP) or t-distributed Stochastic Neighbor Embedding (t-SNE). Cluster biomarkers were identified using the FindAllMarkers function (Wilcoxon rank sum test). Scored cells were projected onto UMAP, and cells were color-coded based on their score. Cells present in each cell cycle phase were also quantified. CellChat analysis. The R package CellChat(23), was utilized to quantitatively infer and analyze intercellular communication networks based on our single-cell RNA sequencing data. CellChat employs network analysis and pattern recognition methodologies to predict major signaling inputs and outputs for cells, as well as how these cells and signals coordinate for various functions. One of the key functionalities of CellChat is its ability to classify signaling pathways and delineate conserved and context-specific pathways through manifold learning and quantitative contrasts. Data analysis by BioTuring The human single-cell sequencing data set (GSE201333) is obtained, processed, and analyzed by the online platform BioTuring. A total of 500K cells are analyzed, and 67,540 PDGFRa high cells are extracted as Fibroblasts. These cells are re-clustered, visualized using UMAP, and pseudo-time-analyzed. Flow cytometry analyses Skin collected from control and Pdgfra/CCL2 fl/fl mice with or without S. aureus infection was cut into small pieces then digested with 2.5 mg/mL Collagenase D and 30 ng/mL DNAse1 for 2 hours at 37°C then filtered through a 70 µm filter to generate single cell suspension for FACS analyses. Cells were then stained with Fixable Viability Dye eFluor™ 506 (eBioscience, 65-0866-14), blocked with anti-mouse CD16/32 (eBioscience, 14016185), followed by staining with antibody cocktails for immune cells. The antibody cocktail for immune cells includes Brilliant Violet 711™ -CD45(BioLegend, 103147), PECy7-CD11b (BioLegend, 101216), FITC-Ly6G (eBioscience, 11593182), PE-F4/80 (eBioscience,12480182), APC-CD11C (BioLegend, 117310), AF700-MHCII (eBioscience, 56532182), and APC-Cy7-CD3 (BioLegend, 100222). FACS analyses for surface expression of immune cell markers were performed by the BD FACSCanto RUO machine and analyzed by FlowJo V10 software. Reverse transcription-quantitative PCR (RTqPCR) analyses RTqPCR was used to determine the mRNA abundance. Total cellular RNA was extracted using the PureLink RNA Mini Kit (Life Technologies Corporation). 100 ng of mRNA was reverse transcribed to cDNA using Verso cDNA Synthesis Kit (Thermo Fisher Scientific Inc). Quantitative, real-time PCR was performed on the CFX96 real time system (Biorad) using predeveloped Taqman gene expression assay (Applied Biosystems) or SYBR Green Mix (Bimake, Houston, TX). The housekeeping gene Tbp (TATA-binding box protein) was used to normalize gene expression in samples. Specific primer sequences are shown in table S1 . Lipidomic analysis Lipidomic analyses were conducted at the UCLA Lipidomics Core following their established protocol, as previously outlined. Briefly, for tissue samples, 50–100 mg of frozen dermis layers of skin was placed in a 2 mL homogenizer tube pre-loaded with 2.8 mm ceramic beads (Omni #19–628). PBS was added to the tube, and the sample was homogenized in the Omni Bead Ruptor Elite (3 cycles of 10 seconds at 5 m/s with a 10-second dwell time). For lipid extraction, 3–6 mg of tissue homogenate was transferred to a glass tube for lipid extraction using a modified Bligh and Dyer extraction method(24).Prior to biphasic extraction, an internal standard mixture comprising 70 lipid standards across 17 subclasses was added to each sample (AB Sciex 5040156, Avanti 330827, Avanti 330830, Avanti 330828, and Avanti 791642). Following two consecutive extractions, pooled organic layers were evaporated in a Thermo SpeedVac SPD300DDA using ramp setting 4 at 35°C for 45 minutes with a total run time of 90 minutes. Lipid samples were reconstituted in a 1:1 mixture of methanol and dichloromethane with 10 mM ammonium acetate and transferred to robovials (Thermo Fisher Scientific, 10800107) for analysis. Samples underwent analysis on the Sciex 5500 with DMS device (Lipidyzer platform) utilizing an expanded targeted acquisition list encompassing 1450 lipid species across 17 subclasses. The differential mobility device on Lipidyzer was calibrated with EquiSPLASH LIPIDOMIX (Avanti 330731). Data analysis was conducted on an in-house data analysis platform similar to the Lipidyzer Workflow Manager. The instrument method, encompassing settings, tuning protocol, and the multiple reaction monitoring (MRM) list, has been previously detailed(25). Quantitative values were normalized to milligrams of tissue weight. Statistical analysis Statistical analyses were performed with GraphPad Prism. All the statistical tests performed are indicated in the figure legends. Study approval: All animal experiments were approved by the University of California, San Diego, Institutional Animal Care (Protocol No. S09074). Results Fibroblasts abundantly express CCL2, CXCL12, and IL6 To identify potential gene products that contribute to the immune function of fibroblasts, we first analyzed a large, single-cell RNA sequencing (scRNAseq) dataset from a multiorgan human tissue atlas (26) for cytokine and chemokine expression in all cell types. This analysis revealed that Ccl2, Cxcl12 and Il6 are highly expressed in fibroblasts compared to other cell types (Fig. 1 a, Supplemental Fig. 1a ). Further analysis of the fibroblast populations distinguished by PDGFRa expression identified 15 different clusters in UMAP plot (Fig. 1 b). Pseudotime analysis showed cluster 12 (Ccl2 and Il6 high) and cluster 11 (Cxcl12 high) represent an immune state distinct from cluster 11 (Cxcl12 high), clusters 3 and 8 (Thy1 and CD24 high) or clusters 13 and 15 (CEBPd, Camp high) (Fig. 1 c). Analysis of independent datasets of mouse skin and colon (27) (28) also showed clusters of potentially immune-acting fibroblasts expressing Ccl2 and Il6 ( cluster 0,1,3, and 4), which were distinct from clusters expressing Cxcl12 ( cluster 6 and 9)(Fig. 2 a to c, Supplemental Fig. 1b ). Top2 Go term analysis defined the Ccl2 and Il6 high clusters as being associated with regulation of inflammatory response in both skin and colon tissue (Fig. 2 d and supplemental fig, 1 c to e ). Fibroblast-derived Ccl2 recruits macrophages and alters immune functions CL2 is a potent chemokine that recruits monocytes, T cells, B cells, natural killer cells, basophils, dendritic cells, myeloid-derived suppressor cells, and neutrophils while also influencing macrophage development, and therefore was a prime candidate to further explore as a key mediator of host defense from fibroblasts (16, 29, 30). To determine whether the CCL2 produced by fibroblasts is sufficient to promote chemotactic activity, we tested whether fibroblasts can recruit monocytes from peripheral blood mononuclear cells (PBMC) (Fig. 3 a). Culture medium from mouse primary fibroblasts recruited neutrophils and monocytes, whereas supernatant from Ccl2 deficient fibroblasts was unable to recruit macrophages (Fig. 3 b and supplemental Fig. 2a to c ). Next, to examine if fibroblast-derived Ccl2 is sufficient to alter macrophage function, we cultured the MHS macrophage cell line with fibroblast-conditioned medium (Fig. 3 c). Bulk transcriptome sequencing analysis revealed that culture medium conditioned by wild type primary dermal fibroblasts induced a variety of defense genes in macrophages. In contrast, Ccl2 deficient fibroblast conditioned medium showed a gene expression profile similar to control media that was not conditioned by fibroblasts, with lower expression of multiple defense genes ( Fig. 3 d ). Gene ontogeny analysis identified a significant increase in expression of genes associated with several GO terms including negative regulation of myeloid cell differentiation in MHS cell exposed to wild-type fibroblast conditioned media compared to Ccl2 deficient fibroblast conditioned media ( Fig. 3 e ). qPCR confirmed a decrease in the expression of immune genes, including Il1b, Nos2, and CD74, in MHS cells exposed to Ccl2 deficient fibroblast conditioned media or CCL2 inhibitor (Fig. 3 f to h , supplemental Fig. 3d ). Conditioned culture media from MHS cells activated by wild-type or Ccl2 deficient fibroblast conditioned media induced T cell proliferation ( Fig. 3 i and j) . Furthermore, ovalbumin (OVA) simulated macrophages enhanced T cell proliferation in a CCL2-dependent manner. Taken together, these findings demonstrated that Ccl2 produced by cultured fibroblasts is sufficient to recruit monocytes and activate macrophages to express genes that are critical to host defense. Fibroblast derived Ccl2 defends against S. aureus To test the role of fibroblast-derived Ccl2 in host defense against infection in vivo, we generated fibroblast specific Ccl2 knockout mice by crossing Pdgfra-Cre with Ccl2 fl/fl mice (Pdgfra/Ccl2 fl/fl ). These mice, along with littermate Cre-negative controls, were challenged with an intradermal injection of Staphylococcus aureus USA300 ( S. aureus ). Mice deficient in Ccl2 in fibroblasts exhibited a large increase in susceptibility to S. aureus infection, as observed by increased lesion area (Fig. 4 a, b ) , heightened perilesional tissue inflammation (Fig. 4 c) and greater bacterial survival estimated by IVIS imaging of bacterial luminescence (Supplemental Fig. 3a, b ). scRNAseq analysis of these skin lesions revealed an increased proportion of monocyte clusters in Pdgfra/Ccl2 fl/fl mice compared to control mice (Fig. 4 d and Supplemental Fig. 3c ). Cell-cell interaction analysis using Cell-Chat demonstrated stronger interactions from monocyte to other cell types and decreased fibroblast autocrine interaction in normal Pdgfra/Ccl2 fl/fl mice (Fig. 4 e). More specifically, immune cell signaling such as MHC-II, CD80, and CD86 signaling were downregulated in monocytes from Pdgfra/Ccl2 fl/fl mice both before ( Supplemental Fig. 3d to e ) and after infection ( Supplemental Fig. 3f to g ). Thus, we performed additional analysis from Monocyte. Go term analysis from Monocytes showed Monocytes from control mice exhibited greater expression of genes associated with cell chemotaxis and leukocyte apoptotic process in the response to S. aureus infection. (Fig. 4 f) In contrast, monocytes from Pdgfra/Ccl2 fl/fl mice showed increased expression of a variety of genes that were not specific to responding to S. aureus infections. UMAP plot showed 10 clusters ( Supplemental Fig. 4a ). Additionally, cluster 4 was significantly reduced in Pdgfra/Ccl2 fl/fl mice ( Supplemental Fig. 4b ), which is associate with the response to bacterial molecules ( Supplemental Fig. 4c ), including Cd74, ( Supplemental Fig. 4d to e ). These observations are consistent with in vitro analysis of macrophage cell line and suggest that the absence of Ccl2 leads to impaired antigen processing and presentation by monocytes. Cell-cell interaction analysis during S. aureus infection further indicated reduced fibroblast interactions with other cell types, as well as decreased interactions within fibroblasts ( Supplemental Fig. 5a ) similar to observations in uninfected samples (Fig. 3 e). Thus, we performed additional analysis from Fibroblasts. GO terms revealed that in control mice with S. aureus infection, enriched GO terms were associated with extracellular matrix organization. In contrast, Pdgfra/Ccl2 fl/fl mice exhibited enrichment in genes related to ATP metabolic process ( Supplemental Fig. 5b ). Further analysis of the fibroblasts clusters highlighted an increased proportion of cluster 2 in Pdgfra/Ccl2 fl/fl mice( Supplemental Fig. 5c and d ), which displayed upregulated genes involved in ATP metabolic process during infection ( Supplemental Fig. 5e and f ). Since the local response to invasive S. aureus infection in the skin is highly spatially organized, we next employed spatial transcriptomic analysis of mouse skin three days post-infection. Across control, S. aureus infection (SA), Pdgfra/Ccl2^fl/fl, and Pdgfra/Ccl2^fl/fl SA samples, 18 distinct transcriptomic clusters were identified (Fig. 5 a and Supplemental Fig. 6a and b ). In control SA mice, six concentric transcriptomic layers were arranged around the infection site (clusters 16 → 8, 4, 0, 6, 5), suggesting a coordinated, multilayered defense program. However, in Pdgfra/Ccl2^fl/fl SA mice, this spatial organization was profoundly disrupted, with only three clusters (9, 7, 13) surrounding the lesion (Fig. 5 b). GO term analysis further highlighted that the infection-edge clusters in Pdgfra/Ccl2 fl/fl (Cluster 7) exhibited loss of extracellular matrix organization and antigen presentation pathways, including reduced expression of Fcgr3 and Fcer1g (Fig. 5 c and d, Supplemental Fig. 6c and Supplemental Fig. 7 ). Moreover, fibroblasts within infected lesions of control SA mice (Cluster 16) upregulated inflammatory mediators such as Lcn2 and Nfkbiz , whereas this response was absent in Pdgfra/Ccl2 fl/fl (Fig. 5 e). These findings demonstrate that fibroblast-derived Ccl2 is required not only for immune cell recruitment but also for maintaining the layered spatial organization of the transcriptomic response at the infection edge. In Pdgfra/Ccl2^fl/fl mice, disruption of this structure coincided with impaired immune activation and loss of extracellular matrix organization normally supported by Ccl2⁺ fibroblasts, leading to compromised barrier integrity and antigen presentation. Fibroblast derived Ccl2 decreases immune responses by macrophages and fibroblasts Based on our observations that the transcriptional response of Pdgfra/Ccl2 fl/fl during S. aureus infection included changes in communication with several cell types that participate in defense against infection, we next focused on analysis of these cells to better understand how they may explain the increase in S. aureus infection. Nitric oxide (NO) production is known to play a critical role in host defense by macrophages(31, 32). Nos2 mRNA signal detected by spatial sequencing was decreased in Pdgfra/Ccl2 fl/fl compared to control mice infected by SA (Fig. 6 a ) and qPCR of whole skin from the site of infection also showed less Nos2 in Pdgfra/Ccl2 fl/fl after infection ( Fig. 6 b ) . Flow cytometry analysis showed a decreased number of CD4 + lymphocytes after S. aureus infection (Fig. 6 c ) . No difference in the number of CD45 positive cells, neutrophils, and macrophages, was seen between control and Pdgfra/Ccl2 fl/fl mice with or without infection ( Supplemental Fig. 8a-c ). However, a small increase in CD11c+, MHCII + DC and an increase in IL10 was observed (Fig. 6 d, e and Supplemental Fig. 8d ). scRNAseq and spatial sequencing analysis also showed decreased expression of genes associated with ECM organization in Pdgfra/Ccl2 fl/fl mice. A decrease in mRNA for Hyaluronan Synthase 2 ( Has2 ) and Lymphatic vessel endothelial hyaluronan receptor 1 ( Lyve1 ), as well as a decrease in total hyaluronan was observed in Pdgfra/Ccl2 fl/fl mice compared to controls