Dihydrocapsaicin secreted by RYK silencing-modified bone marrow-derived mesenchymal stem cells trigger apoptosis of gastric cancer cells

preprint OA: closed
Full text JSON View at publisher
Full text 85,320 characters · extracted from preprint-html · click to expand
Dihydrocapsaicin secreted by RYK silencing-modified bone marrow-derived mesenchymal stem cells trigger apoptosis of gastric cancer cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Dihydrocapsaicin secreted by RYK silencing-modified bone marrow-derived mesenchymal stem cells trigger apoptosis of gastric cancer cells Yongan Fu, Zongda Cai, Yangqiang Wang, Mingjin Huang, Jinghua Huang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7167954/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Bone marrow-derived mesenchymal stem cells (BMSCs) have been proven to be recruited into the tumor microenvironment and contribute to gastric cancer (GC) progression, However, the exact mechanisms remain poorly understood. This study explored the potential mechanism of RYK-silenced BMSCs on gastric cancer cell apoptosis. Firstly, BMSCs were transfected with the RYK siRNA and their corresponding negative controls, and cell co-culture were used to explore the interaction between different BMSCs and NCI-N87 cells. Then, Cancer cell cycle apoptosis was evaluated by flow cytometry. Western blot analysis was performed to determine the protein levels of Caspase3, Bax, and Bcl-2 in NCI-N87 cells. Then metabolomics was used to analyze the differential metabolites in different BMSCs. Furthermore, the NCI-N87 cells were treated with dihydrocapsaicin (DHC), and the proliferation activity, apoptosis level, and expression of apoptosis-related proteins in the NCI-N87 cells were detected after different DHC treatments. Compared to NCI-N87 cells cultured alone, co-culture with si-NC-modified BMSCs reduced apoptosis in NCI-N87 cells. However, co-culture with si-RYK-BMSCs significantly increased apoptosis. Additionally, DHC, a metabolic product secreted by BMSCs after RYK interference, suppresses NCI-N87 cell growth, promotes cell death, and increases the expression of apoptosis-related proteins. These findings suggest that RYK silencing-modified BMSCs can induce the apoptosis of NCI-N87 cells, potentially through increased secretion of DHC. Dihydrocapsaicin RYK Bone marrow-derived mesenchymal stem cells Gastric cancer apoptosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 INTRODUCTION Gastric cancer (GC) ranks as one of the most prevalent malignancies globally, being the second leading cause of cancer-related mortality worldwide (Yasuda and Wang 2024 ). It is also the most common cancer in East Asia, with approximately 990,000 new cases diagnosed annually (Wu et al. 2024 ). GC is a multifactorial disease influenced by both environmental and genetic factors. Key risk factors include age, sex, smoking, and Helicobacter pylori infection (Mamun et al. 2024 ; Machlowska et al. 2020 ; Yang et al. 2023 ). Despite advancements in surgical resection and adjuvant chemotherapy that have improved patient survival, the overall prognosis for gastric cancer remains suboptimal (Thrift et al. 2023 ). Therefore, it is urgent to elucidate the development mechanism of gastric cancer and find effective treatment strategies. Mesenchymal stem cells (MSCs) are intricately associated with the initiation and progression of tumors (Karami et al. 2023; Ridge et al. 2017 ). Research has demonstrated that circulating MSCs can migrate and localize to tumor sites under the chemotactic influence of growth factors and chemokines secreted by tumor cells and other inflammatory cells, thereby contributing to the formation of the tumor microenvironment (Lin et al. 2019 ). The biological properties of MSCs are modulated by the tumor