Delay in Primordial Germ Cell Migration in Adamts9 Knockout Zebrafish

Delay in Primordial Germ Cell Migration in Adamts9 Knockout Zebrafish | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Delay in Primordial Germ Cell Migration in Adamts9 Knockout Zebrafish Jonathan Carver, Yuanfa He, Yong Zhu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-151044/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 20 Apr, 2021 Read the published version in Scientific Reports → Version 1 posted 9 You are reading this latest preprint version Abstract Adamts9 (a disintegrin and metalloproteinase with a thrombospondin type 1 motif, member 9) is one of few metalloproteinases structurally conserved from C. elegans to humans and is indispensable in germ cell migration in invertebrates. However, adamts9’s roles in germ cell migration in vertebrates has not been examined. In the present study, we found zygotic expression of adamts9 started around germ ring stage and reached peak levels at 3 days post fertilization (dpf) in zebrafish. Germ cell migration completed within 24 hours in wildtype sibling, while a delay in germ cell migration was found at 15 and 24-hours post-fertilization (hpf) in the Adamts9 knockout (KO). However, this delayed effect of Adamts9 KO disappeared at 48 hpf. Our study suggests a conserved function of Adamts9 in germ cell migration among invertebrates and vertebrates. In addition, our results also suggest that Adamts9 is not essential for germ cell migration as reported in C. elegans , possibly due to expansion of Adamts family members and compensatory roles from another metalloproteinase in vertebrates. Further studies are required in order to elucidate the functions and mechanisms of metalloproteinases in germ cell migration and gonad formation in vertebrates. General Cell Biology & Physiology Adamts9 Adamts Metalloproteinase Primordial Germ Cell Gonad formation Zebrafish Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Introduction Metalloproteinases serve essential roles in morphogenesis, tissue remodeling, and cell migration, all of which are important in normal or disease processes. From genome-wide association studies (GWAS), Adamts9 (a disintegrin and metalloproteinase with a thrombospondin type 1 motif, member 9) is associated with various human diseases, such as diabetes [ 1 – 3 ] , asthma [ 4 ] , arthritis [ 5 , 6 ] , artery calcification [ 7 , 8 ] , macular degeneration [ 9 ], and cognitive aging [ 10 ] . However, Adamts9-dependent physiological processes, adamts9 expression, and in vivo functions are still poorly understood mainly due to the lack of non-lethal vertebrate knockout animal models. The formation of a functional gonad is essential for animals to reproduce. A functional, adult ovary or testis develops from a juvenile bipotential gonad via several physiological processes that include cell migration, apoptosis, proliferation, and tissue remodeling. These processes are regulated precisely by various cellular signaling molecules and proteinases. Adamts9 is one of few metalloproteinases structurally conserved from C. elegans to humans [ 11 , 12 , 13 ] (Fig. 1 ), and it is involved in gonad formation in invertebrates [ 14 – 16 ] . In the knockout of Adamts9 ortholog, Gon-1 in C. elegans , germ cells do not migrate and the gonad develops as a disorganized mass of somatic and germ line tissues [ 14 – 16 ] . In Drosophila , the knockout of Adamts9 ortholog, AdamtTS-A, causes the mis-migration of collective cells, including germ cells [ 17 ] . However, due to embryonic lethality in the knockout Drosophila [ 17 ] and mouse models [ 18 , 19 ] , the functions and underlying mechanisms of Adamts9 during gonad development and formation are still unknown. It is also important to note that compared to invertebrates, members of the extracellular matrix (ECM) protein families and ADAMTS families expand dramatically in vertebrates [ 20 ] , which may lead to loss and gain of functions for Adamts9. Our previous studies suggest Adamts9 is critical for normal development of ovaries and ovulation in the zebrafish [ 21 – 24 ] . In the present study, we examined expression of Adamts9 in the embryonic development and its roles in germ cell migration. Zygotic expression of Adamts9 started around germ ring stage of embryos in zebrafish development. A delay in the migration of primordial germ cells was found during the gonadal development. Results Expression of Adamts9 in follicular cells and during embryonic development The expression of adamts9 transcript was low in immature oocytes, but dramatically increased in the follicular cells of stage IVb mature and preovulatory ovarian follicles. The expression of adamts9 decreased beneath the detection limit in stage V ovulated oocytes (Figs. 2 & 3 ). These results suggest adamts9 is expressed highly in somatic cells adjacent to mature germ cells, but not in the mature germ cells. Zygotic expression of adamts9 ’s transcript was under the detection limit between 1 cell and oblong stage of embryos (~ 4 hours post fertilization (hpf)), gradually increased around germ ring stage (~ 6 hpf), and reached a peak level around 3 days post fertilization (dpf) (Figs. 2 & 4 ). In corresponding to the expression of adamts9 transcripts, strong GFP expression driven by adamts9 promoters was observed in mature/preovulatory stage IVb follicles, while weak or no GFP expression was observed in immature follicles (stage I, III) or ovulated stage V oocytes. (Fig. 5 ). Zygotic expression of GFP was observed around bud stage of embryos, gradually increased, and become obvious around 8 somite stages of embryos, reached peak levels after 2 dpf (Figs. 6 – 8 ). Delay in primordial germ cell (PGC) migration in Adamts9 knockout (KO) We generated a zebrafish line with all the germ cells labeled with GFP in Adamts9 KO background ( adamts9 +/− ; Tg(vasa:GFP) ). We crossed these heterozygotes and obtained wildtype ( adamts9 +/+ ), heterozygotes ( adamts9 +/− ), and homozygotes ( adamts9 −/− ) sibling. PGC completed their migration and tightly clustered together at 24hpf in wildtype ( adamts9 +/+ ) fish. We found a delay in PGC migration in the Adamts9 KO ( adamts9 −/− ) zebrafish. PGCs spread in wider area in homozygotes than those in wildtype sibling at 15 and 24 hpf, i.e. delay in the migration of PGCs (Figs. 9 , 10 ). However, this delayed migration effect disappeared at 48 hpf (Fig. 11 ). In addition, all the PGCs migrated to the gonadal ridge despite the delay of germ cell migration in Adamts9 KO zebrafish between 15–24 hpf. There is no significant difference in the numbers of germ cells among different genotypes (Figs. 9 – 11 ). Discussion Matrix metalloproteinases (MMPs) are well known for their involvements in cell motility such as stem cell migration or cancer cell invasion [ 29 – 33 ] . ADAMTS is a subgroup of secreted zinc metalloproteases with several distinct domains separated from classical MMPs [ 34 , 35 ] . Studies of Adamts9 orthologs in C. elegans and Drosophila suggest this proteinase may release a signal or clear a path in order for PGC to migrate appropriately [ 14 – 17 ] in invertebrates. However, studies of possible involvements of metalloproteinases in PGC migration is still unknown in vertebrates [ 36 ] . In present study, we provided first evidence that a metalloproteinase, Adamts9, plays a role in the PGC migration in a vertebrate model. Several transgenic lines that label PGCs with fluorescent proteins and nearly transparent embryos made zebrafish an excellent choice for studying germ cell migration at a high resolution within a live organism [ 37 , 38 ] . Transgenic zebrafish lines in a different genetic background, including Adamts9 KO allowed studying the roles of Adamts9 in PGC development starting from the earliest stages of their development. We determined the expression of Adamts9 in early development. We also determined germ cell migration and numbers of germ cells in the homozygous Adamts9 KO in comparison to their wildtype and heterozygous siblings. Our results suggest a conserved function of Adamts9 in germ cell migration among vertebrates and invertebrates (Fig. 12 ). Our results also suggest that Adatms9 is not essential in the germ cell migration as demonstrated in C. elegans [ 14 – 16 ] (Fig. 12 ). Mutation study of Adamts9 ortholog, AdamTS-A also suggest that AdamTS-A is not essential for germ cell migration as some germ cells migrate appropriately, while others mis-migrate [ 17 ] . None of previous studies have reported survival or number of germs in the knockouts. In present study, we found the numbers of PGCs were not affected in Adamts9 KO zebrafish embryos. One single gene, the ancestor of Adamts, is found in the sponge corresponding to the origin of multi-cellularity and embryogenesis [ 20 ] . Up to 8 Adamts members are found in invertebrates. The Adamts family expanded dramatically during Metazoan evolution to 19 genes in vertebrates including zebrafish, mice, and humans [ 20 , 34 , 35 ] . The expansion of Adamts members in vertebrates may lead to gain and loss functions for each Adamts family member, which could explain diminished roles of Adamts9 in germ cell migration in vertebrates. On the other hand, heterozygotes ( adamts9 +/− ) was used to produce wildtype (+/+), heterozygote (+/-) and homozygote (-/-) embryos due to female infertility in homozygous KO. Therefore, we could not exclude the possibility that maternally deposited Adamts9 from heterozygous females may have exerted influence on PGC migration. Future studies, such as using conditional knockouts, will exclude such possibilities. Nevertheless, we found maternal Adamts9 expression disappeared prior to 24 hpf, while zygotic expression of Adamts9 began around germ ring stage of embryos (~ 6 hpf, He et al., in review). Delayed germ cell migration observed between 15 and 24 hpf, and no difference in germ cell migration at 48 hpf in Adamts9 KO suggest little or no role of maternal deposited Adamts9 if present in zebrafish. The expression of adamts9 orthologs (Gon-1 in C. elegans and AdamTS-A) was found in somatic cells adjacent to germ cells, but not in the germ cells [ 14 – 17 ] . However, we found adamts9 is expressed in early germ cells during early development or adult (Figs. 2 – 5 ), although the expression was low. Intriguingly, adamts9 expression decreased as follicle develop, disappeared in the germ then increased dramatically in the follicular cells. Adamts9 knockout in mice is lethal to embryos giving evidence of its essential role during development. It is highly expressed in the mouse genital tubercle and ovary [ 39 ] . However, due to embryonic lethality in the knockout Drosophila and mouse models [ 17 – 19 ] , the specific functions and underlying mechanisms of Adamts9 during gonad development, differentiation, and maintenance are still unknown. We generated zebrafish knockouts by targeting a CRISPR site prior to the enzymatic active site of Adamts9 [ 24 ] . No immune-positive signals were detected in the follicular cells of zebrafish Adamts9 knockout, whereas strong positive signals were detected