after SA infection (Fig. 6 f and g ). No increase in Cell migration-inducing and hyaluronan-binding protein ( Cemip ), the enzyme responsible for hyaluronan degradation during skin injury, was seen (Fig. 6 h). As fibroblasts primarily express hyaluronan in the dermis (33, 34), and fibroblasts activated to undergo adipogenesis defend against SA infection by production of the antimicrobial peptide Cathelicidin ( Camp) (2), we next evaluated Camp expression. Pdgfra/Ccl2 fl/fl mice expressed significantly less Camp in the skin after SA (Fig. 6 i and j ). This decrease in Camp was not associated with decreased neutrophils but was associated with decreased Camp staining in Pdgfra + fibroblasts (Supplemental Fig. 8e and f) . Ccl2 is inducible in dermal fibroblasts and required for adipogenesis To better understand how Ccl2 is induced by fibroblasts during infection and investigate why fibroblasts showed a reduced expression of the antimicrobial peptide Camp in Pdgfra/Ccl2 fl/fl mice we next evaluated mouse primary dermal fibroblasts in culture. Ligands for TLR4 (LPS), TLR2/6 (Malp2) and TNF were each capable of inducing Ccl2 in fibroblasts derived from wild-type mice (Fig. 7 a). Fibroblasts derived from Pdgfra/Ccl2 fl/fl mice were confirmed to lack Ccl2 expression (Fig. 7 b). Fibroblasts derived from Pdgfra/Ccl2 fl/fl mice showed decreased Camp expression after LPS activation (Fig. 7 c) and lower expression of the adipocyte differentiation Zinc Finger Protein 423 (zfp423) following addition of adipocyte differentiation medium (DM) (Fig. 7 d). Further evidence that CCL2 influenced adipocyte differentiation was seen in the decreased phosphorylation of ERK and p38 after DM following the addition of a Ccr2 inhibitor or in fibroblasts from Pdgfra/Ccl2 fl/fl mice treated with DM (Fig. 7 e). Fibroblasts derived from Pdgfra/Ccl2 fl/fl mice also demonstrated decreased lipid accumulation during adipocyte differentiation compared to control (Fig. 7 f). DMS-based shotgun lipidomic analysis further demonstrated that the lipids produced by Pdgfra/Ccl2 fl/fl fibroblasts were different than control when stimulated to undergo adipocyte differentiation (Fig. 7 g). These fibroblasts lacking CCL2 produced low amounts of several lipids including ceramides and cholesterol (Fig. 7 h). Discussion In this study, we demonstrate that fibroblast-derived CCL2 plays a critical role in host defense against S. aureus infection by regulating macrophage function and reactive adipogenesis. Recent research has increasingly highlighted the immune-regulatory roles of fibroblasts, challenging their traditional characterization as mere structural components of tissues. Building on this evolving perspective, we aimed to identify the critical immune functions of fibroblasts, particularly their contributions to host defense and inflammation. By analyzing human and mouse single-cell sequencing datasets, we identified that fibroblasts express a variety of cytokines and chemokines. However, in the steady state, only CCL2, CXCL12, and IL-6 are predominantly expressed by fibroblasts. Importantly, CCL2 expression is confined to a specific subset of fibroblasts, whereas CXCL12 and IL-6 are expressed more broadly across the fibroblast population (Figs. 1 and 2 ). Based on these observations, we hypothesized that fibroblast-derived CCL2 plays a unique and essential role in immune regulation. Supporting this hypothesis, our in vitro findings revealed that fibroblast-derived CCL2 is critical for maintaining macrophage antimicrobial activity, cytokine production, and antigen-presenting function (Fig. 3 ). The essential role for fibroblasts to produce CCL2 was demonstrated by fibroblast-specific deletion of CCL2 in mice, resulting in much greater infections by S. aureus (Figs. 4 and 5 ). This increase in susceptibility to infection is accompanied by impaired immune responses from both monocytes and fibroblasts. This underscores the pivotal role of fibroblast-derived CCL2 in orchestrating innate immune defenses. Mechanistically, fibroblast-derived CCL2 regulates key immune processes, including monocyte differentiation, Nos2 induction, and T cell proliferation in response to S. aureus infection, while also reducing the induction of the anti-inflammatory cytokine IL-10 (Fig. 6 ). Beyond these established roles in macrophage-mediated immunity, we also identified a novel function for fibroblast-derived CCL2 in regulating fibroblast-to-adipocyte differentiation through ERK and P38 signaling pathways (Fig. 7 ). This process enhances reactive adipogenesis, contributing to host defense against S. aureus by producing the antimicrobial peptide cathelicidin. Thus several innate immune defense events, each important to protection against infection, are all influenced by the production of CCL2 from fibroblasts. These findings clarify the immune responses mediated by fibroblasts during bacterial infection and suggest that fibroblast-derived CCL2 may play a broader role in inflammatory responses by modulating reactive adipogenesis, macrophage function, and lymphocyte proliferation. While this study primarily focused on S. aureus infection and fibroblast-specific mechanisms, further research is needed to investigate whether similar pathways are active in other infection models or inflammatory conditions. Additionally, exploring the interplay between fibroblast-derived CCL2 and adaptive immune responses could offer valuable insights into its broader roles in immunological regulation. In summary, our findings provide new insights into the immune-regulatory role of fibroblast-derived CCL2 in host defense against S. aureus infection. We have identified CCL2 as a critical mediator in macrophage function, and reactive adipogenesis, offering a novel perspective on the immune functions of fibroblasts. These findings not only contribute to our understanding of fibroblast biology but also suggest potential therapeutic avenues for diseases involving chronic inflammation and immune dysregulation. Limitation A key limitation of our study is that while we demonstrated that fibroblast-derived CCL2 regulates both macrophage and fibroblast immune responses, we did not determine the relative contribution of these processes or if one is primarily responsible for host defense against S. aureus infection. However, previous studies have shown that both macrophages and fibroblasts play essential roles in controlling S. aureus , suggesting that all are important. By regulating both macrophage function and fibroblast-mediated immune responses, fibroblast-derived CCL2 likely serves as a key coordinator of the immune response to bacterial infection. Future studies are needed to further delineate the specific contributions of each cell type; however, our findings highlight the pivotal role of fibroblast-derived CCL2 in immunity against S. aureus . Declarations Acknowledgments The authors wish to thank Carlos Aguilera for assistance in animal care and breeding and Dr. Alex Horswill for providing USA300 MRSA strain containing the phage11::LL29luxCDABEG reporter Author Contributions: Conceptualization: TD, KJC, RLG Methodology: TD, MPI, MB, HC, SA, YN, KJC, TN Investigation: TD, MPI, MB, HC, SA, YN, KJC, TN Visualization: TD, MPI, MB, HC, SA, YN, KJC, TN Funding acquisition: RLG Project administration: RLG Supervision: RLG Writing – original draft: TD Writing – review & editing: TD, MPI, RLG Competing Interest Statement: RLG is a co-founder, scientific advisor, consultant, and equity holder of MatriSys Biosciences and is a consultant who receives income and equity in Sente. References Cavagnero KJ, Gallo RL. Essential immune functions of fibroblasts in innate host defense. Front Immunol. 2022;13:1058862. Zhang LJ, Guerrero-Juarez CF, Hata T, Bapat SP, Ramos R, Plikus MV, et al. Innate immunity. Dermal adipocytes protect against invasive Staphylococcus aureus skin infection. Science. 2015;347(6217):67–71. Boothby IC, Kinet MJ, Boda DP, Kwan EY, Clancy S, Cohen JN, et al. Early-life inflammation primes a T helper 2 cell-fibroblast niche in skin. Nature. 2021;599(7886):667 − 72. Plikus MV, Wang X, Sinha S, Forte E, Thompson SM, Herzog EL, et al. Fibroblasts: Origins, definitions, and functions in health and disease. Cell. 2021;184(15):3852-72. Buechler MB, Pradhan RN, Krishnamurty AT, Cox C, Calviello AK, Wang AW, et al. Cross-tissue organization of the fibroblast lineage. Nature. 2021;593(7860):575-9. Stark K, Eckart A, Haidari S, Tirniceriu A, Lorenz M, von Brühl ML, et al. Capillary and arteriolar pericytes attract innate leukocytes exiting through venules and 'instruct' them with pattern-recognition and motility programs. Nat Immunol. 2013;14(1):41–51. Kuroda E, Ozasa K, Temizoz B, Ohata K, Koo CX, Kanuma T, et al. Inhaled Fine Particles Induce Alveolar Macrophage Death and Interleukin-1α Release to Promote Inducible Bronchus-Associated Lymphoid Tissue Formation. Immunity. 2016;45(6):1299 − 310. Zheng Z, Li YN, Jia S, Zhu M, Cao L, Tao M, et al. Lung mesenchymal stromal cells influenced by Th2 cytokines mobilize neutrophils and facilitate metastasis by producing complement C3. Nat Commun. 2021;12(1):6202. Cavagnero KJ, Li F, Dokoshi T, Nakatsuji T, O'Neill AM, Aguilera C, et al. CXCL12 + dermal fibroblasts promote neutrophil recruitment and host defense by recognition of IL-17. J Exp Med. 2024;221(4). Villarreal-Ponce A, Tiruneh MW, Lee J, Guerrero-Juarez CF, Kuhn J, David JA, et al. Keratinocyte-Macrophage Crosstalk by the Nrf2/Ccl2/EGF Signaling Axis Orchestrates Tissue Repair. Cell Rep. 2020;33(8):108417. Ramachandran P, Pellicoro A, Vernon MA, Boulter L, Aucott RL, Ali A, et al. Differential Ly-6C expression identifies the recruited macrophage phenotype, which orchestrates the regression of murine liver fibrosis. Proc Natl Acad Sci U S A. 2012;109(46):E3186-95. Ochocka N, Segit P, Walentynowicz KA, Wojnicki K, Cyranowski S, Swatler J, et al. Single-cell RNA sequencing reveals functional heterogeneity of glioma-associated brain macrophages. Nat Commun. 2021;12(1):1151. Boniakowski AE, Kimball AS, Joshi A, Schaller M, Davis FM, denDekker A, et al. Murine macrophage chemokine receptor CCR2 plays a crucial role in macrophage recruitment and regulated inflammation in wound healing. Eur J Immunol. 2018;48(9):1445-55. Voisin B, Nadella V, Doebel T, Goel S, Sakamoto K, Ayush O, et al. Macrophage-mediated extracellular matrix remodeling controls host Staphylococcus aureus susceptibility in the skin. Immunity. 2023;56(7):1561-77.e9. Baggiolini M. Chemokines and leukocyte traffic. Nature. 1998;392(6676):565-8. Gschwandtner M, Derler R, Midwood KS. More Than Just Attractive: How CCL2 Influences Myeloid Cell Behavior Beyond Chemotaxis. Front Immunol. 2019;10:2759. Whelan DS, Caplice NM, Clover AJP. Mesenchymal stromal cell derived CCL2 is required for accelerated wound healing. Sci Rep. 2020;10(1):2642. Giri J, Das R, Nylen E, Chinnadurai R, Galipeau J. CCL2 and CXCL12 Derived from Mesenchymal Stromal Cells Cooperatively Polarize IL-10 + Tissue Macrophages to Mitigate Gut Injury. Cell Rep. 2020;30(6):1923-34.e4. Muhs A, Lyles JT, Parlet CP, Nelson K, Kavanaugh JS, Horswill AR, et al. Virulence Inhibitors from Brazilian Peppertree Block Quorum Sensing and Abate Dermonecrosis in Skin Infection Models. Sci Rep. 2017;7:42275. Paharik AE, Parlet CP, Chung N, Todd DA, Rodriguez EI, Van Dyke MJ, et al. Coagulase-Negative Staphylococcal Strain Prevents Staphylococcus aureus Colonization and Skin Infection by Blocking Quorum Sensing. Cell host & microbe. 2017;22(6):746 − 56 e5. V. Nizet TO, X. Lauth, J. Trowbridge, J. Rudisill, R. A. Dorschner, V. Pestonjamasp, J. Piraino, K. Huttner, R. L. Gallo. Innate antimicrobial peptide protects the skin from invasive bacterial infection. Nature. 2001;414:454–7. Dorschner RA, Pestonjamasp VK, Tamakuwala S, Ohtake T, Rudisill J, Nizet V, et al. Cutaneous injury induces the release of cathelicidin anti-microbial peptides active against group A Streptococcus. The Journal of investigative dermatology. 2001;117(1):91 − 7. Jin S, Guerrero-Juarez CF, Zhang L, Chang I, Ramos R, Kuan CH, et al. Inference and analysis of cell-cell communication using CellChat. Nat Commun. 2021;12(1):1088. Bligh EG, Dyer WJ. A rapid method of total lipid extraction and purification. Can J Biochem Physiol. 1959;37(8):911-7. Su B, Bettcher LF, Hsieh WY, Hornburg D, Pearson MJ, Blomberg N, et al. A DMS Shotgun Lipidomics Workflow Application to Facilitate High-Throughput, Comprehensive Lipidomics. J Am Soc Mass Spectrom. 2021;32(11):2655-63. Jones RC, Karkanias J, Krasnow MA, Pisco AO, Quake SR, Salzman J, et al. The Tabula Sapiens: A multiple-organ, single-cell transcriptomic atlas of humans. Science. 2022;376(6594):eabl4896. Dokoshi T, Chen Y, Cavagnero KJ, Rahman G, Hakim D, Brinton S, et al. Dermal injury drives a skin to gut axis that disrupts the intestinal microbiome and intestinal immune homeostasis in mice. Nat Commun. 2024;15(1):3009. Nakatsuji T, Brinton SL, Cavagnero KJ, O'Neill AM, Chen Y, Dokoshi T, et al. Competition between skin antimicrobial peptides and commensal bacteria in type 2 inflammation enables survival of S. aureus. Cell Rep. 2023;42(5):112494. Matsushima K, Larsen CG, DuBois GC, Oppenheim JJ. Purification and characterization of a novel monocyte chemotactic and activating factor produced by a human myelomonocytic cell line. J Exp Med. 1989;169(4):1485-90. Yoshimura T, Robinson EA, Tanaka S, Appella E, Kuratsu J, Leonard EJ. Purification and amino acid analysis of two human glioma-derived monocyte chemoattractants. J Exp Med. 1989;169(4):1449-59. MacMicking J, Xie QW, Nathan C. Nitric oxide and macrophage function. Annu Rev Immunol. 1997;15:323 − 50. Wu KK, Xu X, Wu M, Li X, Hoque M, Li GHY, et al. MDM2 induces pro-inflammatory and glycolytic responses in M1 macrophages by integrating iNOS-nitric oxide and HIF-1α pathways in mice. Nat Commun. 2024;15(1):8624. Werner S, Krieg T, Smola H. Keratinocyte-fibroblast interactions in wound healing. J Invest Dermatol. 