microenvironment, which may enhance their angiogenic capacity, immunosuppressive functions, and anti-apoptotic activities (Fu et al. 2024 ). Moreover, MSCs can facilitate the epithelial-mesenchymal transition in tumor cells and protect the survival of cancer stem cells, thereby contributing significantly to tumor initiation and progression. Earlier research has indicated that BMSCs can accelerate the development of gastric cancer (Qi et al. 2023 ). Acting as a Wnt5a receptor in the non-canonical Wnt signaling pathway, RYK participates in the regulation of the onset and progression of various cancers (Keeble and Cooper 2006 ; Liang et al. 2022 ; FAdamo et al. 2017 ). Our prior investigation also demonstrated that knocking down RYK in gastric cancer cells could suppress the malignant behavior of gastric cancer (Fu et al. 2020 ). Nevertheless, no studies have explored the impact of RYK depletion in BMSCs on the apoptosis of gastric cancer cells. Consequently, this study was designed to examine how RYK-depleted BMSCs influence the apoptosis of gastric cancer cells and to elucidate the associated molecular mechanisms. MATERIALS AND METHODS Materials. Human bone marrow mesenchymal stem cells (BMSCs) and the gastric cancer cell line NCI-N87 were obtained from Wuhan Pricella Biotechnology Co., Ltd. (Shanghai, China). The Cell Counting Kit-8 and the Annexin V-FITC Apoptosis Detection Kit were acquired from Solaibao Technology Co., Ltd. (Beijing, China). Antibodies targeting Caspase-3, Bax, Bcl-2, RYK, β-Actin, and Caspase-9 were sourced from Abcam (Cambridge, United Kingdom). Anthraquinone, Dihydrocapsaicin, and Cerulenin were purchased from MCE (New Jersey, USA). The siRNAs, including Si-RYK-1, Si-RYK-2, Si-RYK-3, and the negative control siRNA (si-NC), were provided by GenePharma (Shanghai, China). Cell culture and transfection. Human BMSCs and NCI-N87 cells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin at 37°C in an atmosphere containing 5% CO 2 . The transfection procedure was initiated when the confluence of BMSCs reached 70%. Initially, the culture medium was replaced with 1 ml of serum-free medium. Two sterilized EP tubes were prepared, and each tube received 125 µl of Opti-MEM diluent. To one EP tube, 5 µl of Lipofectamine 3000 reagent was added, while to the other, 12.5 µl of siRNA was introduced (the siRNA powder should be pre-dissolved in DEPC water at a concentration of 1 OD/125 µl). After thorough mixing, both EP tubes were incubated at room temperature for 5 minutes. The contents of the two EP tubes were then combined and mixed evenly, followed by an additional incubation at room temperature for 15 minutes. Drops of this combined solution were subsequently added to the appropriate wells of a six-well plate, after which the cells were returned to the incubator for further growth. Four to six hours post-transfection, 1 ml of complete medium containing 20% serum was added to the six-well plate. After 48 hours, the conditioned medium required for the experiment was harvested. This experiment included three control groups: the first group, labeled as si-NC-BMSCs + N87, involved treating NCI-N87 cells with the conditioned medium from the si-NC group of BMSCs for 24 hours; the second group, designated as si-RYK-BMSCS + N87, entailed treating NCI-N87 cells with the conditioned medium from the si-RYK group of BMSCs for 24 hours; the third group, simply referred to as the N87 group, consisted of untreated normal NCI-N87 cells cultured for 24 hours as a baseline comparison. Quantitative real-time PCR (qRT-PCR). Samples were collected and the total RNA was isolated using a Total RNA Miniprep Kit. Subsequently, cDNA synthesis was carried out following the instructions provided by the manufacturer. The qRT-PCR analysis was performed under these