Fat and Carbohydrate Distribution in Maternal Diet Programs Liver Sirtuin-1 Expression and Fatty acid Profile in Offspring

Fat and Carbohydrate Distribution in Maternal Diet Programs Liver Sirtuin-1 Expression and Fatty acid Profile in Offspring | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Help Center Sign In Submit a Preprint Cite Share Download PDF Research Fat and Carbohydrate Distribution in Maternal Diet Programs Liver Sirtuin-1 Expression and Fatty acid Profile in Offspring Seyedeh Neda Mousavi, Mir Saeed Seyed Dorraji, Sara Gharacheh, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-98844/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: Amount of fat and carbohydrate in maternal diet during gestation and lactation has permanent effects on fetal metabolism. SIRT1 is a nutrient-responsive histone deacetylase that modulates the lipid and glucose metabolism in response to energy stress and extends life span. To study the effects of carbohydrate and fat distribution in a maternal isocaloric diet on fetal gene and protein levels of SIRT1, as well as liver fatty acid profile. Methods: Twenty C57BL/6 female mice were inseminated and randomly received the AIN 93G isocaloric pair-fed LF-HC (16% and 64% of calorie as fat and carbohydrate) or HF-LC (48% and 32% of calorie as fat and carbohydrate) diet during gestation and lactation. After weaning, all offspring received LF-HC diet up to the adolescence. Liver tissue were extracted for final analysis. Results: SIRT1 gene and protein levels were lower in both sexes born from HF-LC-fed mothers than LF-HC-fed one, significant differences were only observed between males in the gene expression (p<0.001) and females in protein level (p<0.001). Saturated fatty acids and cholesterol were increased while unsaturated fatty acids decreased at the liver of male and female offspring born from HF-LC-fed mothers (p<0.001). Conclusions: Maternal dietary fat and carbohydrate distribution, regardless of calorie intake, modify the offspring hepatic fatty acid profile, as well as SIRT1 gene and protein expression which effects on life span. Cardiac & Cardiovascular Systems Endocrinology & Metabolism Fat maternal diet programming hepatic fatty acid profile sirtuni-1 Figures Figure 1 Figure 2 Figure 3 Figure 4 Background Silent mating type information regulation two homolog 1 (SIRT1) is a nuclear metabolic sensor which is mostly conserved in mammals. It is an NAD+-dependent enzyme that regulates epigenetic modifications, as well as gene expression through de-acetylation of histones, transcription factors, and transcription co-factors ( 1 , 2 ). Studies reported that nicotinamide mononucleotide supplementation, as the main coenzyme of SIRT-1 promotes neurovascular rejuvenation; activates SIRT1 at the transcriptional level, protects mitochondria from damage, reduces apoptosis and oxidative stress ( 3 , 4 ). Recent studies reported that SIRT1 regulates carbohydrate and lipid metabolism including gluconeogenesis, fatty acid oxidation, cholesterol efflux, bile acid synthesis, and lipogenesis at the liver ( 5 – 7 ). An increase in SIRT1 activity improves liver insulin sensitivity and decreases energy requirements ( 8 ). Recently, attention to SIRT1, as the role player of metabolism is increasing because it is recruited to the damaged sites and promote DNA repair through de-acetylating the repair proteins such as poly (ADP-ribose) polymerase (PARP)-1, Ku70, NBS, and Werner (WRN) helicase and related to lifespan ( 9 ). Interestingly enough, that maternal diet during gestation and lactation creates persistent alterations in fetal metabolism according to the “developmental origins of health and disease” (DOHaD) hypothesis ( 10 ). Hence, early life nutrition and maternal diet can result in developmental adaptations that produce permanent metabolic, physiologic and phenotypic changes without DNA sequence alterations, which predispose an individual to chronic diseases in the adult life ( 11 ). All of these changes are related to the epigenetic marks ( 12 ). Previous studies have shown that type and amount of maternal dietary oil can change fat and bone tissues gene expression at the next generation in a sex-dependent manner ( 13 , 14 ). Moreover, one non-human primate study reported that maternal high fat-high calorie diet acetylates histone H3 (H3K14ac) in the liver of offspring via SIRT1 pathway followed by abnormal cytoplasmic lipid accumulation and homeostasis which predispose the next generation to fatty liver disease ( 15 ). Studies have shown that calorie restriction is an inducer for SIRT1 gene expression and protein level, which finally lead to more lifespan ( 16 , 17 ). According to our knowledge, all studies focused on the high and restricted calorie diet, and no research was done on the isocaloric diet by considering macronutrients distribution up to now. Also, there is no study to assess this effect in critical periods of life, such as gestation and lactation on the next generation. Therefore, we designed the present study regarding fat and carbohydrate distribution in an isocaloric maternal diet on offspring SIRT1 gene expression and protein level with attention to the profile of fatty acids in the liver. Methods Animal experiments This research conforms to the Institutional and National Guide for the Care and Use of Laboratory Animals. The present study was conducted in accordance with the ARRIVE guidelines and the National Institutes of Health guide for the care and use of Laboratory animals (NIH Publications No. 8023, revised 1978). Twenty female C57BL/6 mice (21 ± 1.5 g) were housed according to the standard protocol for maintenance of laboratory animals (21–23 °C; 50 ± 5 % humidity; and 12 h artificial light cycle). After two weeks of adaptation with AIN 93M diet, female mice were mated overnight. The vaginal plug was confirmed, and mothers were randomly divided to the LF-HC and HF-LC diets, which contain 16% and 48% of calories as fat, respectively. LF-HC diet supplies 64% of calorie as carbohydrate compared with 32% in the HF-LC group. Both diets had 3.97 kcal/g. (Table 1) Mothers received LF-HC and HF-LC diets during gestation and lactation periods in a pair-fed model. The number of offspring was equaled in all cages (n=4), nursed, and lactated with their mothers for three weeks. Mice were separated according to the sex, and all offspring received LF-HC diet up to 6 weeks. In the end, one male and one female offspring were randomly selected and euthanized by ketamine and xylazine. Liver tissues were removed, snap froze and kept at -80 °C for final gene and protein expression, as well as gas chromatography- mass spectroscopy (GC/MS) analysis at six weeks of age. The schematic overview of the study is illustrated at Fig 1. Table 1 Composition of diets (per 1 kg) Ingredients (g/kg) Diets Casein Corn starch Sucrose Soybean oil Fiber Mineral mix Vitamin mix L-cysteine Choline tartrate tert-butyl hydroquinone AIN 93M 140 630 100 40 50 35 10 1.8 2.5 0.008 AIN 93G LF-HC 200 530 100 70 50 35 10 3 2.5 0.014 HF-LC 200 217 100 210 222.5 35 10 3 2.5 0.014 AIN 93M; diet during maintenance, AIN 93G; diet during growth, LF-HC; low fat-high carbohydrate diet, HF-LC; high fat-low carbohydrate diet Ingredients were prepared as follows: L-cysteine (W326305, Sigma Aldrich, Germany), AIN 93 M mineral mix (296040002, MP Biomedicals, USA), AIN 93 vitamin mix (296040201, MP Biomedicals, USA), choline bitartrate (C1629, Sigma Aldrich, Germany), tert-butyl hydroquinone (112941, Sigma Aldrich, Germany). Casein lactate, corn starch, sugar, soybean oil and fiber were prepared from local products SIRT1 gene expression Frozen liver tissues were powdered in liquid nitrogen (N2), and total RNA was extracted using TRIzol Lysis Reagent (QIAGEN Inc., Valencia, CA 91355, USA). After tissue washing by PBS, 300 𝜇l of TRIzol was added to prepare the lysates. Then, chloroform was added, and samples were centrifuged (10000 rpm) for 15 min at 4 °C. To purify the RNA supernatants were collected, isopropanol was added, and samples were stored for 30-60 min at -20 °C. Finally, the samples were centrifuged (10000 rpm) for 15 min at 4 °C. To omit the possible contaminants such as lipids, 700 𝜇l of alcohol (70-80%) was added and centrifuged (7500 rpm) for 10 min at 4 °C. RNA sediments were dissolved in 20 𝜇l of distilled water for 5 min at 45-55 °C. The ND-1000 spectrophotometer (DPI-1, QIAGEN Inc., USA) was used to assess RNA quantity at 260 nm. Quality (integrity) of the extracted RNA was checked by agarose gel electrophoresis. The cDNA was synthesized from one microgram of total RNA using Fermentas protocols (Fermentas Co. USA). ABI StepOne sequence detection system (Applied Biosystems, California, USA) was used for the real-time polymerase chain reaction (RT-PCR) with 10 pmol of the forward and reverse primers for SIRT1 and glyceraldehyde 3-phosphate dehydrogenase (GAPDH, housekeeping gene), 1 μl of the synthesized cDNA and SYBR Green I Master Mix (Roche) in duplicate runs. Both primers were designed by the Primer Express software 2.0.0 as bellows: SIRT1 (Forward: GTGTCATAGGATAGGTGGTG; Reverse TATGAAGAGGTGTTGGTGG) and GAPDH gene (Forward: CTATGTTTGTGATGGGTGTGA; Reverse AGTGGATGCAGGGATGATGT). The copy threshold (Ct) values are calculated and normalized against GAPDH mRNA as an appropriate control (11) . The amplification profile included 40 three-step cycles: 94°C for 20, 58-60 °C for 30 s and 72 °C for 30 s. The results were generated and analyzed using the 2 ^-∆∆Ct method in which was computed as follows: Western blotting Liver tissues were washed by PBS, powdered on ice, and transferred to a micro tube. Then, 200 𝜇l of Rippa buffer, as a protease inhibitor, was added and stored for 90 min at 4 °C. The lysates were centrifuged by a refrigerator centrifuge. 