2007;127(5):998–1008. Wang Y, Lauer ME, Anand S, Mack JA, Maytin EV. Hyaluronan synthase 2 protects skin fibroblasts against apoptosis induced by environmental stress. J Biol Chem. 2014;289(46):32253-65. Tables Table 1 PCR primer sequences. Gene name Sequence Tbp forward CCTTGTACCCTTCACCAATGAC Tbp reverse ACAGCCAAGATTCACGGTAGA ll1b forward GAAATGCCACCTTTTGACAGTG ll1b reverse TGGATGCTCTCATCAGGACAG Nos2 forward GTTCTCAGCCCAACAATACAAGA Nos2 reverse GTGGACGGGTCGATGTCAC Cd74 forward AGTGCGACGAGAACGGTAAC Cd74 reverse CGTTGGGGAACACACACCA Il10 forward CGGGAAGACAATAACTGCACCC Il10 reverse CGGTTAGCAGTATGTTGTCCAGC Has2 forward GGTCCAAGTGCCTTACTGAAAC Has2 reverse TGTACAGCCACTCTCGGAAGTA Lyve1 forward ACCAGGTAGAGTCAGCGCAGAA Lyve1 reverse CAGGACACCTTTGCCATTCTTCC Camp forward CAAGGAACAGGGGGTGG Camp reverse TCCGGCTGAGGTACAAGT TT Ccl2 forward AGGTCCCTGTCATGCTTCTG Ccl2 reverse TCTGGACCCATTCCTTCTTG Zfp423 forward CAAGAGGAGAGAAATGAGGACGA Zfp423 reverse AGTGATCGCAGGTGTAAATTGAC Additional Declarations (Not answered) Supplementary Files SupportingInformationforCMIXXX20250908.docx Supplemental Figures SupportingInformationforCMIXXX20250918.docx Figure legends for supplental figures and original image of western blotting sFigure1.png supplemantal figure 1 sFigure2.png supplemantal figure 2 sFigure3.png supplemantal figure 3 sFigure4.png supplemantal figure 4 sFigure5.png supplemantal figure 5 sFigure7.png supplemantal figure 7 sFigure8.png supplemantal figure 8 sFigure6.png supplemantal figure 6 Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: revise 20 Dec, 2025 Review # 3 received at journal 16 Dec, 2025 Review # 2 received at journal 15 Dec, 2025 Reviewer # 3 agreed at journal 21 Nov, 2025 Reviewer # 2 agreed at journal 21 Nov, 2025 Review # 1 received at journal 26 Sep, 2025 Reviewer # 1 agreed at journal 21 Sep, 2025 Reviewers invited by journal 20 Sep, 2025 Editor assigned by journal 19 Sep, 2025 Submission checks completed at journal 18 Sep, 2025 First submitted to journal 18 Sep, 2025 Unknown event 08 Sep, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7559111","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":518060028,"identity":"ed408ca5-96ed-4771-b40d-60f535517684","order_by":0,"name":"Tatsuya dokoshi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABIElEQVRIiWNgGAWjYFACxsYHH37YABk8DAcboGISYIkG7Bp4GJibDWf2pJGkhb1NmoftMJjJiKIFF7BnP9gmOYPnvLx8+9mDB2fUHJZnEDt88AZDjR0D82zs1vDwJDZbfLC4bbjhTF7CwQ3HDhs2SKclWzAcS2ZgnHMAh8MSG2/O4LnNuIEhx+DgA7bbjPtv55hJMLAdYGCckYBdC//DBqBfztnP738D1PLvtn2DdP43CYZ/eLRIJDYBtRxIbLgBtGVj2+3EBukcNgnGNjxabjwEBXJy8oYbQFtm9v1PBvrF2CKxL5kHl1/Y+9MfAqPSznZ+f47xx55vabYN0skPb3z4ZidniCPEcACgk3gMZ5CiAwzk8UboKBgFo2AUjCAAAGi9aPzkDp9oAAAAAElFTkSuQmCC","orcid":"","institution":"Asahikawa Medical University","correspondingAuthor":true,"prefix":"","firstName":"Tatsuya","middleName":"","lastName":"dokoshi","suffix":""},{"id":518060029,"identity":"dd793da1-33f2-4d89-939a-dc3b321e2779","order_by":1,"name":"Marta Palomo-Irigoyen","email":"","orcid":"","institution":"University of California, San Diego","correspondingAuthor":false,"prefix":"","firstName":"Marta","middleName":"","lastName":"Palomo-Irigoyen","suffix":""},{"id":518060030,"identity":"245623dc-1ab1-44b6-9a7f-0739587bcb46","order_by":2,"name":"Michelle Bagood","email":"","orcid":"","institution":"University of California, San Diego","correspondingAuthor":false,"prefix":"","firstName":"Michelle","middleName":"","lastName":"Bagood","suffix":""},{"id":518060031,"identity":"30d5e08d-92e0-4f54-9d70-9718368aa236","order_by":3,"name":"Hung Chan","email":"","orcid":"","institution":"University of California, San Diego","correspondingAuthor":false,"prefix":"","firstName":"Hung","middleName":"","lastName":"Chan","suffix":""},{"id":518060032,"identity":"4b520893-f652-4554-bb79-aa2cbd36cca4","order_by":4,"name":"Samia Almoughrabie","email":"","orcid":"","institution":"University of California, San Diego","correspondingAuthor":false,"prefix":"","firstName":"Samia","middleName":"","lastName":"Almoughrabie","suffix":""},{"id":518060033,"identity":"7e8176eb-6e4e-4a1e-9330-812b19b33cb3","order_by":5,"name":"Yoshiyuki Nakamura","email":"","orcid":"","institution":"University of Tsukuba: Tsukuba","correspondingAuthor":false,"prefix":"","firstName":"Yoshiyuki","middleName":"","lastName":"Nakamura","suffix":""},{"id":518060034,"identity":"5fe03982-2a1b-451d-81c2-27c12af8ad19","order_by":6,"name":"Kellen Cavagnero","email":"","orcid":"","institution":"University of California, San Diego","correspondingAuthor":false,"prefix":"","firstName":"Kellen","middleName":"","lastName":"Cavagnero","suffix":""},{"id":518060035,"identity":"ecd79e5e-d0f2-485b-8980-c88299c0b751","order_by":7,"name":"Teruaki Nakatsuji","email":"","orcid":"","institution":"University of California, San Diego","correspondingAuthor":false,"prefix":"","firstName":"Teruaki","middleName":"","lastName":"Nakatsuji","suffix":""},{"id":518060036,"identity":"6e4b7837-1710-451d-a0b7-2edccfcc2dbb","order_by":8,"name":"Richard Gallo","email":"","orcid":"https://orcid.org/0000-0002-1401-7861","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Richard","middleName":"","lastName":"Gallo","suffix":""}],"badges":[],"createdAt":"2025-09-08 02:05:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7559111/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7559111/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":92581032,"identity":"346db57d-a6d6-4014-8750-a4430d180a4e","added_by":"auto","created_at":"2025-10-01 09:22:39","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":99665,"visible":true,"origin":"","legend":"","description":"","filename":"manuscriptCMI20250908.docx","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/98779635c27c9a9a93fcf8df.docx"},{"id":92581044,"identity":"395cfbbd-1262-4e68-bf1a-abfafe89a9d5","added_by":"auto","created_at":"2025-10-01 09:22:39","extension":"json","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9951,"visible":true,"origin":"","legend":"","description":"","filename":"CMI20251108.json","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/bd9e0f3ad0f07e6f29b5b73b.json"},{"id":92581051,"identity":"8fd2bc61-7699-44a2-8865-c559ee3767de","added_by":"auto","created_at":"2025-10-01 09:22:40","extension":"docx","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":518450,"visible":true,"origin":"","legend":"","description":"","filename":"SupportingInformationforCMIXXX20250918.docx","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/5c208924740de80423464834.docx"},{"id":92581519,"identity":"e87e5683-1cb0-48ad-aab7-4105fbcb8ffd","added_by":"auto","created_at":"2025-10-01 09:30:40","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1164913,"visible":true,"origin":"","legend":"","description":"","filename":"sFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/b2eca15045e023287f142c9e.png"},{"id":92581046,"identity":"013d0c68-472b-4074-8bca-af8ec691cc35","added_by":"auto","created_at":"2025-10-01 09:22:40","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":182792,"visible":true,"origin":"","legend":"","description":"","filename":"sFigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/56ec163cfac6b16493e07c84.png"},{"id":92581050,"identity":"3aa3b06d-7651-47c6-94b6-1a96c119385c","added_by":"auto","created_at":"2025-10-01 09:22:40","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1017889,"visible":true,"origin":"","legend":"","description":"","filename":"sFigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/daec1fe3ab93be0fc06db19c.png"},{"id":92581053,"identity":"16c7c13b-eede-40b5-b99e-ced6022198ef","added_by":"auto","created_at":"2025-10-01 09:22:40","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1162210,"visible":true,"origin":"","legend":"","description":"","filename":"sFigure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/6e2e9d229d36746487b647b5.png"},{"id":92581521,"identity":"b38017ca-1fdf-4f42-85a3-0216bc064d0f","added_by":"auto","created_at":"2025-10-01 09:30:40","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1015120,"visible":true,"origin":"","legend":"","description":"","filename":"sFigure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/b4178550081483ddc11f16e0.png"},{"id":92582055,"identity":"35cf39b1-f35d-44cf-b899-4471af3ca871","added_by":"auto","created_at":"2025-10-01 09:38:40","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1408987,"visible":true,"origin":"","legend":"","description":"","filename":"sFigure6.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/16e65c983574035ac2999ae7.png"},{"id":92581072,"identity":"a10476cf-8a10-4e20-a5a0-3579ad4e3606","added_by":"auto","created_at":"2025-10-01 09:22:40","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3121296,"visible":true,"origin":"","legend":"","description":"","filename":"sFigure7.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/89d7dcd32d360b74216806e7.png"},{"id":92581047,"identity":"f7e6948f-2eb9-4482-8d29-23a43f4fe134","added_by":"auto","created_at":"2025-10-01 09:22:40","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1585570,"visible":true,"origin":"","legend":"","description":"","filename":"sFigure8.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/4eefcdf63e6eee89e57f9546.png"},{"id":92581524,"identity":"5fcaa46b-6d5b-4fbf-8473-c04f9c490c5c","added_by":"auto","created_at":"2025-10-01 09:30:40","extension":"xml","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":87599,"visible":true,"origin":"","legend":"","description":"","filename":"CMI202511080enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/d4ebe091c86bfa7256ebf526.xml"},{"id":92581064,"identity":"ddb08586-2685-4d9f-a0e2-2ba4b3058161","added_by":"auto","created_at":"2025-10-01 09:22:40","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1044267,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/74ecb34547a7bfdee6ef3e0e.png"},{"id":92581529,"identity":"d6b450ad-9c21-46c4-942a-c70667c78eb9","added_by":"auto","created_at":"2025-10-01 09:30:40","extension":"png","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1380483,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/d7508069b7ff150a8d2858a3.png"},{"id":92582324,"identity":"9e450d03-dd9c-4df2-8582-1efeffca5bcc","added_by":"auto","created_at":"2025-10-01 09:46:40","extension":"png","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":828277,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/10c139124ae7510b7e21e58f.png"},{"id":92581060,"identity":"b655b850-fd96-42bc-9edb-38f01075fa08","added_by":"auto","created_at":"2025-10-01 09:22:40","extension":"png","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1625680,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/162f3b5d217d5001f5b7251b.png"},{"id":92581074,"identity":"7eab8c32-b0f2-48e3-b824-6840c13ee88b","added_by":"auto","created_at":"2025-10-01 09:22:40","extension":"png","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2525848,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/bb1aa279de2adc6a34a912bb.png"},{"id":92581062,"identity":"5f04ae54-7d70-4341-aaba-06b2bfde5a94","added_by":"auto","created_at":"2025-10-01 09:22:40","extension":"png","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3022953,"visible":true,"origin":"","legend":"","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/f2438656f9bc509121949547.png"},{"id":92581525,"identity":"cc8173b5-dbca-4854-a145-2f7532d83813","added_by":"auto","created_at":"2025-10-01 09:30:40","extension":"png","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2002700,"visible":true,"origin":"","legend":"","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/fc40b1304139eda22adb925d.png"},{"id":92582325,"identity":"2f347648-42c1-4cc3-9307-51e427cd779c","added_by":"auto","created_at":"2025-10-01 09:46:40","extension":"png","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":179034,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/3194e5452656e0c8bb10b712.png"},{"id":92581530,"identity":"4699453d-cfe5-4de0-8e32-4e91908172eb","added_by":"auto","created_at":"2025-10-01 09:30:40","extension":"png","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":234136,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/01d0ecc692e9695f48bd1ec7.png"},{"id":92582059,"identity":"7aab88d8-deec-4021-8bab-52e759c5f32f","added_by":"auto","created_at":"2025-10-01 09:38:40","extension":"png","order_by":28,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":149437,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/457018c090959badd54bf59e.png"},{"id":92581526,"identity":"2a21d16a-c362-4c60-ae9d-702a19ee4090","added_by":"auto","created_at":"2025-10-01 09:30:40","extension":"png","order_by":29,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":272417,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/e6eaafd601d4b00827d915c2.png"},{"id":92581527,"identity":"13435912-a842-4d05-8e02-e20c5ac40bd3","added_by":"auto","created_at":"2025-10-01 09:30:40","extension":"png","order_by":30,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":355808,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/eceb492731d04eb3992e30c6.png"},{"id":92581071,"identity":"b6920967-8d3c-43a3-8ae2-a366d5d35bc8","added_by":"auto","created_at":"2025-10-01 09:22:40","extension":"png","order_by":31,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":414186,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure6.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/84bbc69f0061cb27cdfbe375.png"},{"id":92581067,"identity":"53c8d5d7-ae76-4cce-b749-cc0d5ef626ab","added_by":"auto","created_at":"2025-10-01 09:22:40","extension":"png","order_by":32,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":342312,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure7.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/a4f6c1760580f16ee904b338.png"},{"id":92581069,"identity":"e2172094-ea0e-4428-acec-cdb0e178979d","added_by":"auto","created_at":"2025-10-01 09:22:40","extension":"xml","order_by":33,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":85350,"visible":true,"origin":"","legend":"","description":"","filename":"CMI202511080structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/afea9d72d4b175e698bd69e2.xml"},{"id":92581061,"identity":"8151bd4b-e14d-41b2-9003-2746b88b5971","added_by":"auto","created_at":"2025-10-01 09:22:40","extension":"html","order_by":34,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":102136,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/5eac82f7f772369b23de057d.html"},{"id":92581029,"identity":"31d87662-f7da-4dc4-9802-b16b721c79a4","added_by":"auto","created_at":"2025-10-01 09:22:39","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1044267,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFibroblasts predominantly express CCL2, CXCL12, and IL6 in Human.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eHuman fibroblasts data is extracted from single cell sequencing data (GSE201333) and analyzed. (\u003cstrong\u003ea\u003c/strong\u003e) Expression levels of inflammatory gene in different cell types. (\u003cstrong\u003eb\u003c/strong\u003e) UMAP plot of extracted fibroblasts. (\u003cstrong\u003ec\u003c/strong\u003e) Pseudo time analysis of each cluster and differentially expressing inflammatory genes.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/a098f57ecf1c48dc1e933ba5.png"},{"id":92581030,"identity":"95fe0796-adf5-429b-b116-a3d87c7d76a1","added_by":"auto","created_at":"2025-10-01 09:22:39","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1380483,"visible":true,"origin":"","legend":"\u003cp\u003eMouse fibroblasts data is extracted from single cell sequencing data and analyzed. (\u003cstrong\u003ea\u003c/strong\u003e) UMAP plot of extracted fibroblasts. (\u003cstrong\u003eb and c\u003c/strong\u003e) Feature plot(\u003cstrong\u003eb\u003c/strong\u003e) and Violin plot(\u003cstrong\u003ec\u003c/strong\u003e) of Ccl2, Cxcl12, and Il6. (\u003cstrong\u003ed\u003c/strong\u003e) Top 2 GO term analysis of each cluster.