conditions: an initial denaturation step at 95°C for 5 minutes, then denaturation at 95°C for 10 seconds, annealing at 60°C for 30 seconds, and a final extension phase from 65 to 95°C, increasing the temperature by 0.5°C every 5 seconds. After completion of the reaction, average cycle threshold (Ct) values were determined for each gene as well as for the reference gene. The relative expression levels of genes were evaluated using the widely accepted method known as 2 − ΔΔCT . The sequences of the primers were showed in Table 1 . Table 1 Primer sequence Gene symbol Forward Primer Reverse primer RYK GCAACTCCTATCACCAGTTATCCT TAAAATCCCATGGAAAATACGCCC β-actin TGGCACCCAGCACAATGAA CTAAGTCATAGTCCGCCTAGAAGCA Cell apoptosis assay. The harvested cells (1×10 6 ) were first centrifuged at 1500 rpm for 3 minutes using PBS, followed by two rinsing steps. Next, the cell pellet was re-suspended in 300 µL of pre-chilled 1× Annexin V-FITC binding buffer. Afterwards, 5 µL of Annexin V-FITC and 10 µL of propidium iodide (PI) were added to each sample well. The mixture was gently vortexed and then incubated in the dark at room temperature for 10 minutes. Finally, the samples were subjected to analysis via NovoCyte flow cytometry. Western Blotting. According to the method proposed by Wu et al. (Wu et al. 2016 ), the detection of apoptosis-related proteins was conducted across different cell groups. Non-targeted metabolomics assay. Differential metabolites in various cell types were detected using liquid chromatography-mass spectrometry (LC-MS) as previously described (Yang et al. 2021 ). Targeted differential metabolites were detected by LC-MS. Take 100 µL of the cell supernatant sample and add 300 µL of methanol. Vortex for 60 seconds, then centrifuge at 17,000 × g for 15 minutes. Collect the supernatant for subsequent analysis. Standard solutions of varying concentrations were prepared using 75% methanol, and mixed with the internal standard in a 1:1 ratio to generate the calibration standards. The sample loading was performed under the following conditions: the column temperature was maintained at 40°C, with an injection volume of 3 µL and utilizing the positive ion mode. The mobile phase was composed of two components: A (water containing 0.1% formic acid) and B (acetonitrile). Gradient elution was carried out as follows: 4% B (from 0 to 3 min), increasing from 4–70% B (from 3 to 10 min), further increasing from 70–100% B (from 10 to 36 min), decreasing from 100–4% B (from 36 to 37 min), and maintaining 4% B (from 37 to 40 min). The flow rate was kept constant at 400 µL/min. For mass spectrometry, data were collected using an AB 6600 mass spectrometer in positive ion mode. The ESI ion source settings were adjusted as follows: gas temperature set to 500°C, curtain gas pressure at 25 Psi, collision gas pressure at 10 Psi, ion spray voltage at 5500 V, and atomization temperature at 500°C. CCK-8 assay. Cell viability was measured using a cell counting kit-8. Briefly, cells (2×10 4 /well) were seeded in 96-well plate and cultured for 48 h. Then, each well was supplement with 10 µl CCK8 solution and incubated for 1 h. Afterwards, the absorbance was measured using a microplate reader at the wavelength of 450 nm. Statistical Analyses. The statistical analysis was conducted using SPSS 26.0, with experimental data presented as the mean ± standard deviation (x ± s). Inter group comparisons were analyzed through One-Way ANOVA, while two-group comparisons were performed using a t-test. A p-value of less than 0.05 was regarded as indicating a statistically significant difference. RESULTS Construction of RYK-silenced BMSCs. Si-NC and three different si-RYK was transfected into BMSCs, and the silencing effect of RYK was verified by qPCR (Fig. 1 A) and WB (Fig. 1 B-C). Compared with