50 mg of protein (from each sample) was added to the same amounts of loading buffer for 5 min at 95 °C. Then, denaturized proteins were loaded on wells, inserted in the western pons and running buffer was added at 90-100 mV for 220-230 min. Proteins were separated by 10% SDS-PAGE (PH=6.8) and transferred to nitrocellulose filter membrane at 80 mV for 70-80 min at 4 °C. After overnight incubation in blocking buffer (skim dried milk), diluted SIRT1 antibodies were diluted by TBS-Tween buffer (1:200), added to the membrane and shaken for 120 min. Samples were washed three times with TBS-Tween buffer and shaken for 10 min in each step. Anti-SIRT1 antibody (1:3000) was added and stored on the shaker for 90 min. Then, samples were washed by TBS-Tween for three times and shaken for 10 min. GAPDH antibody was used as the housekeeping protein. C hemiluminescence detection system and ImageJ software were used for detection of protein bands and analyzing the data, respectively. Gas chromatography-mass spectrometry (GC/MS) Frozen samples were powdered in N 2 , and a mixture of chloroform-methanol (1 mL, 2:1; v/v) was added to the 0.5 g of each sample and shaken for 10 min. The chloroform phase containing the lipids was separated, and the aqueous phase was extracted again, similarly. Then, samples were centrifuged (4500 rpm) for 5 min and supernatants collected for the derivatization step. The 2% H 2 SO 4 -methanol, as a methylation/transesterification solution, was added to the extracted samples and refluxed for 45 min at 80 °C. After neutralization with NaOH (1 M; PH=7), n-hexane was added to each sample, and supernatant was collected for GC/MS analyses. Analyses were performed on a 5977A MS and 7890B GC (Aligent Co., USA) equipped with the split/splitless column as injector system and HP5-MS (60 m × 0.25 m × 0.25 𝜇m) column for fatty acid profile analysis. The oven temperature was kept at 70 ◦C for 5 min, then programmed at 15 °C /min to 150 °C and kept for 2 min. Finally, the system programmed at 20 °C /min to 290 °C and kept for 10 min. Electron impact ionization (EI+, 70 eV) was used for all samples. The split ratio was settled on 1:20. Statistical analysis By considering a power of 80% and α=0.05, sample size was computed according to differences in gene and protein expression of SIRT-1, weight of offspring and lipid profile in the liver through a power analysis using the Mann-Whitney-Wilcoxon test and one-way ANOVA in IBM SPSS statistics software (version 18; IBM Corp). The required sample size was six (for gene and protein expression of SIRT-1), ten (for weight) and five (for lipid profile of liver) offspring in each group to determine the variations. Data were tested for normal distribution using the Kolmogorov-Smirnov test and did not have normal distributions in gene expression even after all of the transformation methods. Then, the differences were measured by the Mann-Whitney-Wilcoxon test. One-way ANOVA was used to compare the lipid profile of liver among the groups. All data are expressed as the means ± SE. The level of significance was set at P <0.05. Results Maternal weight gain during gestation Maternal weight gain was significantly different at week three of gestation. Mothers on the LF-HC diet were significantly heavier than HF-LC-fed one (p < 0.001). Weight gain of mothers had not significant difference at week 1 and 2. The trend of weight gain is shown in Fig. 2 (a). Effect of the isocaloric LF-HC and HF-LC diets on weight of offspring Birth and adolescence weight of offspring born from LF-HC-fed mothers was significantly higher in males than females (1.85 ± 0.1 g vs. 1.42 ± 0.14 g, p < 0.001; and 23.2 ± 1.06 g vs. 19.1 ± 0.7 g, p < 0.001, respectively). Similarly, adolescence weight was significantly higher in the male offspring born from HF-LC-fed mothers than females (24.2 ± 1.6 g vs. 21.8 ± 1.3 g, p = 0.01). But birth weight of male offspring was significantly reduced in the HF-LC-fed mothers compared to females (1 ± 0.14 g vs. 1.45 ± 0.1 g, p < 0.001). Birth weight of male offspring born form LF-HC-fed mothers was significantly higher than HF-LC-fed one (p < 0.001). Moreover, adolescence weight of female offspring was significantly higher in the HF-LC-fed mothers than LF-HC-fed group (p = 0.005). The trend of weight gain is shown at Fig. 2 (b) & (c). Effect of the isocaloric LF-HC and HF-LC diets on SIRT1 gene expression Although there was no significant difference between the female offspring of the two studied groups, SIRT1 gene expression was significantly higher in the liver of male offspring than females at the LF-HC group (p < 0.01). Also, SIRT1 gene expression was significantly reduced in the liver of male offspring born from mothers received HF-LC compared with the LF-HC diet (p < 0.001). (Fig. 3 ) Effect of the isocaloric LF-HC and HF-LC diets on SIRT1 protein level At the offspring born from mothers received LF-HC diet, SIRT1 protein level was significantly higher in the liver of males than females (p < 0.001). Also, SIRT1 protein level was significantly reduced in the liver of female offspring born from mothers received HF-LC than LF-HC diet (p < 0.001). (Fig. 4 ) Effect of the isocaloric LF-HC and HF-LC diets on liver fatty acid profile Meristic (C 14:0 ) and palmitic (C 16:0 ) acid levels were significantly higher in the liver of female offspring born from mothers received HF-LC compared with LF-HC diet group (p < 0.001). Stearic (C 18:0 ), oleic (C 18:1 ), linoleic (C 18:2 ), linolenic (C 18:3 ), dihomo-γ-linolenic acid (C 20:3 ), arachidonic (C 20:4 ) and docosahexaenoic (C 22:6 ) acid were significantly higher in the female offspring of LF-HC than HF-LC diet group (p < 0.001). Fatty acid profile in the liver of male offspring was as the same as females. Moreover, eicosapentaenoic acid (C 20:5 ) was significantly higher in the male offspring of LF-HC diet group (p = 0.001). Palmitic (C 16:0 ) and stearic (C 18:0 ) acid were significantly lower in the liver of male offspring born from HF-LC-fed mothers than females (p = 0.03 and p = 0.01, respectively), but oleic acid (C 18:1 ) was significantly higher in the males than females (p < 0.001). Liver cholesterol level was significantly increased in the male and female offspring born from HF-LC-fed mothers compared with the LF-HC-fed one (p < 0.001, in all cases). Also, cholesterol was significantly higher in the liver of male offspring born from HF-LC-fed mothers than females (p < 0.001). (Table 2 ) Table 2 Amount of liver fatty acids in the studied groups Groups Fatty acids LF-HC Female LF-HC Male HF-LC Female HF-LC Male Meristic acid (C 14:0 ) 0.36 ± 0.04 0.31 ± 0.03 3.5 ± 0.35 3.2 ± 0.2 Palmitic acid (C 16:0 ) 2.83 ± 0.2 2.4 ± 0.1 7.13 ± 0.32 6.44 ± 0.29 Stearic acid (C 18:0 ) 15.38 ± 0.81 19.45 ± 1.4 5.6 ± 1.1 2.5 ± 0.55 Arachidic acid (C 20:0 ) 1.53 ± 0.4 0.35 ± 0.1 0.54 ± 0.08 0.04 ± 0.2 Oleic acid (C 18:1 ) 3.84 ± 0.29 6.7 ± 0.71 0.52 ± 0.07 2.93 ± 0.45 Linoleic acid (C 18:2 ) 2.62 ± 1.64 27.7 ± 1.95 9.4 ± 0.08 10.75 ± 1.32 Linolenic acid (C 18:3 ) 0.43 ± 0.06 0.3 ± 0.04 0.1 ± 0.015 0.06 ± 0.02 Dihomo-γ-linolenic acid (C 20:3 ) 2.83 ± 0.24 1.88 ± 0.28 0.61 ± 0.47 0.06 ± 0.02 Arachidonic acid (C 20:4 ) 13.7 ± 1.36 10.9 ± 0.6 2.94 ± 0.1 2.4 ± 0.5 Eicosapentaenoic acid (C 20:5 ) 1.36 ± 0.56 2.8 ± 0.82 0.22 ± 0.03 0.1 ± 0.04 Docosahexaenoic acid (C 22:6 ) 13.67 ± 2.07 8.97 ± 0.61 2.21 ± 0.3 1.3 ± 0.18 Cholesterol (C 27 H 46 O) 1.13 ± 0.22 2.43 ± 0.44 45.24 ± 1.87 69.5 ± 1.08 Data are expressed as means ± SD No adverse evidence was shown from the experimental protocol during the study. Discussion For the first time, we showed that maternal high fat diet, regardless of calorie intake, during pregnancy and lactation alters fatty acid profile, as well as SIRT1 gene and protein expression in the liver of offspring. Interestingly, female offspring were more susceptible to these changes, compared to the males. Male offspring born from LF-HC-fed mothers were heavier than females, both at the birth and adolescence. Similarly, adolescence weight was significantly higher in the male offspring born from HF-LC-fed mothers than females. However, birth weight of male offspring was significantly reduced in the HF-LC-fed mothers compared to females. SIRT1 gene and protein level were significantly higher in the males than females born from LF-HC-fed mothers compared to the HF-LC-fed group. SIRT1 gene expression was significantly higher in the males at the LF-HC compared with the HF-LC diet group, but these changes were not seen at the protein level. Saturated fatty acids (meristic and palmitic acid) were significantly higher in the liver of male and female offspring born from HF-LC-fed mothers, compared to the LF-HC-fed one. Stearic acid and unsaturated fatty acids level were significantly increased at the liver of male and female offspring of LF-HC than HF-LC group. Liver cholesterol level was significantly higher in males than in females. Studies conducted to the effect of maternal high fat-high calorie diet on SIRT1 are scarce ( 15 , 18 ). Previous studies have shown that SIRT1 expression is reduced in the fetus, especially liver, by maternal obesity, which is related with lower life span ( 19 , 20 ). One animal model study on epileptic rats showed that a ketogenic diet (fat: protein + carbohydrate; 6:1) increases hypothalamic SIRT1 gene expression which was related to brain health ( 21 ). Then, results in this field have inconclusive results, which need more and more precise studies. According to the DOHaD hypothesis, maternal nutrition has permanent effects on fetal epigenome via epigenetic pathways, which increases susceptibility to chronic diseases at the adulthood ( 10 ). All of these changes can be inherited to the next generation, permanently. A recent study reported that maternal diet have significant effect on litter size and survival, pregnancy rate, as well as body weights which is accordance with our results ( 22 ). At the mentioned study maternal western diet reduced offspring survival to 65% compared with the calorie restricted (75%), sucrose (80%) and standard (95%)-fed groups. Moreover, offspring born from western diet-fed mothers were heavier than other groups. Another study compared the effects of long-term high-fat vs. energy-restricted diet on endothelial nitric oxide synthase (eNOS)-Sirtuin-1 axis and Akt/eNOS phosphorylation in the cavernous tissue. Results showed that long-term energy-restriction increase nitric oxide bioavailability. In addition, long- term high fat diet increases SIRT1 deacetylation to levels, which are detrimental for tissues that is related with rapid aging ( 23 ). To elucidate the effects of fat and carbohydrate in an isocaloric diet in the next generation, we focused on SIRT1 as a key regulator of cellular metabolism and life span. It is a nutrient-responsive, NAD + -dependent histone deacetylase that response to energy