in the follicular cells of wildtype and heterozygous sibling [ 24 ] . Any residual of truncated proteins of Adamts9, if present, would have no enzymatic activities as it lost its active metalloproteinase site in our zebrafish knockouts [ 24 ] . It is well established that the number of germ cells is important for gonadal development and sex determination in zebrafish [ 40 – 42 ] . A threshold number of germ cells is required for ovarian development. The depletion of germ cells in development or the adult will lead to the development of males [ 40 – 42 ] . We hypothesized that the unusual development of ovaries and male biased sexual ratio found in Adamts9 KO was due to a defect in germ cell migration, early germ cell survival, and/or proliferation of PGCs. Our results show that removing Adamts9 had no effects in the numbers of germ cells during early development (15–48 hpf). Further studies are required to elucidate the processes and mechanisms of Adamts9 at late time points that could lead to male biased sex ratio, abnormal ovary, and female infertility reported in Adamts9 KO [ 24 ] . Materials And Methods Animals The AB strain of zebrafish ( Danio rerio ) used here originated from the Zebrafish International Resource Center and then propagated in our lab following previously published guidelines [ 25 ] . All methods were carried out in accordance with relevant guidelines and regulations. The study was carried out in compliance with the ARRIVE guidelines. All experimental protocols have been approved by the Institutional Animal Care and Use Committee (IACUC) at East Carolina University. Collection of ovarian follicles and embryos and extraction of total RNA Various stages of AB wildtype embryos were collected at different times of development. Ovarian follicles were divided into different stages according to follicular size and morphological criteria [ 26 ] with a slight modification [ 21 – 23 ] . Stage I, III, IVb and V ovarian follicles were collected from 4-month old mature female AB wildtype fish between 7:00am and 8:30am (lights on photoperiod 8:30am-10:30pm). Samples were placed in 1.7mL RNase-free microcentrifuge tubes (GeneMate) containing 200 ml RNAzol (Molecular Research Center, Inc., OH. Catalog: RN 190) and homogenized immediately. Total RNA was extracted from homogenized solutions according to the manufacturer’s protocol. For each sample, cDNAs was synthesized using 2 mg total RNA and a high-capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific, Waltham, Massachusetts, USA, Catalog#4368814) following the manufacturer’s instructions. PCR amplification of adamts9 A set of PCR primer (forward: 5’-GCGGTACGCGTGGTAAAATC-3’; reverse: 5’- AGGCATGTGGACATAACGCA-3’) targeting 1181bp of 3’-UTR of adamts9 was used for PCR amplification. PCR amplification was carried out using a Taq DNA polymerase (New England Biolabs, Ipswich, Massachusetts, USA, Catalog#0273) with initial denaturation at 95°C for 2 minutes followed by 35 cycles of 30 seconds denaturation at 95°C, 30 seconds annealing at 65°C, and 60 seconds elongation at 68°C. Zebrafish eukaryotic translation elongation factor 1 alpha 1a ( eef1a1a ) showed stable expression in different stages of embryos and ovarian follicles, therefore was used as a housekeeping gene control. A set of PCR primers targeting 242 bp of coding region of eef1a1a (forward: 5’-AGTGTTGCCTTCGTCCCAAT-3’; Reverse:5’-CACACGACCCACAGGTACAG-3’) was used for PCR amplification. The efficiency of the PCR and authentic PCR products was confirmed by gel electrophoresis analysis. The PCR products were also cloned into pGEM-T easy vector and confirmed by Sanger sequencing. The concentrations of these plasmids were quantified on Nanodrop 2000 (Thermo Fisher Scientific, Waltham, Massachusetts, USA), serially diluted and used as DNA templates for generating standard curves described in the following paragraph. Real-time quantitative PCR (qPCR) amplification of adamts9 The levels of adamts9 transcripts were also determined by quantitative real-time PCR (qPCR) using SYBR green dye (Invitrogen) and a CFX Connect real-time thermal cycler (Bio-Rad Laboratories, Hercules, California, USA). The qPCR reaction was conducted with initial denaturation at 95 0 C for 3 minutes, followed by 45 cycles of 30 seconds denaturation at 95 0 C, 30 seconds annealing at 65 0 C, and 30 seconds extension at 72 0 C using the specific primers (Forward: 5’- CTGTCTGCGCGGTGATTCTA − 3’; Reverse: 5’- CTCTTGCAGGGGCGTGATTA − 3’) and GoTaq G2 DNA polymerase (Promega, Madison, Wisconsin, USA). Each PCR mixture (15 ml) consisted of 7.795ml DNase free water, 3 ml 5XGoTaq buffer, 1.5ml 25mM MgCl2, 0.3ml 10 mM dNTP mix, 0.15ml 10mM forward or reverse primer, 2 ml 5X diluted cDNA, 0.03 ml 100X SYBR green dye (final concentration 0.2X), and 0.075ml Taq. The transcript levels, expressed as absolute values (copies/mg total RNA), were determined using Ct values of samples and a standard curve generated from serial known concentrations of plasmid containing the target region of adamts9 . The efficiency of the PCR and authentic PCR products was further confirmed by analyses of melting curve, gel electrophoresis, and Sanger sequencing. Adamts9 expression analyzed by adamts9 promoter driven EGFP Detailed generation and characterization of EGFP expression driven by adamts9 promoters in zebrafish will be reported in a separate manuscript. Briefly, a 4.5-kb upstream of adamts9 start codon was cloned into pGEM-T easy vector (Promega), Sanger sequence confirmed, and then subcloned into a p5E-mcs entry vector. Multisite Gateway cloning (Invitrogen) was conducted with a 5’ entry vector containing 4.5 kb adamts9 promoter sequence, a middle entry vector containing EGFP, a 3’entry vector with stop poly A signal, and a destination vector that expresses a GFP selection marker specifically in the lens of eye [ 27 ] . In this final vector, the expression of EGFP is controlled by adamts9 promoters. Transgenic embryos with the insertion could be easily selected by the eye marker that displays green fluorescence at 48 hpf under a fluorescent dissecting microscope. About 500 nl mixture containing 20 ng/ml construct, 20 ng/ml Tol2 transposon, and phenol red indicator were microinjected into one cell stage of embryos. Multiple F0 transgenic embryos were selected based on the lens selection marker, raised to adults, crossed with AB wildtype, then produced several F1 lines. Subsequently, we established multiple F2 stable transgenic lines ( Tg(adamts9:GFP) ) with stable expression of EGFP in the zebrafish. Confocal imaging and analyses of GFP expression, migration and numbers of PGCs in Adamts9 knockout Fresh, live follicles collected from adult transgenic females ( Tg(adamts9:EGFP) ) were placed immediately in 15 mM HEPS buffer (pH 7.8) containing 50% L-15 medium (Fisher Scientific, #41-300-039). Follicles were pipetted up and down several times to separate individual follicles. Then, individual follicles of various developmental stages were placed on a depression glass slide and mounted in 1.2% low melting point agarose and immediately imaged by confocal microscopy. Live transgenic embryos of various developmental stages were collected by crossing male transgenic fish ( Tg(adamts9:EGFP) ) with AB females. Individual embryos were placed on a depression glass slide, mounted in 1.2% low melting point agarose, and immediately imaged by confocal microscopy. Five independent F1 transgenic lines were used to confirm similar expression among all the transgenic lines. Adamts9 knockout fish were generated and reported in our previous study [ 24 ] . Vasa is an RNA helicase expressed exclusively in primordial germ cells (PGCs) [ 28 ] . By using vasa promoter to drive EGFP expression, it is possible to visualize PGCs in zebrafish embryos with a laser confocal scanning microscope. Adamts9 knockout male fish ( adamts9 −/− ) were crossed with Tg(vasa:EGFP) . Embryos were collected, raised to adult, genotyped, and then in-crossed to obtain a transgenic line with all germ cells labeled with EGFP in Adamts9 knockout background ( adamts9 +/− ; Tg(vasa:GFP) ). This transgenic line was used for generating wildtype (+/+), heterozygote (+/-) and homozygote (-/-) embryos for confocal imaging of PGCs. Zebrafish embryos were collected at 15, 24, 48 hpf, fixed in 10% buffered formalin for four hours at room temperature. Embryos were subsequently washed with distilled water, a PBS solution, and then increasing concentrations of methanol, before storage in 100% methanol at -20ºC until analyses. Individual embryos were mounted onto a depression glass slide in 1.2% low melting point agarose and then imaged by confocal microscopy. Distance between two most distant PGCs was determined as an indicator of PGC migration using Zen 2.6 software. The number of germ cells and gonad size were determined with aid of computer software (Imaris, Bitplane Inc, Zürich, Switzerland) Statistical Analysis All results were presented as mean ± SEM. Two-sample two tailed t-test was used to analyze the effect of genotypes on germ cell migration, One-way ANOVA was used to analyze the gene expression. Statistical significance was set at p < 0.05. All Statistical analysis were conducted using GraphPad Prism. Declarations Authors’ contributions YZ conceived the project, generated Adamts9 knockout, designed experiments, wrote the manuscript. JC generated ( adamts9 -/- ; Tg(vasa:GFP) ), performed confocal imaging and analyses of migration and numbers of PGCs. YH and YZ generated Tg(adamts9:GFP) , performed confocal imaging, RT-PCR and qPCR. JC and YH contributed equally to the study. Additional Information The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Funding This work was supported by the NIH GM100461 to YZ. Acknowledgments We want to thank Dr. Wei Ge (University of Macau) for providing Tg ( vasa:GFP ) zebrafish, Drs. Fadi Issa and Paul Erickson for their assistance in confocal microscope analyses. References Zillikens, M. C. et al. Large meta-analysis of genome-wide association studies identifies five loci for lean body mass. Nat. Commun . 8 , doi: 10.1038/s41467-017-00031-7 (2017). Artunc-Ulkumen, B., Ulucay, S., Pala, H. G. & Cam, S. Maternal serum ADAMTS-9 levels in gestational diabetes: a pilot study. J. Matern. Fetal Neonatal Med . 30 , 1442-1445. doi: 10.1080/14767058.2016.1219717 (2017). Graae, A. S. et al . ADAMTS9regulates skeletal muscle insulin sensitivity through extracellular matrix alterations. Diabetes . 68 , 502-514. doi: 10.2337/db18-0418 (2019). Paulissen, G. et al . Role of ADAM and ADAMTS metalloproteinases in airway diseases. Respir. Res . 10 , doi: 10.1186/1465-9921-10-127 (2009) Yang, C. Y., Chanalaris, A. & Troeberg, L. ADAMTSand ADAM metalloproteinases in osteoarthritis - looking beyond the 'usual suspects'. Osteoarthritis Cartilage . 25 ,1000-1009. doi: 10.1016/j.joca.2017.02.791 (2017). Mead, T. J. & Apte, S. S. ADAMTSproteins in human disorders. Matrix Biol . 71-72 , 225-239. doi: 10.1016/j.matbio.2018.06.002 (2018). Suna, G. et al . Extracellular matrix proteomics reveals interplay of aggrecan and aggrecanases in vascular remodeling of stented coronary arteries. Circulation . 