Marine derivative CHNQD-00603 reverses bone marrow mesenchymal stem cells senescence by enhancing autophagy through the AKT/ERK/mTOR signaling pathway

Marine derivative CHNQD-00603 reverses bone marrow mesenchymal stem cells senescence by enhancing autophagy through the AKT/ERK/mTOR signaling pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Marine derivative CHNQD-00603 reverses bone marrow mesenchymal stem cells senescence by enhancing autophagy through the AKT/ERK/mTOR signaling pathway Xiaoxia Yang, Wenhao ren, Baoying peng, Shaoming li, Jingjing Zheng, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4229655/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Objective Maxillofacial bone defect caused by the tumor and periodontal disease in the elderly will affect implant restoration. Bone marrow mesenchymal stem cells (BMSCs), as seed cells for bone regeneration, play an important role in the treatment of bone defects. The objective of this study was to investigate the effect and mechanism of marine derivative CHNQD-00603 on senescence BMSCs. Materials and Methods Biological function of BMSCs was determined by flow cytometry, alizarin red and oil-red O. Transmission electron microscopy Western blot, qRT-PCR, and reactive oxygen species detection were used to evaluate the effects of CHNQD-00603 on autophagosomes, autophagy-related molecules, senescence-related indicators, and ROS in aging BMSCs. The mechanism of CHNQD-00603 inhibiting BMSCs aging was detected by Western blot and qRT-PCR. Results In this study, CHNQD-00603 increased the level of autophagy, and decreased the level of ROS in senescence BMSCs. In addition, CHNQD-OO603 decreased AKT/ERK phosphorylation and increased mTOR phosphorylation. The agonists of AKT and ERK can increase the mRNA expression of age-related genes p16 and p21. Conclusions Our findings revealed that CHNQD-OO603 inhibits BMSCs senescence via the AKT/ERK/mTOR signaling pathway. This provides a potential idea for the treatment of insufficient jaw volume in the elderly. CHNQD-00603 Senescence Bone marrow mesenchymal stem cells Aging Autophagy AKT/ERK/mTOR signaling pathway Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction A denture implant is regarded as an effective method for replacing partial or complete dentures, restoring function as well as aesthetics. Osseointegration is the combination form between implant and bone and is also an important factor for the survival of implant restoration 1 . Alveolar bone with good bone mass is an important factor in the formation of osseointegration. Various traumatic events including tooth loss, periodontal disease, facial and alveolar injuries, odontogenic and non-odontogenic cysts and tumors, oral pathological lesions, systemic diseases, etc. can result in alveolar bone loss 2 . Unfortunately, the elderly as the main group in denture repair are more vulnerable to these adverse events. Therefore, the elderly need more dental implant restoration and face a higher risk of failure. A series of approaches to increase bone mass has been designed to improve the process of osseointegration, including autogenous bone graft, guided bone regeneration (GBR), and improved osteogenic differentiation of bone marrow stromal cells (BMSCs) 3 , 4 . However, these methods cannot completely solve the current problems and the long-term effect is uncertain. Therefore, how to improve the quality of jaw bone tissue in the elderly has become of great interest in dental implants of the elderly. The BMSCs are one of the most widely used stem cells for bone regeneration, including jawbone regeneration. In addition to being capable of self-renewal, BMSCs act as a powerful tool in bone tissue regeneration and as a lifelong reservoir for the production of somatic cells. It has become increasingly apparent that BMSCs have had a promising role in the treatment of bone metabolic diseases in recent decades 5 – 7 . Additionally, aging has been linked to cellular senescence, and BMSCs undergo senescence when the bone aging process occurs 8 , 9 . Marine environments have obvious ecological differences from terrestrial environments because of their salinity, pressure, temperature, and low oxygen levels 10 . Marine organisms have evolved unique metabolic processes to adapt to this extreme environmental stress, producing new bioactive products 11 . It has been found that marine natural products and their derivatives have anti-cancer, anti-inflammatory, anti-fungal, anti-bacterial, osteogenic, and other biological properties 12 , 13 . Marine organisms not only have diverse and novel structures but also strong biological activities, which contribute to the development of new drugs. In the early stage, our cooperative team isolated a series of 4-phenyl-3,4-dihydroquinolin-2(1H)-one alkaloid from a gorgonian-derived fungus, i.e. Scopulariopsis sp 14 . We obtained various new derivatives by adding different functional groups to 4-phenyl-3,4-dihydroquinolin-2(1H)-one core. Our preliminary experiments showed that CHNQD-00603, one of the derivatives, could promote the osteogenic differentiation of BMSCs 15 . Autophagy is a highly conserved self-degradation process. Autophagy plays an important role in cellular homeostasis and promotes cellular and organism health by eliminating the macromolecules or organelles that are damaged under various adverse conditions 16 , 17 . In some special conditions, it also leads to autophagic death of type II programmed cells characterized by cytoplasmic vacuolization, which has an astonishing connection with human pathology and physiology 18 . Under healthy conditions, autophagy is a normal physiological activity. However, it can be altered under pathological conditions, or specific physiological conditions to promote the occurrence of aging-related diseases 19 . There has been evidence suggesting that abnormal autophagy levels may cause bone metabolism disorders by disrupting the balance of bone metabolism 20 . Autophagy has been widely studied as a mechanism with anti-aging effects and treatment of age-related diseases. Under stress conditions such as nutritional deprivation, hypoxia, mechanical damage, and biological damage, autophagy protects BMSCs from oxidative stress and delays cellular senescence by recycling damaged and non-essential proteins and building new molecules and energy 21 , 22 . Aging is a multidimensional process that is inevitable and complicated by the accumulation of harmful substances and contributes to the continuous loss of physiological function and biological mechanisms, giving Increased susceptibility to disease 23 , 24 . The aging process in bones is featured by the decreased bone formation and increased bone resorption. As a result, jaw bone mass will decrease and implant stability and longevity will be affected 25 . Although studies have shown that CHNQD-00603 can promote osteogenic differentiation of BMSCs, there have been no reports on the effects of CHNQD-00603 on BMSCS senescence 15 . Therefore, this study focuses on exploring whether and how CHNQD-00603 protects BMSCs from senescence induced by D-gal. Finally, we demonstrated that CHNQD-00603 promotes autophagy through the AKT/ERK/mTOR signaling pathway to inhibit D-gal-induced senescence. Materials and methods Isolation and identification of BMSCs Two-month-old female Sprague-Dawley rats were used to isolate the BMSCs. The rats were anesthetized with 10% chloral hydrate and then soaked in 75% alcohol for disinfection. The femur and tibia were separated under sterile conditions. The bone marrow cavity was rinsed with alpha minimum essential medium (α-MEM) and the cells were harvested, planted in culture flyers, plated in a culture flask, and cultured overnight in a 37℃ incubator with 5% CO2. The culture medium was changed every three days, and the third passage was used for cell identification. BMSCs surface markers, including CD90, CD29, CD11b, and CD45, were detected by flow cytometry. The whole animal experimental protocol was approved by the Ethics Committee of the affiliated hospital of Qingdao University. Alizarin Red Staining BMSCs were cultured with an osteogenic induction solution for 3 weeks, and the induction solution was changed every 3 days. After induction, fixation was performed with 4% paraformaldehyde, and alizarin red staining for 30 min, and the formation of calcified nodules were observed under a microscope. Oil-Red O Staining BMSCs were incubated in an adipose differentiation medium for 3 weeks, and the fluid was changed according to the instructions. After induction, oil red O staining was performed after fixation with 4% paraformaldehyde, and lipid droplet formation was observed under a microscope. Cell Viability Assay Cell viability analysis was performed using the Cell Counting Kit-8 reagent (CCK-8, Biyuntian, China). The third-generation BMSCs were seeded into a 96-well plate at a density of 7×10 3 cells/well and cultured for 24 h. Then the medium was replaced with different concentrations of D-gal (0 mmol/L, 10 mmol/L, 50 mmol/L, 100 mmol/L, 200 mmol/L, 400 mmol/L, Mac, China) and incubated at 37°C for another 48 h. According to the instructions, the media were removed, then mixing CCK-8 was added to each well and incubated at 37°C for 2 h. The absorbance was measured at a wavelength of 450 nm using a microplate reader to assess cell viability. RNA isolation and Quantitative Real-Time PCR (qRT-PCR) assays RNA extraction and cDNA synthesis: Total RNA was extracted from BMSCs using TRIzol reagent (ThermoFisher Scientific) and used for the synthesis of first-strand cDNAs by A PrimeScript RT (TaKaRa) reagent kit. cDNA was subjected to Quantitative PCR analysis. Real-time PCR (RT-PCR) assays were conducted using SYBR GREEN PCR Master Mix (Takala, Japan) on a Bio-Rad CFX96 thermal cycler GAPDH was used as a reference gene. The primers are shown in Table 1 . Table 1 Primer sequences. Primer set Forward primer Reverse primer P16 P21 Runx2 ALP OPN OCN GAPDH TCGCTCGTACCCCGATACAG CTGGTGGCGTAGGCAAGAGT GCCGGGAATGATGAGAACTACT ACCGAATGCTGCACGACAA