availability by inducing macronutrient’s catabolic while repressing anabolic pathways, as well as inflammation ( 24 ). At the present study, we showed that high maternal fat compared to high carbohydrate in an isocaloric diet decreases SIRT-1 gene expression and protein level in female and male offspring which increases cholesterol and saturated however decreases omega-3, -6 and-9 fatty acids production in the liver. Fatty acids are important biological components with various vital roles, and the liver is the main and primary organ for their metabolism. The fetus at the critical stage of development needs substantial amounts of fatty acids, especially omega-3 and omega-6 fatty acids, to support rapid cellular growth and activity ( 25 ). The most biologically important omega-3 fatty acids are eicosapentaenoic acid and docosahexaenoic acid, which are metabolic derivatives of α-linolenic acid via desaturase and elongase enzymes activity. But, an increase in dietary omega-6 fatty acids and intake of high-fat diet block this conversion ( 26 ). Di-homo-γ-linolenic acid (DHGLA) and arachidonic acid (AA) are metabolic derivatives of linoleic acid (LA) as the main omega-6 fatty acids ( 22 ). These are precursors of eicosanoids, as signaling molecules, which have important roles in the regulation of inflammation. Intake of high amounts of fat in diet suppresses LA conversion to DHGLA and AA ( 27 ). In general, eicosanoids derived from omega-6 fatty acids are pro-inflammatory while omega-3 derivatives have anti-inflammatory effects. Over the past few decades, the nutritional transition occurred, and there is a notable increase in fat intake, especially sources of omega-6 fatty acids compared to the omega-3 in the world (~ 15 : 1), which are associated with greater metabolism of these fatty acids and more inflammatory diseases ( 26 , 27 ). The main sources of omega-6 fatty acids are safflower, sunflower, soybean, and corn oils ( 27 ). At the present study, we prepared diets by soybean oil, which is conventional and contains more omega-6 compared to omega-3 fatty acids (~ 7:1). Increase in omega-6 fatty acid intake at the HF-LC diet group leads to more saturated fatty acid and cholesterol and lower unsaturated fatty acids (MUFA and PUFA) production in the liver. These disturbances in omega-6/omega-3 fatty acids and finally derivate eicosanoids lead to increase in insulin resistance and susceptibility to chronic diseases in the next generation ( 28 ). Therefore, one of the reasons for SIRT1 suppression and finally aging process may occur because of liver fatty acid disturbances. We resulted that female offspring are more susceptible to metabolic changes than males, which is in agree with the previous studies ( 27 , 28 ). Since female is responsible for generating the next generation and because these changes are permanent, maternal diet during gestation and lactation needs striking attention. Conclusions In summary, even a normal diet after birth could not delete the effects of maternal dietary changes during critical periods of life and these changes permanently transferred to the next generation and effects on life span. Therefore, any education and intervention to decrease the prevalence and incidence of chronic diseases, as well as extending life span had better start from gestation and lactation in mothers. Declarations Ethics approval and consent to participate: The present study was approved by the Ethical Committee of Tehran University of Medical Sciences, Tehran, Iran (protocol number: 34223-161-01-96). Consent for publication: Not applicable. Availability of data and materials: Available. Competing interests: None. Funding: Tehran University of Medical Sciences was financially supported the present study. Authors' contributions: Authorship Conceptualization, S.N.M. and F.K.; Methodology, S. Gh., M.S.S.D., S.N.M: Investigation, S.N.M., M.S.S.D and F.K; Writing – Original Draft, S.N.M. and M.S.S.D.; Writing – Review & Editing, S.N.M., M.S.S.D. and F.K. Acknowledgements: The authors thank the staffs at the animal care laboratory. This study was extracted from the Master student thesis. References Kiss T, Nyúl-Tóth Á, Balasubramanian P, Tarantini S, Ahire C, Yabluchanskiy A, et al. Nicotinamide mononucleotide (NMN) supplementation promotes neurovascular rejuvenation in aged mice: transcriptional footprint of SIRT1 activation, mitochondrial protection, anti-inflammatory, and anti-apoptotic effects. GeroScience . 2020; 1–20. Kiss T, Balasubramanian P, Valcarcel-Ares MN, Tarantini S, Yabluchanskiy A, Csipo T, et al. Nicotinamide mononucleotide (NMN) treatment attenuates oxidative stress and rescues angiogenic capacity in aged cerebromicrovascular endothelial cells: a potential mechanism for the prevention of vascular cognitive impairment. GeroScience. 2019;41:619–30. Dominy JE Jr, Lee Y, Gerhart-Hines Z, Puigserver P. Nutrient-dependent regulation of PGC-1α's acetylation state and metabolic function through the enzymatic activities of Sirt1/GCN5. Biochimica et biophysica acta (BBA)-proteins and proteomics . 2010; 1804: 1676–83. Purushotham A, Xu Q, Lu J, Foley JF, Yan X, Kim D-H, et al. Hepatic deletion of SIRT1 decreases hepatocyte nuclear factor 1α/farnesoid X receptor signaling and induces formation of cholesterol gallstones in mice. Molecular cellular biology. 2012;32:1226–36. Purushotham A, Schug TT, Xu Q, Surapureddi S, Guo X, Li X. Hepatocyte-specific deletion of SIRT1 alters fatty acid metabolism and results in hepatic steatosis and inflammation. Cell Metabol. 2009;9:327–38. Banks AS, Kon N, Knight C, Matsumoto M, Gutiérrez-Juárez R, Rossetti L, et al. SirT1 gain of function increases energy efficiency and prevents diabetes in mice. Cell Metabol. 2008;8:333–41. Oberdoerffer P, Michan S, McVay M, Mostoslavsky R, Vann J, Park S-K, et al. SIRT1 redistribution on chromatin promotes genomic stability but alters gene expression during aging. Cell. 2008;135:907–18. Hales CN, Barker DJ. The thrifty phenotype hypothesis: Type 2 diabetes. British medical bulletin. 2001;60:5–20. Kwon EJ, Kim YJ. What is fetal programming?: a lifetime health is under the control of in utero health. Obstetrics gynecology science. 2017;60:506–19. Vickers MH. Early life nutrition, epigenetics and programming of later life disease. Nutrients. 2014;6:2165–78. Mousavi SN, Koohdani F, Shidfar F, Eslaminejad MB. Comparison of maternal isocaloric high carbohydrate and high fat diets on osteogenic and adipogenic genes expression in adolescent mice offspring. Nutrition metabolism. 2016;13:69. Mousavi SN, Koohdani F, Eslaminejad MB, Izadi P, Eshraghian M, Sayahpour FA, et al. Extra virgin olive oil in maternal diet increases osteogenic genes expression, but high amounts have deleterious effects on bones in mice offspring at adolescence. Iranian journal of basic medical sciences. 2016;19:1299. Suter MA, Chen A, Burdine MS, Choudhury M, Harris RA, Lane RH, et al. A maternal high-fat diet modulates fetal SIRT1 histone and protein deacetylase activity in nonhuman primates. FASEB J. 2012;26:5106–14. Lee JD, Choi M-A, Ro SW, Yang WI, Cho AE, Ju H-L, et al. Synergic chemoprevention with dietary carbohydrate restriction and supplementation of AMPK-activating phytochemicals: the role of SIRT1. Eur J Cancer Prev. 2016;25:54. Chalkiadaki A, Guarente L. High-fat diet triggers inflammation-induced cleavage of SIRT1 in adipose tissue to promote metabolic dysfunction. Cell Metabol. 2012;16:180–8. Gamba CA, Friedman SM, Rodriguez PN, Macri EV, Vacas MI, Lifshitz F. Metabolic status in growing rats fed isocaloric diets with increased carbohydrate-to-fat ratio. Nutrition. 2005;21:249–54. Nguyen LT, Chen H, Zaky A, Pollock C, Saad S. SIRT1 overexpression attenuates offspring metabolic and liver disorders as a result of maternal high-fat feeding. J Physiol. 2019;597:467–80. Chen H, Morris MJ. Differential responses of orexigenic neuropeptides to fasting in offspring of obese mothers. Obesity. 2009;17:1356–62. Elamin M, Ruskin DN, Masino SA, Sacchetti P. Ketogenic diet modulates nad+-dependent enzymes and reduces DNA damage in hippocampus. Frontiers in cellular neuroscience. 2018;12:263. Palliyaguru DL, Rudderow AL, Sossong AM, Lewis KN, Younts C, Pearson KJ, et al. Perinatal diet influences health and survival in a mouse model of leukemia. Geroscience. 2020. doi: 10.1007/s11357-020-00199-9 . Tomada I, Negrão R, Almeida H, Neves D. Long-term high-fat consumption leads to downregulation of Akt phosphorylation of eNOS at Ser1177 and upregulation of Sirtuin-1 expression in rat cavernous tissue. Age. 2014;36:597–611. Gillum MP, Erion DM, Shulman GI. Sirtuin-1 regulation of mammalian metabolism. Trends in molecular medicine. 2011;17:8–13. Haggarty P. Fatty acid supply to the human fetus. Ann Rev Nutr. 2010;30:237–55. Schmitz G, Ecker J. The opposing effects of n – 3 and n – 6 fatty acids. Progress in lipid research. 2008;47:147–55. Patterson E, Wall R, Fitzgerald G, Ross R, Stanton C. Health implications of high dietary omega-6 polyunsaturated fatty acids. Journal of nutrition and metabolism . 2012; 2012. Molendi-Coste O, Legry V, Leclercq IA. Why and how meet n-3 PUFA dietary recommendations? Gastroenterology research and practice . 2011, 2011. Benatti P, Peluso G, Nicolai R, Calvani M. Polyunsaturated fatty acids: biochemical, nutritional and epigenetic properties. J Am Coll Nutr. 2004;23:281–302. Vuppalanchi R, Cummings OW, Saxena R, Ulbright TM, Martis N, Jones DR, et al. Relationship among histologic, radiologic, and biochemical assessments of hepatic steatosis: a study of human liver samples. Journal of clinical gastroenterology. 2007;41:206–10. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-98844","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research","associatedPublications":[],"authors":[{"id":4193150,"identity":"56683e2c-dcaf-4e8d-9957-24caeb6a146c","order_by":0,"name":"Seyedeh Neda Mousavi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA50lEQVRIiWNgGAWjYHACAzjrwAcsgvi1HJxBshZmHmJcZc7evPEDY45N4vz2M4aHbf4cjpZvYH74gaHgHk4tlj3HiiUYt6UlbjiTY3A4h+dw7oYDbMYSDAbFuF11I8cAqOVw4gaGtITDORJALQwMZkDxBNxa7r8x/gHSMr//WcJhC4PDufMb2L/h13KDxwxsS8ON5AOHGRIO5zYc4CFgy5m0MovEbWnGG248PnCw50B67obDPMUSCfi0HD+8+cbHbTay8/sTmz/8+GOdO7+9feOHD39wawEDVGlmDJFRMApGwSgYBaQCAC2FWIbX82saAAAAAElFTkSuQmCC","orcid":"","institution":"Zanjan University of Medical Sciences","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Seyedeh","middleName":"Neda","lastName":"Mousavi","suffix":""},{"id":4193151,"identity":"d79ee362-f58a-40fc-9389-0a0a98bcf737","order_by":1,"name":"Mir Saeed Seyed Dorraji","email":"","orcid":"","institution":"University of Zanjan","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Mir","middleName":"Saeed Seyed","lastName":"Dorraji","suffix":""},{"id":4193152,"identity":"87fcc33e-7407-45b2-8ac6-c5481a890a04","order_by":2,"name":"Sara Gharacheh","email":"","orcid":"","institution":"Tehran University of Medical Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Sara","middleName":"","lastName":"Gharacheh","suffix":""},{"id":4193153,"identity":"63143333-a680-435e-bdae-f1f0398dd750","order_by":3,"name":"Fariba Koohdani","email":"","orcid":"","institution":"Tehran University of Medical Sciences","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Fariba","middleName":"","lastName":"Koohdani","suffix":""}],"badges":[],"createdAt":"2020-10-27 11:38:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-98844/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-98844/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":3361752,"identity":"ccf66ffb-3dfa-455b-a1e5-5e65662ee3d2","added_by":"auto","created_at":"2020-11-03 22:12:10","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":139405,"visible":true,"origin":"","legend":"Schematic overview of the study protocol","description":"","filename":"fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-98844/v1/ec01e6c6cffe453253b4b7f1.png"},{"id":3361753,"identity":"29033f83-c9eb-4eab-80b1-69a6b6430d9f","added_by":"auto","created_at":"2020-11-03 22:12:10","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":51881,"visible":true,"origin":"","legend":"a) Trend of maternal weight gain during gestation; b) Trend of male offspring weight gain from birth up to the adolescence; c) Trend of female offspring weight gain from birth up to the adolescence","description":"","filename":"fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-98844/v1/3a2bcfbd2f1a8210b31e804e.png"},{"id":3361754,"identity":"31245bd0-745a-4da4-bb9b-739a57d5e1ee","added_by":"auto","created_at":"2020-11-03 22:12:10","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":113760,"visible":true,"origin":"","legend":"Normalized SIRT1 gene expression against GAPDH in the liver of studied groups (*p\u003c0.01 and **p\u003c0.001) ","description":"","filename":"fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-98844/v1/678944d3afdfe22ec884ded9.png"},{"id":3361755,"identity":"44b955c1-0b0c-4003-92f6-6b46e35aca86","added_by":"auto","created_at":"2020-11-03 22:12:10","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":174775,"visible":true,"origin":"","legend":"a) Quantitative analysis of SIRT-1 protein normalized against GAPDH in the liver of studied groups (**p\u003c0.001); b) Western-blot analysis of liver tissue lysates from the same groups. GAPDH was used as the housekeeping protein. The grouping of gels/blots cropped from different parts of the same gel","description":"","filename":"fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-98844/v1/fbec0c83fee4c5cba560d7ed.png"},{"id":13609195,"identity":"a52a7a07-a4a4-46a0-91dc-c822c58f2df1","added_by":"auto","created_at":"2021-09-17 06:19:16","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":858743,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-98844/v1/a9ca2e27-dcdd-488c-8f32-29388885217d.pdf"}],"financialInterests":"","formattedTitle":"\u003cp\u003eFat and Carbohydrate Distribution in Maternal Diet Programs Liver Sirtuin-1 Expression and Fatty acid Profile in Offspring\u003c/p\u003e","fulltext":[{"header":"Background","content":" \u003cp\u003eSilent mating type information regulation two homolog 1 (SIRT1) is a nuclear metabolic sensor which is mostly conserved in mammals. It is an NAD+-dependent enzyme that regulates epigenetic modifications, as well as gene expression through de-acetylation of histones, transcription factors, and transcription co-factors (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). Studies reported that nicotinamide mononucleotide supplementation, as the main coenzyme of SIRT-1 promotes neurovascular rejuvenation; activates SIRT1 at the transcriptional level, protects mitochondria from damage, reduces apoptosis and oxidative stress (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). Recent studies reported that SIRT1 regulates carbohydrate and lipid metabolism including gluconeogenesis, fatty acid oxidation, cholesterol efflux, bile acid synthesis, and lipogenesis at the liver (\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). An increase in SIRT1 activity improves liver insulin sensitivity and decreases energy requirements (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Recently, attention to SIRT1, as the role player of metabolism is increasing because it is recruited to the damaged sites and promote DNA repair through de-acetylating the repair proteins such as poly (ADP-ribose) polymerase (PARP)-1, Ku70, NBS, and Werner (WRN) helicase and related to lifespan (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eInterestingly enough, that maternal diet during gestation and lactation creates persistent alterations in fetal metabolism according to the \u0026ldquo;developmental origins of health and disease\u0026rdquo; (DOHaD) hypothesis (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). Hence, early life nutrition and maternal diet can result in developmental adaptations that produce permanent metabolic, physiologic and phenotypic changes without DNA sequence alterations, which predispose an individual to chronic diseases in the adult life (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). All of these changes are related to the epigenetic marks (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). Previous studies have shown that type and amount of maternal dietary oil can change fat and bone tissues gene expression at the next generation in a sex-dependent manner (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). Moreover, one non-human primate study reported that maternal high fat-high calorie diet acetylates histone H3 (H3K14ac) in the liver of offspring via SIRT1 pathway followed by abnormal cytoplasmic lipid accumulation and homeostasis which predispose the next generation to fatty liver disease (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). Studies have shown that calorie restriction is an inducer for SIRT1 gene expression and protein level, which finally lead to more lifespan (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e). According to our knowledge, all studies focused on the high and restricted calorie diet, and no research was done on the isocaloric diet by considering macronutrients distribution up to now. Also, there is no study to assess this effect in critical periods of life, such as gestation and lactation on the next generation. Therefore, we designed the present study regarding fat and carbohydrate distribution in an isocaloric maternal diet on offspring SIRT1 gene expression and protein level with attention to the profile of fatty acids in the liver.\u003c/p\u003e "},{"header":"Methods","content":"\u003ch2\u003eAnimal experiments\u003c/h2\u003e\n\u003cp\u003eThis research conforms to the Institutional and National Guide for the Care and Use of Laboratory Animals. The present study was conducted in accordance with the ARRIVE guidelines and the National Institutes of Health guide for the care and use of Laboratory animals (NIH Publications No. 8023, revised 1978). Twenty female C57BL/6 mice (21\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5\u0026nbsp;g) were housed according to the standard protocol for maintenance of laboratory animals (21\u0026ndash;23\u0026nbsp;\u0026deg;C; 50\u0026thinsp;\u0026plusmn;\u0026thinsp;5\u0026nbsp;% humidity; and 12\u0026nbsp;h artificial light cycle). After two weeks of adaptation with AIN 93M diet, female mice were mated overnight. The vaginal plug was confirmed, and mothers were randomly divided to the LF-HC and HF-LC diets, which contain 16% and 48% of calories as fat, respectively. LF-HC diet supplies 64% of calorie as carbohydrate compared with 32% in the HF-LC group. Both diets had 3.97 kcal/g. (Table 1) Mothers received LF-HC and HF-LC diets during gestation and lactation periods in a pair-fed model. The number of offspring was equaled in all cages (n=4), nursed, and lactated with their mothers for three weeks. Mice were separated according to the sex, and all offspring received LF-HC diet up to 6 weeks. In the end, one male and one female offspring were randomly selected and euthanized by ketamine and xylazine. Liver tissues were removed, snap froze and kept at -80 \u0026deg;C for final gene and protein expression, as well as gas chromatography- mass spectroscopy (GC/MS) analysis at six\u0026nbsp;weeks of age. The schematic overview of the study is illustrated at Fig 1.