137 ,166-183. doi: 10.1161/CIRCULATIONAHA.116.023381 (2018). Franceschini, N. et al . GWAS and colocalization analyses implicate carotid intima-media thickness and carotid plaque loci in cardiovascularoutcomes. Nat. Commun . 9 , 5141. doi: 10.1038/s41467-018-07340-5 (2018). Singh, M. & Tyagi, S.C. Metalloproteinasesas mediators of inflammation and the eyes: molecular genetic underpinnings governing ocular pathophysiology. Int. J. Ophthalmol . 10 ,1308-1318. doi: 10.18240/ijo.2017.08.20 (2017). Rosenberg, G. A. Extracellular matrix inflammation in vascular cognitive impairment and dementia. Clin Sci (Lond) . 131 , 425-437. doi: 10.1042/CS20160604 (2017). Somerville, R. P. et al . Characterization of ADAMTS-9 and ADAMTS-20 as a distinct ADAMTS subfamily related to Caenorhabditis elegans GON-1. J. Biol. Chem . 278 , 9503-9513 (2003). Clark,M. E. et al. ADAMTS9, a novel member of the ADAM-TS/ metallospondin gene family. Genomics . 67 , 343-350 (2000). Kelwick, R., Desanlis, I., Wheeler, G. N. & Edwards, D. R. The ADAMTS (A Disintegrin and Metalloproteinase with Thrombospondin motifs) family. Genome Biol . 16 , 113. doi: 10.1186/s13059-015-0676-3 (2015). Blelloch,R. & Kimble,J. Control of organ shape by a secreted metalloprotease in the nematode Caenorhabditis elegans . Nature . 399 , 586-590 (1999). Blelloch,R., Anna-Arriola, S. S., Gao, D., Li, Y., Hodgkin, J. & Kimble,J. The gon-1 gene is required for gonadal morphogenesis in Caenorhabditis elegans . Dev. Biol . 216 , 382-393 (1999). Nishiwaki, K., Hisamoto, N., Matsumoto, K. A metalloprotease disintegrin that controls cell migration in Caenorhabditis elegans. Science , 288 , 2205–2208 (2000). Ismat,A., Cheshire, A. M., Andrew, D. J. The secreted AdamTS-A metalloprotease is required for collective cell migration. Development . 140 , 1981-1993. doi: 10.1242/dev.087908 (2013). Kern,C. B. et al . 2010 Reduced versican cleavage due to Adamts9haploinsufficiency is associated with cardiac and aortic anomalies. Matrix Biol . 29 , 304-16. doi: 10.1016/j.matbio.2010.01.005 (2010). Nandadasa, S., Nelson, C. M. & Apte, S. S. ADAMTS9-mediated extracellular matrix dynamics regulates umbilical cord vascular smooth muscle differentiation and rotation. Cell Rep . 11 , 1519-1528. doi: 10.1016/j.celrep.2015.05.005 (2015). Brunet, F. G. et al . The evolutionaryconservationof the a disintegrin-like and metalloproteinase domain with thrombospondin-1 motif metzincins across vertebrate species and their expression in teleost zebrafish. BMC Evol. Biol . 15 , doi: 10.1186/s12862-015-0281-9 (2015). Liu, D. T., Brewer, M. S., Chen, S., Hong, W. S. & Zhu, Y. Transcriptomic signatures for ovulation in vertebrates. Gen. Comp. Endocrinol . 247 , 74-86. doi: 10.1016/j.ygcen.2017.01.019 (2017). Liu,D. T., Carter, N. J., Wu, X. J., Hong, W. S., Chen S. X. & Zhu,Y. Progestin and nuclear progestin receptor are essential for upregulation of metalloproteinase in zebrafish preovulatory follicles. Front. Endocrinol . (Lausanne). 9 , 517. doi: 10.3389/fendo.2018.00517 (2018). Liu,D. T., Hong, W. S., Chen, S. X. & Zhu,Y. Upregulation of adamts9 by gonadotropin in preovulatory follicles of zebrafish. Mol. Cell. Endocrinol . 499 ,110608. doi: 10.1016/j.mce.2019.110608 (2020). Carter,N. J., Roach, Z. A., Byrnes, M. M. & Zhu,Y. Adamts9 is necessary for ovarian development in zebrafish. Gen. Comp. Endocrinol . 277 , 130-140. doi: 10.1016/j.ygcen.2019.04.003 (2019). Zhu, Y., Liu, D., Shaner, Z. C., Chen, S., Hong, W. & Stellwag, E. J. Nuclear progestin receptor (pgr) knockouts in zebrafishdemonstrate role for pgr in ovulation but not in rapid non-genomic steroid mediated meiosis resumption. Front Endocrinol (Lausanne). 6 , 37. doi: 10.3389/fendo.2015.00037 (2015). Selman, K., Wallace, R. A., Sarka, A. & QI, X. Stages of oocyte development in the zebrafish, Brachydanio rerio . Journal of Morphology 218, 203-224 (1993). Kurita, R et al . Suppression of lens growth by alphaA‐crystallin promoter‐driven expression of diphtheria toxin results in disruption of retinal cell organization in zebrafish. Dev. Biol . 255 ,113–127 (2003). Hartung,O., Forbes,M. M. & Marlow, F. L. Zebrafish vasa is required for germ-cell differentiation and maintenance. Mol. Reprod. Dev . 81 , 946-961. doi: 10.1002/mrd.22414 (2014). Kessenbrock, K . , Plaks, V. & Werb, Z. (2010) Matrix metalloproteinases: regulators of the tumor microenvironment. Cell , 141 , 52–67 (2010). Golan , K . , Vagima , Y . , Goichberg , P . , Gur‐Cohen , S . & Lapidot , T. MT1‐MMP and RECK: opposite and essential roles in hematopoietic stem and progenitor cell retention and migration. J . Mol . Med . (Berl) 89 , 1167–1174 (2011). Molyneaux , K . A . , Wang , Y . , Schaible , K . & Wylie , C. Transcriptional profiling identifies genes differentially expressed during and after migration in murine primordial germ cells. Gene Expr . Patterns . 4 , 167–181 (2004). Kucia , M . , Wu , W . & Ratajczak , M . Z. Bone marrow‐derived very small embryoniclike stem cells: their developmental origin and biological significance. Dev . Dyn . 236 , 3309–3320 (2007). 33. Gialeli, C., Theocharis, A. D. & Karamanos, N. K. Roles of matrix metalloproteinases in cancer progression and their pharmacological targeting. FEBS. J . 278, 16–27 (2011). 34. Apte, S. S. A disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motifs: the ADAMTS family. Int. J. Biochem. Cell Biol . 36, 981–985 (2004). Porter,S., Clark, I. M., Kevorkian, L. & Edwards, D. R. 2005 The ADAMTS metalloproteinases. Biochem. J . 386 (Pt 1):15-27 (2005). 36. Díez-Torre, A., Díaz-Núñez, M., Eguizábal, C., Silván, U. & Aréchaga, J. Evidence for a role of matrix metalloproteinases and their inhibitors in primordial germ cell migration. Andrology , 1,779-786. doi: 10.1111/j.2047-2927.2013.00109.x (2013). Raz,E. Primordial germ cell development in zebrafish. Semin. Cell, Dev. Biol . 13 , 489-495 (2002). Dumstrei, K., Mennecke, R. & Raz, E. Signaling pathways controlling primordial germ cell migration in zebrafish. J. CellSci . 117 , 4787-95 (2004). Jungers,K. A., Le Goff, C., Somerville, R. P. & Apte, S. S. Adamts9is widely expressed during mouse embryo development. Gene Expr Patterns . 5 , 609-617 (2005). Dranow, D. B., Tucker, R. P. & Draper, B. W. Germ cells are required to maintain a stable sexual phenotype in adult zebrafish. Dev. Biol . 376 , 43-50. doi: 10.1016/j.ydbio.2013.01.016 (2013). Dai, X., Jin, X., Chen, X., He, J. & Yin, Z. Sufficient numbers of early germ cells are essential for female sex development in zebrafish. PLoS One . 10 , e0117824. doi: 10.1371/journal.pone.0117824 (2015). Tzung, K. W. et al Earlydepletionof primordial germ cells in zebrafish promotes testis formation. Stem Cell Reports . 4 , 61-73. doi: 10.1016/j.stemcr.2014.10.011 (2015). Additional Declarations No competing interests reported. Supplementary Files SupplementalFigures.pdf Cite Share Download PDF Status: Published Journal Publication published 20 Apr, 2021 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Major revision 04 Mar, 2021 Reviewers agreed at journal 20 Feb, 2021 Reviews received at journal 16 Feb, 2021 Reviewers agreed at journal 29 Jan, 2021 Reviewers invited by journal 27 Jan, 2021 Editor assigned by journal 27 Jan, 2021 Editor invited by journal 21 Jan, 2021 Submission checks completed at journal 21 Jan, 2021 First submitted to journal 19 Jan, 2021 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-151044","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":8753130,"identity":"0e7b5d30-3fa8-4ef1-ab30-a5e26a4b6a96","order_by":0,"name":"Jonathan Carver","email":"","orcid":"","institution":"East Carolina University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jonathan","middleName":"","lastName":"Carver","suffix":""},{"id":8753131,"identity":"363aa991-6eab-49b0-b907-1ff369c066b3","order_by":1,"name":"Yuanfa He","email":"","orcid":"","institution":"East Carolina University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yuanfa","middleName":"","lastName":"He","suffix":""},{"id":8753132,"identity":"18ab0d06-b222-4cbc-a95e-3b3b15f53e8a","order_by":2,"name":"Yong Zhu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAnklEQVRIiWNgGAWjYDACCSD+AGEaEK+FcQbJWph5SNIiP7vHTNqmwi6xgb15mwRRWhjnnDGTzjmTnNjAc6yMOC3MEjlm0rltBxIbgAzitLCBtFj+A2qRf0OkFh6QFsYGkC08RGqRkEgrtuw5lmzcxpNWbEGUFvkZyRtv/Kixk+1nP7zxBlFagIAF7B42YpWDAPMHUlSPglEwCkbBCAQAgJwmvktrADkAAAAASUVORK5CYII=","orcid":"","institution":"Department of Biology, East Carolina University, Greenville, NC 27858, USA","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Yong","middleName":"","lastName":"Zhu","suffix":""}],"badges":[],"createdAt":"2021-01-19 18:59:14","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-151044/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-151044/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-021-88024-x","type":"published","date":"2021-04-20T19:03:48+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":5307245,"identity":"0bf877ef-920c-4fee-bb7a-e3254481dd97","added_by":"auto","created_at":"2021-01-27 16:36:45","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":68245,"visible":true,"origin":"","legend":"Conserved structure of Adamts9 from C. elegans to human. Different function domains are illustrated in different color. Green triangles show sites for two commercial antibodies (Triple Point Biologics, Inc., OR) generated against 180 peptide sequence of prodomain and metalloproteinase domain of human Adamts9, which share 41% and 86% sequence identity with zebrafish Adamts9, respectively. Red triangle shows CRISPR targeting site for generating zebrafish adamts9 knockout. Two mutant zebrafish lines (∆10 and ∆11) which generated premature stop codons before the enzymatic active site (at 573aa) were selected and propagated[24].","description":"","filename":"Fig1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-151044/v1/cf42e3b944071f2a8028f5fb.jpg"},{"id":5307388,"identity":"a0984969-8d7a-4892-9465-e3ca5f442d33","added_by":"auto","created_at":"2021-01-27 16:39:46","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":92134,"visible":true,"origin":"","legend":"Strong adamts9 expression in preovulatory follicular cells and developing embryos determined by RT-PCR. Top panel is adamts9 transcript analyzed by RT-PCR (35 cycles), bottom panel is expression of a house keep gene, eukaryotic translation elongation factor 1 alpha 1a (eef1a1a). M. NEB 1kb plus DNA ladder; 1. Ovary (fully grown immature follicles); 2. Preovulatory stage IVb follicles; 3. Ovulated stage V oocytes; 4. One cell stage embryos; 5. Four cell stage embryos; 6. Oblong stage embryos (~3.5 hpf, hours post fertilization); 7. Germ-ring stage embryos (~5.5 hpf); 8. Eight somite stage embryos (~11.5 hpf); 9. 