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/ceec1b9d6f697c5e6c0932e0.png"},{"id":92581512,"identity":"31d1575f-dd9c-4c0d-8eb6-38b1b5d8c9d7","added_by":"auto","created_at":"2025-10-01 09:30:39","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":828277,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFibroblast derived Ccl2 recruits macrophage and alters their immune functions.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe mouse PBMC is incubated in top layer. The fibroblast culture supernatant from wildtype and CCL2 KO is placed in the bottom layer for 3 hours. And migrated cells are counted by Flowcytometry. (\u003cstrong\u003ea\u003c/strong\u003e) Schematic image of the chemotaxis assay. (\u003cstrong\u003eb\u003c/strong\u003e) The ratio of migrated macrophage in the bottom layer. Mouse MHS macrophage cell is treated with fibroblast supernatant for 24 hours. (\u003cstrong\u003ec\u003c/strong\u003e) Schematic image of MHS macrophage cell line treated by fibroblast supernatant. (\u003cstrong\u003ed\u003c/strong\u003e) Heatmap plot of the Bulk-RNA sequencing of MHS macrophage cell line. (\u003cstrong\u003ee\u003c/strong\u003e) Top 10 Down-regulated GO term in the macrophage treated with CCL2 KO fibroblast supernatant for 24 hours. (\u003cstrong\u003ef to h\u003c/strong\u003e) qPCR analysis of Il1b, Nos2, and Cd74. (\u003cstrong\u003ei\u003c/strong\u003e) Mouse Nive CD4+ cell are collected and cultured with MHS macrophage treated with Fibroblast supernatant. (\u003cstrong\u003ej\u003c/strong\u003e) The number of CD4+ cells after incubation for 48 hours. Statistical significance was determined using ordinary one-way ANOVA and Tukey’s multiple comparison two-sided test and ordinary two-way ANOVA and Sidak’s multiple comparisons two-sided test. Error bars indicate mean ± SEM; * P\u0026lt;0.05, ** P \u0026lt; 0.01, *** P\u0026lt;0.001. Each experiment was repeated at least 3 times.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/924916d1a247ab415ed861c4.png"},{"id":92581515,"identity":"27124c62-5494-49f7-9eb7-3db98d57f1f8","added_by":"auto","created_at":"2025-10-01 09:30:39","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1625680,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFibroblast derived Ccl2 contribute to fight against \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eS.aureus\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e. \u003c/strong\u003e\u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eControl and PDGRRa/Ccl2\u003csup\u003efl/fl\u003c/sup\u003e mice are intradermally injected \u003cem\u003eS.aureus\u003c/em\u003e USA 300 (MRSA, 5x10\u003csup\u003e5\u003c/sup\u003e CFU) on back skin. (\u003cstrong\u003ea\u003c/strong\u003e) Macroscopic image of infectious area. (\u003cstrong\u003eb\u003c/strong\u003e) Size of infection area after 3 days of infection. \u003cstrong\u003e(c)\u003c/strong\u003e H and E staining of samples from the day 3. \u003cstrong\u003e(d)\u003c/strong\u003e UMAP plot of single cell sequencing from control, PDGRRa/Ccl2\u003csup\u003efl/fl\u003c/sup\u003e, \u003cem\u003eS.aureus\u003c/em\u003e infection, and PDGRRa/Ccl2\u003csup\u003efl/fl\u003c/sup\u003e and \u003cem\u003eS.aureus\u003c/em\u003e infection mice. \u003cstrong\u003e(e)\u003c/strong\u003e The numbers and strength of cell interaction signaling in PDGRRa/Ccl2\u003csup\u003efl/fl \u003c/sup\u003ecompared to Control. \u003cstrong\u003e(f)\u003c/strong\u003e Top 2 GO term of Monocyte cluster in each group. Scale bar: 50 microns. Statistical significance was determined using Student’s unpaired two-sided t test, Error bars indicate mean ± SEM; * P\u0026lt;0.05, ** P \u0026lt; 0.01, *** P\u0026lt;0.001. Each experiment was repeated at least 3 times.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/eb0c9d34b9b46f65607d7eae.png"},{"id":92581035,"identity":"75eda8d7-ddcb-47d8-ae2b-b7efa3b46b7c","added_by":"auto","created_at":"2025-10-01 09:22:39","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2525848,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003e(a and b)\u003c/strong\u003e Spatial sequencing analysis of control, PDGRRa/Ccl2\u003csup\u003efl/fl\u003c/sup\u003e, \u003cem\u003eS.aureus\u003c/em\u003e infection, and PDGRRa/Ccl2\u003csup\u003efl/fl\u003c/sup\u003e and \u003cem\u003eS.aureus\u003c/em\u003e infection mice. H and E staining\u003cstrong\u003e (a), \u003c/strong\u003eSpatial plot of clusters \u003cstrong\u003e(b). (c)\u003c/strong\u003e Top 2 GO term of cluster in each group.\u003cstrong\u003e (d and e)\u003c/strong\u003e Spatial plot of differentially expressing genes in infection edge (Fcgr3 and Fcer1g in Cluster 7,8,13) \u003cstrong\u003e(d)\u003c/strong\u003e and infection area (Lcn2 and Nfkbiz in Cluster 16) \u003cstrong\u003e(e)\u003c/strong\u003e. Scale bar: 50 microns. Statistical significance was determined using Student’s unpaired two-sided t test, Error bars indicate mean ± SEM; * P\u0026lt;0.05, ** P \u0026lt; 0.01, *** P\u0026lt;0.001. Each experiment was repeated at least 3 times.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/17cd0bc3ae4a48ee755112d8.png"},{"id":92581045,"identity":"72ba17a8-e5b5-466b-8783-d86bad63be15","added_by":"auto","created_at":"2025-10-01 09:22:39","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":3022953,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFibroblast derived Ccl2 control macrophage and fibroblast immune response.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(\u003cstrong\u003ea\u003c/strong\u003e) Spatial plot of Nos2 expression. (\u003cstrong\u003eb\u003c/strong\u003e) mRNA expression of Nos2 after 3 days of infection. (\u003cstrong\u003ec\u003c/strong\u003e)The number of CD4+ cells in the tissue after 3 days of infection. (\u003cstrong\u003ed\u003c/strong\u003e) mRNA expression of Il10 after 6 days of infection. (\u003cstrong\u003ee\u003c/strong\u003e) Immunofluorescence staining of IL10 after 6 days of infection. (\u003cstrong\u003ef and g\u003c/strong\u003e) mRNA expression of HAS2 and Lyve1 after 3 days of infection. (\u003cstrong\u003eh\u003c/strong\u003e) Immunofluorescence staining of HABP and Cemip after 3 days of infection. (\u003cstrong\u003ei\u003c/strong\u003e) mRNA expression of Camp after 3 days of infection. (\u003cstrong\u003ej\u003c/strong\u003e) Immunofluorescence staining of CAMP after 3 days of infection. Scale bar: 50 microns. Statistical significance was determined using ordinary two-way ANOVA and Sidak’s multiple comparisons two-sided test. Error bars indicate mean ± SEM; * P\u0026lt;0.05, ** P \u0026lt; 0.01, *** P\u0026lt;0.001. Each experiment was repeated at least 3 times.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/cdfdea41a46a59a2a61dd3fd.png"},{"id":92581039,"identity":"824f2d5a-c355-4c94-939e-123fd9b3fb4c","added_by":"auto","created_at":"2025-10-01 09:22:39","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":2002700,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCcl2 contribute to adipogenesis.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMouse primary fibroblasts (mFb) are isolated from mouse back skin. (\u003cstrong\u003ea\u003c/strong\u003e) mRNA expression of Ccl2 after 24 hours of LPS, Malp2, TNF stimulation. (\u003cstrong\u003eb and c\u003c/strong\u003e) mFB are stimulated with differentiation medium for 6 days. mRNA expression of Ccl2(\u003cstrong\u003eb\u003c/strong\u003e) and Camp(\u003cstrong\u003ec\u003c/strong\u003e) at the day 2. (\u003cstrong\u003ed\u003c/strong\u003e) mRNA expression of zfp423 over the treatment. (\u003cstrong\u003ee\u003c/strong\u003e) Western blotting of Bactin, p-ERK, p-P38 after 24 hours of differentiation treatment. (\u003cstrong\u003ef\u003c/strong\u003e) Oil red O staining of mFB after 4 days of differentiation treatment. DMS-based shotgun lipidomic analysis from mFB culture suparnatant. (\u003cstrong\u003eg\u003c/strong\u003e) PCA plot of Lipid composition. (\u003cstrong\u003eh\u003c/strong\u003e) Heatmap plot of CE, cholesterol esters; Cer d18:1, ceramides; DG, diacylglycerols; Cer d18:0, dihydroceramides; FFA, free fatty acids; HexCER, hexosyl ceramides; LacCER, lactosyl ceramides; LPC, lysophosphatidylcholine; LPE, lysophosphatidylethanolamine; PA, phosphatidic acid; PC, phosphatidylcholine; PE, phosphatidylethanolamine; PG, phosphatidylglycerol; PI, phosphatidylinositol; PS, phosphatidylserine; SM, sphingomyelin. Scale bar: 50 microns. Statistical significance was determined using ordinary one-way ANOVA and Tukey’s multiple comparison two-sided test and ordinary two-way ANOVA and Sidak’s multiple comparisons two-sided test. Error bars indicate mean ± SEM; * P\u0026lt;0.05, ** P \u0026lt; 0.01, *** P\u0026lt;0.001. Each experiment was repeated at least 3 times.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/d1cca888f9863046d2ed2987.png"},{"id":92582914,"identity":"1958e613-8636-40c8-a373-0b9f5994b1aa","added_by":"auto","created_at":"2025-10-01 09:54:45","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":11833238,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/555594ae-e962-4b8d-a068-734ec50d43f7.pdf"},{"id":92581042,"identity":"2f9557f2-c83e-4bd2-8ccf-57bbb6d6b71c","added_by":"auto","created_at":"2025-10-01 09:22:39","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":11273714,"visible":true,"origin":"","legend":"Supplemental Figures","description":"","filename":"SupportingInformationforCMIXXX20250908.docx","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/81177b782fe35d7a3beb2265.docx"},{"id":92582053,"identity":"5d4b13a4-124c-4b9d-ac42-c5dde2bf381c","added_by":"auto","created_at":"2025-10-01 09:38:39","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":518450,"visible":true,"origin":"","legend":"Figure legends for supplental figures and original image of western blotting","description":"","filename":"SupportingInformationforCMIXXX20250918.docx","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/43007e2cf9052d153f7040af.docx"},{"id":92582052,"identity":"1dedb0a8-2cdf-40c5-830b-b589907b4ad3","added_by":"auto","created_at":"2025-10-01 09:38:39","extension":"png","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":1164913,"visible":true,"origin":"","legend":"\u003cp\u003esupplemantal figure 1\u003c/p\u003e","description":"","filename":"sFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/17f5d08e22079f6e8a6a57e0.png"},{"id":92581036,"identity":"bdc93feb-d44f-4b57-be3c-d168c11102c0","added_by":"auto","created_at":"2025-10-01 09:22:39","extension":"png","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":182792,"visible":true,"origin":"","legend":"\u003cp\u003esupplemantal figure 2\u003c/p\u003e","description":"","filename":"sFigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/010f7dcb74393c914049d1ba.png"},{"id":92582054,"identity":"f9047063-34a6-493f-9c5a-89e93d848ce1","added_by":"auto","created_at":"2025-10-01 09:38:39","extension":"png","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":1017889,"visible":true,"origin":"","legend":"\u003cp\u003esupplemantal figure 3\u003c/p\u003e","description":"","filename":"sFigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/a0e50b2f043f0c41d6a7b34c.png"},{"id":92581041,"identity":"45f63d1a-895c-4210-9b3e-0ca3895560ef","added_by":"auto","created_at":"2025-10-01 09:22:39","extension":"png","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":1162210,"visible":true,"origin":"","legend":"\u003cp\u003esupplemantal figure 4\u003c/p\u003e","description":"","filename":"sFigure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/08b22f5c4c6eae5b66c5c9b6.png"},{"id":92581517,"identity":"2a238f3a-954c-4f62-bc22-4fabb191d824","added_by":"auto","created_at":"2025-10-01 09:30:39","extension":"png","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":1015120,"visible":true,"origin":"","legend":"\u003cp\u003esupplemantal figure 5\u003c/p\u003e","description":"","filename":"sFigure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/b4e60918912dd018e880d3d0.png"},{"id":92581057,"identity":"8b781dc2-bfdb-4df1-9ee0-f5d4bfbdebc0","added_by":"auto","created_at":"2025-10-01 09:22:40","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":3121296,"visible":true,"origin":"","legend":"\u003cp\u003esupplemantal figure 7\u003c/p\u003e","description":"","filename":"sFigure7.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/6524a5f5fd48e5058ae9f585.png"},{"id":92582057,"identity":"66d45a0f-a25e-4298-8f13-01324281b0f5","added_by":"auto","created_at":"2025-10-01 09:38:40","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":1585570,"visible":true,"origin":"","legend":"\u003cp\u003esupplemantal figure 8\u003c/p\u003e","description":"","filename":"sFigure8.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/f5eb227bc3e51315bedb648d.png"},{"id":92581048,"identity":"1a2e4a25-9c9e-4a99-a525-42e88439fca8","added_by":"auto","created_at":"2025-10-01 09:22:40","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"supplement","size":1408987,"visible":true,"origin":"","legend":"\u003cp\u003esupplemantal figure 6\u003c/p\u003e","description":"","filename":"sFigure6.png","url":"https://assets-eu.researchsquare.com/files/rs-7559111/v1/44533456ba3c6595c3e2b9e6.png"}],"financialInterests":"(Not answered)","formattedTitle":"Fibroblast-derived CCL2 orchestrates immune responses and defends against Staphylococcus aureus skin infection","fulltext":[{"header":"Introduction","content":"\u003cp\u003eRecent studies have highlighted the significant role of transcriptionally distinct fibroblast subsets in regulating immune responses in barrier tissues by: 1) producing antimicrobial molecules, 2) recruiting immune cells, and 3) organizing the extracellular matrix (1\u0026ndash;4). However, despite these emerging insights, the precise mechanisms by which fibroblasts regulate immune responses, especially during infection, remain incompletely understood (5). In particular, the interactions between fibroblasts and macrophages in the context of infection are not well characterized.\u003c/p\u003e\u003cp\u003eFibroblasts express and produce a variety of cytokines and chemokines in response to inflammation, such as IL-1, IL-6, CCL2, and CCL7, indicating strong interactions between fibroblasts and immune cells(6\u0026ndash;9). Previous research demonstrated that dermal fibroblasts in the preadipocyte lineage act to resist \u003cem\u003eStaphylococcus aureus\u003c/em\u003e (\u003cem\u003eS. aureus\u003c/em\u003e) infection in the skin through the production of cathelicidin antimicrobial peptide (Camp)(2). More recently, fibroblasts were identified to be required for normal neutrophil recruitment in response to IL-17 and TNFα, also an essential innate immune response to infection (9). Additionally, while fibroblast-macrophage interactions have been explored in the contexts of tissue repair, fibrosis, and tumor microenvironments (10\u0026ndash;12), the mechanism by which fibroblasts influence macrophage functions during infection is unclear. In this study, we sought to identify critical communication events that enable fibroblasts to contribute to host defense against \u003cem\u003eS. aureus\u003c/em\u003e infection in the skin.