\u003c/p\u003e\n\u003cp class=\"gridtable\"\u003e\u0026nbsp;\u003c/p\u003e\n\u003ctable id=\"Tab1\" style=\"width: 829px;\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eComposition of diets (per 1 kg)\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 125px;\" colspan=\"2\"\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp;\u0026nbsp; Ingredients (g/kg) \u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDiets\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 56px;\"\u003e\n\u003cp\u003e\u003cstrong\u003eCasein\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 50px;\"\u003e\n\u003cp\u003e\u003cstrong\u003eCorn starch\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 59px;\"\u003e\n\u003cp\u003e\u003cstrong\u003eSucrose\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 66px;\"\u003e\n\u003cp\u003e\u003cstrong\u003eSoybean oil\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 47px;\"\u003e\n\u003cp\u003e\u003cstrong\u003eFiber\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 60px;\"\u003e\n\u003cp\u003e\u003cstrong\u003eMineral mix\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 65px;\"\u003e\n\u003cp\u003e\u003cstrong\u003eVitamin mix\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 74px;\"\u003e\n\u003cp\u003e\u003cstrong\u003eL-cysteine\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 59px;\"\u003e\n\u003cp\u003e\u003cstrong\u003eCholine tartrate\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 94px;\"\u003e\n\u003cp\u003e\u003cstrong\u003etert-butyl hydroquinone\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 125px;\" colspan=\"2\"\u003e\n\u003cp\u003e\u003cstrong\u003eAIN 93M\u003c/strong\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 56px;\"\u003e\n\u003cp\u003e140\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 50px;\"\u003e\n\u003cp\u003e630\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 59px;\"\u003e\n\u003cp\u003e100\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 66px;\"\u003e\n\u003cp\u003e40\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 47px;\"\u003e\n\u003cp\u003e50\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 60px;\"\u003e\n\u003cp\u003e35\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 65px;\"\u003e\n\u003cp\u003e10\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 74px;\"\u003e\n\u003cp\u003e1.8\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 59px;\"\u003e\n\u003cp\u003e2.5\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 94px;\"\u003e\n\u003cp\u003e0.008\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 71px;\" rowspan=\"2\"\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAIN 93G\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 54px;\"\u003e\n\u003cp\u003eLF-HC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 56px;\"\u003e\n\u003cp\u003e200\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 50px;\"\u003e\n\u003cp\u003e530\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 59px;\"\u003e\n\u003cp\u003e100\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 66px;\"\u003e\n\u003cp\u003e70\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 47px;\"\u003e\n\u003cp\u003e50\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 60px;\"\u003e\n\u003cp\u003e35\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 65px;\"\u003e\n\u003cp\u003e10\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 74px;\"\u003e\n\u003cp\u003e3\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 59px;\"\u003e\n\u003cp\u003e2.5\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 94px;\"\u003e\n\u003cp\u003e0.014\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 54px;\"\u003e\n\u003cp\u003eHF-LC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 56px;\"\u003e\n\u003cp\u003e200\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 50px;\"\u003e\n\u003cp\u003e217\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 59px;\"\u003e\n\u003cp\u003e100\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 66px;\"\u003e\n\u003cp\u003e210\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 47px;\"\u003e\n\u003cp\u003e222.5\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 60px;\"\u003e\n\u003cp\u003e35\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 65px;\"\u003e\n\u003cp\u003e10\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 74px;\"\u003e\n\u003cp\u003e3\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 59px;\"\u003e\n\u003cp\u003e2.5\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd style=\"width: 94px;\"\u003e\n\u003cp\u003e0.014\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd style=\"width: 755px;\" colspan=\"12\"\u003e\n\u003cp\u003e\u003csub\u003eAIN 93M; diet during maintenance, AIN 93G; diet during growth, LF-HC; low fat-high carbohydrate diet, HF-LC; high fat-low carbohydrate diet\u003c/sub\u003e\u003csub\u003eIngredients were prepared as follows: L-cysteine (W326305, Sigma Aldrich, Germany), AIN 93\u0026nbsp;M mineral mix (296040002, MP Biomedicals, USA), AIN 93 vitamin mix (296040201, MP Biomedicals, USA), choline bitartrate (C1629, Sigma Aldrich, Germany), tert-butyl hydroquinone (112941, Sigma Aldrich, Germany). Casein lactate, corn starch, sugar, soybean oil and fiber were prepared from local products\u003c/sub\u003e\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003eSIRT1 gene expression\u003c/h2\u003e\n\u003cp\u003eFrozen liver tissues were powdered in liquid nitrogen (N2), and total RNA was extracted using TRIzol Lysis Reagent (QIAGEN Inc., Valencia, CA 91355, USA). After tissue washing by PBS, 300 𝜇l of TRIzol was added to prepare the lysates. Then, chloroform was added, and samples were centrifuged (10000 rpm) for 15 min at 4 \u0026deg;C. To purify the RNA supernatants were collected, isopropanol was added, and samples were stored for 30-60 min at -20 \u0026deg;C. Finally, the samples were centrifuged (10000 rpm) for 15 min at 4 \u0026deg;C. To omit the possible contaminants such as lipids, 700 𝜇l of alcohol (70-80%) was added and centrifuged (7500 rpm) for 10 min at 4 \u0026deg;C. RNA sediments were dissolved in 20 𝜇l of distilled water for 5 min at 45-55 \u0026deg;C. The ND-1000 spectrophotometer (DPI-1, QIAGEN Inc., USA) was used to assess RNA quantity at 260 nm. Quality (integrity) of the extracted RNA was checked by agarose gel electrophoresis. The cDNA was synthesized from one microgram of total RNA using Fermentas protocols (Fermentas Co. USA).\u003c/p\u003e\n\u003cp\u003eABI StepOne sequence detection system (Applied Biosystems, California, USA) was used for the real-time polymerase chain reaction (RT-PCR) with 10 pmol of the forward and reverse primers for SIRT1 and glyceraldehyde 3-phosphate dehydrogenase (GAPDH, housekeeping gene), 1 \u0026mu;l of the synthesized cDNA and SYBR Green I Master Mix (Roche) in duplicate runs. Both primers were designed by the Primer Express software 2.0.0 as bellows: SIRT1 (Forward: GTGTCATAGGATAGGTGGTG; Reverse TATGAAGAGGTGTTGGTGG) and GAPDH gene (Forward: CTATGTTTGTGATGGGTGTGA; Reverse AGTGGATGCAGGGATGATGT).\u003c/p\u003e\n\u003cp\u003eThe copy threshold (Ct) values are calculated and normalized against GAPDH mRNA as an appropriate control \u003cem\u003e(11)\u003c/em\u003e. The amplification profile included 40 three-step cycles: 94\u0026deg;C for 20, 58-60 \u0026deg;C for 30 s and 72 \u0026deg;C for 30 s. The results were generated and analyzed using the 2\u003csup\u003e^-∆∆Ct \u003c/sup\u003emethod in which \u0026nbsp;was computed as follows:\u003c/p\u003e\n\u003cp\u003e\u003cimg src=\"https://myfiles.space/user_files/58895_8739fc6c57c1c19a/58895_custom_files/img1604388962.png\" alt=\"\" /\u003e\u003c/p\u003e\n\u003ch2\u003eWestern blotting\u003c/h2\u003e\n\u003cp\u003eLiver tissues were washed by PBS, powdered on ice, and transferred to a micro tube. Then, 200 𝜇l of Rippa buffer, as a protease inhibitor, was added and stored for 90 min at 4 \u0026deg;C. The lysates were centrifuged by a refrigerator centrifuge. 50 mg of protein (from each sample) was added to the same amounts of loading buffer for 5 min at 95 \u0026deg;C. Then, denaturized proteins were loaded on wells, inserted in the western pons and running buffer was added at 90-100 mV for 220-230 min. Proteins were separated by 10% SDS-PAGE (PH=6.8) and transferred to\u0026nbsp;\u003ca href=\"https://www.sciencedirect.com/topics/medicine-and-dentistry/nitrocellulose\"\u003enitrocellulose\u003c/a\u003e\u0026nbsp;filter membrane at 80\u0026nbsp;mV for 70-80\u0026nbsp;min at 4\u0026nbsp;\u0026deg;C. After overnight incubation in blocking buffer (skim dried milk), diluted SIRT1 antibodies were diluted by TBS-Tween buffer (1:200), added to the membrane and shaken for 120 min. Samples were washed three times with TBS-Tween buffer and shaken for 10 min in each step. Anti-SIRT1 antibody (1:3000) was added and stored on the shaker for 90 min. Then, samples were washed by TBS-Tween for three times and shaken for 10 min. GAPDH antibody was used as the housekeeping protein. C\u003ca href=\"https://www.sciencedirect.com/topics/biochemistry-genetics-and-molecular-biology/chemoluminescence\"\u003ehemiluminescence\u003c/a\u003e\u0026nbsp;detection system and\u0026nbsp;ImageJ\u0026nbsp;software were used for detection of protein bands and analyzing the data, respectively.\u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003eGas chromatography-mass spectrometry (GC/MS)\u003c/h2\u003e\n\u003cp\u003eFrozen samples were powdered in N\u003csub\u003e2\u003c/sub\u003e, and a mixture of chloroform-methanol (1 mL, 2:1; v/v) was added to the 0.5 g of each sample and shaken for 10 min. The chloroform phase containing the lipids was separated, and the aqueous phase was extracted again, similarly. Then, samples were centrifuged (4500 rpm) for 5 min and supernatants collected for the derivatization step. The 2% H\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e-methanol, as a methylation/transesterification solution, was added to the extracted samples and refluxed for 45 min at 80 \u0026deg;C. After neutralization with NaOH (1 M; PH=7), n-hexane was added to each sample, and supernatant was collected for GC/MS analyses.\u003c/p\u003e\n\u003cp\u003eAnalyses were performed on a 5977A MS and 7890B GC (Aligent Co., USA) equipped with the split/splitless column as injector system and HP5-MS (60 m \u0026times; 0.25 m \u0026times; 0.25 𝜇m) column for fatty acid profile analysis. The oven temperature was kept at 70 ◦C for 5 min, then programmed at 15 \u0026deg;C /min to 150 \u0026deg;C and kept for 2 min. Finally, the system programmed at 20 \u0026deg;C /min to 290 \u0026deg;C and kept for 10 min. Electron impact ionization (EI+, 70 eV) was used for all samples. The split ratio was settled on 1:20.\u003c/p\u003e\n\u003ch2\u003eStatistical analysis\u003c/h2\u003e\n\u003cp\u003eBy considering a power of 80% and \u0026alpha;=0.05, sample size was computed according to differences in gene and protein expression of SIRT-1, weight of offspring and lipid profile in the liver through a power analysis using the Mann-Whitney-Wilcoxon test and one-way ANOVA in IBM SPSS statistics software (version 18; IBM Corp). The required sample size was six (for gene and protein expression of SIRT-1), ten (for weight) and five (for lipid profile of liver) offspring in each group to determine the variations. Data were tested for normal distribution using the Kolmogorov-Smirnov test and did not have normal distributions in gene expression even after all of the transformation methods. Then, the differences were measured by the Mann-Whitney-Wilcoxon test. One-way ANOVA was used to compare the lipid profile of liver among the groups. All data are expressed as the means \u0026plusmn; SE. The level of significance was set at\u0026nbsp;\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\n\u003ch2\u003eMaternal weight gain during gestation\u003c/h2\u003e\n\u003cp\u003eMaternal weight gain was significantly different at week three of gestation. Mothers on the LF-HC diet were significantly heavier than HF-LC-fed one (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Weight gain of mothers had not significant difference at week 1 and 2. The trend of weight gain is shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e (a).