24 hpf (hours post fertilization) embryos; 10. Two dpf (days post fertilization ) embryos; 11. Three dpf embryos; 12. Six dpf embryos; 13. Six wpf (weeks post fertilization) gonad. Please see supplemental figures 1 and 2 for full agarose gel images.","description":"","filename":"Fig2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-151044/v1/377e7d10ac1502ced918551f.jpg"},{"id":5307249,"identity":"aa8a6c07-29a1-44f5-acfb-e47e4a0730d5","added_by":"auto","created_at":"2021-01-27 16:36:46","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":84997,"visible":true,"origin":"","legend":"Strong adamts9 expression in preovulatory follicles, low or no expression in immature follicles or ovulated oocytes determined by real-time quantitative PCR (qPCR). Stage I, III and IVb preovulatory follicular cell enclosed oocytes and stage V ovulated oocytes were collected from mature AB wildtype females between 7-8:30 am (lights on 8:30am-10:30pm). Results were presented as mean ± SEM (n=5). Different letters above the error bars indicate that those groups are significantly different from each other at P \u003c 0.05.","description":"","filename":"Fig3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-151044/v1/ca408288f9459459b4bcbcbe.jpg"},{"id":5307120,"identity":"1a95f37e-733c-4703-ad5e-d0ca7e8db66d","added_by":"auto","created_at":"2021-01-27 16:33:45","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":132189,"visible":true,"origin":"","legend":"Zygotic expression of adamts9 in developing embryos determined by real-time quantitative PCR (qPCR). Results were presented as mean ± SEM (n=6). Different letters above the error bars indicate that those groups are significantly different from each other at P \u003c 0.05.","description":"","filename":"Fig4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-151044/v1/862ae39ed66434c7c401776b.jpg"},{"id":5307127,"identity":"032322ab-d770-42d7-acb7-cac016ae7fdf","added_by":"auto","created_at":"2021-01-27 16:33:46","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":795285,"visible":true,"origin":"","legend":"Strong expression of Adamts9 in preovulatory follicles, weak or no expression in immature ovarian follicles or ovulated oocytes in Adamts9 transgenic lines (Tg(adamts9:GFP)). The expression of Adamts9 was determined by EGFP expression driven by adamts9 promoters located in a 4.5 kb upstream sequence of adamts9 start codon. Representative confocal slice images of stage I (immature pre-vitellogenic), III (immature vitellogenic), IVb (mature \u0026 preovulatory) follicles and stage V ovulated oocytes were shown. Follicles or oocytes were confocal imaged under EGFP and transmit light (T-PMT) channels. Similar expression was confirmed in the follicles or oocytes of several F1 and F2 adult females from five independent transgenic lines. Scale bar: 10 µm (stage I); 100 µm (stages III, IVb, V).","description":"","filename":"Fig5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-151044/v1/74c9bfb009d45dc1a05cb268.jpg"},{"id":5307246,"identity":"b3a68d00-7e2f-4094-a0c7-12de2b30a2ef","added_by":"auto","created_at":"2021-01-27 16:36:46","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":933680,"visible":true,"origin":"","legend":"Expression of Adamts9 in F2 transgenic (Tg(adamts9:GFP)) embryos during embryonic development. The expression of Adamts9 was determined by EGFP expression driven by adamts9 promoters located in a 4.5 kb upstream sequence of adamts9 start codon. Representative confocal z-stack images of various stages of development embryos were imaged by a confocal microscope under EGFP or transmit light (T-PMT) channels. Similar expression was confirmed in multiple F2 embryos from five independent F1 transgenic lines (Tg(adamts9:GFP)). Scale bar: 200 µm.","description":"","filename":"Fig6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-151044/v1/bc450420dad52f47a781416d.jpg"},{"id":5307251,"identity":"dab30ece-fff7-4c95-8884-fdb50d16943f","added_by":"auto","created_at":"2021-01-27 16:36:46","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":148839,"visible":true,"origin":"","legend":"Representative confocal z-stack images of a F2 transgenic (Tg(adamts9:GFP)) embryo in comparison to a wildtype embryo at 10 hours post fertilization (hpf). The expression of Adamts9 was determined by EGFP expression driven by adamts9 promoters located in a 4.5 kb upstream sequence of adamts9 start codon. Same conditions were used for imaging transgenic or AB wildtype embryos under the EGFP and transmit light (T-PMT) channels. Scale bar: 100 µm.","description":"","filename":"Fig7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-151044/v1/d716813b75ae13d411449709.jpg"},{"id":5307122,"identity":"8e0057ad-d7a9-4734-a28b-bb4c9d150f29","added_by":"auto","created_at":"2021-01-27 16:33:45","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":327875,"visible":true,"origin":"","legend":"Strong Adamt9 expression in transgenic embryos. Representative confocal z-stack images of a F2 transgenic (Tg(adamts9:GFP)) embryo (panels A \u0026B) in comparison to a wildtype embryo (panels C \u0026 D) at 48 hours post fertilization (hpf). The expression of Adamts9 was determined by EGFP expression driven by adamts9 promoters located in a 4.5 kb upstream sequence of adamts9 start codon. Same conditions were used for imaging embryos under the EGFP, red (for monitoring autofluorescence), and transmit light (T-PMT) channels. Panels A and C are merged confocal z-stack images from all three channels, while panels B and D were confocal z-stack images from red channel. Scale bar: 400 µm. \n\n","description":"","filename":"Fig8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-151044/v1/b93dd47dac6cbcfcab763a9a.jpg"},{"id":5307525,"identity":"96d3767c-f880-44e4-bcb0-7ef2e71a1375","added_by":"auto","created_at":"2021-01-27 16:42:46","extension":"jpg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":332719,"visible":true,"origin":"","legend":"Delayed primordial germ cell (PGC) migration in Adamts9 knockout zebrafish at 15 hours-post fertilization (hpf). PGC is labeled with GFP by crossing Adamts9 KO with Tg(vasa:GFP). Distance between two most distant PGCs were determined as an indicator of PGC migration (See Fig.12 for detail). Showing average distance, number of PGC, or representative images of zebrafish embryos at 15 hours post fertilization (hpf) for wildtype (+/+), heterozygous (+/-), and homozygous (-/-) Adamts9 mutants. Embryos from 5 sets of parents were analyzed. The numbers on the left side of the forward slash is the number of embryos analyzed, and the numbers on the right side of the forward slash indicate sets of parents used for producing these embryos. Top left row are confocal images showing entire embryos with GFP labeled PGC at low magnification (scale bar: 200 µm). Bottom row are magnified confocal images of the embryos from the top (scale bar: 50 µm). ","description":"","filename":"Fig9.jpg","url":"https://assets-eu.researchsquare.com/files/rs-151044/v1/0774c99d545c309ee93d4ce1.jpg"},{"id":5307130,"identity":"a6621cbd-e14e-4b5b-a679-fd7a931ea625","added_by":"auto","created_at":"2021-01-27 16:33:46","extension":"jpg","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":295326,"visible":true,"origin":"","legend":"Delayed primordial germ cell (PGC) migration in Adamts9 knockout zebrafish at 24 hours-post fertilization (hpf). PGC is labeled with GFP by crossing Adamts9 KO with Tg(vasa:GFP). Distance between two most distant PGCs were determined as an indicator of PGC migration (See Fig.12 for detail). Showing average distance, number of PGC, or representative images of zebrafish embryos at 24 hours post fertilization (hpf) for wildtype (+/+), heterozygous (+/-), and homozygous (-/-) Adamts9 mutants. Embryos from 6 sets of parents were analyzed. The numbers on the left side of the forward slash is the number of embryos analyzed, and the numbers on the right side of the forward slash indicate sets of parents used for producing these embryos. Top left row are confocal images showing part of embryos with GFP labeled PGC at low magnification (scale bar: 200 µm). Bottom row are magnified confocal images of the embryos from the top (scale bar: 50 µm). ","description":"","filename":"Fig10.jpg","url":"https://assets-eu.researchsquare.com/files/rs-151044/v1/569bf03b1847ebe4b842d59b.jpg"},{"id":5307125,"identity":"88a0850d-e774-45f4-bb51-4f1880084df3","added_by":"auto","created_at":"2021-01-27 16:33:46","extension":"jpg","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":258591,"visible":true,"origin":"","legend":"No significant difference in the migration or number of primordial germ cell (PGC) in Adamts9 knockout zebrafish in comparison to wildtype sibling at 48 hours-post fertilization (hpf). PGC is labeled with GFP by crossing Adamts9 KO with Tg(vasa:GFP). Distance between two most distant PGCs were determined as an indicator of PGC migration (See Fig.12 for detail). Showing average distance, number of PGC, or representative images of zebrafish embryos at 24 hours post fertilization (hpf) for wildtype (+/+), heterozygous (+/-), and homozygous (-/-) Adamts9 mutants. Embryos from 4 sets of parents were analyzed. The numbers on the left side of the forward slash is the number of embryos analyzed, and the numbers on the right side of the forward slash indicate sets of parents used for producing these embryos. Top left row are confocal images showing part of embryos with GFP labeled PGC at low magnification (scale bar: 200 µm). Bottom row are magnified confocal images of the embryos from the top (scale bar: 50 µm). ","description":"","filename":"Fig11.jpg","url":"https://assets-eu.researchsquare.com/files/rs-151044/v1/57a3b95b124c3e17a2944bf8.jpg"},{"id":5307386,"identity":"002f836f-49ee-4ad2-aa3a-658616f6eeed","added_by":"auto","created_at":"2021-01-27 16:39:46","extension":"jpg","order_by":12,"title":"Figure 12","display":"","copyAsset":false,"role":"figure","size":134620,"visible":true,"origin":"","legend":"Schematic drawings show difference in the defects of germ cell migration in Adamts9 or its ortholog knockouts in C. elegans, Drosophila, and zebrafish models. Green dots denote primordial germ cells (PGC). Only the posterior gonad arm is shown for C. elegans. (A) PGCs migrate in wildtype C elegans, (B) no migration occurs in gon-1 mutant (modified from Blelloch \u0026 Kimble, 1999)[14,15]. (C) PGCs migrate correctly in wildtype Drosophila and clustered together at gonadal ridge at stage 16 embryo. (D) PGC mis-migrate in AdamTS-A knockout embryos (modified from Ismat et al., 2013)[17]. E-H. All PGC migrate toward gonadal ridge in zebrafish embryos, though these PGC were distributed in wider area (D2\u003eD1) in the Adamts9 knockouts at 15 hpf (hours post fertilization. E: wildtype; F: mutant) and 24 hpf (G: wildtype; H: mutant), i.e. delayed migration. However, this delayed migration disappeared at 48 hpf (see Figs.9-11 for detail).","description":"","filename":"Fig12.jpg","url":"https://assets-eu.researchsquare.com/files/rs-151044/v1/86312072ceb24ffd6b410db7.jpg"},{"id":13651828,"identity":"b2f478b4-5ee2-433a-b668-44fa1b872ac9","added_by":"auto","created_at":"2021-09-17 09:47:04","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1239367,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-151044/v1/df767a09-89a5-4615-90a3-01054d577782.pdf"},{"id":5307252,"identity":"37652d24-00f7-4b6a-a755-37cc6ea63704","added_by":"auto","created_at":"2021-01-27 16:36:46","extension":"pdf","order_by":14,"title":"","display":"","copyAsset":false,"role":"supplement","size":5066012,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementalFigures.pdf","url":"https://assets-eu.researchsquare.com/files/rs-151044/v1/d25c833fd9c692c7783ac9d3.