\u003c/p\u003e\u003cp\u003eAn important chemokine for control of infection is CCL2, also known as MCP-1, that recruits CCR2\u0026thinsp;+\u0026thinsp;monocytes/macrophages (13, 14). CCL2 is produced by various cell types during inflammation and has been shown to influence monocyte recruitment, polarization, and macrophage activation, promoting phagocytosis and production of interleukins such as IL-1b and IL-10 (15, 16). In the bone marrow, CCL2 retains monocytes, whereas in epithelial tissues, it activates monocytes/macrophages, enhancing immune responses such as phagocytosis and cytokine expression. These events are relevant \u003cem\u003ein vivo\u003c/em\u003e as the administration of recombinant CCL2 or bone marrow-derived CCL2\u0026thinsp;+\u0026thinsp;mesenchymal stromal cells (MSCs) has been shown to improve wound healing in the skin and colon (17, 18). While epithelial-derived CCL2 has been implicated in wound healing by modulating IL-10 production from macrophages, the role of fibroblast-derived CCL2 in infection and inflammation remains unexplored.\u003c/p\u003e\u003cp\u003eIn this study, we investigate the role of fibroblast-derived chemokines in defense against \u003cem\u003eS. aureus\u003c/em\u003e infection. We found that fibroblasts predominantly express CCL2 in both human and mouse single-cell RNA sequencing (scRNA-seq) datasets under steady-state conditions. Using a fibroblast-specific Ccl2 knockout mouse model, we show that these mice exhibit increased susceptibility to \u003cem\u003eS. aureus\u003c/em\u003e infection. scRNA-seq and spatial sequencing show that increased susceptibility to infection associates with the combined activity of Ccl2 to modulate macrophage function and promote differentiation of fibroblasts into mature adipocytes via activation of the ERK and p38 pathways. Taken together, our findings show how fibroblasts in the dermis play a critical role in defense against \u003cem\u003eS. aureus\u003c/em\u003e infection through their capacity to express CCL2.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n\u003ch2\u003eAnimals and animal care\u003c/h2\u003e\n\u003cp\u003eAll animal experiments were approved by the University of California, San Diego, Institutional Animal Care and Use committee (Protocol No. S09074). For all animal studies, animals were randomly selected without formal pre-randomization and quantitative measurements were done without the opportunity for bias.\u003c/p\u003e\n\u003cp\u003eC57BL/6 mice were purchased from The Jackson Laboratory. Pdgfra/Ccl2 mice on the C57BL/6 background were cross bred and maintained at UCSD. Mice were housed under a specific pathogen\u0026ndash;free conditions with 12-h light and 12-h dark cycle at 20\u0026ndash;22\u0026deg;C and 30\u0026ndash;70% humidity with unrestricted access to water and standard chow. Experimental and littermate control animals were age- and sex-matched 7\u0026ndash;9-wk-old males and females.\u003c/p\u003e\n\u003c/div\u003e\n\u003ch3\u003eBacterial strains\u003c/h3\u003e\n\u003cp\u003e\u003cem\u003eS. aureus\u003c/em\u003e strain USA300 is a predominant community-associated Methicillin-resistant \u003cem\u003eS. aureus\u003c/em\u003e (MRSA) strain and AH4807, a USA300 MRSA strain containing the phage11::LL29luxCDABEG reporter plasmid was tested in a manner that was similar to previously described (19, 20), was kindly provided by Alexander Horswill (Deprtment of Immunology \u0026amp; Microbiology at the University of Colorado).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMouse model of\u003c/strong\u003e \u003cstrong\u003eS. aureus\u003c/strong\u003e \u003cstrong\u003eskin infection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSkin infection experiments were done as described before (21). \u003cstrong\u003eS. aureus\u003c/strong\u003e strain USA300/MRSA was used for infection. In brief, the backs of sex-matched and age-matched (8 week to 12 week) adult wildtype or Pdgfra/Ccl2 \u003csup\u003efl/fl\u003c/sup\u003e mice were shaved and hair removed by chemical depilation (Nair) then injected intradermaly with 100 \u0026micro;l of a mid-logarithmic growth phase of \u003cem\u003eS. aureus\u003c/em\u003e (2x 10\u003csup\u003e6\u003c/sup\u003e CFU of bacteria) in PBS. Mice were sacrificed after day 3 and 8 mm skin punch biopsy comprising the center of the injection site was harvested. Infected skin surrounding the infection center (6\u0026ndash;8 mm) void of center abscess was carefully dissected out for RNA extraction. Skin biopsies were homogenized in 1 ml Trizol with 2 mm zirconia beads in a mini-bead beater 16 (Biospect, Bartlesville, OK). For in vivo live bacterial imaging, mice were imaged under isoflurane inhalation anesthesia (2%). Photons emitted from luminescent bacteria were collected during a 1 min exposure using the Xenogen IVIS Imaging System and living image software (Xenogen, Alameda, CA). Bioluminescent image data are presented on a pseudocolor scale (blue representing least intense and red representing the most intense signal) overlaid onto a gray-scale photographic image. Using the image analysis tools in living image software, circular analysis windows (of uniform area) were overlaid onto regions of interest and the corresponding bioluminescence values (total flux) were measured.\u003c/p\u003e\n\u003ch3\u003eCell culture\u003c/h3\u003e\n\u003cp\u003eFor primary fibroblast studies, neonatal (P1) cells were used unless otherwise noted. Primary dermal fibroblasts were isolated by our laboratory as previously described (Zhang et al., 2019) and used in passage 1. Cells were grown in Dulbecco\u0026rsquo;s Modified Eagle Medium (DMEM) supplemented with 10% FBS, Glutamax (35050061; Thermo Fisher Scientific), and antibiotic\u0026ndash;antimycotic (15240062; Thermo Fisher Scientific). 2-day post-confluent cells were stimulated with recombinant cytokines, purified toll ligands, or an adipogenesis-inducing cocktail. Adipogenesis was induced as described previously (Zhang et al., 2015). Fibroblast cell culture supernatant was collected and added to fresh culture medium to achieve a final concentration of 20% for chemotaxis assay and treatment for MHS Macrophage or CD4\u0026thinsp;+\u0026thinsp;T cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eChemicals and reagents.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eanti-CAMP antibodies were made from our lab as described previously (22);; BODIPY\u0026reg; FL dye was purchased from Thermo Fisher (Houston, TX). HA binding protein was purchased from Millipore. Lipopolysaccharide (LPS) Solution (500X) was purchased from eBioscience\u0026trade;, Malp2 was purchased from Enzo biochem Inc, recombinant TNF was purchased from Fisher scientific.\u003c/p\u003e\n\u003ch3\u003eHistology and immunohistochemistry (IHC)\u003c/h3\u003e\n\u003cp\u003eTissue biopsies were directly embedded in OCT compound or paraffin. Paraffin embedded tissues were used for Hematoxylin and Eosin (H\u0026amp;E) staining, and frozen sections were fixed in 4% PFA for 20 mins to immunofluorescence staining. For IHC, fixed and permeabilized frozen tissue sections were blocked with Image-iT FX reagent (Invitrogen) before incubating with anti-CAMP. Anti-IL10 and anti-Gr1 antibodies were purchased from Abcam (Cambridge, MA), or anti-Cemip antibody is provided by KAO company. Samples are followed by appropriate 488- or 568-coupled secondary antibodies. Nuclei were counterstained with DAPI. All images were taken with an Olympus BX41 microscope (widefield).\u003c/p\u003e\n\u003ch3\u003eOil Red O staining\u003c/h3\u003e\n\u003cp\u003eAn Oil Red O stock solution was prepared at 3 mg/ml in 100% isopropanol. Following stimulation, cells were washed three times with phosphate-buffered saline (PBS) and fixed in 10% formalin for 2 hours at room temperature. Cells were then rinsed with 60% isopropanol. Oil Red O working solution (60% diluted in dH\u003csub\u003e2\u003c/sub\u003eO) was then applied to cells for 2 hours and 30 min. Then, cells were again rinsed three times with PBS.\u003c/p\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n\u003ch2\u003eWestern blotting\u003c/h2\u003e\n\u003cp\u003eMouse colon tissues were homogenized in RIPA buffer (Thermo Fisher). After centrifugation, cell lysates were subjected to SDS gel electrophoresis and transferred onto polyvinylidene difluoride membranes (IPVH 00010, Millipore). In brief, membranes were blocked in blocking buffer(Licor Biosciences) and Abs for p-ERK, p-P38 and Bactin were incubated over night at 4\u0026deg;C. The membranes were analyzed by immunoblotting with the indicated antibodies.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Heading\"\u003e\u003cstrong\u003eTissue processing for Single Cell RNA Sequencing\u003c/strong\u003e:\u003c/div\u003e\n\u003cp\u003eTissue samples from 3 mice in each group were minced with a razor blade into 1 cm fragments, suspended in enzymatic digestion buffer collagenase and DNase I as previously described 3, incubated with frequent agitation at 37\u0026deg;C for 120 min, and triturated briefly with a 5 ml pipet. Cells in a single-cell suspension were then passed through a 100-micron mesh filter. Then, Dead cells were removed using the Dead Cell Removal kit (Miltenyi Biotec, 130-090-101) following the manufacturer\u0026rsquo;s instructions. Live cells were manually counted using a hemocytometer and resuspended in 0.04% Ultrapure BSA (Thermo Fisher, AM2618). 20,000 live cells were loaded on the 10X Genomics Chromium system.\u003c/p\u003e\n\u003ch3\u003eTissue processing for spatial transcriptomics\u003c/h3\u003e\n\u003cp\u003eSkin tissues from untreated and \u003cem\u003eS.aureus\u003c/em\u003e infected mice from Control and Pdgfra/CCL2 mouse were fixed in cold 4% PFA, embedded in the paraffin, sectioned in 4um, and placed on the slide glasses. The experimental slide with the tissue was fixed and stained with hematoxylin and eosin (H\u0026amp;E) and imaged using a Keyence BZX-700 Fluorescent Microscopy (Keyence) at 4X magnification and transferred to sequencing slide by the Visium CytAssist. Sequence libraries were then processed according to manufacturer\u0026rsquo;s instructions (10x Genomics, Visium Spatial Transcriptomic).\u003c/p\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n\u003ch2\u003eLibrary construction protocol:\u003c/h2\u003e\n\u003cp\u003eSingle cell suspensions were loaded onto the 10X Genomics Chromium Controller instrument to generate single cell GEMs. GEM-RT and library construction were performed following the 10X Genomics Protocol. Library fragment size distributions was determined using an Agilent Bioanalyzer High Sensitivity chip, and library DNA concentrations were determined using a Qubit 2.0 Fluorometer (Invitrogen). Libraries were sequenced using an Illumina NovaSeq.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n\u003ch2\u003e\u003cstrong\u003eData analysis\u003c/strong\u003e:\u003c/h2\u003e\n\u003cp\u003eFor mouse skin samples, the 10X Genomics Cell Ranger version 7.2 software pipeline with default parameters was used to perform sample demultiplexing, barcode processing, alignment to the mm10 reference genome, and single-cell gene counting. Data were further filtered, processed and analyzed using the Seurat R toolkit version 5. Integration anchors between datasets were identified using the FindIntegrationAnchors function (dims\u0026thinsp;=\u0026thinsp;50) and integrated using the IntegrateData function (dims\u0026thinsp;=\u0026thinsp;50). The integrated data was then scaled, and principal component analysis (PCA) was performed on highly variable features. Significant Principal Components (PCs) were identified using a combination of statistical and heuristic methods and were employed to guide clustering. Neighbors and clusters were identified using the FindNeighbors and FindClusters functions, respectively, and visualized using Uniform Manifold Approximation and Projection (UMAP) or t-distributed Stochastic Neighbor Embedding (t-SNE). Cluster biomarkers were identified using the FindAllMarkers function (Wilcoxon rank sum test). Scored cells were projected onto UMAP, and cells were color-coded based on their score. Cells present in each cell cycle phase were also quantified. \u003cstrong\u003eCellChat analysis.\u003c/strong\u003e The R package CellChat(23), was utilized to quantitatively infer and analyze intercellular communication networks based on our single-cell RNA sequencing data. CellChat employs network analysis and pattern recognition methodologies to predict major signaling inputs and outputs for cells, as well as how these cells and signals coordinate for various functions. One of the key functionalities of CellChat is its ability to classify signaling pathways and delineate conserved and context-specific pathways through manifold learning and quantitative contrasts.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\n\u003ch2\u003eData analysis by BioTuring\u003c/h2\u003e\n\u003cp\u003eThe human single-cell sequencing data set (GSE201333) is obtained, processed, and analyzed by the online platform BioTuring. A total of 500K cells are analyzed, and 67,540 PDGFRa high cells are extracted as Fibroblasts. These cells are re-clustered, visualized using UMAP, and pseudo-time-analyzed.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n\u003ch2\u003eFlow cytometry analyses\u003c/h2\u003e\n\u003cp\u003eSkin collected from control and Pdgfra/CCL2\u003csup\u003efl/fl\u003c/sup\u003e mice with or without \u003cem\u003eS. aureus\u003c/em\u003e infection was cut into small pieces then digested with 2.5 mg/mL Collagenase D and 30 ng/mL DNAse1 for 2 hours at 37\u0026deg;C then filtered through a 70 \u0026micro;m filter to generate single cell suspension for FACS analyses. Cells were then stained with Fixable Viability Dye eFluor\u0026trade; 506 (eBioscience, 65-0866-14), blocked with anti-mouse CD16/32 (eBioscience, 14016185), followed by staining with antibody cocktails for immune cells. The antibody cocktail for immune cells includes Brilliant Violet 711\u0026trade; -CD45(BioLegend, 103147), PECy7-CD11b (BioLegend, 101216), FITC-Ly6G (eBioscience, 11593182), PE-F4/80 (eBioscience,12480182), APC-CD11C (BioLegend, 117310), AF700-MHCII (eBioscience, 56532182), and APC-Cy7-CD3 (BioLegend, 100222). FACS analyses for surface expression of immune cell markers were performed by the BD FACSCanto RUO machine and analyzed by FlowJo V10 software.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n\u003ch2\u003eReverse transcription-quantitative PCR (RTqPCR) analyses\u003c/h2\u003e\n\u003cp\u003eRTqPCR was used to determine the mRNA abundance. Total cellular RNA was extracted using the PureLink RNA Mini Kit (Life Technologies Corporation). 100 ng of mRNA was reverse transcribed to cDNA using Verso cDNA Synthesis Kit (Thermo Fisher Scientific Inc). Quantitative, real-time PCR was performed on the CFX96 real time system (Biorad) using predeveloped Taqman gene expression assay (Applied Biosystems) or SYBR Green Mix (Bimake, Houston, TX). The housekeeping gene Tbp (TATA-binding box protein) was used to normalize gene expression in samples. Specific primer sequences are shown in table \u003cspan class=\"InternalRef\"\u003eS1\u003c/span\u003e.