the si-NC group, the mRNA and protein expression of RYK in si-RYK-1, si-RYK-2, and si-RYK-3 group were significantly decreased in BMSCs (P < 0.05). According to the results of silencing RKY, we used si-RYK-3 for follow-up experiments. Effect of RYK-silenced BMSCs on apoptosis of NCI-N87 cells. As illustrated in Fig. 2 A, flow cytometry was employed to assess the apoptosis of various NCI-N87 cells. In comparison with the N87 group, a significant reduction in apoptosis was observed in the si-NC-BMSCs + N87 group (P < 0.05). These findings indicate that BMSCs possess the ability to suppress apoptosis in NCI-N87 cells. Furthermore, when compared to the si-NC-BMSCs + N87 group, there was a marked increase in apoptosis in the si-RYK-BMSCs + NCI-N87 group (P < 0.05) (Fig. 2 B). Additionally, we conducted further analysis on the expression levels of proteins associated with apoptosis (Caspase3, Bax, and Bcl-2) using Western blotting (Fig. 2 C). The quantitative protein analysis results are displayed in Fig. 2 D. Relative to the N87 group, the expression levels of Caspase3 and Bax proteins in NCI-N87 cells were notably reduced in the si-NC-BMSCs + N87 group (P < 0.05), whereas Bcl-2 protein expression was significantly elevated (P < 0.05). Conversely, in comparison with the si-NC-BMSCs + N87 group, the si-RYK-BMSCs + N87 group exhibited a significant increase in Caspase3 and Bax protein expression (P < 0.05), while Bcl-2 protein expression was substantially decreased (P < 0.05). Identification of Metabolites in RYK-Silenced BMSCs. To further analyze the metabolic components of si-RYK-BMSCs in inhibiting the apoptosis of NCI-N87 cells, we used metabolomics to analyze the differential metabolites between si-RYK-BMSCs and si-NC-BMSCs. The volcano plot in Fig. 3 A showed that there were 104 up-regulated metabolites and 306 down-regulated metabolites in the RYR group (si-RYK-BMSCs) compared with the NC group (si-NC-BMSCs). As shown in Fig. 3 B, We employed principal component analysis (PCA) to visualize the clustering between the NC and RYR groups and observed a significant separation in the PCA score plots between the two groups. Subsequently, we normalized the metabolites exhibiting the most significant differences, identified the top 10 metabolites with the most substantial up-regulation and the top 12 metabolites with the most pronounced down-regulation, and generated a cluster heatmap to visualize the results (Fig. 3 C). Effect of DHC on proliferation of NCI-N87 cells. To further validate the elevated levels of differential metabolites in the BMSCs-si-RYK group, we employed liquid chromatography-mass spectrometry (LC-MS) to quantify the concentrations of three specific metabolites (Anthraquinone, Dihydrocapsaicin, and Cerulenin) in different cells (Fig. 4 A-C). The results showed that compared with the BMSCs-si-NC group, the level of dihydrocapsaicin (DHC) in the BMSCs-si-RYK group was significantly increased (P 0.05). Additionally, we used a CCK-8 assay to investigate the effect of DHC on the proliferation of NCI-N87 cells at 12, 24, 48h (Fig. 4 D). Compared with the N87 group, the proliferation of NCI-N87 cells were significantly decreased in the 60 µM DHC and 80 µM DHC group at 12, 24, 48h (P < 0.05). The results showed that DHC can inhibit the proliferation of NCI-N87 cells. Effect of DHC on apoptosis of NCI-N87 cells. Subsequently, flow cytometry and WB were used to detect the apoptosis of different treated cells (Fig. 5 A, 5 C). The analysis results of flow cytometry were shown in Fig. 5 B. Compared with the N87 group, the apoptosis of NCI-N87 cells were significantly increased in the 60 µM DHC and 80 µM DHC group (P < 0.05). The apoptosis level of NCI-N87 cells also increased with the increase in DHC dose. Moreover, as shown in Fig. 5 D, the