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Delay in Primordial Germ Cell Migration in Adamts9 Knockout Zebrafish","fulltext":[{"header":"Introduction","content":" \u003cp\u003eMetalloproteinases serve essential roles in morphogenesis, tissue remodeling, and cell migration, all of which are important in normal or disease processes. From genome-wide association studies (GWAS), Adamts9 (a disintegrin and metalloproteinase with a thrombospondin type 1 motif, member 9) is associated with various human diseases, such as diabetes\u003csup\u003e[\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e, asthma\u003csup\u003e[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]\u003c/sup\u003e, arthritis\u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e, artery calcification\u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e, macular degeneration\u003csup\u003e[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e],\u003c/sup\u003e and cognitive aging\u003csup\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. However, Adamts9-dependent physiological processes, \u003cem\u003eadamts9\u003c/em\u003e expression, and \u003cem\u003ein vivo\u003c/em\u003e functions are still poorly understood mainly due to the lack of non-lethal vertebrate knockout animal models.\u003c/p\u003e \u003cp\u003eThe formation of a functional gonad is essential for animals to reproduce. A functional, adult ovary or testis develops from a juvenile bipotential gonad via several physiological processes that include cell migration, apoptosis, proliferation, and tissue remodeling. These processes are regulated precisely by various cellular signaling molecules and proteinases. Adamts9 is one of few metalloproteinases structurally conserved from \u003cem\u003eC. elegans\u003c/em\u003e to humans\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), and it is involved in gonad formation in invertebrates\u003csup\u003e[\u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e. In the knockout of Adamts9 ortholog, Gon-1 in \u003cem\u003eC. elegans\u003c/em\u003e, germ cells do not migrate and the gonad develops as a disorganized mass of somatic and germ line tissues\u003csup\u003e[\u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e. In \u003cem\u003eDrosophila\u003c/em\u003e, the knockout of Adamts9 ortholog, AdamtTS-A, causes the mis-migration of collective cells, including germ cells \u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. However, due to embryonic lethality in the knockout \u003cem\u003eDrosophila\u003c/em\u003e\u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e and mouse models\u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e, the functions and underlying mechanisms of Adamts9 during gonad development and formation are still unknown. It is also important to note that compared to invertebrates, members of the extracellular matrix (ECM) protein families and ADAMTS families expand dramatically in vertebrates \u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e, which may lead to loss and gain of functions for Adamts9.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eOur previous studies suggest Adamts9 is critical for normal development of ovaries and ovulation in the zebrafish\u003csup\u003e[\u003cspan additionalcitationids=\"CR22 CR23\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e. In the present study, we examined expression of Adamts9 in the embryonic development and its roles in germ cell migration. Zygotic expression of Adamts9 started around germ ring stage of embryos in zebrafish development. A delay in the migration of primordial germ cells was found during the gonadal development.\u003c/p\u003e "},{"header":"Results","content":" \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eExpression of Adamts9 in follicular cells and during embryonic development\u003c/h2\u003e \u003cp\u003eThe expression of \u003cem\u003eadamts9\u003c/em\u003e transcript was low in immature oocytes, but dramatically increased in the follicular cells of stage IVb mature and preovulatory ovarian follicles. The expression of \u003cem\u003eadamts9\u003c/em\u003e decreased beneath the detection limit in stage V ovulated oocytes (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e \u0026amp; \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). These results suggest \u003cem\u003eadamts9\u003c/em\u003e is expressed highly in somatic cells adjacent to mature germ cells, but not in the mature germ cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eZygotic expression of \u003cem\u003eadamts9\u003c/em\u003e\u0026rsquo;s transcript was under the detection limit between 1 cell and oblong stage of embryos (~\u0026thinsp;4 hours post fertilization (hpf)), gradually increased around germ ring stage (~\u0026thinsp;6 hpf), and reached a peak level around 3 days post fertilization (dpf) (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e \u0026amp; \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn corresponding to the expression of \u003cem\u003eadamts9\u003c/em\u003e transcripts, strong GFP expression driven by \u003cem\u003eadamts9\u003c/em\u003e promoters was observed in mature/preovulatory stage IVb follicles, while weak or no GFP expression was observed in immature follicles (stage I, III) or ovulated stage V oocytes. (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). Zygotic expression of GFP was observed around bud stage of embryos, gradually increased, and become obvious around 8 somite stages of embryos, reached peak levels after 2 dpf (Figs.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eDelay in primordial germ cell (PGC) migration in Adamts9 knockout (KO)\u003c/h2\u003e \u003cp\u003eWe generated a zebrafish line with all the germ cells labeled with GFP in Adamts9 KO background (\u003cem\u003eadamts9\u003c/em\u003e\u003csup\u003e\u003cem\u003e+/\u0026minus;\u003c/em\u003e\u003c/sup\u003e; \u003cem\u003eTg(vasa:GFP)\u003c/em\u003e). We crossed these heterozygotes and obtained wildtype (\u003cem\u003eadamts9\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e), heterozygotes (\u003cem\u003eadamts9\u003c/em\u003e\u003csup\u003e+/\u0026minus;\u003c/sup\u003e), and homozygotes (\u003cem\u003eadamts9\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e) sibling. PGC completed their migration and tightly clustered together at 24hpf in wildtype (\u003cem\u003eadamts9\u003c/em\u003e\u003csup\u003e+/+\u003c/sup\u003e) fish. We found a delay in PGC migration in the Adamts9 KO (\u003cem\u003eadamts9\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e) zebrafish. PGCs spread in wider area in homozygotes than those in wildtype sibling at 15 and 24 hpf, i.e. delay in the migration of PGCs (Figs.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e,\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003e). However, this delayed migration effect disappeared at 48 hpf (Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e11\u003c/span\u003e). In addition, all the PGCs migrated to the gonadal ridge despite the delay of germ cell migration in Adamts9 KO zebrafish between 15\u0026ndash;24 hpf. There is no significant difference in the numbers of germ cells among different genotypes (Figs.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e11\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e "},{"header":"Discussion","content":" \u003cp\u003eMatrix metalloproteinases (MMPs) are well known for their involvements in cell motility such as stem cell migration or cancer cell invasion\u003csup\u003e[\u003cspan additionalcitationids=\"CR30 CR31 CR32\" citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e. ADAMTS is a subgroup of secreted zinc metalloproteases with several distinct domains separated from classical MMPs\u003csup\u003e[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/sup\u003e. Studies of Adamts9 orthologs in \u003cem\u003eC. elegans\u003c/em\u003e and \u003cem\u003eDrosophila\u003c/em\u003e suggest this proteinase may release a signal or clear a path in order for PGC to migrate appropriately\u003csup\u003e[\u003cspan additionalcitationids=\"CR15 CR16\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e in invertebrates. However, studies of possible involvements of metalloproteinases in PGC migration is still unknown in vertebrates\u003csup\u003e[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]\u003c/sup\u003e. In present study, we provided first evidence that a metalloproteinase, Adamts9, plays a role in the PGC migration in a vertebrate model. Several transgenic lines that label PGCs with fluorescent proteins and nearly transparent embryos made zebrafish an excellent choice for studying germ cell migration at a high resolution within a live organism\u003csup\u003e[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]\u003c/sup\u003e. Transgenic zebrafish lines in a different genetic background, including Adamts9 KO allowed studying the roles of Adamts9 in PGC development starting from the earliest stages of their development. We determined the expression of Adamts9 in early development. We also determined germ cell migration and numbers of germ cells in the homozygous Adamts9 KO in comparison to their wildtype and heterozygous siblings. Our results suggest a conserved function of Adamts9 in germ cell migration among vertebrates and invertebrates (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e12\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eOur results also suggest that Adatms9 is not essential in the germ cell migration as demonstrated in \u003cem\u003eC. elegans\u003c/em\u003e\u003csup\u003e[\u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e12\u003c/span\u003e). Mutation study of Adamts9 ortholog, AdamTS-A also suggest that AdamTS-A is not essential for germ cell migration as some germ cells migrate appropriately, while others mis-migrate\u003csup\u003e[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. None of previous studies have reported survival or number of germs in the knockouts. In present study, we found the numbers of PGCs were not affected in Adamts9 KO zebrafish embryos.