\u003c/p\u003e\n\u003ch2\u003eEffect of the isocaloric LF-HC and HF-LC diets on weight of offspring\u003c/h2\u003e\n\u003cp\u003eBirth and adolescence weight of offspring born from LF-HC-fed mothers was significantly higher in males than females (1.85\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1\u0026nbsp;g \u003cem\u003evs.\u003c/em\u003e 1.42\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14\u0026nbsp;g, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; and 23.2\u0026thinsp;\u0026plusmn;\u0026thinsp;1.06\u0026nbsp;g \u003cem\u003evs.\u003c/em\u003e 19.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.7\u0026nbsp;g, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, respectively). Similarly, adolescence weight was significantly higher in the male offspring born from HF-LC-fed mothers than females (24.2\u0026thinsp;\u0026plusmn;\u0026thinsp;1.6\u0026nbsp;g \u003cem\u003evs.\u003c/em\u003e 21.8\u0026thinsp;\u0026plusmn;\u0026thinsp;1.3\u0026nbsp;g, p\u0026thinsp;=\u0026thinsp;0.01). But birth weight of male offspring was significantly reduced in the HF-LC-fed mothers compared to females (1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.14\u0026nbsp;g \u003cem\u003evs.\u003c/em\u003e 1.45\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1\u0026nbsp;g, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Birth weight of male offspring born form LF-HC-fed mothers was significantly higher than HF-LC-fed one (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Moreover, adolescence weight of female offspring was significantly higher in the HF-LC-fed mothers than LF-HC-fed group (p\u0026thinsp;=\u0026thinsp;0.005). The trend of weight gain is shown at Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e (b) \u0026amp; (c).\u003c/p\u003e\n\u003ch2\u003eEffect of the isocaloric LF-HC and HF-LC diets on SIRT1 gene expression\u003c/h2\u003e\n\u003cp\u003eAlthough there was no significant difference between the female offspring of the two studied groups, SIRT1 gene expression was significantly higher in the liver of male offspring than females at the LF-HC group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Also, SIRT1 gene expression was significantly reduced in the liver of male offspring born from mothers received HF-LC compared with the LF-HC diet (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e)\u003c/p\u003e\n\u003ch2\u003eEffect of the isocaloric LF-HC and HF-LC diets on SIRT1 protein level\u003c/h2\u003e\n\u003cp\u003eAt the offspring born from mothers received LF-HC diet, SIRT1 protein level was significantly higher in the liver of males than females (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Also, SIRT1 protein level was significantly reduced in the liver of female offspring born from mothers received HF-LC than LF-HC diet (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e)\u003c/p\u003e\n\u003ch2\u003eEffect of the isocaloric LF-HC and HF-LC diets on liver fatty acid profile\u003c/h2\u003e\n\u003cp\u003eMeristic (C\u003csub\u003e14:0\u003c/sub\u003e) and palmitic (C\u003csub\u003e16:0\u003c/sub\u003e) acid levels were significantly higher in the liver of female offspring born from mothers received HF-LC compared with LF-HC diet group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Stearic (C\u003csub\u003e18:0\u003c/sub\u003e), oleic (C\u003csub\u003e18:1\u003c/sub\u003e), linoleic (C\u003csub\u003e18:2\u003c/sub\u003e), linolenic (C\u003csub\u003e18:3\u003c/sub\u003e), dihomo-\u0026gamma;-linolenic acid (C\u003csub\u003e20:3\u003c/sub\u003e), arachidonic (C\u003csub\u003e20:4\u003c/sub\u003e) and docosahexaenoic (C\u003csub\u003e22:6\u003c/sub\u003e) acid were significantly higher in the female offspring of LF-HC than HF-LC diet group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Fatty acid profile in the liver of male offspring was as the same as females. Moreover, eicosapentaenoic acid (C\u003csub\u003e20:5\u003c/sub\u003e) was significantly higher in the male offspring of LF-HC diet group (p\u0026thinsp;=\u0026thinsp;0.001). Palmitic (C\u003csub\u003e16:0\u003c/sub\u003e) and stearic (C\u003csub\u003e18:0\u003c/sub\u003e) acid were significantly lower in the liver of male offspring born from HF-LC-fed mothers than females (p\u0026thinsp;=\u0026thinsp;0.03 and p\u0026thinsp;=\u0026thinsp;0.01, respectively), but oleic acid (C\u003csub\u003e18:1\u003c/sub\u003e) was significantly higher in the males than females (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Liver cholesterol level was significantly increased in the male and female offspring born from HF-LC-fed mothers compared with the LF-HC-fed one (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, in all cases). Also, cholesterol was significantly higher in the liver of male offspring born from HF-LC-fed mothers than females (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001). (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e)\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tab2\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eAmount of liver fatty acids in the studied groups\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eGroups\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFatty acids\u003c/strong\u003e\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eLF-HC\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFemale\u003c/strong\u003e\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eLF-HC\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMale\u003c/strong\u003e\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eHF-LC\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFemale\u003c/strong\u003e\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003e\u003cstrong\u003eHF-LC\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMale\u003c/strong\u003e\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eMeristic acid (C\u003csub\u003e14:0\u003c/sub\u003e)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e0.36\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e0.31\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e3.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.35\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e3.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePalmitic acid (C\u003csub\u003e16:0\u003c/sub\u003e)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e2.83\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e2.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e7.13\u0026thinsp;\u0026plusmn;\u0026thinsp;0.32\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e6.44\u0026thinsp;\u0026plusmn;\u0026thinsp;0.29\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eStearic acid (C\u003csub\u003e18:0\u003c/sub\u003e)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e15.38\u0026thinsp;\u0026plusmn;\u0026thinsp;0.81\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e19.45\u0026thinsp;\u0026plusmn;\u0026thinsp;1.4\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e5.6\u0026thinsp;\u0026plusmn;\u0026thinsp;1.1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e2.5\u0026thinsp;\u0026plusmn;\u0026thinsp;0.55\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eArachidic acid (C\u003csub\u003e20:0\u003c/sub\u003e)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e1.53\u0026thinsp;\u0026plusmn;\u0026thinsp;0.4\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e0.35\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e0.54\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e0.04\u0026thinsp;\u0026plusmn;\u0026thinsp;0.2\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eOleic acid (C\u003csub\u003e18:1\u003c/sub\u003e)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e3.84\u0026thinsp;\u0026plusmn;\u0026thinsp;0.29\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e6.7\u0026thinsp;\u0026plusmn;\u0026thinsp;0.71\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e0.52\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e2.93\u0026thinsp;\u0026plusmn;\u0026thinsp;0.45\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eLinoleic acid (C\u003csub\u003e18:2\u003c/sub\u003e)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e2.62\u0026thinsp;\u0026plusmn;\u0026thinsp;1.64\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e27.7\u0026thinsp;\u0026plusmn;\u0026thinsp;1.95\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e9.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e10.75\u0026thinsp;\u0026plusmn;\u0026thinsp;1.32\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eLinolenic acid (C\u003csub\u003e18:3\u003c/sub\u003e)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e0.43\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e0.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e0.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.015\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e0.06\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eDihomo-\u0026gamma;-linolenic acid (C\u003csub\u003e20:3\u003c/sub\u003e)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e2.83\u0026thinsp;\u0026plusmn;\u0026thinsp;0.24\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e1.88\u0026thinsp;\u0026plusmn;\u0026thinsp;0.28\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e0.61\u0026thinsp;\u0026plusmn;\u0026thinsp;0.47\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e0.06\u0026thinsp;\u0026plusmn;\u0026thinsp;0.02\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eArachidonic acid (C\u003csub\u003e20:4\u003c/sub\u003e)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e13.7\u0026thinsp;\u0026plusmn;\u0026thinsp;1.36\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e10.9\u0026thinsp;\u0026plusmn;\u0026thinsp;0.6\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e2.94\u0026thinsp;\u0026plusmn;\u0026thinsp;0.1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e2.