CCTTCACTGCCAGCACACAA AGGACCCTCTCTCTGCTCACTCT ATGCCGCCTGGAGAAACC TCGCTCGTACCCCGATACAG GACCTGCTGTGTCGAGAATATCC AGGATTTGTGAAGACCGTTATGG CCCCGCCATGGACTTTAGTA CTGTGGCATCGGGATACTGTT GAGGTAGCGCCGGAGTCTATT GCATCAAAGGTGGAAGAATGG Western blot (WB) assay The BMSCs were extracted using RIPA buffer (Beyotime Biotechnology, Shanghai, China) containing a protease inhibitor cocktail. The protein concentration was measured with a BCA kit (Solarbio, Beijing, China). Proteins were separated through 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (Solarbio, Beijing, China), and then transferred to PVDF membranes (Sigma-Aldrich, China). After blocking with 5% non-fat milk, the membranes were incubated with the primary antibodies GAPDH(1:2000; Elabscience, cat. no. E-AB-20059, China), P62 (1:1000; Catalog No.AF5484; Affinity Biosciences), LC3(1:1000; Proteintech, cat. no. 16400-1-AP, China), AKT (1:1000; Cell Signaling Technology, cat. no.C67E7 China), P-AKT(1:1000; Cell Signaling Technology, cat. no.D25E6 China), ERK (1:1000; Cell Signaling Technology, cat. no.137F5 China), P-ERK(1:2000; Cell Signaling Technology, cat. no.D13.14.4E China), overnight at 4 ◦ C and then incubated for 1h at 37℃ with secondary antibodies, anti-Rabbit IgG (1:10000, 1:10,000; Proteintech, cat. no. 10285-1-AP). Finally, images were acquired using ChemiDoc Touch Imaging System (BioRad). The bands were quantified by densitometry using Image J software (National Institutes of Health). Senescence-Associated β-Galactosidase (SA-β-Gal) Staining The SA-β-gal activity was measured with a staining kit (Beyotime, China) following the manufacturer’s protocols. After washing with PBS three times, fixed with fixative for 15 min and then incubated with 1 mL SA-β-gal staining working fluid at 37 ° C overnight. Finally, SA-β‐gal‐positive cells, stained blue, were randomly imaged. The number of blue SA-β-gal-positive cells was calculated. Alkaline phosphatase (ALP) staining After culturing in the osteogenesis-inducing media for 7 days, BMSCs were washed with PBS three times and fixed with 4% paraformaldehyde for 15 minutes. After washing, the cells were stained using an alkaline phosphatase kit (Beyotime, Shanghai, China) according to the manufacturer's instructions. Reactive oxygen species (ROS) detection ROS in BMSCs were evaluated by using a reactive oxygen species detection kit. After the BMSCs were treated with the method, the medium was replaced by Diluted DCFH-DA. Incubate in the cell incubator at 37℃ for 20 minutes. Then, the cells were washed three times with serum-free cell culture solution and the images of the cells were taken by the fluorescence microscope. Transmission Electron Microscopy(TEM) BMSCs were treated with D-gal for 48h, then treated with or without CHNQD-00603 for 7 days. Then, the treated cells were fixed in 2.5% glutaraldehyde (Solarbio). The next steps were performed by Servicebio Company, and a transmission electron microscope was used to observe the results. Result Determination of BMSCs surface markers and differentiation potential. The surface antigens of BMSCs were detected by flow cytometry. The results showed that CD90 and CD29 were positive, and CD11b and CD45 were negative, as shown in Figure.1A. The primary BMSCs on the 5th day of growth were long spindle-shaped and adherent ( Figure.1B ). Alizarin red and oil-red O staining after osteogenesis and lipid formation respectively revealed calcified nodules and lipid droppings in BMSCs (Figure.1C, D). The above results proved that BMSCs were successfully extracted and cultured. D-gal induces BMSCs Senescence. D-galactose (D-gal)-induced aging model offers a very similar picture to that which occurs in natural aging and is widely used in the study 26 . Different types of cells respond differently to D-gal concentrations that cause senescence. As a result, we built a model of D-gal-induced senescence in BMSCs. It is well known that β-galactosidase (SA-β-gal) is a metabolic marker of senescence. The activity of SA-β-gal was observed by staining with SA-β-gal. To determine the optimal concentration of D-gal to induce BMSCs senescence, SA-β-gal staining, and cell viability assays were performed in this experiment. As shown in Figure.2A, B, compared with the control group, the number of SA-β-gal + cells in the D-gal-induced group increased in a dose-dependent manner. Additionally, as D-gal concentration increased, cell viability decreased significantly (Figure.2C). Based on these results, the experimental group with very high numbers of SA-β-gal + cells and a relatively small decrease in cell viability meets the requirements. Therefore, 200umol/L of D-gal was used to construct the aging model for BMSCs. CHNQD-00603 attenuated D-gal-induced senescence of BMSCs. Our previous experiments showed that CHNQD-00603 could promote osteogenic differentiation of bone marrow mesenchymal stem cells. Surprisingly, we further found that the target of CHNQD-00603 was closely related to aging by GO-Kegg bioinformatics analysis (Figure.3A). To investigate the effect of CHNQD-00603 on senescent BMSCs, which were induced by D-gal (200mmol/L) and treated with or without CHNQD-00603 (1µg/mL) 15, 27 , SA-β-gal staining was used to detect SA-β-gal + cells. Compared with the control group, the number of SA-β-gal + cells in BMSCs induced by D-gal increased significantly, but the number of SA-β-gal + cells decreased after the CHNQD-00603 intervention (Figure.3B). Next, we also examined the expression of the aging-related genes p16 and p21. Compared with the D-gal alone, CHNQD-00603 reduced the expression of p16 and p21 (Figure.3C). Subsequently, the osteogenesis-related gene, including RUNX2, ALP, OPG, and OCN was determined by ALP staining and qRT-PCR. The results showed that the D-gal inhibited the osteogenesis of BMSCs, and CHNQD-00603 significantly alleviated the inhibitory effect of D-gal on osteogenesis (Figure.3D, E). CHNQD-00603 increased the level of autophagy in BMSCs induced by D-gal. Previous experiments have shown that CHNQD-00603 can improve the autophagy level in BMSCs. More and more studies have shown that autophagy is associated with diseases such as aging and abnormal bone metabolism 28 , 29 . As shown in As shown in Figure.4A, B, the results of WB showed that the expression levels of LC3 were significantly up-regulated by treatment with CHNQD-00603, However, the expression levels of P62 were significantly reduced. Additionally, we analyzed the level of mature autophagosomes by Transmission electron microscopy (TEM). There was a significant increase in autophagosomes in BMSCs treated with CHNQD-00603 compared to the untreated group (Figure.4C). To determine the role of CHNQD-00603-induced autophagy in BMSCs senescence, 3-methyladenine (3-MA) the established autophagy inhibitor, was applied. 3-MA can significantly inhibit autophagy as shown in Figure.4D. In addition, reactive oxygen species (ROS) in BMSCs treated with D-gal increased significantly, but ROS decreased significantly after CHNQD-00603 treatment, as shown in Figure.4E. This indicates that ROS is also involved in the process of BMSCs senescence regulated by CHNQD-00603. CHNQD-00603 induced autophagy via AKT/ERK/mTOR signaling pathways. AKT is a key signaling molecule in the PI3K/AKT/mTOR signaling pathway, which has a pivotal role in the regulation of cell proliferation, differentiation, and survival under normal physiologic and pathophysiological processes 30 , 31 . Constitutively active ERK also traffics to autophagy 32 . To clarify whether CHNQD-00603 affects the autophagy level of senescent BMSCs through AKT/ERK/mTOR signaling pathway, we first detected the protein expression of p-AKT, p-ERK, and p-mTOR in senescent BMSCs treated with CHNQD-00603. Western blot results showed that the expression of p-AKT and p-ERK was significantly increased, while the expression of p-mTOR was decreased(Figure.5A). Therefore, we deduced that AKT/ERK/mTOR signaling pathways may be involved in the process of CHNQD-00603 activating autophagy in senescent BMSCs. To further reveal the regulatory effect of CHNQD-00603 on the AKT/ERK/mTOR signaling pathway, senescent BMSCs were treated with SC79 and TBHQ (AKT and ERK Agonists), respectively. Western blot results showed that compared with CHNQD-00603 alone treatment group, SC79, and TBHQ treatment effectively increased the phosphorylation levels of AKT and ERK, and decreased the phosphorylation level of mTOR.The results of western blotting suggested that SC79 and TBHQ decreased the level of autophagy-related protein of LC3, while the expression of p62 was enhanced (Figure.5B, D). In addition, qRT-PCR data showed that the expression of senescence-associated mRNAs (p16 and p21) was negatively correlated with autophagy levels (Figure.5C, E). The above experimental results showed that CHNQD-00603 activated autophagy through AKT/ERK/mTOR signaling pathway and inhibited the senescence of BMSCs Discussion The self-renewal and differentiation ability of BMSCs makes them play an important role in the maintenance, renewal, and reconstruction of bone tissue. However, more and more evidence shows that the aging of BMSCs will affect their normal function, which may eventually lead to bone loss, bone deficiency, bone tissue defect repair and reconstruction difficulties, and other problems. Surprisingly, based on previous studies, we further found that CHNQD-00603 can promote autophagy through AKT/ERK/mTOR signaling pathway, inhibit the senescence of BMSCs, and promote the osteogenic differentiation of BMSCs (Figure.6). Due to its special environment of high salt, high pressure, low oxygen, and oligotrophic, the ocean has nurtured many marine organisms whose structure and function are different from those of terrestrial products. The relationship between marine products and diseases and the underlying molecular mechanism has generated tremendous interest over the years. In this experiment, we used the marine product derivative CHNQD-00603 for the first time, which is a series of 4-phenyl-2 (1H)-quinolinone natural products isolated