\u003c/p\u003e \u003cp\u003eOne single gene, the ancestor of Adamts, is found in the sponge corresponding to the origin of multi-cellularity and embryogenesis\u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e. Up to 8 Adamts members are found in invertebrates. The Adamts family expanded dramatically during Metazoan evolution to 19 genes in vertebrates including zebrafish, mice, and humans \u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/sup\u003e. The expansion of Adamts members in vertebrates may lead to gain and loss functions for each Adamts family member, which could explain diminished roles of Adamts9 in germ cell migration in vertebrates. On the other hand, heterozygotes (\u003cem\u003eadamts9\u003c/em\u003e\u003csup\u003e+/\u0026minus;\u003c/sup\u003e) was used to produce wildtype (+/+), heterozygote (+/-) and homozygote (-/-) embryos due to female infertility in homozygous KO. Therefore, we could not exclude the possibility that maternally deposited Adamts9 from heterozygous females may have exerted influence on PGC migration. Future studies, such as using conditional knockouts, will exclude such possibilities. Nevertheless, we found maternal Adamts9 expression disappeared prior to 24 hpf, while zygotic expression of Adamts9 began around germ ring stage of embryos (~\u0026thinsp;6 hpf, He et al., in review). Delayed germ cell migration observed between 15 and 24 hpf, and no difference in germ cell migration at 48 hpf in Adamts9 KO suggest little or no role of maternal deposited Adamts9 if present in zebrafish.\u003c/p\u003e \u003cp\u003eThe expression of adamts9 orthologs (Gon-1 in \u003cem\u003eC. elegans\u003c/em\u003e and AdamTS-A) was found in somatic cells adjacent to germ cells, but not in the germ cells\u003csup\u003e[\u003cspan additionalcitationids=\"CR15 CR16\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. However, we found \u003cem\u003eadamts9\u003c/em\u003e is expressed in early germ cells during early development or adult (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e), although the expression was low. Intriguingly, \u003cem\u003eadamts9\u003c/em\u003e expression decreased as follicle develop, disappeared in the germ then increased dramatically in the follicular cells.\u003c/p\u003e \u003cp\u003eAdamts9 knockout in mice is lethal to embryos giving evidence of its essential role during development. It is highly expressed in the mouse genital tubercle and ovary\u003csup\u003e[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]\u003c/sup\u003e. However, due to embryonic lethality in the knockout \u003cem\u003eDrosophila\u003c/em\u003e and mouse models\u003csup\u003e[\u003cspan additionalcitationids=\"CR18\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e, the specific functions and underlying mechanisms of Adamts9 during gonad development, differentiation, and maintenance are still unknown. We generated zebrafish knockouts by targeting a CRISPR site prior to the enzymatic active site of Adamts9\u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e. No immune-positive signals were detected in the follicular cells of zebrafish Adamts9 knockout, whereas strong positive signals were detected in the follicular cells of wildtype and heterozygous sibling\u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e. Any residual of truncated proteins of Adamts9, if present, would have no enzymatic activities as it lost its active metalloproteinase site in our zebrafish knockouts\u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eIt is well established that the number of germ cells is important for gonadal development and sex determination in zebrafish\u003csup\u003e[\u003cspan additionalcitationids=\"CR41\" citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]\u003c/sup\u003e. A threshold number of germ cells is required for ovarian development. The depletion of germ cells in development or the adult will lead to the development of males\u003csup\u003e[\u003cspan additionalcitationids=\"CR41\" citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]\u003c/sup\u003e. We hypothesized that the unusual development of ovaries and male biased sexual ratio found in Adamts9 KO was due to a defect in germ cell migration, early germ cell survival, and/or proliferation of PGCs. Our results show that removing Adamts9 had no effects in the numbers of germ cells during early development (15\u0026ndash;48 hpf). Further studies are required to elucidate the processes and mechanisms of Adamts9 at late time points that could lead to male biased sex ratio, abnormal ovary, and female infertility reported in Adamts9 KO\u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e "},{"header":"Materials And Methods","content":" \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eAnimals\u003c/h2\u003e \u003cp\u003eThe AB strain of zebrafish (\u003cem\u003eDanio rerio\u003c/em\u003e) used here originated from the Zebrafish International Resource Center and then propagated in our lab following previously published guidelines\u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e. All methods were carried out in accordance with relevant guidelines and regulations. The study was carried out in compliance with the ARRIVE guidelines. All experimental protocols have been approved by the Institutional Animal Care and Use Committee (IACUC) at East Carolina University.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eCollection of ovarian follicles and embryos and extraction of total RNA\u003c/h2\u003e \u003cp\u003eVarious stages of AB wildtype embryos were collected at different times of development. Ovarian follicles were divided into different stages according to follicular size and morphological criteria\u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e with a slight modification\u003csup\u003e[\u003cspan additionalcitationids=\"CR22\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e. Stage I, III, IVb and V ovarian follicles were collected from 4-month old mature female AB wildtype fish between 7:00am and 8:30am (lights on photoperiod 8:30am-10:30pm). Samples were placed in 1.7mL RNase-free microcentrifuge tubes (GeneMate) containing 200 ml RNAzol (Molecular Research Center, Inc., OH. Catalog: RN 190) and homogenized immediately. Total RNA was extracted from homogenized solutions according to the manufacturer\u0026rsquo;s protocol. For each sample, cDNAs was synthesized using 2 mg total RNA and a high-capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific, Waltham, Massachusetts, USA, Catalog#4368814) following the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003cp\u003e \u003cb\u003ePCR amplification of\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eadamts9\u003c/span\u003e\u003c/p\u003e \u003cp\u003eA set of PCR primer (forward: 5\u0026rsquo;-GCGGTACGCGTGGTAAAATC-3\u0026rsquo;; reverse: 5\u0026rsquo;- AGGCATGTGGACATAACGCA-3\u0026rsquo;) targeting 1181bp of 3\u0026rsquo;-UTR of \u003cem\u003eadamts9\u003c/em\u003e was used for PCR amplification. PCR amplification was carried out using a Taq DNA polymerase (New England Biolabs, Ipswich, Massachusetts, USA, Catalog#0273) with initial denaturation at 95\u0026deg;C for 2 minutes followed by 35 cycles of 30 seconds denaturation at 95\u0026deg;C, 30 seconds annealing at 65\u0026deg;C, and 60 seconds elongation at 68\u0026deg;C. Zebrafish eukaryotic translation elongation factor 1 alpha 1a (\u003cem\u003eeef1a1a\u003c/em\u003e) showed stable expression in different stages of embryos and ovarian follicles, therefore was used as a housekeeping gene control. A set of PCR primers targeting 242 bp of coding region of \u003cem\u003eeef1a1a\u003c/em\u003e (forward: 5\u0026rsquo;-AGTGTTGCCTTCGTCCCAAT-3\u0026rsquo;; Reverse:5\u0026rsquo;-CACACGACCCACAGGTACAG-3\u0026rsquo;) was used for PCR amplification. The efficiency of the PCR and authentic PCR products was confirmed by gel electrophoresis analysis. The PCR products were also cloned into pGEM-T easy vector and confirmed by Sanger sequencing. The concentrations of these plasmids were quantified on Nanodrop 2000 (Thermo Fisher Scientific, Waltham, Massachusetts, USA), serially diluted and used as DNA templates for generating standard curves described in the following paragraph.\u003c/p\u003e \u003cp\u003e \u003cb\u003eReal-time quantitative PCR (qPCR) amplification of\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eadamts9\u003c/span\u003e\u003c/p\u003e \u003cp\u003eThe levels of \u003cem\u003eadamts9\u003c/em\u003e transcripts were also determined by quantitative real-time PCR (qPCR) using SYBR green dye (Invitrogen) and a CFX Connect real-time thermal cycler (Bio-Rad Laboratories, Hercules, California, USA). The qPCR reaction was conducted with initial denaturation at 95\u003csup\u003e0\u003c/sup\u003eC for 3 minutes, followed by 45 cycles of 30 seconds denaturation at 95\u003csup\u003e0\u003c/sup\u003eC, 30 seconds annealing at 65\u003csup\u003e0\u003c/sup\u003eC, and 30 seconds extension at 72\u003csup\u003e0\u003c/sup\u003eC using the specific primers (Forward: 5\u0026rsquo;- CTGTCTGCGCGGTGATTCTA \u0026minus;\u0026thinsp;3\u0026rsquo;; Reverse: 5\u0026rsquo;- CTCTTGCAGGGGCGTGATTA \u0026minus;\u0026thinsp;3\u0026rsquo;) and GoTaq G2 DNA polymerase (Promega, Madison, Wisconsin, USA). Each PCR mixture (15 ml) consisted of 7.795ml DNase free water, 3 ml 5XGoTaq buffer, 1.5ml 25mM MgCl2, 0.3ml 10 mM dNTP mix, 0.15ml 10mM forward or reverse primer, 2 ml 5X diluted cDNA, 0.03 ml 100X SYBR green dye (final concentration 0.2X), and 0.075ml Taq. The transcript levels, expressed as absolute values (copies/mg total RNA), were determined using Ct values of samples and a standard curve generated from serial known concentrations of plasmid containing the target region of \u003cem\u003eadamts9\u003c/em\u003e. The efficiency of the PCR and authentic PCR products was further confirmed by analyses of melting curve, gel electrophoresis, and Sanger sequencing.\u003c/p\u003e \u003cp\u003e \u003cb\u003eAdamts9 expression analyzed by\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eadamts9\u003c/span\u003e \u003cb\u003epromoter driven EGFP\u003c/b\u003e\u003c/p\u003e \u003cp\u003eDetailed generation and characterization of EGFP expression driven by \u003cem\u003eadamts9\u003c/em\u003e promoters in zebrafish will be reported in a separate manuscript. Briefly, a 4.5-kb upstream of \u003cem\u003eadamts9\u003c/em\u003e start codon was cloned into pGEM-T easy vector (Promega), Sanger sequence confirmed, and then subcloned into a p5E-mcs entry vector. Multisite Gateway cloning (Invitrogen) was conducted with a 5\u0026rsquo; entry vector containing 4.5 kb \u003cem\u003eadamts9\u003c/em\u003e promoter sequence, a middle entry vector containing EGFP, a 3\u0026rsquo;entry vector with stop poly A signal, and a destination vector that expresses a GFP selection marker specifically in the lens of eye\u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e. In this final vector, the expression of EGFP is controlled by \u003cem\u003eadamts9\u003c/em\u003e promoters. Transgenic embryos with the insertion could be easily selected by the eye marker that displays green fluorescence at 48 hpf under a fluorescent dissecting microscope. About 500 nl mixture containing 20 ng/ml construct, 20 ng/ml Tol2 transposon, and phenol red indicator were microinjected into one cell stage of embryos. Multiple F0 transgenic embryos were selected based on the lens selection marker, raised to adults, crossed with AB wildtype, then produced several F1 lines. Subsequently, we established multiple F2 stable transgenic lines (\u003cem\u003eTg(adamts9:GFP)\u003c/em\u003e) with stable expression of EGFP in the zebrafish.