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.5\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eEicosapentaenoic acid (C\u003csub\u003e20:5\u003c/sub\u003e)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e1.36\u0026thinsp;\u0026plusmn;\u0026thinsp;0.56\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e2.8\u0026thinsp;\u0026plusmn;\u0026thinsp;0.82\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e0.22\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e0.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.04\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eDocosahexaenoic acid (C\u003csub\u003e22:6\u003c/sub\u003e)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e13.67\u0026thinsp;\u0026plusmn;\u0026thinsp;2.07\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e8.97\u0026thinsp;\u0026plusmn;\u0026thinsp;0.61\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e2.21\u0026thinsp;\u0026plusmn;\u0026thinsp;0.3\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e1.3\u0026thinsp;\u0026plusmn;\u0026thinsp;0.18\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eCholesterol (C\u003csub\u003e27\u003c/sub\u003eH\u003csub\u003e46\u003c/sub\u003eO)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e1.13\u0026thinsp;\u0026plusmn;\u0026thinsp;0.22\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e2.43\u0026thinsp;\u0026plusmn;\u0026thinsp;0.44\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e45.24\u0026thinsp;\u0026plusmn;\u0026thinsp;1.87\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\"\u0026plusmn;\"\u003e\n\u003cp\u003e69.5\u0026thinsp;\u0026plusmn;\u0026thinsp;1.08\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003ctfoot\u003e\n\u003ctr\u003e\n\u003ctd colspan=\"5\"\u003e\n\u003cp\u003eData are expressed as means\u0026thinsp;\u0026plusmn;\u0026thinsp;SD\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tfoot\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eNo adverse evidence was shown from the experimental protocol during the study.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":" \u003cp\u003eFor the first time, we showed that maternal high fat diet, regardless of calorie intake, during pregnancy and lactation alters fatty acid profile, as well as SIRT1 gene and protein expression in the liver of offspring. Interestingly, female offspring were more susceptible to these changes, compared to the males. Male offspring born from LF-HC-fed mothers were heavier than females, both at the birth and adolescence. Similarly, adolescence weight was significantly higher in the male offspring born from HF-LC-fed mothers than females. However, birth weight of male offspring was significantly reduced in the HF-LC-fed mothers compared to females. SIRT1 gene and protein level were significantly higher in the males than females born from LF-HC-fed mothers compared to the HF-LC-fed group. SIRT1 gene expression was significantly higher in the males at the LF-HC compared with the HF-LC diet group, but these changes were not seen at the protein level. Saturated fatty acids (meristic and palmitic acid) were significantly higher in the liver of male and female offspring born from HF-LC-fed mothers, compared to the LF-HC-fed one. Stearic acid and unsaturated fatty acids level were significantly increased at the liver of male and female offspring of LF-HC than HF-LC group. Liver cholesterol level was significantly higher in males than in females.\u003c/p\u003e \u003cp\u003eStudies conducted to the effect of maternal high fat-high calorie diet on SIRT1 are scarce (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e). Previous studies have shown that SIRT1 expression is reduced in the fetus, especially liver, by maternal obesity, which is related with lower life span (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). One animal model study on epileptic rats showed that a ketogenic diet (fat: protein\u0026thinsp;+\u0026thinsp;carbohydrate; 6:1) increases hypothalamic SIRT1 gene expression which was related to brain health (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). Then, results in this field have inconclusive results, which need more and more precise studies.\u003c/p\u003e \u003cp\u003eAccording to the DOHaD hypothesis, maternal nutrition has permanent effects on fetal epigenome via epigenetic pathways, which increases susceptibility to chronic diseases at the adulthood (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). All of these changes can be inherited to the next generation, permanently. A recent study reported that maternal diet have significant effect on litter size and survival, pregnancy rate, as well as body weights which is accordance with our results (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e). At the mentioned study maternal western diet reduced offspring survival to 65% compared with the calorie restricted (75%), sucrose (80%) and standard (95%)-fed groups. Moreover, offspring born from western diet-fed mothers were heavier than other groups. Another study compared the effects of long-term high-fat vs. energy-restricted diet on endothelial nitric oxide synthase (eNOS)-Sirtuin-1 axis and Akt/eNOS phosphorylation in the cavernous tissue. Results showed that long-term energy-restriction increase nitric oxide bioavailability. In addition, long- term high fat diet increases SIRT1 deacetylation to levels, which are detrimental for tissues that is related with rapid aging (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTo elucidate the effects of fat and carbohydrate in an isocaloric diet in the next generation, we focused on SIRT1 as a key regulator of cellular metabolism and life span. It is a nutrient-responsive, NAD\u003csup\u003e+\u003c/sup\u003e-dependent histone deacetylase that response to energy availability by inducing macronutrient\u0026rsquo;s catabolic while repressing anabolic pathways, as well as inflammation (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). At the present study, we showed that high maternal fat compared to high carbohydrate in an isocaloric diet decreases SIRT-1 gene expression and protein level in female and male offspring which increases cholesterol and saturated however decreases omega-3, -6 and-9 fatty acids production in the liver. Fatty acids are important biological components with various vital roles, and the liver is the main and primary organ for their metabolism. The fetus at the critical stage of development needs substantial amounts of fatty acids, especially omega-3 and omega-6 fatty acids, to support rapid cellular growth and activity (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e). The most biologically important omega-3 fatty acids are eicosapentaenoic acid and docosahexaenoic acid, which are metabolic derivatives of α-linolenic acid via desaturase and elongase enzymes activity. But, an increase in dietary omega-6 fatty acids and intake of high-fat diet block this conversion (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). Di-homo-γ-linolenic acid (DHGLA) and arachidonic acid (AA) are metabolic derivatives of linoleic acid (LA) as the main omega-6 fatty acids (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e). These are precursors of eicosanoids, as signaling molecules, which have important roles in the regulation of inflammation. Intake of high amounts of fat in diet suppresses LA conversion to DHGLA and AA (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e). In general, eicosanoids derived from omega-6 fatty acids are pro-inflammatory while omega-3 derivatives have anti-inflammatory effects. Over the past few decades, the nutritional transition occurred, and there is a notable increase in fat intake, especially sources of omega-6 fatty acids compared to the omega-3 in the world (~\u0026thinsp;15 : 1), which are associated with greater metabolism of these fatty acids and more inflammatory diseases (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e). The main sources of omega-6 fatty acids are safflower, sunflower, soybean, and corn oils (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e). At the present study, we prepared diets by soybean oil, which is conventional and contains more omega-6 compared to omega-3 fatty acids (~\u0026thinsp;7:1). Increase in omega-6 fatty acid intake at the HF-LC diet group leads to more saturated fatty acid and cholesterol and lower unsaturated fatty acids (MUFA and PUFA) production in the liver. These disturbances in omega-6/omega-3 fatty acids and finally derivate eicosanoids lead to increase in insulin resistance and susceptibility to chronic diseases in the next generation (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e). Therefore, one of the reasons for SIRT1 suppression and finally aging process may occur because of liver fatty acid disturbances. We resulted that female offspring are more susceptible to metabolic changes than males, which is in agree with the previous studies (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e). Since female is responsible for generating the next generation and because these changes are permanent, maternal diet during gestation and lactation needs striking attention.\u003c/p\u003e "},{"header":"Conclusions","content":" \u003cp\u003eIn summary, even a normal diet after birth could not delete the effects of maternal dietary changes during critical periods of life and these changes permanently transferred to the next generation and effects on life span. Therefore, any education and intervention to decrease the prevalence and incidence of chronic diseases, as well as extending life span had better start from gestation and lactation in mothers.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eEthics approval and consent to participate:\u003c/h2\u003e\n\u003cp\u003eThe present study was approved by the Ethical Committee of Tehran University of Medical Sciences, Tehran, Iran (protocol number: 34223-161-01-96). \u0026nbsp;\u003c/p\u003e\n\u003ch2\u003eConsent for publication:\u003c/h2\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003ch2\u003eAvailability of data and materials:\u003c/h2\u003e\n\u003cp\u003eAvailable.\u003c/p\u003e\n\u003ch2\u003eCompeting interests:\u003c/h2\u003e\n\u003cp\u003eNone.