from gorgonian-derived fungus Scopulariopsis sp. by our co-operation group 15 . In our previous experiments, we not only found that CHNQD-00603 can regulate autophagy in BMSCs but also predicted possible target genes through the CHNQD-00603 structural formula on the Swiss TargetPrediction database platform. In this experiment, we performed GO enrichment analysis on the DAVID database and found that CHNQD-00603 may be related to aging, cytoplasm, nucleus, etc. Therefore, we speculate that CHNQD-00603 may affect the aging of BMSCs. Cell senescence is a cell cycle arrest leading to decreased cell function and resilience. This is not only reflected in the increased expression of aging-related molecules including p16, p21, and β-galactosidase at the molecular level. At the cellular level, it can be manifested as a weakened or subsided function 33 , 34 . For example, the expression of osteogenic-related factors RUNX2, ALP, OPN, and OCN decreased in BMSCS. In our study, we observed that the number of SA-β-gal positive cells increased, and the mRNA expression of p16 and p21 increased significantly in O-BMSCs induced by D-gal. However, ALP staining and mRNA expression of RUNX2, ALP, OPN, and OCN were significantly reduced in O-BMSCs. These results indicate that the osteogenic differentiation ability of senescent BMSCs is weakened. Interestingly, in senescent BMSCs after CHNQD-00603 treatment, the number of SA-β-gal positive cells decreased, the mRNA expression of p16 and p21 decreased, ALP staining and the mRNA expression of RUNX2, ALP, OPN, and OCN decreased. This indicates that CHNQD-00603 inhibits the senescence of BMSCs to some extent. Based on these findings, we conclude that CHNQD-00603 can inhibit the senescence of BMSCs and enhance osteogenic differentiation ability. Autophagy is a self-degrading system with multiple functions and plays an important role in maintaining the balance of bone metabolism 35 . Many signaling molecules play a role in autophagy. When cells are induced by various intracellular and extracellular stimuli, ATG13 induces ULK1 to the pre-autophagosome structure (PAS), and then almost all autophagy-related (Atg) proteins are aggregated on the PAS 36 . Some mammalian cells have homologs of yeast Atg8, such as LC3, GATE16, GABARAP, and ATG8L. In mammal cells, LC3 has been studied and characterized as a marker of autophagosomes 16 , 37 . The P62, also known as sequestosome 1 (SQSTM1), is a selective substrate of autophagy. p62/SQSTM1 can directly interact with LC3, leading to the specific degradation of p62 by autophagy. Therefore, the p62 level has been used as a marker of autophagy inhibition or autophagy degradation defects 38 , 39 . 3-MA (3-methyladenine) is an inhibitor of class I and class III PtdIns 3-kinase, which results in autophagy inhibition due to the suppression of class III PtdIns 3-kinase 32 . Our data showed that CHNQD-00603 triggered autophagy in senescent BMSCs, inducing autophagosome formation, increasing LC3II expression, and decreasing P62 expression. Nevertheless, autophagy inhibitor 3-MA could attenuate the effect of CHNQD-00603 on aging BMSCs. These results demonstrate that CHNQD-00603 inhibits BMSCs senescence by autophagy. Nonetheless, the mechanism of CHNQD-00603 to regulate autophagy in senescence BMSCs is not clear. Several molecular and signaling pathways play a crucial role in regulating autophagy. We focused on AKT and ERK. AKT is a key signaling molecule in the PI3K/AKT/mTOR signaling pathway, which has a pivotal role in the regulation of cell proliferation, differentiation, and survival under normal physiologic and pathophysiological processes 30 , 31 . Constitutively active ERK1/2 also traffics to autophagy 32 . CHNQD-00603 treated O-BMSCs decreased the phosphorylated expression of AKT and ERK, and finally activated autophagy. To further verify the role of AKT/ERK/mTOR in the regulation of autophagy by CHNQD-00603, SC79(AKT agonist) and TBHQ (ERK agonist) were used to interfere with senescent BMSCs, respectively. Our results demonstrated that AKT/ERK/mTOR was regulated by CHNQD-00603 and that their specific agonist SC79 and ERK mitigated CHNQD-00603-elicited autophagy, thereby verifying the AKT/ERK/mTOR molecular network's positive participation in the regulation of autophagy by CHNQD-00603 in aging BMSCs. Conclusions In conclusion, our current study revealed for the first time that CHNQD-00603 can restrain BMSCs senescence by enhancing autophagy through the AKT/ERK/mTOR signaling pathway. These findings suggest that CHNQD-00603 may be a promising method to improve the function of senescent BMSCs and improve the osseointegration of implants in the elderly. Declarations Acknowledgments Thanks to Professor Changlun Shao of the Ocean University of China for his support of this experiment. Data Availability Statement The raw data supporting the conclusions of this article will be made available on request to the corresponding author by email. Funding Statement This study was funded by the National Natural Science Foundation of China (No.42176096, 42176097), Natural Science Foundation of Shandong Province (ZR2021MD065), Traditional Chinese Medicine Scientific Research Project of Qingdao (2020-zyy060), Qingdao Outstanding Health Professional Development Fund, and Qilu Health Leading Talent Project. Conflicts of Interest Disclosure The authors declare no conflict of interest. Ethics Approval Statement The study was conducted by the Declaration of Helsinki, and approved by the Research Ethics Committee of the affiliated hospital of Qingdao University. Author Contribution XX Yang: study conception and design, data collection, and writing the original draft. WH Ren: Data collection, writing, review & editing, and visualization. BY Peng: Data collection and writing—review & editing. SM Li: Data collection and visualization. JJ Zheng：Data collection.K Sun：visualization. KQ Zhi: Supervision and funding acquisition. L Gao: Study conception and design, supervision, and funding acquisition. References Buser D, Sennerby L, De Bruyn H (2017) Modern implant dentistry based on osseointegration: 50 years of progress, current trends and open questions. Periodontol 2000 73:7–21 Tolstunov L, Hamrick JFE, Broumand V, Shilo D, Rachmiel A (2019) Bone Augmentation Techniques for Horizontal and Vertical Alveolar Ridge Deficiency in Oral Implantology. Oral Maxillofac Surg Clin North Am 31:163–191 Jensen SS, Terheyden H (2009) Bone augmentation procedures in localized defects in the alveolar ridge: clinical results with different bone grafts and bone-substitute materials. Int J Oral Maxillofac Implants 24:218–236 Hu D, Li K, Xie Y et al (2017) The combined effects of nanotopography and Sr ion for enhanced osteogenic activity of bone marrow mesenchymal stem cells (BMSCs). J Biomater Appl 31:1135–1147 Guo Q, Guo Q, Xiao Y, Li C, Huang Y, Luo X (2020) Regulation of bone marrow mesenchymal stem cell fate by long non-coding RNA. Bone 141:115617 Xie H, Cui Z, Wang L et al (2014) PDGF-BB secreted by preosteoclasts induces angiogenesis during coupling with osteogenesis. Nat Med 20:1270–1278 Kolios G, Moodley Y (2013) Introduction to stem cells and regenerative medicine. Respiration 85:3–10 Abdelmagid SM, Barbe MF, Safadi FF (2015) Role of inflammation in the aging bones. Life Sci 123:25–34 Zhou X, Hong Y, Zhang H, Li X (2020) Mesenchymal Stem Cell Senescence and Rejuvenation: Current Status and Challenges. Front Cell Dev Biol 8:364 Li CS, Liu LT, Yang L, Li J, Dong X (2022) Chemistry and Bioactivity of Marine-Derived Bisabolane Sesquiterpenoids: A Review. Front Chem 10:881767 Alonso E, Alvariño R, Leirós M et al (2016) Evaluation of the Antioxidant Activity of the Marine Pyrroloiminoquinone Makaluvamines. Mar Drugs. ;14 Khalifa SAM, Elias N, Farag MA et al (2019) Marine Natural Products: A Source of Novel Anticancer Drugs. Mar Drugs. ;17 Carroll AR, Copp BR, Davis RA, Keyzers RA, Prinsep MR (2022) Marine natural products. Nat Prod Rep 39:1122–1171 Shao CL, Xu RF, Wang CY, Qian PY, Wang KL, Wei MY (2015) Potent Antifouling Marine Dihydroquinolin-2(1H)-one-Containing Alkaloids from the Gorgonian Coral-Derived Fungus Scopulariopsis sp. Mar Biotechnol (NY) 17:408–415 Xin S, Li SM, Gao L et al (2021) CHNQD-00603 Promotes Osteogenic Differentiation of Bone Marrow Mesenchymal Stem Cells by the miR-452-3p-Mediated Autophagy Pathway. Front Cell Dev Biol 9:779287 Glick D, Barth S, Macleod KF (2010) Autophagy: cellular and molecular mechanisms. J Pathol 221:3–12 Mizushima N, Levine B, Cuervo AM, Klionsky DJ (2008) Autophagy fights disease through cellular self-digestion. Nature 451:1069–1075 Caramés B, Taniguchi N, Otsuki S, Blanco FJ, Lotz M (2010) Autophagy is a protective mechanism in normal cartilage, and its aging-related loss is linked with cell death and osteoarthritis. Arthritis Rheum 62:791–801 Shirakabe A, Ikeda Y, Sciarretta S, Zablocki DK, Sadoshima J (2016) Aging and Autophagy in the Heart. Circ Res 118:1563–1576 Wang S, Deng Z, Ma Y et al (2020) The Role of Autophagy and Mitophagy in Bone Metabolic Disorders. Int J Biol Sci 16:2675–2691 Song C, Song C, Tong F (2014) Autophagy induction is a survival response against oxidative stress in bone marrow-derived mesenchymal stromal cells. Cytotherapy 16:1361–1370 Ma Y, Qi M, An Y et al (2018) Autophagy controls mesenchymal stem cell properties and senescence during bone aging. Aging Cell. ;17 Akhter F, Chen D, Akhter A, Yan SF, Yan SS (2021) Age-dependent accumulation of dicarbonyls and advanced glycation endproducts (AGEs) associates with mitochondrial stress. Free Radic Biol Med 164:429–438 Lee HC, Wei YH (2007) Oxidative stress, mitochondrial DNA mutation, and apoptosis in aging. Exp Biol Med (Maywood) 232:592–606 Xu R, Shen X, Si Y et al (2018) MicroRNA-31a-5p from aging BMSCs links bone formation and resorption in the aged bone marrow microenvironment. Aging Cell 17:e12794 Alejandro SP (2022) ER stress in cardiac aging, a current view on the D-galactose model. Exp Gerontol 169:111953 Wang J, Liu L, Ding Z, Luo Q, Ju Y, Song G (2021) Exogenous NAD(+) Postpones