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eConfocal imaging and analyses of GFP expression, migration and numbers of PGCs in Adamts9 knockout\u003c/h2\u003e \u003cp\u003eFresh, live follicles collected from adult transgenic females (\u003cem\u003eTg(adamts9:EGFP)\u003c/em\u003e) were placed immediately in 15 mM HEPS buffer (pH 7.8) containing 50% L-15 medium (Fisher Scientific, #41-300-039). Follicles were pipetted up and down several times to separate individual follicles. Then, individual follicles of various developmental stages were placed on a depression glass slide and mounted in 1.2% low melting point agarose and immediately imaged by confocal microscopy.\u003c/p\u003e \u003cp\u003eLive transgenic embryos of various developmental stages were collected by crossing male transgenic fish (\u003cem\u003eTg(adamts9:EGFP)\u003c/em\u003e) with AB females. Individual embryos were placed on a depression glass slide, mounted in 1.2% low melting point agarose, and immediately imaged by confocal microscopy. Five independent F1 transgenic lines were used to confirm similar expression among all the transgenic lines.\u003c/p\u003e \u003cp\u003eAdamts9 knockout fish were generated and reported in our previous study\u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e. Vasa is an RNA helicase expressed exclusively in primordial germ cells (PGCs)\u003csup\u003e[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e. By using vasa promoter to drive EGFP expression, it is possible to visualize PGCs in zebrafish embryos with a laser confocal scanning microscope. Adamts9 knockout male fish (\u003cem\u003eadamts9\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e) were crossed with \u003cem\u003eTg(vasa:EGFP)\u003c/em\u003e. Embryos were collected, raised to adult, genotyped, and then in-crossed to obtain a transgenic line with all germ cells labeled with EGFP in Adamts9 knockout background (\u003cem\u003eadamts9\u003c/em\u003e\u003csup\u003e+/\u0026minus;\u003c/sup\u003e; \u003cem\u003eTg(vasa:GFP)\u003c/em\u003e). This transgenic line was used for generating wildtype (+/+), heterozygote (+/-) and homozygote (-/-) embryos for confocal imaging of PGCs.\u003c/p\u003e \u003cp\u003eZebrafish embryos were collected at 15, 24, 48 hpf, fixed in 10% buffered formalin for four hours at room temperature. Embryos were subsequently washed with distilled water, a PBS solution, and then increasing concentrations of methanol, before storage in 100% methanol at -20\u0026ordm;C until analyses. Individual embryos were mounted onto a depression glass slide in 1.2% low melting point agarose and then imaged by confocal microscopy. Distance between two most distant PGCs was determined as an indicator of PGC migration using Zen 2.6 software. The number of germ cells and gonad size were determined with aid of computer software (Imaris, Bitplane Inc, Z\u0026uuml;rich, Switzerland)\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eAll results were presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. Two-sample two tailed t-test was used to analyze the effect of genotypes on germ cell migration, One-way ANOVA was used to analyze the gene expression. Statistical significance was set at p\u0026thinsp;\u0026lt;\u0026thinsp;0.05. All Statistical analysis were conducted using GraphPad Prism.\u003c/p\u003e \u003c/div\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYZ conceived the project, generated Adamts9 knockout, designed experiments, wrote the manuscript. JC generated (\u003cem\u003eadamts9\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003e; \u003cem\u003eTg(vasa:GFP)\u003c/em\u003e), performed confocal imaging and analyses of migration and numbers of PGCs. YH and YZ generated \u003cem\u003eTg(adamts9:GFP)\u003c/em\u003e, performed confocal imaging, RT-PCR and qPCR. JC and YH contributed equally to the study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdditional Information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the NIH GM100461 to YZ.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe want to thank Dr. Wei Ge (University of Macau) for providing \u003cem\u003eTg\u003c/em\u003e(\u003cem\u003evasa:GFP\u003c/em\u003e) zebrafish, Drs. Fadi Issa and Paul Erickson for their assistance in confocal microscope analyses.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eZillikens, M. C. \u003cem\u003eet al.\u003c/em\u003e Large meta-analysis of genome-wide association studies identifies five loci for lean body mass. \u003cem\u003eNat. Commun\u003c/em\u003e. \u003cstrong\u003e8\u003c/strong\u003e, doi: 10.1038/s41467-017-00031-7 (2017).\u003c/li\u003e\n\u003cli\u003eArtunc-Ulkumen, B., Ulucay, S., Pala, H. G. \u0026amp; Cam, S. Maternal serum\u0026nbsp;ADAMTS-9 levels in gestational\u0026nbsp;diabetes: a pilot study. \u003cem\u003eJ. Matern. Fetal Neonatal Med\u003c/em\u003e\u003cem\u003e.\u003c/em\u003e\u003cstrong\u003e30\u003c/strong\u003e, 1442-1445. doi: 10.1080/14767058.2016.1219717 (2017).\u003c/li\u003e\n\u003cli\u003eGraae, A. S. \u003cem\u003eet al\u003c/em\u003e. ADAMTS9regulates skeletal muscle insulin sensitivity through extracellular matrix alterations. \u003cem\u003eDiabetes\u003c/em\u003e. \u003cstrong\u003e68\u003c/strong\u003e, 502-514. doi: 10.2337/db18-0418 (2019).\u003c/li\u003e\n\u003cli\u003ePaulissen, G. \u003cem\u003eet al\u003c/em\u003e. Role of ADAM and ADAMTS metalloproteinases in airway diseases. \u003cem\u003eRespir. Res\u003c/em\u003e\u003cem\u003e.\u003c/em\u003e\u003cstrong\u003e10\u003c/strong\u003e, doi: 10.1186/1465-9921-10-127 (2009)\u003c/li\u003e\n\u003cli\u003eYang, C. Y., Chanalaris, A. \u0026amp; Troeberg, L. ADAMTSand ADAM metalloproteinases in osteoarthritis - looking beyond the 'usual suspects'. \u003cem\u003eOsteoarthritis Cartilage\u003c/em\u003e. \u003cstrong\u003e25\u003c/strong\u003e,1000-1009. doi: 10.1016/j.joca.2017.02.791 (2017).\u0026nbsp;\u003c/li\u003e\n\u003cli\u003eMead, T. J. \u0026amp; Apte, S. S. ADAMTSproteins in human disorders. \u003cem\u003eMatrix Biol\u003c/em\u003e\u003cem\u003e.\u003c/em\u003e\u003cstrong\u003e71-72\u003c/strong\u003e, 225-239. doi: 10.1016/j.matbio.2018.06.002 (2018).\u003c/li\u003e\n\u003cli\u003eSuna, G. \u003cem\u003eet al\u003c/em\u003e. Extracellular matrix proteomics reveals interplay of aggrecan and aggrecanases in vascular remodeling of stented coronary arteries. \u003cem\u003eCirculation\u003c/em\u003e. \u003cstrong\u003e137\u003c/strong\u003e,166-183. doi: 10.1161/CIRCULATIONAHA.116.023381 (2018).\u003c/li\u003e\n\u003cli\u003eFranceschini, N. \u003cem\u003eet al\u003c/em\u003e. GWAS and colocalization analyses implicate carotid intima-media thickness and carotid plaque loci in\u0026nbsp;cardiovascularoutcomes. \u003cem\u003eNat. Commun\u003c/em\u003e. \u003cstrong\u003e9\u003c/strong\u003e, 5141. doi: 10.1038/s41467-018-07340-5 (2018).\u003c/li\u003e\n\u003cli\u003eSingh, M. \u0026amp; Tyagi, S.C. Metalloproteinasesas mediators of inflammation and the eyes: molecular genetic underpinnings governing ocular pathophysiology. \u003cem\u003eInt. J. Ophthalmol\u003c/em\u003e. \u003cstrong\u003e10\u003c/strong\u003e,1308-1318. doi: 10.18240/ijo.2017.08.20 (2017).\u003c/li\u003e\n\u003cli\u003eRosenberg, G. A. Extracellular matrix inflammation in vascular cognitive impairment and dementia. \u003cem\u003eClin Sci (Lond)\u003c/em\u003e. \u003cstrong\u003e131\u003c/strong\u003e, 425-437. doi: 10.1042/CS20160604 (2017).\u003c/li\u003e\n\u003cli\u003eSomerville, R. P. \u003cem\u003eet al\u003c/em\u003e. Characterization of ADAMTS-9 and ADAMTS-20 as a distinct ADAMTS subfamily related to \u003cem\u003eCaenorhabditis elegans\u003c/em\u003e GON-1. \u003cem\u003eJ. Biol. Chem\u003c/em\u003e.\u0026nbsp;\u003cstrong\u003e278\u003c/strong\u003e, 9503-9513 (2003).\u003c/li\u003e\n\u003cli\u003eClark,M. E. et al. ADAMTS9, a novel member of the ADAM-TS/ metallospondin gene family. \u003cem\u003eGenomics\u003c/em\u003e.\u0026nbsp;\u003cstrong\u003e67\u003c/strong\u003e, 343-350 (2000).\u003c/li\u003e\n\u003cli\u003eKelwick, R.,\u0026nbsp;Desanlis, I.,\u0026nbsp;Wheeler, G. N. \u0026amp; Edwards, D. R. The ADAMTS (A Disintegrin and Metalloproteinase with Thrombospondin motifs) family. \u003cem\u003eGenome Biol\u003c/em\u003e. \u003cstrong\u003e16\u003c/strong\u003e, 113. doi:\u0026nbsp;10.1186/s13059-015-0676-3 (2015).\u003c/li\u003e\n\u003cli\u003eBlelloch,R. \u0026amp;\u0026nbsp;Kimble,J. Control of organ shape by a secreted metalloprotease in the nematode \u003cem\u003eCaenorhabditis elegans\u003c/em\u003e. \u003cem\u003eNature\u003c/em\u003e.\u0026nbsp;\u003cstrong\u003e399\u003c/strong\u003e, 586-590 (1999).\u003c/li\u003e\n\u003cli\u003eBlelloch,R., Anna-Arriola, S. S., Gao, D., Li, Y., Hodgkin, J. \u0026amp;\u0026nbsp;Kimble,J. The gon-1 gene is required for gonadal morphogenesis in \u003cem\u003eCaenorhabditis elegans\u003c/em\u003e. \u003cem\u003eDev. Biol\u003c/em\u003e.\u0026nbsp;\u003cstrong\u003e216\u003c/strong\u003e, 382-393 (1999).\u003c/li\u003e\n\u003cli\u003eNishiwaki, K., Hisamoto, N., Matsumoto, K. A metalloprotease disintegrin that controls cell migration in Caenorhabditis elegans. \u003cem\u003eScience\u003c/em\u003e, \u003cstrong\u003e288\u003c/strong\u003e, 2205\u0026ndash;2208 (2000).\u003c/li\u003e\n\u003cli\u003eIsmat,A., Cheshire, A. M., Andrew, D. J. The secreted AdamTS-A metalloprotease is required for collective cell migration. \u003cem\u003eDevelopment\u003c/em\u003e. \u003cstrong\u003e140\u003c/strong\u003e, 1981-1993. doi: 10.1242/dev.087908 (2013).\u003c/li\u003e\n\u003cli\u003eKern,C. B. \u003cem\u003eet al\u003c/em\u003e. 2010 Reduced versican cleavage due to\u0026nbsp;Adamts9haploinsufficiency is associated with cardiac and aortic anomalies. \u003cem\u003eMatrix Biol\u003c/em\u003e.\u0026nbsp;\u003cstrong\u003e29\u003c/strong\u003e, 304-16. doi: 10.1016/j.matbio.2010.01.005 (2010).\u003c/li\u003e\n\u003cli\u003eNandadasa, S.,\u0026nbsp;Nelson, C. M. \u0026amp;\u0026nbsp;Apte, S. S. ADAMTS9-mediated extracellular matrix dynamics regulates umbilical cord vascular smooth muscle differentiation and rotation. \u003cem\u003eCell Rep\u003c/em\u003e. \u003cstrong\u003e11\u003c/strong\u003e, 1519-1528. doi: 10.1016/j.celrep.2015.05.005 (2015).\u003c/li\u003e\n\u003cli\u003eBrunet, F. G. \u003cem\u003eet al\u003c/em\u003e. The\u0026nbsp;evolutionaryconservationof the a\u0026nbsp;disintegrin-like and metalloproteinase domain with thrombospondin-1 motif metzincins across vertebrate species and their expression in teleost zebrafish. \u003cem\u003eBMC Evol. Biol\u003c/em\u003e.\u0026nbsp;\u003cstrong\u003e15\u003c/strong\u003e, doi: 10.1186/s12862-015-0281-9 (2015).\u003c/li\u003e\n\u003cli\u003eLiu, D. T.,\u0026nbsp;Brewer, M. S.,\u0026nbsp;Chen, S.,\u0026nbsp;Hong, W. S. \u0026amp;\u0026nbsp;Zhu, Y. Transcriptomic signatures for ovulation in vertebrates. \u003cem\u003eGen. Comp. Endocrinol\u003c/em\u003e.\u0026nbsp;\u003cstrong\u003e247\u003c/strong\u003e, 74-86. doi: 10.1016/j.ygcen.2017.01.019 (2017).\u003c/li\u003e\n\u003cli\u003eLiu,D. T., Carter, N. J., Wu, X. J., Hong, W. S., Chen S. X.