\u003c/p\u003e\n\u003ch2\u003eFunding:\u003c/h2\u003e\n\u003cp\u003eTehran University of Medical Sciences was financially supported the present study.\u003c/p\u003e\n\u003ch2\u003eAuthors' contributions:\u003c/h2\u003e\n\u003cp\u003eAuthorship\u003c/p\u003e\n\u003cp\u003eConceptualization, S.N.M. and F.K.; Methodology, S. Gh., M.S.S.D., S.N.M: Investigation, S.N.M., M.S.S.D and F.K; Writing \u0026ndash; Original Draft, S.N.M. and M.S.S.D.; Writing \u0026ndash; Review \u0026amp; Editing, S.N.M., M.S.S.D. and F.K.\u003c/p\u003e\n\u003ch2\u003eAcknowledgements:\u003c/h2\u003e\n\u003cp\u003eThe authors thank the staffs at the animal care laboratory. This study was extracted from the Master student thesis.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eKiss T, Ny\u0026uacute;l-T\u0026oacute;th \u0026Aacute;, Balasubramanian P, Tarantini S, Ahire C, Yabluchanskiy A, et al. Nicotinamide mononucleotide (NMN) supplementation promotes neurovascular rejuvenation in aged mice: transcriptional footprint of SIRT1 activation, mitochondrial protection, anti-inflammatory, and anti-apoptotic effects. \u003cem\u003eGeroScience\u003c/em\u003e. 2020; 1\u0026ndash;20.\u003c/li\u003e\n\u003cli\u003eKiss T, Balasubramanian P, Valcarcel-Ares MN, Tarantini S, Yabluchanskiy A, Csipo T, et al. Nicotinamide mononucleotide (NMN) treatment attenuates oxidative stress and rescues angiogenic capacity in aged cerebromicrovascular endothelial cells: a potential mechanism for the prevention of vascular cognitive impairment. GeroScience. 2019;41:619\u0026ndash;30.\u003c/li\u003e\n\u003cli\u003eDominy JE Jr, Lee Y, Gerhart-Hines Z, Puigserver P. Nutrient-dependent regulation of PGC-1\u0026alpha;'s acetylation state and metabolic function through the enzymatic activities of Sirt1/GCN5. \u003cem\u003eBiochimica et biophysica acta (BBA)-proteins and proteomics\u003c/em\u003e. 2010; 1804: 1676\u0026ndash;83.\u003c/li\u003e\n\u003cli\u003ePurushotham A, Xu Q, Lu J, Foley JF, Yan X, Kim D-H, et al. Hepatic deletion of SIRT1 decreases hepatocyte nuclear factor 1\u0026alpha;/farnesoid X receptor signaling and induces formation of cholesterol gallstones in mice. Molecular cellular biology. 2012;32:1226\u0026ndash;36.\u003c/li\u003e\n\u003cli\u003ePurushotham A, Schug TT, Xu Q, Surapureddi S, Guo X, Li X. Hepatocyte-specific deletion of SIRT1 alters fatty acid metabolism and results in hepatic steatosis and inflammation. Cell Metabol. 2009;9:327\u0026ndash;38.\u003c/li\u003e\n\u003cli\u003eBanks AS, Kon N, Knight C, Matsumoto M, Guti\u0026eacute;rrez-Ju\u0026aacute;rez R, Rossetti L, et al. SirT1 gain of function increases energy efficiency and prevents diabetes in mice. Cell Metabol. 2008;8:333\u0026ndash;41.\u003c/li\u003e\n\u003cli\u003eOberdoerffer P, Michan S, McVay M, Mostoslavsky R, Vann J, Park S-K, et al. SIRT1 redistribution on chromatin promotes genomic stability but alters gene expression during aging. Cell. 2008;135:907\u0026ndash;18.\u003c/li\u003e\n\u003cli\u003eHales CN, Barker DJ. The thrifty phenotype hypothesis: Type 2 diabetes. British medical bulletin. 2001;60:5\u0026ndash;20.\u003c/li\u003e\n\u003cli\u003eKwon EJ, Kim YJ. What is fetal programming?: a lifetime health is under the control of in utero health. Obstetrics gynecology science. 2017;60:506\u0026ndash;19.\u003c/li\u003e\n\u003cli\u003eVickers MH. Early life nutrition, epigenetics and programming of later life disease. Nutrients. 2014;6:2165\u0026ndash;78.\u003c/li\u003e\n\u003cli\u003eMousavi SN, Koohdani F, Shidfar F, Eslaminejad MB. Comparison of maternal isocaloric high carbohydrate and high fat diets on osteogenic and adipogenic genes expression in adolescent mice offspring. Nutrition metabolism. 2016;13:69.\u003c/li\u003e\n\u003cli\u003eMousavi SN, Koohdani F, Eslaminejad MB, Izadi P, Eshraghian M, Sayahpour FA, et al. Extra virgin olive oil in maternal diet increases osteogenic genes expression, but high amounts have deleterious effects on bones in mice offspring at adolescence. Iranian journal of basic medical sciences. 2016;19:1299.\u003c/li\u003e\n\u003cli\u003eSuter MA, Chen A, Burdine MS, Choudhury M, Harris RA, Lane RH, et al. A maternal high-fat diet modulates fetal SIRT1 histone and protein deacetylase activity in nonhuman primates. FASEB J. 2012;26:5106\u0026ndash;14.\u003c/li\u003e\n\u003cli\u003eLee JD, Choi M-A, Ro SW, Yang WI, Cho AE, Ju H-L, et al. Synergic chemoprevention with dietary carbohydrate restriction and supplementation of AMPK-activating phytochemicals: the role of SIRT1. Eur J Cancer Prev. 2016;25:54.\u003c/li\u003e\n\u003cli\u003eChalkiadaki A, Guarente L. High-fat diet triggers inflammation-induced cleavage of SIRT1 in adipose tissue to promote metabolic dysfunction. Cell Metabol. 2012;16:180\u0026ndash;8.\u003c/li\u003e\n\u003cli\u003eGamba CA, Friedman SM, Rodriguez PN, Macri EV, Vacas MI, Lifshitz F. Metabolic status in growing rats fed isocaloric diets with increased carbohydrate-to-fat ratio. Nutrition. 2005;21:249\u0026ndash;54.\u003c/li\u003e\n\u003cli\u003eNguyen LT, Chen H, Zaky A, Pollock C, Saad S. SIRT1 overexpression attenuates offspring metabolic and liver disorders as a result of maternal high-fat feeding. J Physiol. 2019;597:467\u0026ndash;80.\u003c/li\u003e\n\u003cli\u003eChen H, Morris MJ. Differential responses of orexigenic neuropeptides to fasting in offspring of obese mothers. Obesity. 2009;17:1356\u0026ndash;62.\u003c/li\u003e\n\u003cli\u003eElamin M, Ruskin DN, Masino SA, Sacchetti P. Ketogenic diet modulates nad+-dependent enzymes and reduces DNA damage in hippocampus. Frontiers in cellular neuroscience. 2018;12:263.\u003c/li\u003e\n\u003cli\u003ePalliyaguru DL, Rudderow AL, Sossong AM, Lewis KN, Younts C, Pearson KJ, et al. Perinatal diet influences health and survival in a mouse model of leukemia. Geroscience. 2020. doi:\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11357-020-00199-9\u003c/span\u003e\u003c/span\u003e.\u003c/li\u003e\n\u003cli\u003eTomada I, Negr\u0026atilde;o R, Almeida H, Neves D. Long-term high-fat consumption leads to downregulation of Akt phosphorylation of eNOS at Ser1177 and upregulation of Sirtuin-1 expression in rat cavernous tissue. Age. 2014;36:597\u0026ndash;611.\u003c/li\u003e\n\u003cli\u003eGillum MP, Erion DM, Shulman GI. Sirtuin-1 regulation of mammalian metabolism. Trends in molecular medicine. 2011;17:8\u0026ndash;13.\u003c/li\u003e\n\u003cli\u003eHaggarty P. Fatty acid supply to the human fetus. Ann Rev Nutr. 2010;30:237\u0026ndash;55.\u003c/li\u003e\n\u003cli\u003eSchmitz G, Ecker J. The opposing effects of n \u0026ndash; 3 and n \u0026ndash; 6 fatty acids. Progress in lipid research. 2008;47:147\u0026ndash;55.\u003c/li\u003e\n\u003cli\u003ePatterson E, Wall R, Fitzgerald G, Ross R, Stanton C. Health implications of high dietary omega-6 polyunsaturated fatty acids. \u003cem\u003eJournal of nutrition and metabolism\u003c/em\u003e. 2012; 2012.\u003c/li\u003e\n\u003cli\u003eMolendi-Coste O, Legry V, Leclercq IA. Why and how meet n-3 PUFA dietary recommendations? \u003cem\u003eGastroenterology research and practice\u003c/em\u003e. 2011, 2011.\u003c/li\u003e\n\u003cli\u003eBenatti P, Peluso G, Nicolai R, Calvani M. Polyunsaturated fatty acids: biochemical, nutritional and epigenetic properties. J Am Coll Nutr. 2004;23:281\u0026ndash;302.\u003c/li\u003e\n\u003cli\u003eVuppalanchi R, Cummings OW, Saxena R, Ulbright TM, Martis N, Jones DR, et al. Relationship among histologic, radiologic, and biochemical assessments of hepatic steatosis: a study of human liver samples. Journal of clinical gastroenterology. 2007;41:206\u0026ndash;10.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Fat, maternal diet, programming, hepatic fatty acid profile, sirtuni-1","lastPublishedDoi":"10.21203/rs.3.rs-98844/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-98844/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBackground: Amount of fat and carbohydrate in maternal diet during gestation and lactation has permanent effects on fetal metabolism. SIRT1 is a nutrient-responsive histone deacetylase that modulates the lipid and glucose metabolism in response to energy stress and extends life span. To study the effects of carbohydrate and fat distribution in a maternal isocaloric diet on fetal gene and protein levels of SIRT1, as well as liver fatty acid profile.\u003c/p\u003e\u003cp\u003eMethods: Twenty C57BL/6 female mice were inseminated and randomly received the AIN 93G isocaloric pair-fed LF-HC (16% and 64% of calorie as fat and carbohydrate) or HF-LC (48% and 32% of calorie as fat and carbohydrate) diet during gestation and lactation. After weaning, all offspring received LF-HC diet up to the adolescence. Liver tissue were extracted for final analysis. \u003c/p\u003e\u003cp\u003eResults: SIRT1 gene and protein levels were lower in both sexes born from HF-LC-fed mothers than LF-HC-fed one, significant differences were only observed between males in the gene expression (p\u0026lt;0.001) and females in protein level (p\u0026lt;0.001). Saturated fatty acids and cholesterol were increased while unsaturated fatty acids decreased at the liver of male and female offspring born from HF-LC-fed mothers (p\u0026lt;0.001). \u003c/p\u003e\u003cp\u003eConclusions: Maternal dietary fat and carbohydrate distribution, regardless of calorie intake, modify the offspring hepatic fatty acid profile, as well as SIRT1 gene and protein expression which effects on life span.\u0026nbsp;\u0026nbsp;\u003c/p\u003e","manuscriptTitle":"Fat and Carbohydrate Distribution in Maternal Diet Programs Liver Sirtuin-1 Expression and Fatty acid Profile in Offspring","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2020-11-03 22:12:08","doi":"10.21203/rs.3.rs-98844/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"780b6a4e-a0de-450c-9dd5-d379265127ac","owner":[],"postedDate":"November 3rd, 2020","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":961961,"name":"Cardiac \u0026 Cardiovascular Systems"},{"id":961962,"name":"Endocrinology \u0026 Metabolism"}],"tags":[],"updatedAt":"2020-11-14T13:56:55+00:00","versionOfRecord":[],"versionCreatedAt":"2020-11-03 22:12:08","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-98844","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-98844","identity":"rs-98844","version":["v1"]},"buildId":"GqpaHPwrfC8PjnIFayRh5","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}