the D-Gal-Induced Senescence of Bone Marrow-Derived Mesenchymal Stem Cells via Sirt1 Signaling. Antioxidants (Basel). ;10 Qi M, Zhang L, Ma Y et al (2017) Autophagy Maintains the Function of Bone Marrow Mesenchymal Stem Cells to Prevent Estrogen Deficiency-Induced Osteoporosis. Theranostics 7:4498–4516 Broda M, Millar AH, Van Aken O, Mitophagy (2018) A Mechanism for Plant Growth and Survival. Trends Plant Sci 23:434–450 Gonzalez-Angulo AM, Blumenschein GR (2013) Jr. Defining biomarkers to predict sensitivity to PI3K/Akt/mTOR pathway inhibitors in breast cancer. Cancer Treat Rev 39:313–320 Papadimitrakopoulou V (2012) Development of PI3K/AKT/mTOR pathway inhibitors and their application in personalized therapy for non-small-cell lung cancer. J Thorac Oncol 7:1315–1326 Klionsky DJ, Baehrecke EH, Brumell JH et al (2011) A comprehensive glossary of autophagy-related molecules and processes (2nd edition). Autophagy. ;7: 1273–1294 Birch J, Gil J (2020) Senescence and the SASP: many therapeutic avenues. Genes Dev 34:1565–1576 Milanovic M, Fan DNY, Belenki D et al (2018) Senescence-associated reprogramming promotes cancer stemness. Nature 553:96–100 Kim KH, Lee MS (2014) Autophagy–a key player in cellular and body metabolism. Nat Rev Endocrinol 10:322–337 Suzuki K, Kirisako T, Kamada Y, Mizushima N, Noda T, Ohsumi Y (2001) The pre-autophagosomal structure organized by concerted functions of APG genes is essential for autophagosome formation. Embo j 20:5971–5981 Kabeya Y, Mizushima N, Yamamoto A, Oshitani-Okamoto S, Ohsumi Y, Yoshimori T (2004) LC3, GABARAP and GATE16 localize to autophagosomal membrane depending on form-II formation. J Cell Sci 117:2805–2812 Bjørkøy G, Lamark T, Brech A et al (2005) p62/SQSTM1 forms protein aggregates degraded by autophagy and has a protective effect on huntingtin-induced cell death. J Cell Biol 171:603–614 Mathew R, Karp CM, Beaudoin B et al (2009) Autophagy suppresses tumorigenesis through elimination of p62. Cell 137:1062–1075 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4229655","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":288601668,"identity":"ff8bb535-4b41-4650-9147-0e9979368978","order_by":0,"name":"Xiaoxia Yang","email":"","orcid":"","institution":"the Affiliated Hospital of Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Xiaoxia","middleName":"","lastName":"Yang","suffix":""},{"id":288601669,"identity":"2aa03dc5-4c1f-4b5b-b0b7-7ab9f55e3b9a","order_by":1,"name":"Wenhao ren","email":"","orcid":"","institution":"the Affiliated Hospital of Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Wenhao","middleName":"","lastName":"ren","suffix":""},{"id":288601670,"identity":"6224f419-7bcf-4e46-9946-e5d2d4abe253","order_by":2,"name":"Baoying peng","email":"","orcid":"","institution":"Qingdao Stomatological Hospital Affiliated to Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Baoying","middleName":"","lastName":"peng","suffix":""},{"id":288601671,"identity":"27346676-9038-45c1-bff8-4ccdc4c66117","order_by":3,"name":"Shaoming li","email":"","orcid":"","institution":"the Affiliated Hospital of Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Shaoming","middleName":"","lastName":"li","suffix":""},{"id":288601672,"identity":"91101d64-e060-42eb-ac58-a50abb55a43b","order_by":4,"name":"Jingjing Zheng","email":"","orcid":"","institution":"the Affiliated Hospital of Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Jingjing","middleName":"","lastName":"Zheng","suffix":""},{"id":288601673,"identity":"de995f89-2cbb-440f-97cb-a4957e5c9e76","order_by":5,"name":"Kai sun","email":"","orcid":"","institution":"the Affiliated Hospital of Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Kai","middleName":"","lastName":"sun","suffix":""},{"id":288601674,"identity":"cc9b50bf-89f5-464f-8eac-22540ab43cfc","order_by":6,"name":"Keqian zhi","email":"","orcid":"","institution":"the Affiliated Hospital of Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Keqian","middleName":"","lastName":"zhi","suffix":""},{"id":288601675,"identity":"2cc98d28-0b76-4d8a-866d-b6362f2cb742","order_by":7,"name":"Ling Gao","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2klEQVRIiWNgGAWjYFACxgcfwDQzcwPDBwMbOyK0MBvOgNCMDYwzCtKSSdDCwNjAzPPhEGMDIQ387c2MDR8qGOx12xkbH9sYHGBmYD98dAM+LRJnDjM2zjjDkLjtMGOzcY7BHT4GnrS0G/i0GEjkH3/M28aQYHaYsU06x+AZM4MEjxkBLcmMzX//MdgDtbT/tjA4zNhAlBaglxmBDmtjZiBGC9gvPccgfpHsMUhLZiPkF3CI/agBOuz84YMffvyxseNnP3wMrxYo+I9gshGhfBSMglEwCkYBAQAA7xhJX1PAezgAAAAASUVORK5CYII=","orcid":"","institution":"the Affiliated Hospital of Qingdao University","correspondingAuthor":true,"prefix":"","firstName":"Ling","middleName":"","lastName":"Gao","suffix":""}],"badges":[],"createdAt":"2024-04-07 04:59:52","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4229655/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4229655/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":54483968,"identity":"f8c60edb-9ac4-4be6-b68e-97c6d41abfa2","added_by":"auto","created_at":"2024-04-11 08:52:16","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":307634,"visible":true,"origin":"","legend":"\u003cp\u003eDetermination of surface markers and differentiation potential of rat BMSCs (A) Determination of BMSCs surface antigen by flow cytometry. (B) The growth state of primary cells under a microscope. ( C ) Oil red O staining. (D) Alizarin red staining (scale bar =200μm ).\u003c/p\u003e","description":"","filename":"floatimage1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4229655/v1/c46d68dc28f1a96de1286b14.jpg"},{"id":54484605,"identity":"f4b4955c-4047-4ef8-bce2-135ecaf867a6","added_by":"auto","created_at":"2024-04-11 09:00:16","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":245093,"visible":true,"origin":"","legend":"\u003cp\u003eThe effects of different concentrations of D-gal on the senescence of BMSCs. (A) BMSCs were induced by different concentrations of D-gal for 48 h. Galactosidase staining was used to detect the SA-β-gal activity in BMSCs induced by D-gal at different concentrations (scale bar = 200 μm). (B) Quantitative analysis of SA-β-gal + cells. (C) An MTT was used to measure cell viability. Quantitative data are presented as the mean ± SD (n=3) (*\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003e P\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003e P\u003c/em\u003e\u0026lt;0.001).\u003c/p\u003e","description":"","filename":"floatimage2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4229655/v1/a0637e1970454aa07bdd9d36.jpg"},{"id":54483969,"identity":"3cd6b4cb-ab7e-4d72-9918-8afcb5347a31","added_by":"auto","created_at":"2024-04-11 08:52:16","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":321906,"visible":true,"origin":"","legend":"\u003cp\u003eCHNQD-00603 attenuated D-gal-induced senescence of BMSCs. (A) Target genes were predicted by bioinformatics analysis. (B)The effect of CHNQD-00603 on D-gal-induced BMSCs was determined by galactosidase staining. And conduct quantitative analysis. (C) ALP expression of BMSCs after D-gal and CHNQD-00603 were detected by ALP staining. (D) qRT-PCR tested the expression of senescence-related genes in D-gal and CHNQD-00603-induced BMSCs. (E) qRT-PCR tested the expression of osteogenesis-related genes in D-gal and CHNQD-00603-induced BMSCs. Quantitative data are presented as the mean ± SD (n=3) (*\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003e P\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003e P\u003c/em\u003e\u0026lt;0.001)\u003c/p\u003e","description":"","filename":"floatimage3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4229655/v1/abc1c18575a9d2225375ca71.jpg"},{"id":54483971,"identity":"eca146ea-7685-400c-8a3c-67ccb45cf090","added_by":"auto","created_at":"2024-04-11 08:52:16","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":359841,"visible":true,"origin":"","legend":"\u003cp\u003eCHNQD-00603 increased autophagy in BMSCs induced by D-gal. (A.B) Autophagy-related proteins LC3 and p62 were detected by Western blot. (C) TEM was used to observe the number of autophagosomes. (D) Autophagy-related genes LC3 and p62 were detected after being treated with 3-MA by Western blot. (E) Immunofluorescent staining was used to detect ROS in BMSCs, which interfered with D-gal, and CHNQD-OO603, respectively. Quantitative data are presented as the mean ± SD (n=3) (*\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003e P\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003e P\u003c/em\u003e\u0026lt;0.001).\u003c/p\u003e","description":"","filename":"floatimage4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4229655/v1/c6d723a2024c2c208bc5810f.jpg"},{"id":54483973,"identity":"29ba2012-c96f-46c9-835f-e8f368060a00","added_by":"auto","created_at":"2024-04-11 08:52:16","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":255095,"visible":true,"origin":"","legend":"\u003cp\u003eCHNQD-00603 promotes autophagy of aging BMSCs through AKT/ERK/mTOR signaling pathway (A) Western blot was used to detect the expression of AKT, p-AKT, ERK, p-ERK mTOR, and p-mTOR in BMSCs treated with D-gal and CHNQD-00603. (B) Western blot was used to detect the effect of SC79 ( AKT agonist ) on p-AKT, p-mTOR, and autophagy-related genes LC3 and p62. (C) qRT-PCR was used to detect the effect of SC79 on senescence-related genes p16 and p21. (D) Western blot was used to detect the effect of TBHQ (ERK agonist) on p-ERK, p-mTOR, and autophagy-related genes LC3 and p62. (E) qRT-PCR was used to detect the effect of TBHQ on aging-related genes p16 and p21. Quantitative data are presented as the mean ± SD (n=3) (*\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **\u003cem\u003e P\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003e P\u003c/em\u003e\u0026lt;0.001).\u003c/p\u003e","description":"","filename":"floatimage6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4229655/v1/1d7771b9000f06c4f285786a.jpg"},{"id":54483972,"identity":"e6362680-f269-44cd-83a6-a351070c91ec","added_by":"auto","created_at":"2024-04-11 08:52:16","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":253523,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic diagram showing the findings of this study. The CHNQD-00603 activated autophagy by inhibiting the AKT/ERK/mTOR signaling pathway, which reduced ROS to reduce the senescence of BMSCS.