Bax, Caspase3, and Caspase9 protein expression in the 60 µM DHC and 80 µM DHC group were significantly increased (P < 0.05) compared with the N87 group. Taken together, we concluded that si-RYK intervention in BMSCs promotes the apoptosis in gastric cancer cells by enhancing the release of DHC from BMSCs (Fig. 6 ). DISCUSSION When a tumor develops within the body, non-cancerous tissue-derived mesenchymal stem cells (MSCs), such as BMSCs, are recruited to the cancerous tissue and become an integral component of the tumor microenvironment (Zhang et al. 2024 ). Subsequently, under the influence of inflammatory cytokines and other stromal cells present at the local cancer site, BMSCs undergo differentiation, acquiring novel characteristics, and transform into resident MSCs within the tumor tissue (Taheri et al. 2024 ). Mu et al. found that co-culture of BMSCs with SGC7901 gastric cancer cells could significantly promote the apoptosis of gastric cancer cells (Mu et al. 2019 ). In this paper, we found that treating NCI-N87 cells with the conditioned medium from BMSCs could inhibit their apoptosis, which is consistent with the results of Mu et al. However, BMSCs modified by gene editing exhibit the ability to suppress tumor progression. Liu et al. found that treatment of breast cancer cells with Rictor knockout BMSCs inhibited bone metastasis of breast cancer (Liu et al. 2019 ). Chang et al. demonstrated that treating gastric cancer cells with BMSC-derived exosomes overexpressing miR-1228 significantly suppressed the apoptosis of gastric cancer cells (Chang et al. 2021 ). Thus, inhibiting gastric cancer progression by utilizing genetically modified BMSCs holds significant potential for the treatment of gastric cancer. RYK belongs to the family of receptor tyrosine kinases, a group of genes that encode proteins typically located on cell membranes. These proteins are capable of detecting external signals and converting them into intracellular biochemical reactions (Zhai et al. 2025 ; Gonzalez et al. 2023 ; Zhou et al. 2022 ). A series of studies have demonstrated that the abnormal expression of RYK is significantly associated with various types of cancer, including breast, colorectal, and gastric cancers (Wow et al. 2023 ; Gorroño-Etxebarria et al. 2019 ). Our earlier research also demonstrated that reducing RYK expression in gastric cancer cells can inhibit liver metastasis of gastric cancer (Fu et al. 2020 ). However, there are few studies that have reported the effect of si-RYK modified BMSCs on apoptosis of gastric cancer cells. In this paper, we found that treating NCI-N87 cells with the conditioned medium from si-RYK modified BMSCs could promote the apoptosis compared with the si-NC-BMSCs + N87 group. Dihydrocapsaicin, as a spicy component of capsicum, has been found to have analgesic, anti-inflammatory, antioxidant, anti-obesity and anti-cancer effects (Lai et al. 2024 ; Laorob et al. 2024 ; Hudáková et al. 2024 ). Shi et al. found that treating melanoma cell lines with dihydrocapsaicin could significantly inhibit the proliferation, migration and metastasis of melanoma cells (Shi et al. 2021 ). Xie et al. demonstrated that treatment of glioma cell lines with dihydrocapsaicin significantly enhanced the apoptosis of glioma cells (Xie et al. 2016 ). However, no studies have reported the effect of dihydrocapsaicin on the development of gastric cancer. In this study, metabolomics analysis was employed to investigate the metabolite profiles of Si-RyK-modified BMSCs, revealing a significant increase in dihydrocapsaicin levels within these modified cells. Subsequently, we treated gastric cancer cell line NCI-N87 with different concentrations of dihydrocapsaicin, and found that dihydrocapsaicin could significantly promote the apoptosis of NCI-N87 cells and