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n\u003ch2\u003eLipidomic analysis\u003c/h2\u003e\n\u003cp\u003eLipidomic analyses were conducted at the UCLA Lipidomics Core following their established protocol, as previously outlined. Briefly, for tissue samples, 50\u0026ndash;100 mg of frozen dermis layers of skin was placed in a 2 mL homogenizer tube pre-loaded with 2.8 mm ceramic beads (Omni #19\u0026ndash;628). PBS was added to the tube, and the sample was homogenized in the Omni Bead Ruptor Elite (3 cycles of 10 seconds at 5 m/s with a 10-second dwell time). For lipid extraction, 3\u0026ndash;6 mg of tissue homogenate was transferred to a glass tube for lipid extraction using a modified Bligh and Dyer extraction method(24).Prior to biphasic extraction, an internal standard mixture comprising 70 lipid standards across 17 subclasses was added to each sample (AB Sciex 5040156, Avanti 330827, Avanti 330830, Avanti 330828, and Avanti 791642). Following two consecutive extractions, pooled organic layers were evaporated in a Thermo SpeedVac SPD300DDA using ramp setting 4 at 35\u0026deg;C for 45 minutes with a total run time of 90 minutes. Lipid samples were reconstituted in a 1:1 mixture of methanol and dichloromethane with 10 mM ammonium acetate and transferred to robovials (Thermo Fisher Scientific, 10800107) for analysis. Samples underwent analysis on the Sciex 5500 with DMS device (Lipidyzer platform) utilizing an expanded targeted acquisition list encompassing 1450 lipid species across 17 subclasses. The differential mobility device on Lipidyzer was calibrated with EquiSPLASH LIPIDOMIX (Avanti 330731). Data analysis was conducted on an in-house data analysis platform similar to the Lipidyzer Workflow Manager. The instrument method, encompassing settings, tuning protocol, and the multiple reaction monitoring (MRM) list, has been previously detailed(25). Quantitative values were normalized to milligrams of tissue weight.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\n\u003ch2\u003eStatistical analysis\u003c/h2\u003e\n\u003cp\u003eStatistical analyses were performed with GraphPad Prism. All the statistical tests performed are indicated in the figure legends.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\n\u003ch2\u003eStudy approval:\u003c/h2\u003e\n\u003cp\u003eAll animal experiments were approved by the University of California, San Diego, Institutional Animal Care (Protocol No. S09074).\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003eFibroblasts abundantly express CCL2, CXCL12, and IL6\u003c/h2\u003e\u003cp\u003eTo identify potential gene products that contribute to the immune function of fibroblasts, we first analyzed a large, single-cell RNA sequencing (scRNAseq) dataset from a multiorgan human tissue atlas (26) for cytokine and chemokine expression in all cell types. This analysis revealed that Ccl2, Cxcl12 and Il6 are highly expressed in fibroblasts compared to other cell types (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea, \u003cb\u003eSupplemental Fig.\u0026nbsp;1a\u003c/b\u003e). Further analysis of the fibroblast populations distinguished by PDGFRa expression identified 15 different clusters in UMAP plot (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). Pseudotime analysis showed cluster 12 (Ccl2 and Il6 high) and cluster 11 (Cxcl12 high) represent an immune state distinct from cluster 11 (Cxcl12 high), clusters 3 and 8 (Thy1 and CD24 high) or clusters 13 and 15 (CEBPd, Camp high) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec). Analysis of independent datasets of mouse skin and colon (27) (28) also showed clusters of potentially immune-acting fibroblasts expressing Ccl2 and Il6 ( cluster 0,1,3, and 4), which were distinct from clusters expressing Cxcl12 ( cluster 6 and 9)(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea \u003cb\u003eto c, Supplemental Fig.\u0026nbsp;1b\u003c/b\u003e). Top2 Go term analysis defined the Ccl2 and Il6 high clusters as being associated with regulation of inflammatory response in both skin and colon tissue (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed \u003cb\u003eand supplemental fig, \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec to e\u003c/b\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003eFibroblast-derived Ccl2 recruits macrophages and alters immune functions\u003c/h2\u003e\u003cp\u003eCL2 is a potent chemokine that recruits monocytes, T cells, B cells, natural killer cells, basophils, dendritic cells, myeloid-derived suppressor cells, and neutrophils while also influencing macrophage development, and therefore was a prime candidate to further explore as a key mediator of host defense from fibroblasts (16, 29, 30). To determine whether the CCL2 produced by fibroblasts is sufficient to promote chemotactic activity, we tested whether fibroblasts can recruit monocytes from peripheral blood mononuclear cells (PBMC) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea). Culture medium from mouse primary fibroblasts recruited neutrophils and monocytes, whereas supernatant from Ccl2 deficient fibroblasts was unable to recruit macrophages (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb \u003cb\u003eand supplemental Fig.\u0026nbsp;2a to c\u003c/b\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eNext, to examine if fibroblast-derived Ccl2 is sufficient to alter macrophage function, we cultured the MHS macrophage cell line with fibroblast-conditioned medium (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec). Bulk transcriptome sequencing analysis revealed that culture medium conditioned by wild type primary dermal fibroblasts induced a variety of defense genes in macrophages. In contrast, Ccl2 deficient fibroblast conditioned medium showed a gene expression profile similar to control media that was not conditioned by fibroblasts, with lower expression of multiple defense genes \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed\u003cb\u003e).\u003c/b\u003e Gene ontogeny analysis identified a significant increase in expression of genes associated with several GO terms including negative regulation of myeloid cell differentiation in MHS cell exposed to wild-type fibroblast conditioned media compared to Ccl2 deficient fibroblast conditioned media \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ee\u003cb\u003e).\u003c/b\u003e qPCR confirmed a decrease in the expression of immune genes, including Il1b, Nos2, and CD74, in MHS cells exposed to Ccl2 deficient fibroblast conditioned media or CCL2 inhibitor (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ef \u003cb\u003eto h\u003c/b\u003e, \u003cb\u003esupplemental Fig.\u0026nbsp;3d\u003c/b\u003e). Conditioned culture media from MHS cells activated by wild-type or Ccl2 deficient fibroblast conditioned media induced T cell proliferation \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ei \u003cb\u003eand j)\u003c/b\u003e. Furthermore, ovalbumin (OVA) simulated macrophages enhanced T cell proliferation in a CCL2-dependent manner.\u003c/p\u003e\u003cp\u003eTaken together, these findings demonstrated that Ccl2 produced by cultured fibroblasts is sufficient to recruit monocytes and activate macrophages to express genes that are critical to host defense.\u003c/p\u003e\u003cp\u003e\u003cb\u003eFibroblast derived Ccl2 defends against\u003c/b\u003e \u003cb\u003eS. aureus\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo test the role of fibroblast-derived Ccl2 in host defense against infection in vivo, we generated fibroblast specific Ccl2 knockout mice by crossing Pdgfra-Cre with Ccl2\u003csup\u003efl/fl\u003c/sup\u003e mice (Pdgfra/Ccl2\u003csup\u003efl/fl\u003c/sup\u003e). These mice, along with littermate Cre-negative controls, were challenged with an intradermal injection of \u003cem\u003eStaphylococcus aureus\u003c/em\u003e USA300 (\u003cem\u003eS. aureus\u003c/em\u003e). Mice deficient in Ccl2 in fibroblasts exhibited a large increase in susceptibility to \u003cem\u003eS. aureus\u003c/em\u003e infection, as observed by increased lesion area (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea, b\u003cb\u003e)\u003c/b\u003e, heightened perilesional tissue inflammation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec) and greater bacterial survival estimated by IVIS imaging of bacterial luminescence \u003cb\u003e(Supplemental Fig.\u0026nbsp;3a, b\u003c/b\u003e). scRNAseq analysis of these skin lesions revealed an increased proportion of monocyte clusters in Pdgfra/Ccl2\u003csup\u003efl/fl\u003c/sup\u003e mice compared to control mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed \u003cb\u003eand Supplemental Fig.\u0026nbsp;3c\u003c/b\u003e). Cell-cell interaction analysis using Cell-Chat demonstrated stronger interactions from monocyte to other cell types and decreased fibroblast autocrine interaction in normal Pdgfra/Ccl2\u003csup\u003efl/fl\u003c/sup\u003e mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ee). More specifically, immune cell signaling such as MHC-II, CD80, and CD86 signaling were downregulated in monocytes from Pdgfra/Ccl2\u003csup\u003efl/fl\u003c/sup\u003e mice both before (\u003cb\u003eSupplemental Fig.\u0026nbsp;3d to e\u003c/b\u003e) and after infection (\u003cb\u003eSupplemental Fig.\u0026nbsp;3f to g\u003c/b\u003e). Thus, we performed additional analysis from Monocyte. Go term analysis from Monocytes showed Monocytes from control mice exhibited greater expression of genes associated with cell chemotaxis and leukocyte apoptotic process in the response to \u003cem\u003eS. aureus\u003c/em\u003e infection. (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ef) In contrast, monocytes from Pdgfra/Ccl2\u003csup\u003efl/fl\u003c/sup\u003e mice showed increased expression of a variety of genes that were not specific to responding to \u003cem\u003eS. aureus\u003c/em\u003e infections. UMAP plot showed 10 clusters (\u003cb\u003eSupplemental Fig.\u0026nbsp;4a\u003c/b\u003e). Additionally, cluster 4 was significantly reduced in Pdgfra/Ccl2\u003csup\u003efl/fl\u003c/sup\u003e mice (\u003cb\u003eSupplemental Fig.\u0026nbsp;4b\u003c/b\u003e), which is associate with the response to bacterial molecules (\u003cb\u003eSupplemental Fig.\u0026nbsp;4c\u003c/b\u003e), including Cd74, (\u003cb\u003eSupplemental Fig.\u0026nbsp;4d to e\u003c/b\u003e). These observations are consistent with in vitro analysis of macrophage cell line and suggest that the absence of Ccl2 leads to impaired antigen processing and presentation by monocytes.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eCell-cell interaction analysis during \u003cem\u003eS. aureus\u003c/em\u003e infection further indicated reduced fibroblast interactions with other cell types, as well as decreased interactions within fibroblasts (\u003cb\u003eSupplemental Fig.\u0026nbsp;5a\u003c/b\u003e) similar to observations in uninfected samples (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ee). Thus, we performed additional analysis from Fibroblasts. GO terms revealed that in control mice with \u003cem\u003eS. aureus\u003c/em\u003e infection, enriched GO terms were associated with extracellular matrix organization. In contrast, Pdgfra/Ccl2\u003csup\u003efl/fl\u003c/sup\u003e mice exhibited enrichment in genes related to ATP metabolic process (\u003cb\u003eSupplemental Fig.\u0026nbsp;5b\u003c/b\u003e). Further analysis of the fibroblasts clusters highlighted an increased proportion of cluster 2 in Pdgfra/Ccl2\u003csup\u003efl/fl\u003c/sup\u003e mice(\u003cb\u003eSupplemental Fig.\u0026nbsp;5c and d\u003c/b\u003e), which displayed upregulated genes involved in ATP metabolic process during infection (\u003cb\u003eSupplemental Fig.\u0026nbsp;5e and f\u003c/b\u003e).\u003c/p\u003e\u003cp\u003eSince the local response to invasive \u003cem\u003eS. aureus\u003c/em\u003e infection in the skin is highly spatially organized, we next employed spatial transcriptomic analysis of mouse skin three days post-infection. Across control, \u003cem\u003eS. aureus\u003c/em\u003e infection (SA), Pdgfra/Ccl2^fl/fl, and Pdgfra/Ccl2^fl/fl SA samples, 18 distinct transcriptomic clusters were identified (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea \u003cb\u003eand Supplemental Fig.\u0026nbsp;6a and b\u003c/b\u003e). In control SA mice, six concentric transcriptomic layers were arranged around the infection site (clusters 16 \u0026rarr; 8, 4, 0, 6, 5), suggesting a coordinated, multilayered defense program. However, in Pdgfra/Ccl2^fl/fl SA mice, this spatial organization was profoundly disrupted, with only three clusters (9, 7, 13) surrounding the lesion (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb). GO term analysis further highlighted that the infection-edge clusters in Pdgfra/Ccl2\u003csup\u003efl/fl\u003c/sup\u003e (Cluster 7) exhibited loss of extracellular matrix organization and antigen presentation pathways, including reduced expression of \u003cem\u003eFcgr3\u003c/em\u003e and \u003cem\u003eFcer1g\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec \u003cb\u003eand d, Supplemental Fig.\u0026nbsp;6c and Supplemental Fig.\u0026nbsp;7\u003c/b\u003e). Moreover, fibroblasts within infected lesions of control SA mice (Cluster 16) upregulated inflammatory mediators such as \u003cem\u003eLcn2\u003c/em\u003e and \u003cem\u003eNfkbiz\u003c/em\u003e, whereas this response was absent in Pdgfra/Ccl2\u003csup\u003efl/fl\u003c/sup\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ee). These findings demonstrate that fibroblast-derived Ccl2 is required not only for immune cell recruitment but also for maintaining the layered spatial organization of the transcriptomic response at the infection edge. In Pdgfra/Ccl2^fl/fl mice, disruption of this structure coincided with impaired immune activation and loss of extracellular matrix organization normally supported by Ccl2⁺ fibroblasts, leading to compromised barrier integrity and antigen presentation.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\u003ch2\u003eFibroblast derived Ccl2 decreases immune responses by macrophages and fibroblasts\u003c/h2\u003e\u003cp\u003eBased on our observations that the transcriptional response of Pdgfra/Ccl2\u003csup\u003efl/fl\u003c/sup\u003e during \u003cem\u003eS. aureus\u003c/em\u003e infection included changes in communication with several cell types that participate in defense against infection, we next focused on analysis of these cells to better understand how they may explain the increase in \u003cem\u003eS. aureus\u003c/em\u003e infection. Nitric oxide (NO) production is known to play a critical role in host defense by macrophages(31, 32). Nos2 mRNA signal detected by spatial sequencing was decreased in Pdgfra/Ccl2\u003csup\u003efl/fl\u003c/sup\u003e compared to control mice infected by SA (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea\u003cb\u003e)\u003c/b\u003e and qPCR of whole skin from the site of infection also showed less Nos2 in Pdgfra/Ccl2\u003csup\u003efl/fl\u003c/sup\u003e after infection \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eb\u003cb\u003e)\u003c/b\u003e. Flow cytometry analysis showed a decreased number of CD4\u0026thinsp;+\u0026thinsp;lymphocytes after \u003cem\u003eS. aureus\u003c/em\u003e infection (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ec\u003cb\u003e)\u003c/b\u003e. No difference in the number of CD45 positive cells, neutrophils, and macrophages, was seen between control and Pdgfra/Ccl2\u003csup\u003efl/fl\u003c/sup\u003e mice with or without infection (\u003cb\u003eSupplemental Fig.