(By Figdraw(www.figdraw.com).\u003c/p\u003e","description":"","filename":"floatimage7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4229655/v1/ccc6b09e885f3f8eaa23c2ce.jpg"},{"id":54683274,"identity":"b5edea34-cd35-46f2-b791-c3b271667d42","added_by":"auto","created_at":"2024-04-15 08:25:15","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1108351,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4229655/v1/18afc55f-0d05-41f4-b30c-141399680bd5.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Marine derivative CHNQD-00603 reverses bone marrow mesenchymal stem cells senescence by enhancing autophagy through the AKT/ERK/mTOR signaling pathway","fulltext":[{"header":"Introduction","content":"\u003cp\u003eA denture implant is regarded as an effective method for replacing partial or complete dentures, restoring function as well as aesthetics. Osseointegration is the combination form between implant and bone and is also an important factor for the survival of implant restoration\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. Alveolar bone with good bone mass is an important factor in the formation of osseointegration. Various traumatic events including tooth loss, periodontal disease, facial and alveolar injuries, odontogenic and non-odontogenic cysts and tumors, oral pathological lesions, systemic diseases, etc. can result in alveolar bone loss\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. Unfortunately, the elderly as the main group in denture repair are more vulnerable to these adverse events. Therefore, the elderly need more dental implant restoration and face a higher risk of failure. A series of approaches to increase bone mass has been designed to improve the process of osseointegration, including autogenous bone graft, guided bone regeneration (GBR), and improved osteogenic differentiation of bone marrow stromal cells (BMSCs)\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. However, these methods cannot completely solve the current problems and the long-term effect is uncertain. Therefore, how to improve the quality of jaw bone tissue in the elderly has become of great interest in dental implants of the elderly.\u003c/p\u003e \u003cp\u003eThe BMSCs are one of the most widely used stem cells for bone regeneration, including jawbone regeneration. In addition to being capable of self-renewal, BMSCs act as a powerful tool in bone tissue regeneration and as a lifelong reservoir for the production of somatic cells. It has become increasingly apparent that BMSCs have had a promising role in the treatment of bone metabolic diseases in recent decades\u003csup\u003e\u003cspan additionalcitationids=\"CR6\" citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. Additionally, aging has been linked to cellular senescence, and BMSCs undergo senescence when the bone aging process occurs\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eMarine environments have obvious ecological differences from terrestrial environments because of their salinity, pressure, temperature, and low oxygen levels\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. Marine organisms have evolved unique metabolic processes to adapt to this extreme environmental stress, producing new bioactive products \u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. It has been found that marine natural products and their derivatives have anti-cancer, anti-inflammatory, anti-fungal, anti-bacterial, osteogenic, and other biological properties\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. Marine organisms not only have diverse and novel structures but also strong biological activities, which contribute to the development of new drugs. In the early stage, our cooperative team isolated a series of 4-phenyl-3,4-dihydroquinolin-2(1H)-one alkaloid from a gorgonian-derived fungus, i.e. Scopulariopsis sp\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. We obtained various new derivatives by adding different functional groups to 4-phenyl-3,4-dihydroquinolin-2(1H)-one core. Our preliminary experiments showed that CHNQD-00603, one of the derivatives, could promote the osteogenic differentiation of BMSCs\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eAutophagy is a highly conserved self-degradation process. Autophagy plays an important role in cellular homeostasis and promotes cellular and organism health by eliminating the macromolecules or organelles that are damaged under various adverse conditions\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. In some special conditions, it also leads to autophagic death of type II programmed cells characterized by cytoplasmic vacuolization, which has an astonishing connection with human pathology and physiology\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. Under healthy conditions, autophagy is a normal physiological activity. However, it can be altered under pathological conditions, or specific physiological conditions to promote the occurrence of aging-related diseases\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. There has been evidence suggesting that abnormal autophagy levels may cause bone metabolism disorders by disrupting the balance of bone metabolism\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. Autophagy has been widely studied as a mechanism with anti-aging effects and treatment of age-related diseases. Under stress conditions such as nutritional deprivation, hypoxia, mechanical damage, and biological damage, autophagy protects BMSCs from oxidative stress and delays cellular senescence by recycling damaged and non-essential proteins and building new molecules and energy\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eAging is a multidimensional process that is inevitable and complicated by the accumulation of harmful substances and contributes to the continuous loss of physiological function and biological mechanisms, giving Increased susceptibility to disease\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e. The aging process in bones is featured by the decreased bone formation and increased bone resorption. As a result, jaw bone mass will decrease and implant stability and longevity will be affected\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eAlthough studies have shown that CHNQD-00603 can promote osteogenic differentiation of BMSCs, there have been no reports on the effects of CHNQD-00603 on BMSCS senescence\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. Therefore, this study focuses on exploring whether and how CHNQD-00603 protects BMSCs from senescence induced by D-gal. Finally, we demonstrated that CHNQD-00603 promotes autophagy through the AKT/ERK/mTOR signaling pathway to inhibit D-gal-induced senescence.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eIsolation and identification of BMSCs\u003c/h2\u003e \u003cp\u003eTwo-month-old female Sprague-Dawley rats were used to isolate the BMSCs. The rats were anesthetized with 10% chloral hydrate and then soaked in 75% alcohol for disinfection. The femur and tibia were separated under sterile conditions. The bone marrow cavity was rinsed with alpha minimum essential medium (α-MEM) and the cells were harvested, planted in culture flyers, plated in a culture flask, and cultured overnight in a 37℃ incubator with 5% CO2. The culture medium was changed every three days, and the third passage was used for cell identification. BMSCs surface markers, including CD90, CD29, CD11b, and CD45, were detected by flow cytometry. The whole animal experimental protocol was approved by the Ethics Committee of the affiliated hospital of Qingdao University.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eAlizarin Red Staining\u003c/h2\u003e \u003cp\u003eBMSCs were cultured with an osteogenic induction solution for 3 weeks, and the induction solution was changed every 3 days. After induction, fixation was performed with 4% paraformaldehyde, and alizarin red staining for 30 min, and the formation of calcified nodules were observed under a microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eOil-Red O Staining\u003c/h2\u003e \u003cp\u003eBMSCs were incubated in an adipose differentiation medium for 3 weeks, and the fluid was changed according to the instructions. After induction, oil red O staining was performed after fixation with 4% paraformaldehyde, and lipid droplet formation was observed under a microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eCell Viability Assay\u003c/h2\u003e \u003cp\u003eCell viability analysis was performed using the Cell Counting Kit-8 reagent (CCK-8, Biyuntian, China). The third-generation BMSCs were seeded into a 96-well plate at a density of 7×10\u003csup\u003e3\u003c/sup\u003e cells/well and cultured for 24 h. Then the medium was replaced with different concentrations of D-gal (0 mmol/L, 10 mmol/L, 50 mmol/L, 100 mmol/L, 200 mmol/L, 400 mmol/L, Mac, China) and incubated at 37°C for another 48 h. According to the instructions, the media were removed, then mixing CCK-8 was added to each well and incubated at 37°C for 2 h. The absorbance was measured at a wavelength of 450 nm using a microplate reader to assess cell viability.