\u0026nbsp;\u0026amp; Zhu,Y. Progestin and nuclear progestin receptor are essential for upregulation of metalloproteinase in\u0026nbsp;zebrafish\u0026nbsp;preovulatory follicles. \u003cem\u003eFront. Endocrinol\u003c/em\u003e. (Lausanne). \u003cstrong\u003e9\u003c/strong\u003e, 517. doi: 10.3389/fendo.2018.00517 (2018).\u0026nbsp;\u003c/li\u003e\n\u003cli\u003eLiu,D. T., Hong, W. S., Chen, S. X. \u0026amp;\u0026nbsp;Zhu,Y. Upregulation of adamts9 by gonadotropin in preovulatory follicles of\u0026nbsp;zebrafish. \u003cem\u003eMol. Cell. Endocrinol\u003c/em\u003e. \u003cstrong\u003e499\u003c/strong\u003e,110608. doi: 10.1016/j.mce.2019.110608 (2020).\u003c/li\u003e\n\u003cli\u003eCarter,N. J., Roach, Z. A., Byrnes, M. M. \u0026amp;\u0026nbsp;Zhu,Y. Adamts9 is necessary for ovarian development in\u0026nbsp;zebrafish. \u003cem\u003eGen. Comp. Endocrinol\u003c/em\u003e. \u003cstrong\u003e277\u003c/strong\u003e, 130-140. doi: 10.1016/j.ygcen.2019.04.003 (2019).\u003c/li\u003e\n\u003cli\u003eZhu, Y., Liu, D., Shaner, Z. C., Chen, S., Hong, W. \u0026amp; Stellwag, E. J. Nuclear progestin receptor (pgr) knockouts in\u0026nbsp;zebrafishdemonstrate role for\u0026nbsp;pgr\u0026nbsp;in ovulation but not in rapid non-genomic steroid mediated meiosis resumption. \u003cem\u003eFront Endocrinol\u003c/em\u003e (Lausanne). \u003cstrong\u003e6\u003c/strong\u003e, 37. doi: 10.3389/fendo.2015.00037 (2015).\u003c/li\u003e\n\u003cli\u003eSelman, K., Wallace, R. A., Sarka, A. \u0026amp; QI, X. Stages of oocyte development in the zebrafish, \u003cem\u003eBrachydanio rerio\u003c/em\u003e. \u003cem\u003eJournal of Morphology\u003c/em\u003e\u003cstrong\u003e218,\u003c/strong\u003e 203-224 (1993).\u003c/li\u003e\n\u003cli\u003eKurita, R \u003cem\u003eet al\u003c/em\u003e. Suppression of lens growth by alphaA‐crystallin promoter‐driven expression of diphtheria toxin results in disruption of retinal cell organization in zebrafish. \u003cem\u003eDev. Biol\u003c/em\u003e. \u003cstrong\u003e255\u003c/strong\u003e,113\u0026ndash;127 (2003).\u003c/li\u003e\n\u003cli\u003eHartung,O.,\u0026nbsp;Forbes,M. M. \u0026amp;\u0026nbsp;Marlow,\u0026nbsp;F. L. Zebrafish vasa is required for germ-cell differentiation and maintenance. \u003cem\u003eMol. Reprod. Dev\u003c/em\u003e.\u0026nbsp;\u003cstrong\u003e81\u003c/strong\u003e, 946-961. doi: 10.1002/mrd.22414 (2014).\u003c/li\u003e\n\u003cli\u003eKessenbrock, K\u003cstrong\u003e.\u003c/strong\u003e, Plaks, V. \u0026amp; Werb, Z. (2010) Matrix metalloproteinases: regulators of the tumor microenvironment. \u003cem\u003eCell\u003c/em\u003e, \u003cstrong\u003e141\u003c/strong\u003e, 52\u0026ndash;67 (2010).\u003c/li\u003e\n\u003cli\u003eGolan\u003cstrong\u003e,\u003c/strong\u003e K\u003cstrong\u003e.\u003c/strong\u003e, Vagima\u003cstrong\u003e,\u003c/strong\u003e Y\u003cstrong\u003e.\u003c/strong\u003e, Goichberg\u003cstrong\u003e,\u003c/strong\u003e P\u003cstrong\u003e.\u003c/strong\u003e, Gur‐Cohen\u003cstrong\u003e,\u003c/strong\u003e S\u003cstrong\u003e.\u003c/strong\u003e \u0026amp; Lapidot\u003cstrong\u003e,\u003c/strong\u003e T. MT1‐MMP and RECK: opposite and essential roles in hematopoietic stem and progenitor cell retention and migration. \u003cem\u003eJ\u003cstrong\u003e.\u003c/strong\u003e Mol\u003cstrong\u003e.\u003c/strong\u003e Med\u003cstrong\u003e.\u003c/strong\u003e\u003c/em\u003e (Berl) \u003cstrong\u003e89\u003c/strong\u003e, 1167\u0026ndash;1174 (2011).\u003c/li\u003e\n\u003cli\u003eMolyneaux\u003cstrong\u003e,\u003c/strong\u003e K\u003cstrong\u003e. \u003c/strong\u003eA\u003cstrong\u003e.\u003c/strong\u003e, Wang\u003cstrong\u003e,\u003c/strong\u003e Y\u003cstrong\u003e.\u003c/strong\u003e, Schaible\u003cstrong\u003e,\u003c/strong\u003e K\u003cstrong\u003e.\u003c/strong\u003e \u0026amp; Wylie\u003cstrong\u003e,\u003c/strong\u003e C. Transcriptional profiling identifies genes differentially expressed during and after migration in murine primordial germ cells. \u003cem\u003eGene Expr\u003cstrong\u003e.\u003c/strong\u003e Patterns\u003cstrong\u003e.\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e4\u003c/strong\u003e, 167\u0026ndash;181 (2004).\u003c/li\u003e\n\u003cli\u003eKucia\u003cstrong\u003e,\u003c/strong\u003e M\u003cstrong\u003e.\u003c/strong\u003e, Wu\u003cstrong\u003e,\u003c/strong\u003e W\u003cstrong\u003e.\u003c/strong\u003e \u0026amp; Ratajczak\u003cstrong\u003e,\u003c/strong\u003e M\u003cstrong\u003e. \u003c/strong\u003eZ. Bone marrow‐derived very small embryoniclike stem cells: their developmental origin and biological significance. \u003cem\u003eDev\u003cstrong\u003e.\u003c/strong\u003e Dyn\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e\u003cstrong\u003e236\u003c/strong\u003e, 3309\u0026ndash;3320 (2007).\u003c/li\u003e\n\u003cli\u003e33. Gialeli, C., Theocharis, A. D. \u0026amp; Karamanos, N. K. Roles of matrix metalloproteinases in cancer progression and their pharmacological targeting. \u003cem\u003eFEBS. J\u003c/em\u003e. 278, 16\u0026ndash;27 (2011).\u003c/li\u003e\n\u003cli\u003e34. Apte, S. S. A disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motifs: the ADAMTS family. \u003cem\u003eInt. J. Biochem. Cell Biol\u003c/em\u003e. 36, 981\u0026ndash;985 (2004).\u003c/li\u003e\n\u003cli\u003ePorter,S.,\u0026nbsp;Clark, I. M.,\u0026nbsp;Kevorkian, L. \u0026amp;\u0026nbsp;Edwards, D. R. 2005 The ADAMTS metalloproteinases. \u003cem\u003eBiochem. J\u003c/em\u003e.\u0026nbsp;\u003cstrong\u003e386\u003c/strong\u003e(Pt 1):15-27 (2005).\u003c/li\u003e\n\u003cli\u003e36. D\u0026iacute;ez-Torre,\u0026nbsp;A., D\u0026iacute;az-N\u0026uacute;\u0026ntilde;ez,\u0026nbsp;M., Eguiz\u0026aacute;bal,\u0026nbsp;C., Silv\u0026aacute;n,\u0026nbsp;U. \u0026amp; Ar\u0026eacute;chaga, J. Evidence for a role of matrix metalloproteinases and their inhibitors in primordial germ cell migration. \u003cem\u003eAndrology\u003c/em\u003e, 1,779-786. doi: 10.1111/j.2047-2927.2013.00109.x (2013).\u0026nbsp;\u003c/li\u003e\n\u003cli\u003eRaz,E. Primordial germ cell development in zebrafish. \u003cem\u003eSemin. Cell, Dev. Biol\u003c/em\u003e. \u003cstrong\u003e13\u003c/strong\u003e, 489-495 (2002).\u003c/li\u003e\n\u003cli\u003eDumstrei, K., Mennecke, R. \u0026amp; Raz, E. Signaling pathways controlling primordial germ cell migration in zebrafish. \u003cem\u003eJ.\u0026nbsp;CellSci\u003c/em\u003e. \u003cstrong\u003e117\u003c/strong\u003e, 4787-95 (2004).\u003c/li\u003e\n\u003cli\u003eJungers,K. A.,\u0026nbsp;Le Goff, C.,\u0026nbsp;Somerville, R. P. \u0026amp;\u0026nbsp;Apte, S. S. Adamts9is widely expressed during mouse embryo development. \u003cem\u003eGene Expr Patterns\u003c/em\u003e.\u0026nbsp;\u003cstrong\u003e5\u003c/strong\u003e, 609-617 (2005).\u003c/li\u003e\n\u003cli\u003eDranow, D. B.,\u0026nbsp;Tucker, R. P. \u0026amp;\u0026nbsp;Draper, B. W. Germ cells are required to maintain a stable sexual phenotype in adult zebrafish. \u003cem\u003eDev. Biol\u003c/em\u003e.\u0026nbsp;\u003cstrong\u003e376\u003c/strong\u003e, 43-50. doi: 10.1016/j.ydbio.2013.01.016 (2013).\u003c/li\u003e\n\u003cli\u003eDai, X.,\u0026nbsp;Jin, X.,\u0026nbsp;Chen, X.,\u0026nbsp;He, J. \u0026amp;\u0026nbsp;Yin, Z. Sufficient numbers of early germ cells are essential for female sex development in zebrafish. \u003cem\u003ePLoS One\u003c/em\u003e.\u0026nbsp;\u003cstrong\u003e10\u003c/strong\u003e, e0117824. doi: 10.1371/journal.pone.0117824 (2015).\u003c/li\u003e\n\u003cli\u003eTzung, K. W. \u003cem\u003eet al\u003c/em\u003e Earlydepletionof\u0026nbsp;primordial\u0026nbsp;germ cells in zebrafish promotes testis formation. \u003cem\u003eStem Cell Reports\u003c/em\u003e. \u003cstrong\u003e4\u003c/strong\u003e, 61-73. doi: 10.1016/j.stemcr.2014.10.011 (2015).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Adamts9, Adamts, Metalloproteinase, Primordial Germ Cell, Gonad formation, Zebrafish","lastPublishedDoi":"10.21203/rs.3.rs-151044/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-151044/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAdamts9 (a disintegrin and metalloproteinase with a thrombospondin type 1 motif, member 9) is one of few metalloproteinases structurally conserved from \u003cem\u003eC. elegans\u003c/em\u003e to humans and is indispensable in germ cell migration in invertebrates. However, adamts9’s roles in germ cell migration in vertebrates has not been examined. In the present study, we found zygotic expression of \u003cem\u003eadamts9 \u003c/em\u003estarted around germ ring stage and reached peak levels at 3 days post fertilization (dpf) in zebrafish. Germ cell migration completed within 24 hours in wildtype sibling, while a delay in germ cell migration was found at 15 and 24-hours post-fertilization (hpf) in the Adamts9 knockout (KO). However, this delayed effect of Adamts9 KO disappeared at 48 hpf. Our study suggests a conserved function of Adamts9 in germ cell migration among invertebrates and vertebrates. In addition, our results also suggest that Adamts9 is not essential for germ cell migration as reported in \u003cem\u003eC. elegans\u003c/em\u003e, possibly due to expansion of Adamts family members and compensatory roles from another metalloproteinase in vertebrates. Further studies are required in order to elucidate the functions and mechanisms of metalloproteinases in germ cell migration and gonad formation in vertebrates.\u003cstrong\u003e\u0026nbsp;\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e","manuscriptTitle":"Delay in Primordial Germ Cell Migration in Adamts9 Knockout Zebrafish","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2021-01-27 16:33:43","doi":"10.21203/rs.3.rs-151044/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2021-03-04T07:30:35+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"225d3e11-4f37-43db-9fe1-81cc738c75c6","date":"2021-02-20T20:41:22+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2021-02-17T04:38:06+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"8d216229-7802-405c-9c08-edd4d36edb6c","date":"2021-01-29T09:48:11+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2021-01-27T12:42:43+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2021-01-27T12:35:56+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2021-01-21T18:56:29+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2021-01-21T18:41:37+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2021-01-19T18:54:04+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"6f21e51f-d541-4df0-9395-4333e46e306a","owner":[],"postedDate":"January 27th, 2021","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":2100514,"name":"General Cell Biology \u0026 Physiology"}],"tags":[],"updatedAt":"2021-08-18T19:28:04+00:00","versionOfRecord":{"articleIdentity":"rs-151044","link":"https://doi.org/10.1038/s41598-021-88024-x","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2021-04-20 19:03:48","publishedOnDateReadable":"April 20th, 2021"},"versionCreatedAt":"2021-01-27 16:33:43","video":"","vorDoi":"10.1038/s41598-021-88024-x","vorDoiUrl":"https://doi.org/10.1038/s41598-021-88024-x","workflowStages":[]},"version":"v1","identity":"rs-151044","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-151044","identity":"rs-151044","version":["v1"]},"buildId":"omnImTCwR2MFx8CMYfrG7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}