\u0026nbsp;8a-c\u003c/b\u003e). However, a small increase in CD11c+, MHCII\u0026thinsp;+\u0026thinsp;DC and an increase in IL10 was observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ed, e \u003cb\u003eand Supplemental Fig.\u0026nbsp;8d\u003c/b\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003escRNAseq and spatial sequencing analysis also showed decreased expression of genes associated with ECM organization in Pdgfra/Ccl2\u003csup\u003efl/fl\u003c/sup\u003emice. A decrease in mRNA for Hyaluronan Synthase 2 (\u003cem\u003eHas2\u003c/em\u003e) and Lymphatic vessel endothelial hyaluronan receptor 1 (\u003cem\u003eLyve1\u003c/em\u003e), as well as a decrease in total hyaluronan was observed in Pdgfra/Ccl2\u003csup\u003efl/fl\u003c/sup\u003e mice compared to controls after SA infection (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ef \u003cb\u003eand g\u003c/b\u003e). No increase in Cell migration-inducing and hyaluronan-binding protein (\u003cem\u003eCemip\u003c/em\u003e), the enzyme responsible for hyaluronan degradation during skin injury, was seen (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eh).\u003c/p\u003e\u003cp\u003eAs fibroblasts primarily express hyaluronan in the dermis (33, 34), and fibroblasts activated to undergo adipogenesis defend against SA infection by production of the antimicrobial peptide Cathelicidin (\u003cem\u003eCamp)\u003c/em\u003e (2), we next evaluated \u003cem\u003eCamp\u003c/em\u003e expression. Pdgfra/Ccl2\u003csup\u003efl/fl\u003c/sup\u003e mice expressed significantly less \u003cem\u003eCamp\u003c/em\u003e in the skin after SA (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ei \u003cb\u003eand j\u003c/b\u003e). This decrease in \u003cem\u003eCamp\u003c/em\u003e was not associated with decreased neutrophils but was associated with decreased Camp staining in Pdgfra\u0026thinsp;+\u0026thinsp;fibroblasts \u003cb\u003e(Supplemental Fig.\u0026nbsp;8e and f)\u003c/b\u003e.\u003c/p\u003e\u003cdiv id=\"Sec23\" class=\"Section3\"\u003e\u003ch2\u003eCcl2 is inducible in dermal fibroblasts and required for adipogenesis\u003c/h2\u003e\u003cp\u003eTo better understand how Ccl2 is induced by fibroblasts during infection and investigate why fibroblasts showed a reduced expression of the antimicrobial peptide \u003cem\u003eCamp\u003c/em\u003e in Pdgfra/Ccl2\u003csup\u003efl/fl\u003c/sup\u003e mice we next evaluated mouse primary dermal fibroblasts in culture. Ligands for TLR4 (LPS), TLR2/6 (Malp2) and TNF were each capable of inducing Ccl2 in fibroblasts derived from wild-type mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ea). Fibroblasts derived from Pdgfra/Ccl2\u003csup\u003efl/fl\u003c/sup\u003e mice were confirmed to lack Ccl2 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eb). Fibroblasts derived from Pdgfra/Ccl2\u003csup\u003efl/fl\u003c/sup\u003e mice showed decreased \u003cem\u003eCamp\u003c/em\u003e expression after LPS activation (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ec) and lower expression of the adipocyte differentiation Zinc Finger Protein 423 (zfp423) following addition of adipocyte differentiation medium (DM) (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ed). Further evidence that CCL2 influenced adipocyte differentiation was seen in the decreased phosphorylation of ERK and p38 after DM following the addition of a Ccr2 inhibitor or in fibroblasts from Pdgfra/Ccl2\u003csup\u003efl/fl\u003c/sup\u003e mice treated with DM (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ee). Fibroblasts derived from Pdgfra/Ccl2\u003csup\u003efl/fl\u003c/sup\u003e mice also demonstrated decreased lipid accumulation during adipocyte differentiation compared to control (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003ef). DMS-based shotgun lipidomic analysis further demonstrated that the lipids produced by Pdgfra/Ccl2\u003csup\u003efl/fl\u003c/sup\u003e fibroblasts were different than control when stimulated to undergo adipocyte differentiation (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eg). These fibroblasts lacking CCL2 produced low amounts of several lipids including ceramides and cholesterol (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eh).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, we demonstrate that fibroblast-derived CCL2 plays a critical role in host defense against \u003cem\u003eS. aureus\u003c/em\u003e infection by regulating macrophage function and reactive adipogenesis. Recent research has increasingly highlighted the immune-regulatory roles of fibroblasts, challenging their traditional characterization as mere structural components of tissues. Building on this evolving perspective, we aimed to identify the critical immune functions of fibroblasts, particularly their contributions to host defense and inflammation. By analyzing human and mouse single-cell sequencing datasets, we identified that fibroblasts express a variety of cytokines and chemokines. However, in the steady state, only CCL2, CXCL12, and IL-6 are predominantly expressed by fibroblasts. Importantly, CCL2 expression is confined to a specific subset of fibroblasts, whereas CXCL12 and IL-6 are expressed more broadly across the fibroblast population (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Based on these observations, we hypothesized that fibroblast-derived CCL2 plays a unique and essential role in immune regulation. Supporting this hypothesis, our \u003cem\u003ein vitro\u003c/em\u003e findings revealed that fibroblast-derived CCL2 is critical for maintaining macrophage antimicrobial activity, cytokine production, and antigen-presenting function (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe essential role for fibroblasts to produce CCL2 was demonstrated by fibroblast-specific deletion of CCL2 in mice, resulting in much greater infections by \u003cem\u003eS. aureus\u003c/em\u003e (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). This increase in susceptibility to infection is accompanied by impaired immune responses from both monocytes and fibroblasts. This underscores the pivotal role of fibroblast-derived CCL2 in orchestrating innate immune defenses. Mechanistically, fibroblast-derived CCL2 regulates key immune processes, including monocyte differentiation, Nos2 induction, and T cell proliferation in response to \u003cem\u003eS. aureus\u003c/em\u003e infection, while also reducing the induction of the anti-inflammatory cytokine IL-10 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). Beyond these established roles in macrophage-mediated immunity, we also identified a novel function for fibroblast-derived CCL2 in regulating fibroblast-to-adipocyte differentiation through ERK and P38 signaling pathways (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). This process enhances reactive adipogenesis, contributing to host defense against \u003cem\u003eS. aureus\u003c/em\u003e by producing the antimicrobial peptide cathelicidin. Thus several innate immune defense events, each important to protection against infection, are all influenced by the production of CCL2 from fibroblasts.\u003c/p\u003e\u003cp\u003eThese findings clarify the immune responses mediated by fibroblasts during bacterial infection and suggest that fibroblast-derived CCL2 may play a broader role in inflammatory responses by modulating reactive adipogenesis, macrophage function, and lymphocyte proliferation. While this study primarily focused on \u003cem\u003eS. aureus\u003c/em\u003e infection and fibroblast-specific mechanisms, further research is needed to investigate whether similar pathways are active in other infection models or inflammatory conditions. Additionally, exploring the interplay between fibroblast-derived CCL2 and adaptive immune responses could offer valuable insights into its broader roles in immunological regulation.\u003c/p\u003e\u003cp\u003eIn summary, our findings provide new insights into the immune-regulatory role of fibroblast-derived CCL2 in host defense against \u003cem\u003eS. aureus\u003c/em\u003e infection. We have identified CCL2 as a critical mediator in macrophage function, and reactive adipogenesis, offering a novel perspective on the immune functions of fibroblasts. These findings not only contribute to our understanding of fibroblast biology but also suggest potential therapeutic avenues for diseases involving chronic inflammation and immune dysregulation.\u003c/p\u003e\u003cdiv id=\"Sec25\" class=\"Section2\"\u003e\u003ch2\u003eLimitation\u003c/h2\u003e\u003cp\u003eA key limitation of our study is that while we demonstrated that fibroblast-derived CCL2 regulates both macrophage and fibroblast immune responses, we did not determine the relative contribution of these processes or if one is primarily responsible for host defense against \u003cem\u003eS. aureus\u003c/em\u003e infection. However, previous studies have shown that both macrophages and fibroblasts play essential roles in controlling \u003cem\u003eS. aureus\u003c/em\u003e, suggesting that all are important. By regulating both macrophage function and fibroblast-mediated immune responses, fibroblast-derived CCL2 likely serves as a key coordinator of the immune response to bacterial infection. Future studies are needed to further delineate the specific contributions of each cell type; however, our findings highlight the pivotal role of fibroblast-derived CCL2 in immunity against \u003cem\u003eS. aureus\u003c/em\u003e.\u003c/p\u003e\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors wish to thank Carlos Aguilera for assistance in animal care and breeding and Dr. Alex Horswill for providing USA300 MRSA strain containing the phage11::LL29luxCDABEG reporter\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization: TD, KJC, RLG\u003c/p\u003e\n\u003cp\u003eMethodology: TD, MPI, MB, HC, SA, YN, KJC, TN\u003c/p\u003e\n\u003cp\u003eInvestigation: TD, MPI, MB, HC, SA, YN, KJC, TN\u003c/p\u003e\n\u003cp\u003eVisualization: TD, MPI, MB, HC, SA, YN, KJC, TN\u003c/p\u003e\n\u003cp\u003eFunding acquisition: RLG\u003c/p\u003e\n\u003cp\u003eProject administration: RLG\u003c/p\u003e\n\u003cp\u003eSupervision: RLG\u003c/p\u003e\n\u003cp\u003eWriting – original draft: TD\u003c/p\u003e\n\u003cp\u003eWriting – review \u0026amp; editing: TD, MPI, RLG\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interest Statement:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eRLG is a co-founder, scientific advisor, consultant, and equity holder of MatriSys Biosciences and is a consultant who receives income and equity in Sente.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eCavagnero KJ, Gallo RL. Essential immune functions of fibroblasts in innate host defense. Front Immunol. 2022;13:1058862.\u003c/li\u003e\n\u003cli\u003eZhang LJ, Guerrero-Juarez CF, Hata T, Bapat SP, Ramos R, Plikus MV, et al. Innate immunity. Dermal adipocytes protect against invasive Staphylococcus aureus skin infection. Science. 2015;347(6217):67\u0026ndash;71.\u003c/li\u003e\n\u003cli\u003eBoothby IC, Kinet MJ, Boda DP, Kwan EY, Clancy S, Cohen JN, et al. Early-life inflammation primes a T helper 2 cell-fibroblast niche in skin. Nature. 2021;599(7886):667\u0026thinsp;\u0026minus;\u0026thinsp;72.\u003c/li\u003e\n\u003cli\u003ePlikus MV, Wang X, Sinha S, Forte E, Thompson SM, Herzog EL, et al. Fibroblasts: Origins, definitions, and functions in health and disease. Cell. 2021;184(15):3852-72.\u003c/li\u003e\n\u003cli\u003eBuechler MB, Pradhan RN, Krishnamurty AT, Cox C, Calviello AK, Wang AW, et al. Cross-tissue organization of the fibroblast lineage. Nature. 2021;593(7860):575-9.\u003c/li\u003e\n\u003cli\u003eStark K, Eckart A, Haidari S, Tirniceriu A, Lorenz M, von Br\u0026uuml;hl ML, et al. Capillary and arteriolar pericytes attract innate leukocytes exiting through venules and 'instruct' them with pattern-recognition and motility programs. Nat Immunol. 2013;14(1):41\u0026ndash;51.\u003c/li\u003e\n\u003cli\u003eKuroda E, Ozasa K, Temizoz B, Ohata K, Koo CX, Kanuma T, et al. Inhaled Fine Particles Induce Alveolar Macrophage Death and Interleukin-1\u0026alpha; Release to Promote Inducible Bronchus-Associated Lymphoid Tissue Formation. Immunity. 2016;45(6):1299\u0026thinsp;\u0026minus;\u0026thinsp;310.\u003c/li\u003e\n\u003cli\u003eZheng Z, Li YN, Jia S, Zhu M, Cao L, Tao M, et al. Lung mesenchymal stromal cells influenced by Th2 cytokines mobilize neutrophils and facilitate metastasis by producing complement C3. Nat Commun. 2021;12(1):6202.\u003c/li\u003e\n\u003cli\u003eCavagnero KJ, Li F, Dokoshi T, Nakatsuji T, O'Neill AM, Aguilera C, et al. CXCL12\u0026thinsp;+\u0026thinsp;dermal fibroblasts promote neutrophil recruitment and host defense by recognition of IL-17. J Exp Med. 2024;221(4).\u003c/li\u003e\n\u003cli\u003e Villarreal-Ponce A, Tiruneh MW, Lee J, Guerrero-Juarez CF, Kuhn J, David JA, et al. Keratinocyte-Macrophage Crosstalk by the Nrf2/Ccl2/EGF Signaling Axis Orchestrates Tissue Repair. Cell Rep. 2020;33(8):108417.\u003c/li\u003e\n\u003cli\u003e Ramachandran P, Pellicoro A, Vernon MA, Boulter L, Aucott RL, Ali A, et al. Differential Ly-6C expression identifies the recruited macrophage phenotype, which orchestrates the regression of murine liver fibrosis. Proc Natl Acad Sci U S A. 2012;109(46):E3186-95.\u003c/li\u003e\n\u003cli\u003e Ochocka N, Segit P, Walentynowicz KA, Wojnicki K, Cyranowski S, Swatler J, et al. Single-cell RNA sequencing reveals functional heterogeneity of glioma-associated brain macrophages. Nat Commun. 2021;12(1):1151.\u003c/li\u003e\n\u003cli\u003e Boniakowski AE, Kimball AS, Joshi A, Schaller M, Davis FM, denDekker A, et al. Murine macrophage chemokine receptor CCR2 plays a crucial role in macrophage recruitment and regulated inflammation in wound healing. Eur J Immunol. 2018;48(9):1445-55.\u003c/li\u003e\n\u003cli\u003e Voisin B, Nadella V, Doebel T, Goel S, Sakamoto K, Ayush O, et al. Macrophage-mediated extracellular matrix remodeling controls host Staphylococcus aureus susceptibility in the skin. Immunity. 2023;56(7):1561-77.e9.\u003c/li\u003e\n\u003cli\u003e Baggiolini M. Chemokines and leukocyte traffic. Nature. 1998;392(6676):565-8.\u003c/li\u003e\n\u003cli\u003e Gschwandtner M, Derler R, Midwood KS. More Than Just Attractive: How CCL2 Influences Myeloid Cell Behavior Beyond Chemotaxis. Front Immunol. 