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eRNA isolation and Quantitative Real-Time PCR (qRT-PCR) assays\u003c/h2\u003e \u003cp\u003eRNA extraction and cDNA synthesis: Total RNA was extracted from BMSCs using TRIzol reagent (ThermoFisher Scientific) and used for the synthesis of first-strand cDNAs by A PrimeScript RT (TaKaRa) reagent kit. cDNA was subjected to Quantitative PCR analysis. Real-time PCR (RT-PCR) assays were conducted using SYBR GREEN PCR Master Mix (Takala, Japan) on a Bio-Rad CFX96 thermal cycler GAPDH was used as a reference gene. The primers are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003c/colgroup\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer set\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward primer\u003c/p\u003e \u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse primer\u003c/p\u003e \u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eP16\u003c/p\u003e \u003cp\u003eP21\u003c/p\u003e \u003cp\u003eRunx2\u003c/p\u003e \u003cp\u003eALP\u003c/p\u003e \u003cp\u003eOPN\u003c/p\u003e \u003cp\u003eOCN\u003c/p\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCGCTCGTACCCCGATACAG\u003c/p\u003e \u003cp\u003eCTGGTGGCGTAGGCAAGAGT\u003c/p\u003e \u003cp\u003eGCCGGGAATGATGAGAACTACT\u003c/p\u003e \u003cp\u003eACCGAATGCTGCACGACAA\u003c/p\u003e \u003cp\u003eCCTTCACTGCCAGCACACAA\u003c/p\u003e \u003cp\u003eAGGACCCTCTCTCTGCTCACTCT\u003c/p\u003e \u003cp\u003eATGCCGCCTGGAGAAACC\u003c/p\u003e \u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCGCTCGTACCCCGATACAG\u003c/p\u003e \u003cp\u003eGACCTGCTGTGTCGAGAATATCC\u003c/p\u003e \u003cp\u003eAGGATTTGTGAAGACCGTTATGG\u003c/p\u003e \u003cp\u003eCCCCGCCATGGACTTTAGTA\u003c/p\u003e \u003cp\u003eCTGTGGCATCGGGATACTGTT\u003c/p\u003e \u003cp\u003eGAGGTAGCGCCGGAGTCTATT\u003c/p\u003e \u003cp\u003eGCATCAAAGGTGGAAGAATGG\u003c/p\u003e \u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/table\u003e\u003c/div\u003e \u003cp\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot (WB) assay\u003c/h2\u003e \u003cp\u003eThe BMSCs were extracted using RIPA buffer (Beyotime Biotechnology, Shanghai, China) containing a protease inhibitor cocktail. The protein concentration was measured with a BCA kit (Solarbio, Beijing, China). Proteins were separated through 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (Solarbio, Beijing, China), and then transferred to PVDF membranes (Sigma-Aldrich, China). After blocking with 5% non-fat milk, the membranes were incubated with the primary antibodies GAPDH(1:2000; Elabscience, cat. no. E-AB-20059, China), P62 (1:1000; Catalog No.AF5484; Affinity Biosciences), LC3(1:1000; Proteintech, cat. no. 16400-1-AP, China), AKT (1:1000; Cell Signaling Technology, cat. no.C67E7 China), P-AKT(1:1000; Cell Signaling Technology, cat. no.D25E6 China), ERK (1:1000; Cell Signaling Technology, cat. no.137F5 China), P-ERK(1:2000; Cell Signaling Technology, cat. no.D13.14.4E China), overnight at 4 ◦ C and then incubated for 1h at 37℃ with secondary antibodies, anti-Rabbit IgG (1:10000, 1:10,000; Proteintech, cat. no. 10285-1-AP). Finally, images were acquired using ChemiDoc Touch Imaging System (BioRad). The bands were quantified by densitometry using Image J software (National Institutes of Health).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eSenescence-Associated β-Galactosidase (SA-β-Gal) Staining\u003c/h2\u003e \u003cp\u003eThe SA-β-gal activity was measured with a staining kit (Beyotime, China) following the manufacturer’s protocols. After washing with PBS three times, fixed with fixative for 15 min and then incubated with 1 mL SA-β-gal staining working fluid at 37 ° C overnight. Finally, SA-β‐gal‐positive cells, stained blue, were randomly imaged. The number of blue SA-β-gal-positive cells was calculated.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eAlkaline phosphatase (ALP) staining\u003c/h2\u003e \u003cp\u003eAfter culturing in the osteogenesis-inducing media for 7 days, BMSCs were washed with PBS three times and fixed with 4% paraformaldehyde for 15 minutes. After washing, the cells were stained using an alkaline phosphatase kit (Beyotime, Shanghai, China) according to the manufacturer's instructions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eReactive oxygen species (ROS) detection\u003c/h2\u003e \u003cp\u003eROS in BMSCs were evaluated by using a reactive oxygen species detection kit. After the BMSCs were treated with the method, the medium was replaced by Diluted DCFH-DA. Incubate in the cell incubator at 37℃ for 20 minutes. Then, the cells were washed three times with serum-free cell culture solution and the images of the cells were taken by the fluorescence microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eTransmission Electron Microscopy(TEM)\u003c/h2\u003e \u003cp\u003eBMSCs were treated with D-gal for 48h, then treated with or without CHNQD-00603 for 7 days. Then, the treated cells were fixed in 2.5% glutaraldehyde (Solarbio). The next steps were performed by Servicebio Company, and a transmission electron microscope was used to observe the results.\u003c/p\u003e \u003c/div\u003e "},{"header":"Result","content":"\u003cp\u003e \u003cb\u003eDetermination of BMSCs surface markers and differentiation potential.\u003c/b\u003e \u003c/p\u003e\u003cp\u003eThe surface antigens of BMSCs were detected by flow cytometry. The results showed that CD90 and CD29 were positive, and CD11b and CD45 were negative, as shown in Figure.1A. The primary BMSCs on the 5th day of growth were long spindle-shaped and adherent ( Figure.1B ). Alizarin red and oil-red O staining after osteogenesis and lipid formation respectively revealed calcified nodules and lipid droppings in BMSCs (Figure.1C, D). The above results proved that BMSCs were successfully extracted and cultured.\u003c/p\u003e\u003cp\u003e \u003cb\u003eD-gal induces BMSCs Senescence.\u003c/b\u003e \u003c/p\u003e\u003cp\u003eD-galactose (D-gal)-induced aging model offers a very similar picture to that which occurs in natural aging and is widely used in the study\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. Different types of cells respond differently to D-gal concentrations that cause senescence. As a result, we built a model of D-gal-induced senescence in BMSCs. It is well known that β-galactosidase (SA-β-gal) is a metabolic marker of senescence. The activity of SA-β-gal was observed by staining with SA-β-gal. To determine the optimal concentration of D-gal to induce BMSCs senescence, SA-β-gal staining, and cell viability assays were performed in this experiment. As shown in Figure.2A, B, compared with the control group, the number of SA-β-gal\u003csup\u003e+\u003c/sup\u003e cells in the D-gal-induced group increased in a dose-dependent manner. Additionally, as D-gal concentration increased, cell viability decreased significantly (Figure.2C). Based on these results, the experimental group with very high numbers of SA-β-gal\u003csup\u003e+\u003c/sup\u003e cells and a relatively small decrease in cell viability meets the requirements. Therefore, 200umol/L of D-gal was used to construct the aging model for BMSCs.\u003c/p\u003e\u003cp\u003e \u003cb\u003eCHNQD-00603 attenuated D-gal-induced senescence of BMSCs.\u003c/b\u003e \u003c/p\u003e\u003cp\u003eOur previous experiments showed that CHNQD-00603 could promote osteogenic differentiation of bone marrow mesenchymal stem cells. Surprisingly, we further found that the target of CHNQD-00603 was closely related to aging by GO-Kegg bioinformatics analysis (Figure.3A). To investigate the effect of CHNQD-00603 on senescent BMSCs, which were induced by D-gal (200mmol/L) and treated with or without CHNQD-00603 (1µg/mL)\u003csup\u003e15, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e, SA-β-gal staining was used to detect SA-β-gal\u003csup\u003e+\u003c/sup\u003e cells. Compared with the control group, the number of SA-β-gal\u003csup\u003e+\u003c/sup\u003e cells in BMSCs induced by D-gal increased significantly, but the number of SA-β-gal\u003csup\u003e+\u003c/sup\u003e cells decreased after the CHNQD-00603 intervention (Figure.3B). Next, we also examined the expression of the aging-related genes p16 and p21. Compared with the D-gal alone, CHNQD-00603 reduced the expression of p16 and p21 (Figure.3C). Subsequently, the osteogenesis-related gene, including RUNX2, ALP, OPG, and OCN was determined by ALP staining and qRT-PCR. The results showed that the D-gal inhibited the osteogenesis of BMSCs, and CHNQD-00603 significantly alleviated the inhibitory effect of D-gal on osteogenesis (Figure.3D, E).\u003c/p\u003e\u003cp\u003e \u003cb\u003eCHNQD-00603 increased the level of autophagy in BMSCs induced by D-gal.\u003c/b\u003e \u003c/p\u003e\u003cp\u003ePrevious experiments have shown that CHNQD-00603 can improve the autophagy level in BMSCs. More and more studies have shown that autophagy is associated with diseases such as aging and abnormal bone metabolism\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. As shown in As shown in Figure.4A, B, the results of WB showed that the expression levels of LC3 were significantly up-regulated by treatment with CHNQD-00603, However, the expression levels of P62 were significantly reduced. Additionally, we analyzed the level of mature autophagosomes by Transmission electron microscopy (TEM). There was a significant increase in autophagosomes in BMSCs treated with CHNQD-00603 compared to the untreated group (Figure.4C). To determine the role of CHNQD-00603-induced autophagy in BMSCs senescence, 3-methyladenine (3-MA) the established autophagy inhibitor, was applied. 3-MA can significantly inhibit autophagy as shown in Figure.4D. In addition, reactive oxygen species (ROS) in BMSCs treated with D-gal increased significantly, but ROS decreased significantly after CHNQD-00603 treatment, as shown in Figure.4E. This indicates that ROS is also involved in the process of BMSCs senescence regulated by CHNQD-00603.\u003c/p\u003e\u003cp\u003e \u003cb\u003eCHNQD-00603 induced autophagy via AKT/ERK/mTOR signaling pathways.\u003c/b\u003e \u003c/p\u003e\u003cp\u003eAKT is a key signaling molecule in the PI3K/AKT/mTOR signaling pathway, which has a pivotal role in the regulation of cell proliferation, differentiation, and survival under normal physiologic and pathophysiological processes\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. Constitutively active ERK also traffics to autophagy\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. To clarify whether CHNQD-00603 affects the autophagy level of senescent BMSCs through AKT/ERK/mTOR signaling pathway, we first detected the protein expression of p-AKT, p-ERK, and p-mTOR in senescent BMSCs treated with CHNQD-00603. Western blot results showed that the expression of p-AKT and p-ERK was significantly increased, while the expression of p-mTOR was decreased(Figure.5A). Therefore, we deduced that AKT/ERK/mTOR signaling pathways may be involved in the process of CHNQD-00603 activating autophagy in senescent BMSCs. To further reveal the regulatory effect of CHNQD-00603 on the AKT/ERK/mTOR signaling pathway, senescent BMSCs were treated with SC79 and TBHQ (AKT and ERK Agonists), respectively. Western blot results showed that compared with CHNQD-00603 alone treatment group, SC79, and TBHQ treatment effectively increased the phosphorylation levels of AKT and ERK, and decreased the phosphorylation level of mTOR.The results of western blotting suggested that SC79 and TBHQ decreased the level of autophagy-related protein of LC3, while the expression of p62 was enhanced (Figure.5B, D). In addition, qRT-PCR data showed that the expression of senescence-associated mRNAs (p16 and p21) was negatively correlated with autophagy levels (Figure.5C, E). The above experimental results showed that CHNQD-00603 activated autophagy through AKT/ERK/mTOR signaling pathway and inhibited the senescence of BMSCs\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe self-renewal and differentiation ability of BMSCs makes them play an important role in the maintenance, renewal, and reconstruction of bone tissue. However, more and more evidence shows that the aging of BMSCs will affect their normal function, which may eventually lead to bone loss, bone deficiency, bone tissue defect repair and reconstruction difficulties, and other problems. Surprisingly, based on previous studies, we further found that CHNQD-00603 can promote autophagy through AKT/ERK/mTOR signaling pathway, inhibit the senescence of BMSCs, and promote the osteogenic differentiation of BMSCs (Figure.6).\u003c/p\u003e \u003cp\u003eDue to its special environment of high salt, high pressure, low oxygen, and oligotrophic, the ocean has nurtured many marine organisms whose structure and function are different from those of terrestrial products. The relationship between marine products and diseases and the underlying molecular mechanism has generated tremendous interest over the years. In this experiment, we used the marine product derivative CHNQD-00603 for the first time, which is a series of 4-phenyl-2 (1H)-quinolinone natural products isolated from gorgonian-derived fungus Scopulariopsis sp. by our co-operation group\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. In our previous experiments, we not only found that CHNQD-00603 can regulate autophagy in BMSCs but also predicted possible target genes through the CHNQD-00603 structural formula on the Swiss TargetPrediction database platform. In this experiment, we performed GO enrichment analysis on the DAVID database and found that CHNQD-00603 may be related to aging, cytoplasm, nucleus, etc. Therefore, we speculate that CHNQD-00603 may affect the aging of BMSCs.\u003c/p\u003e \u003cp\u003eCell senescence is a cell cycle arrest leading to decreased cell function and resilience. This is not only reflected in the increased expression of aging-related molecules including p16, p21, and β-galactosidase at the molecular level. At the cellular level, it can be manifested as a weakened or subsided function\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. For example, the expression of osteogenic-related factors RUNX2, ALP, OPN, and OCN decreased in BMSCS. In our study, we observed that the number of SA-β-gal positive cells increased, and the mRNA expression of p16 and p21 increased significantly in O-BMSCs induced by D-gal. However, ALP staining and mRNA expression of RUNX2, ALP, OPN, and OCN were significantly reduced in O-BMSCs. These results indicate that the osteogenic differentiation ability of senescent BMSCs is weakened. Interestingly, in senescent BMSCs after CHNQD-00603 treatment, the number of SA-β-gal positive cells decreased, the mRNA expression of p16 and p21 decreased, ALP staining and the mRNA expression of RUNX2, ALP, OPN, and OCN decreased. This indicates that CHNQD-00603 inhibits the senescence of BMSCs to some extent. Based on these findings, we conclude that CHNQD-00603 can inhibit the senescence of BMSCs and enhance osteogenic differentiation ability.\u003c/p\u003e \u003cp\u003eAutophagy is a self-degrading system with multiple functions and plays an important role in maintaining the balance of bone metabolism\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. Many signaling molecules play a role in autophagy. When cells are induced by various intracellular and extracellular stimuli, ATG13 induces ULK1 to the pre-autophagosome structure (PAS), and then almost all autophagy-related (Atg) proteins are aggregated on the PAS\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. Some mammalian cells have homologs of yeast Atg8, such as LC3, GATE16, GABARAP, and ATG8L. In mammal cells, LC3 has been studied and characterized as a marker of autophagosomes\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. The P62, also known as sequestosome 1 (SQSTM1), is a selective substrate of autophagy. p62/SQSTM1 can directly interact with LC3, leading to the specific degradation of p62 by autophagy. Therefore, the p62 level has been used as a marker of autophagy inhibition or autophagy degradation defects\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. 3-MA (3-methyladenine) is an inhibitor of class I and class III PtdIns 3-kinase, which results in autophagy inhibition due to the suppression of class III PtdIns 3-kinase\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. Our data showed that CHNQD-00603 triggered autophagy in senescent BMSCs, inducing autophagosome formation, increasing LC3II expression, and decreasing P62 expression. Nevertheless, autophagy inhibitor 3-MA could attenuate the effect of CHNQD-00603 on aging BMSCs. These results demonstrate that CHNQD-00603 inhibits BMSCs senescence by autophagy. Nonetheless, the mechanism of CHNQD-00603 to regulate autophagy in senescence BMSCs is not clear.\u003c/p\u003e \u003cp\u003eSeveral molecular and signaling pathways play a crucial role in regulating autophagy. We focused on AKT and ERK. AKT is a key signaling molecule in the PI3K/AKT/mTOR signaling pathway, which has a pivotal role in the regulation of cell proliferation, differentiation, and survival under normal physiologic and pathophysiological processes\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. Constitutively active ERK1/2 also traffics to autophagy\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. CHNQD-00603 treated O-BMSCs decreased the phosphorylated expression of AKT and ERK, and finally activated autophagy. To further verify the role of AKT/ERK/mTOR in the regulation of autophagy by CHNQD-00603, SC79(AKT agonist) and TBHQ (ERK agonist) were used to interfere with senescent BMSCs, respectively. Our results demonstrated that AKT/ERK/mTOR was regulated by CHNQD-00603 and that their specific agonist SC79 and ERK mitigated CHNQD-00603-elicited autophagy, thereby verifying the AKT/ERK/mTOR molecular network's positive participation in the regulation of autophagy by CHNQD-00603 in aging BMSCs.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn conclusion, our current study revealed for the first time that CHNQD-00603 can restrain BMSCs senescence by enhancing autophagy through the AKT/ERK/mTOR signaling pathway. These findings suggest that CHNQD-00603 may be a promising method to improve the function of senescent BMSCs and improve the osseointegration of implants in the elderly.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThanks to Professor Changlun Shao of the Ocean University of China for his support of this experiment.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe raw data supporting the conclusions of this article will be made available on request to the corresponding author by email.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was funded by the National Natural Science Foundation of China (No.42176096, 42176097), Natural Science Foundation of Shandong Province (ZR2021MD065), Traditional Chinese Medicine Scientific Research Project of Qingdao (2020-zyy060), Qingdao Outstanding Health Professional Development Fund, and Qilu Health Leading Talent Project.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of Interest Disclosure\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics Approval Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was conducted by the Declaration of Helsinki, and approved by the Research Ethics Committee of the affiliated hospital of Qingdao University.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eXX Yang: study conception and design, data collection, and writing the original draft. WH Ren: Data collection, writing, review \u0026amp; editing, and visualization. BY Peng: Data collection and writing\u0026mdash;review \u0026amp; editing. SM Li: Data collection and visualization. JJ Zheng：Data collection.K Sun：visualization. KQ Zhi: Supervision and funding acquisition. L Gao: Study conception and design, supervision, and funding acquisition.