2019;10:2759.\u003c/li\u003e\n\u003cli\u003e Whelan DS, Caplice NM, Clover AJP. Mesenchymal stromal cell derived CCL2 is required for accelerated wound healing. Sci Rep. 2020;10(1):2642.\u003c/li\u003e\n\u003cli\u003e Giri J, Das R, Nylen E, Chinnadurai R, Galipeau J. CCL2 and CXCL12 Derived from Mesenchymal Stromal Cells Cooperatively Polarize IL-10\u0026thinsp;+\u0026thinsp;Tissue Macrophages to Mitigate Gut Injury. Cell Rep. 2020;30(6):1923-34.e4.\u003c/li\u003e\n\u003cli\u003e Muhs A, Lyles JT, Parlet CP, Nelson K, Kavanaugh JS, Horswill AR, et al. Virulence Inhibitors from Brazilian Peppertree Block Quorum Sensing and Abate Dermonecrosis in Skin Infection Models. Sci Rep. 2017;7:42275.\u003c/li\u003e\n\u003cli\u003e Paharik AE, Parlet CP, Chung N, Todd DA, Rodriguez EI, Van Dyke MJ, et al. Coagulase-Negative Staphylococcal Strain Prevents Staphylococcus aureus Colonization and Skin Infection by Blocking Quorum Sensing. Cell host \u0026amp; microbe. 2017;22(6):746\u0026thinsp;\u0026minus;\u0026thinsp;56 e5.\u003c/li\u003e\n\u003cli\u003e V. Nizet TO, X. Lauth, J. Trowbridge, J. Rudisill, R. A. Dorschner, V. Pestonjamasp, J. Piraino, K. Huttner, R. L. Gallo. Innate antimicrobial peptide protects the skin from invasive bacterial infection. Nature. 2001;414:454\u0026ndash;7.\u003c/li\u003e\n\u003cli\u003e Dorschner RA, Pestonjamasp VK, Tamakuwala S, Ohtake T, Rudisill J, Nizet V, et al. Cutaneous injury induces the release of cathelicidin anti-microbial peptides active against group A Streptococcus. The Journal of investigative dermatology. 2001;117(1):91\u0026thinsp;\u0026minus;\u0026thinsp;7.\u003c/li\u003e\n\u003cli\u003e Jin S, Guerrero-Juarez CF, Zhang L, Chang I, Ramos R, Kuan CH, et al. Inference and analysis of cell-cell communication using CellChat. Nat Commun. 2021;12(1):1088.\u003c/li\u003e\n\u003cli\u003e Bligh EG, Dyer WJ. A rapid method of total lipid extraction and purification. Can J Biochem Physiol. 1959;37(8):911-7.\u003c/li\u003e\n\u003cli\u003e Su B, Bettcher LF, Hsieh WY, Hornburg D, Pearson MJ, Blomberg N, et al. A DMS Shotgun Lipidomics Workflow Application to Facilitate High-Throughput, Comprehensive Lipidomics. J Am Soc Mass Spectrom. 2021;32(11):2655-63.\u003c/li\u003e\n\u003cli\u003e Jones RC, Karkanias J, Krasnow MA, Pisco AO, Quake SR, Salzman J, et al. The Tabula Sapiens: A multiple-organ, single-cell transcriptomic atlas of humans. Science. 2022;376(6594):eabl4896.\u003c/li\u003e\n\u003cli\u003e Dokoshi T, Chen Y, Cavagnero KJ, Rahman G, Hakim D, Brinton S, et al. Dermal injury drives a skin to gut axis that disrupts the intestinal microbiome and intestinal immune homeostasis in mice. Nat Commun. 2024;15(1):3009.\u003c/li\u003e\n\u003cli\u003e Nakatsuji T, Brinton SL, Cavagnero KJ, O'Neill AM, Chen Y, Dokoshi T, et al. Competition between skin antimicrobial peptides and commensal bacteria in type 2 inflammation enables survival of S. aureus. Cell Rep. 2023;42(5):112494.\u003c/li\u003e\n\u003cli\u003e Matsushima K, Larsen CG, DuBois GC, Oppenheim JJ. Purification and characterization of a novel monocyte chemotactic and activating factor produced by a human myelomonocytic cell line. J Exp Med. 1989;169(4):1485-90.\u003c/li\u003e\n\u003cli\u003e Yoshimura T, Robinson EA, Tanaka S, Appella E, Kuratsu J, Leonard EJ. Purification and amino acid analysis of two human glioma-derived monocyte chemoattractants. J Exp Med. 1989;169(4):1449-59.\u003c/li\u003e\n\u003cli\u003e MacMicking J, Xie QW, Nathan C. Nitric oxide and macrophage function. Annu Rev Immunol. 1997;15:323\u0026thinsp;\u0026minus;\u0026thinsp;50.\u003c/li\u003e\n\u003cli\u003e Wu KK, Xu X, Wu M, Li X, Hoque M, Li GHY, et al. MDM2 induces pro-inflammatory and glycolytic responses in M1 macrophages by integrating iNOS-nitric oxide and HIF-1\u0026alpha; pathways in mice. Nat Commun. 2024;15(1):8624.\u003c/li\u003e\n\u003cli\u003e Werner S, Krieg T, Smola H. Keratinocyte-fibroblast interactions in wound healing. J Invest Dermatol. 2007;127(5):998\u0026ndash;1008.\u003c/li\u003e\n\u003cli\u003e Wang Y, Lauer ME, Anand S, Mack JA, Maytin EV. Hyaluronan synthase 2 protects skin fibroblasts against apoptosis induced by environmental stress. J Biol Chem. 2014;289(46):32253-65.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cdiv class=\"SimplePara\"\u003ePCR primer sequences.\u003c/div\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cdiv class=\"SimplePara\"\u003eGene name\u003c/div\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cdiv class=\"SimplePara\"\u003eSequence\u003c/div\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cdiv class=\"SimplePara\"\u003eTbp\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cdiv class=\"SimplePara\"\u003eforward\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cdiv class=\"SimplePara\"\u003eCCTTGTACCCTTCACCAATGAC\u003c/div\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cdiv class=\"SimplePara\"\u003eTbp\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cdiv class=\"SimplePara\"\u003ereverse\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cdiv class=\"SimplePara\"\u003eACAGCCAAGATTCACGGTAGA\u003c/div\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cdiv class=\"SimplePara\"\u003ell1b\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cdiv class=\"SimplePara\"\u003eforward\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cdiv class=\"SimplePara\"\u003eGAAATGCCACCTTTTGACAGTG\u003c/div\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cdiv class=\"SimplePara\"\u003ell1b\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cdiv class=\"SimplePara\"\u003ereverse\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cdiv class=\"SimplePara\"\u003eTGGATGCTCTCATCAGGACAG\u003c/div\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cdiv class=\"SimplePara\"\u003eNos2\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cdiv class=\"SimplePara\"\u003eforward\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cdiv class=\"SimplePara\"\u003eGTTCTCAGCCCAACAATACAAGA\u003c/div\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cdiv class=\"SimplePara\"\u003eNos2\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cdiv class=\"SimplePara\"\u003ereverse\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cdiv class=\"SimplePara\"\u003eGTGGACGGGTCGATGTCAC\u003c/div\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cdiv class=\"SimplePara\"\u003eCd74\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cdiv class=\"SimplePara\"\u003eforward\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cdiv class=\"SimplePara\"\u003eAGTGCGACGAGAACGGTAAC\u003c/div\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cdiv class=\"SimplePara\"\u003eCd74\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cdiv class=\"SimplePara\"\u003ereverse\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cdiv class=\"SimplePara\"\u003eCGTTGGGGAACACACACCA\u003c/div\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cdiv class=\"SimplePara\"\u003eIl10\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cdiv class=\"SimplePara\"\u003eforward\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cdiv class=\"SimplePara\"\u003eCGGGAAGACAATAACTGCACCC\u003c/div\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cdiv class=\"SimplePara\"\u003eIl10\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cdiv class=\"SimplePara\"\u003ereverse\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cdiv class=\"SimplePara\"\u003eCGGTTAGCAGTATGTTGTCCAGC\u003c/div\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cdiv class=\"SimplePara\"\u003eHas2\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cdiv class=\"SimplePara\"\u003eforward\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cdiv class=\"SimplePara\"\u003eGGTCCAAGTGCCTTACTGAAAC\u003c/div\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cdiv class=\"SimplePara\"\u003eHas2\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cdiv class=\"SimplePara\"\u003ereverse\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cdiv class=\"SimplePara\"\u003eTGTACAGCCACTCTCGGAAGTA\u003c/div\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cdiv class=\"SimplePara\"\u003eLyve1\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cdiv class=\"SimplePara\"\u003eforward\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cdiv class=\"SimplePara\"\u003eACCAGGTAGAGTCAGCGCAGAA\u003c/div\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cdiv class=\"SimplePara\"\u003eLyve1\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cdiv class=\"SimplePara\"\u003ereverse\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cdiv class=\"SimplePara\"\u003eCAGGACACCTTTGCCATTCTTCC\u003c/div\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cdiv class=\"SimplePara\"\u003eCamp\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cdiv class=\"SimplePara\"\u003eforward\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cdiv class=\"SimplePara\"\u003eCAAGGAACAGGGGGTGG\u003c/div\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cdiv class=\"SimplePara\"\u003eCamp\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cdiv class=\"SimplePara\"\u003ereverse\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cdiv class=\"SimplePara\"\u003eTCCGGCTGAGGTACAAGT TT\u003c/div\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cdiv class=\"SimplePara\"\u003eCcl2\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cdiv class=\"SimplePara\"\u003eforward\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cdiv class=\"SimplePara\"\u003eAGGTCCCTGTCATGCTTCTG\u003c/div\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cdiv class=\"SimplePara\"\u003eCcl2\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cdiv class=\"SimplePara\"\u003ereverse\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cdiv class=\"SimplePara\"\u003eTCTGGACCCATTCCTTCTTG\u003c/div\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cdiv class=\"SimplePara\"\u003eZfp423\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cdiv class=\"SimplePara\"\u003eforward\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cdiv class=\"SimplePara\"\u003eCAAGAGGAGAGAAATGAGGACGA\u003c/div\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cdiv class=\"SimplePara\"\u003eZfp423\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cdiv class=\"SimplePara\"\u003ereverse\u003c/div\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cdiv class=\"SimplePara\"\u003eAGTGATCGCAGGTGTAAATTGAC\u003c/div\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003cbr/\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"cellular-and-molecular-immunology","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cmi","sideBox":"Learn more about [Cellular \u0026 Molecular Immunology](http://www.nature.com/cmi/)","snPcode":"41423","submissionUrl":"https://mts-cmi.nature.com/cgi-bin/main.plex","title":"Cellular \u0026 Molecular Immunology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-7559111/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7559111/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eHost defense against invasive bacterial infections of the skin is essential for survival. It involves a complex yet incompletely understood process of microbial recognition followed by innate and adaptive systems for communication between resident and recruited cells to mount an effective defense. Stromal fibroblasts have not been classically considered immunocytes, yet are gaining recognition for their critical roles in inflammation. Here, we identify fibroblast-derived C-C motif chemokine ligand 2 (CCL2) produced by stromal fibroblasts as a key mediator in host defense against invasive \u003cem\u003eStaphylococcus aureus\u003c/em\u003e infection. Single-cell RNA sequencing revealed that fibroblasts predominantly express CCL2 under steady-state conditions in human and mouse tissues. Use of mice with a conditional deletion of CCL2 in fibroblasts demonstrates that the expression of CCL2 by fibroblasts alters macrophage cytokine production and antigen presentation and is important for monocyte recruitment. Additionally, we uncover a novel role for fibroblast-derived CCL2 in promoting fibroblast-to-adipocyte differentiation via ERK and P38 signaling, leading to reactive adipogenesis and enhanced production of the antimicrobial peptide cathelicidin. In mice with targeted deletion of CCL2 in fibroblasts, these host immune responses are impaired and \u003cem\u003eS. aureus\u003c/em\u003e infection of the skin is greatly increased. These findings highlight fibroblast-derived CCL2 as a critical regulator of immunity and suggest its broader implications in inflammatory and infectious diseases.\u003c/p\u003e","manuscriptTitle":"Fibroblast-derived CCL2 orchestrates immune responses and defends against Staphylococcus aureus skin infection","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-01 09:22:34","doi":"10.21203/rs.3.rs-7559111/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2025-12-20T12:02:38+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2025-12-16T07:58:36+00:00","index":3,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2025-12-15T18:34:50+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2025-11-21T22:12:12+00:00","index":3,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2025-11-21T15:37:58+00:00","index":2,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2025-09-26T12:40:50+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2025-09-21T04:57:00+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2025-09-20T14:33:22+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-09-19T06:06:36+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-09-19T03:40:30+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cellular \u0026 Molecular Immunology","date":"2025-09-18T05:18:05+00:00","index":"","fulltext":""},{"type":"checksFailed","content":"","date":"2025-09-08T07:55:54+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"cellular-and-molecular-immunology","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cmi","sideBox":"Learn more about [Cellular \u0026 Molecular Immunology](http://www.nature.com/cmi/)","snPcode":"41423","submissionUrl":"https://mts-cmi.nature.com/cgi-bin/main.plex","title":"Cellular \u0026 Molecular Immunology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"5bb2d7cb-efae-4b1e-846a-0561cff31e78","owner":[],"postedDate":"October 1st, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":55056858,"name":"Biological sciences/Immunology/Innate immunity"},{"id":55056859,"name":"Biological sciences/Immunology/Infectious diseases/Bacterial infection"},{"id":55056860,"name":"Biological sciences/Immunology/Antimicrobial responses"}],"tags":[],"updatedAt":"2026-05-04T14:31:32+00:00","versionOfRecord":[],"versionCreatedAt":"2025-10-01 09:22:34","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7559111","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7559111","identity":"rs-7559111","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}