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBuser D, Sennerby L, De Bruyn H (2017) Modern implant dentistry based on osseointegration: 50 years of progress, current trends and open questions. Periodontol 2000 73:7\u0026ndash;21\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTolstunov L, Hamrick JFE, Broumand V, Shilo D, Rachmiel A (2019) Bone Augmentation Techniques for Horizontal and Vertical Alveolar Ridge Deficiency in Oral Implantology. Oral Maxillofac Surg Clin North Am 31:163\u0026ndash;191\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJensen SS, Terheyden H (2009) Bone augmentation procedures in localized defects in the alveolar ridge: clinical results with different bone grafts and bone-substitute materials. Int J Oral Maxillofac Implants 24:218\u0026ndash;236\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu D, Li K, Xie Y et al (2017) The combined effects of nanotopography and Sr ion for enhanced osteogenic activity of bone marrow mesenchymal stem cells (BMSCs). J Biomater Appl 31:1135\u0026ndash;1147\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo Q, Guo Q, Xiao Y, Li C, Huang Y, Luo X (2020) Regulation of bone marrow mesenchymal stem cell fate by long non-coding RNA. Bone 141:115617\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXie H, Cui Z, Wang L et al (2014) PDGF-BB secreted by preosteoclasts induces angiogenesis during coupling with osteogenesis. Nat Med 20:1270\u0026ndash;1278\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKolios G, Moodley Y (2013) Introduction to stem cells and regenerative medicine. Respiration 85:3\u0026ndash;10\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbdelmagid SM, Barbe MF, Safadi FF (2015) Role of inflammation in the aging bones. Life Sci 123:25\u0026ndash;34\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou X, Hong Y, Zhang H, Li X (2020) Mesenchymal Stem Cell Senescence and Rejuvenation: Current Status and Challenges. Front Cell Dev Biol 8:364\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi CS, Liu LT, Yang L, Li J, Dong X (2022) Chemistry and Bioactivity of Marine-Derived Bisabolane Sesquiterpenoids: A Review. Front Chem 10:881767\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlonso E, Alvari\u0026ntilde;o R, Leir\u0026oacute;s M et al (2016) Evaluation of the Antioxidant Activity of the Marine Pyrroloiminoquinone Makaluvamines. Mar Drugs. ;14\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhalifa SAM, Elias N, Farag MA et al (2019) Marine Natural Products: A Source of Novel Anticancer Drugs. Mar Drugs. ;17\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarroll AR, Copp BR, Davis RA, Keyzers RA, Prinsep MR (2022) Marine natural products. Nat Prod Rep 39:1122\u0026ndash;1171\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShao CL, Xu RF, Wang CY, Qian PY, Wang KL, Wei MY (2015) Potent Antifouling Marine Dihydroquinolin-2(1H)-one-Containing Alkaloids from the Gorgonian Coral-Derived Fungus Scopulariopsis sp. Mar Biotechnol (NY) 17:408\u0026ndash;415\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXin S, Li SM, Gao L et al (2021) CHNQD-00603 Promotes Osteogenic Differentiation of Bone Marrow Mesenchymal Stem Cells by the miR-452-3p-Mediated Autophagy Pathway. Front Cell Dev Biol 9:779287\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGlick D, Barth S, Macleod KF (2010) Autophagy: cellular and molecular mechanisms. J Pathol 221:3\u0026ndash;12\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMizushima N, Levine B, Cuervo AM, Klionsky DJ (2008) Autophagy fights disease through cellular self-digestion. Nature 451:1069\u0026ndash;1075\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCaram\u0026eacute;s B, Taniguchi N, Otsuki S, Blanco FJ, Lotz M (2010) Autophagy is a protective mechanism in normal cartilage, and its aging-related loss is linked with cell death and osteoarthritis. Arthritis Rheum 62:791\u0026ndash;801\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShirakabe A, Ikeda Y, Sciarretta S, Zablocki DK, Sadoshima J (2016) Aging and Autophagy in the Heart. Circ Res 118:1563\u0026ndash;1576\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang S, Deng Z, Ma Y et al (2020) The Role of Autophagy and Mitophagy in Bone Metabolic Disorders. Int J Biol Sci 16:2675\u0026ndash;2691\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong C, Song C, Tong F (2014) Autophagy induction is a survival response against oxidative stress in bone marrow-derived mesenchymal stromal cells. Cytotherapy 16:1361\u0026ndash;1370\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa Y, Qi M, An Y et al (2018) Autophagy controls mesenchymal stem cell properties and senescence during bone aging. Aging Cell. ;17\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAkhter F, Chen D, Akhter A, Yan SF, Yan SS (2021) Age-dependent accumulation of dicarbonyls and advanced glycation endproducts (AGEs) associates with mitochondrial stress. Free Radic Biol Med 164:429\u0026ndash;438\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee HC, Wei YH (2007) Oxidative stress, mitochondrial DNA mutation, and apoptosis in aging. Exp Biol Med (Maywood) 232:592\u0026ndash;606\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu R, Shen X, Si Y et al (2018) MicroRNA-31a-5p from aging BMSCs links bone formation and resorption in the aged bone marrow microenvironment. Aging Cell 17:e12794\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlejandro SP (2022) ER stress in cardiac aging, a current view on the D-galactose model. Exp Gerontol 169:111953\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang J, Liu L, Ding Z, Luo Q, Ju Y, Song G (2021) Exogenous NAD(+) Postpones the D-Gal-Induced Senescence of Bone Marrow-Derived Mesenchymal Stem Cells via Sirt1 Signaling. Antioxidants (Basel). ;10\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQi M, Zhang L, Ma Y et al (2017) Autophagy Maintains the Function of Bone Marrow Mesenchymal Stem Cells to Prevent Estrogen Deficiency-Induced Osteoporosis. Theranostics 7:4498\u0026ndash;4516\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBroda M, Millar AH, Van Aken O, Mitophagy (2018) A Mechanism for Plant Growth and Survival. Trends Plant Sci 23:434\u0026ndash;450\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGonzalez-Angulo AM, Blumenschein GR (2013) Jr. Defining biomarkers to predict sensitivity to PI3K/Akt/mTOR pathway inhibitors in breast cancer. Cancer Treat Rev 39:313\u0026ndash;320\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePapadimitrakopoulou V (2012) Development of PI3K/AKT/mTOR pathway inhibitors and their application in personalized therapy for non-small-cell lung cancer. J Thorac Oncol 7:1315\u0026ndash;1326\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKlionsky DJ, Baehrecke EH, Brumell JH et al (2011) A comprehensive glossary of autophagy-related molecules and processes (2nd edition). Autophagy. ;7: 1273\u0026ndash;1294\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBirch J, Gil J (2020) Senescence and the SASP: many therapeutic avenues. Genes Dev 34:1565\u0026ndash;1576\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMilanovic M, Fan DNY, Belenki D et al (2018) Senescence-associated reprogramming promotes cancer stemness. Nature 553:96\u0026ndash;100\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim KH, Lee MS (2014) Autophagy\u0026ndash;a key player in cellular and body metabolism. Nat Rev Endocrinol 10:322\u0026ndash;337\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSuzuki K, Kirisako T, Kamada Y, Mizushima N, Noda T, Ohsumi Y (2001) The pre-autophagosomal structure organized by concerted functions of APG genes is essential for autophagosome formation. Embo j 20:5971\u0026ndash;5981\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKabeya Y, Mizushima N, Yamamoto A, Oshitani-Okamoto S, Ohsumi Y, Yoshimori T (2004) LC3, GABARAP and GATE16 localize to autophagosomal membrane depending on form-II formation. J Cell Sci 117:2805\u0026ndash;2812\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBj\u0026oslash;rk\u0026oslash;y G, Lamark T, Brech A et al (2005) p62/SQSTM1 forms protein aggregates degraded by autophagy and has a protective effect on huntingtin-induced cell death. J Cell Biol 171:603\u0026ndash;614\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMathew R, Karp CM, Beaudoin B et al (2009) Autophagy suppresses tumorigenesis through elimination of p62. Cell 137:1062\u0026ndash;1075\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"CHNQD-00603, Senescence, Bone marrow mesenchymal stem cells, Aging, Autophagy, AKT/ERK/mTOR signaling pathway","lastPublishedDoi":"10.21203/rs.3.rs-4229655/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4229655/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eObjective\u003c/h2\u003e \u003cp\u003eMaxillofacial bone defect caused by the tumor and periodontal disease in the elderly will affect implant restoration. Bone marrow mesenchymal stem cells (BMSCs), as seed cells for bone regeneration, play an important role in the treatment of bone defects. The objective of this study was to investigate the effect and mechanism of marine derivative CHNQD-00603 on senescence BMSCs.\u003c/p\u003e\u003ch2\u003eMaterials and Methods\u003c/h2\u003e \u003cp\u003eBiological function of BMSCs was determined by flow cytometry, alizarin red and oil-red O. Transmission electron microscopy Western blot, qRT-PCR, and reactive oxygen species detection were used to evaluate the effects of CHNQD-00603 on autophagosomes, autophagy-related molecules, senescence-related indicators, and ROS in aging BMSCs. The mechanism of CHNQD-00603 inhibiting BMSCs aging was detected by Western blot and qRT-PCR.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eIn this study, CHNQD-00603 increased the level of autophagy, and decreased the level of ROS in senescence BMSCs. In addition, CHNQD-OO603 decreased AKT/ERK phosphorylation and increased mTOR phosphorylation. The agonists of AKT and ERK can increase the mRNA expression of age-related genes p16 and p21.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eOur findings revealed that CHNQD-OO603 inhibits BMSCs senescence via the AKT/ERK/mTOR signaling pathway. This provides a potential idea for the treatment of insufficient jaw volume in the elderly.\u003c/p\u003e","manuscriptTitle":"Marine derivative CHNQD-00603 reverses bone marrow mesenchymal stem cells senescence by enhancing autophagy through the AKT/ERK/mTOR signaling pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-11 08:52:11","doi":"10.21203/rs.3.rs-4229655/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"d94c527c-b5c4-4f3d-9e9f-0ba4a340909d","owner":[],"postedDate":"April 11th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-04-15T08:17:08+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-11 08:52:11","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4229655","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4229655","identity":"rs-4229655","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}