increase the expression of pro-apoptotic protein (Bax, Caspase3, and Caspase9). Taken together, our results suggest that RYK silencing-modified BMSCs can induce the apoptosis of NCI-N87 cells, potentially through increased secretion of DHC. However, this study also has some limitations. This study did not investigate the potential signaling pathways involved in the effect of dihydrocapsaicin on apoptosis of gastric cancer cells. We will conduct an in-depth analysis of the signaling pathway by which dihydrocapsaicin promotes apoptosis in gastric cancer cells and validate it through both in vivo and in vitro experiments in our subsequent study. CONCLUSIONS According to the findings of this study, we conclude that BMSCs modified by RYK silencing are capable of triggering apoptosis in NCI-N87 cells, possibly by enhancing the secretion of DHC. Declarations Authors' contributions : Yongan Fu conceived and designed the experiments. Yongan Fu, Zongda Cai, and Yangqiang Wang carried out the experiments. Yongan Fu and Mingjin Huang drafted the manuscript. Jinghua Huang revised the manuscript. All authors read and approved the final manuscript. Funding : This research was supported by grants from the Fujian Provincial Natural Science Foundation of China [grant numbers: 2021J011405; 2024J011522]. Data availability : Data will be made available on request. Conflict of interests : The authors declare no competing financial interest. Ethical Approval and Consent to participate: Not applicable. Patient consent for publication : Not applicable. References Chang L, Gao H, Wang L, et al (2021) Exosomes derived from miR-1228 overexpressing bone marrow-mesenchymal stem cells promote growth of gastric cancer cells [J]. Aging (Albany NY) 13(8):11808–11821 FAdamo A, Fiore D, De Martino F, et al (2017) RYK promotes the stemness of glioblastoma cells via the WNT/ β-catenin pathway [J]. Oncotarget 8(8):13476–13487 Fu Y, Chen Y, Huang J, et al (2020) RYK, a receptor of noncanonical Wnt ligand Wnt5a, is positively correlated with gastric cancer tumorigenesis and potential of liver metastasis [J]. Am J Physiol Gastrointest Liver Physiol 318(2):G352-G360 Fu Y, Zhang M, Sui B, et al (2024) Mesenchymal stem cell-derived apoptotic vesicles ameliorate impaired ovarian folliculogenesis in polycystic ovary syndrome and ovarian aging by targeting WNT signaling [J]. Theranostics 14(8):3385–3403 Gonzalez RD, Small GW, Green AJ, et al (2023) RYK Gene Expression Associated with Drug Response Variation of Temozolomide and Clinical Outcomes in Glioma Patients [J]. Pharmaceuticals (Basel) 16(5):726 Gorroño-Etxebarria I, Aguirre U, Sanchez S, et al (2019) Wnt-11 as a Potential Prognostic Biomarker and Therapeutic Target in Colorectal Cancer [J]. Cancers (Basel) 11(7):908 Hudáková T, Šemeláková M, Očenáš P, et al (2024) Chili pepper extracts, capsaicin, and dihydrocapsaicin as potential anticancer agents targeting topoisomerases [J]. BMC Complement Med Ther 24(1):96 Karami Fath M, Moayedi Banan Z, Barati R, et al (2023) Recent advancements to engineer mesenchymal stem cells and their extracellular vesicles for targeting and destroying tumors [J]. Prog Biophys Mol Biol 178:1–16 Keeble TR, Cooper HM (2006) Ryk: a novel Wnt receptor regulating axon pathfinding [J]. Int J Biochem Cell Biol 38(12):2011–7 Lai Y, Yang N, Chen X, et al (2024) Dihydrocapsaicin suppresses the STING-mediated accumulation of ROS and NLRP3 inflammasome and alleviates apoptosis after ischemia-reperfusion injury of perforator skin flap [J]. Phytother Res 38(5):2539–2559 Laorob T, Ngoenkam J, Nuiyen A, et al (2024) Comparative effectiveness of nitro dihydrocapsaicin, new synthetic derivative capsaicinoid, and capsaicin in alleviating oxidative stress and inflammation on lipopolysaccharide-stimulated corneal epithelial cells [J]. Exp Eye Res 244:109950 Liang Z, Liu L, Gao R, et al (2022) Downregulation of exosomal miR-7-5p promotes breast cancer migration and invasion by targeting RYK and participating in the atypical WNT signalling pathway [J]. Cell Mol Biol Lett 27(1):88 Lin W, Huang L, Li Y, et al (2019) Mesenchymal Stem Cells and Cancer: Clinical Challenges and Opportunities [J]. Biomed Res Int 2019:2820853 Liu Z, Wang H, He J, et al (2019) Rictor ablation in BMSCs inhibits bone metastasis of TM40D cells by attenuating osteolytic destruction and CAF formation [J]. Int J Biol Sci 15(11):2448–2460 Machlowska J, Baj J, Sitarz M, et al (2020) Gastric Cancer: Epidemiology, Risk Factors, Classification, Genomic Characteristics and Treatment Strategies [J]. Int J Mol Sci 21(11):4012 Mamun TI, Younus S, Rahman MH (2024) Gastric cancer-Epidemiology, modifiable and non-modifiable risk factors, challenges and opportunities: An updated review [J]. Cancer Treat Res Commun 41:100845 Mu L, Sui W, Lin Y, et al (2019) Androgen attenuates antitumor effects of gastric cancer cells by bone marrow mesenchymal stem cells via restricting the JNK signaling activation [J]. Transl Cancer Res 8(3):917–927 Qi C, Shi H, Fan M, et al (2023) Microvesicles from bone marrow-derived mesenchymal stem cells promote Helicobacter pylori-associated gastric cancer progression by transferring thrombospondin-2 [J]. Cell Commun Signal 21(1):274 Ridge SM, Sullivan FJ, Glynn SA (2017) Mesenchymal stem cells: key players in cancer progression [J]. Mol Cancer 16(1):31 Shi S, Li C, Zhang Y, et al (2021) Dihydrocapsaicin Inhibits Cell Proliferation and Metastasis in Melanoma via Down-regulating β-Catenin Pathway [J]. Front Oncol 11:648052 Taheri M, Tehrani HA, Dehghani S, et al (2024) Nanotechnology and bioengineering approaches to improve the potency of mesenchymal stem cell as an off-the-shelf versatile tumor delivery vehicle [J]. Med Res Rev 44(4):1596–1661 Thrift AP, Wenker TN, El-Serag HB (2023) Global burden of gastric cancer: epidemiological trends, risk factors, screening and prevention [J]. Nat Rev Clin Oncol 20(5):338–349 Wow T, Murawa D, Boguszewska-Byczkiewicz K, et al (2023) Retrospective analysis of treatment, including access to breast reconstructions, of breast cancer patients - war refugees from Ukraine in Poland - the experience of a single tertiary care institution [J]. Pol Przegl Chir 95(6):20–23 Wu M, Yuan S, Liu K et al (2024) Gastric Cancer Signaling Pathways and Therapeutic Applications [J]. Technol Cancer Res Treat 23:15330338241271935 Wu YJ, Wong BS, Yea SH, et al (2016) Sinularin Induces Apoptosis through Mitochondria Dysfunction and Inactivation of the pI3K/Akt/mTOR Pathway in Gastric Carcinoma Cells [J]. Mar Drugs 14(8):142 Xie L, Xiang GH, Tang T, et al (2016) Capsaicin and dihydrocapsaicin induce apoptosis in human glioma cells via ROS and Ca2+–mediated mitochondrial pathway [J]. Mol Med Rep 14(5):4198–4208 Yang L, Hou Y, Du YE, et al (2021) Mirtronic miR-4646-5p promotes gastric cancer metastasis by regulating ABHD16A and metabolite lysophosphatidylserines [J]. Cell Death Differ 28(9):2708–2727 Yang WJ, Zhao HP, Yu Y, et al (2023) Updates on global epidemiology, risk and prognostic factors of gastric cancer [J]. World J Gastroenterol 29(16):2452–2468 Yasuda T, Wang YA (2024) Gastric cancer immunosuppressive microenvironment heterogeneity: implications for therapy development [J]. Trends Cancer 10(7):627–642 Zhang H, Cao X, Gui R, et al (2024) Mesenchymal Stem/Stromal cells in solid tumor Microenvironment: Orchestrating NK cell remodeling and therapeutic insights [J]. Int Immunopharmacol 142(Pt B):113181 Zhai M, Peng B, Zhu H, et al (2025) Wnt5a/Ryk signaling contributes to bone cancer pain by sensitizing the peripheral nociceptors through JNK-mediated TRPV1 pathway in rats [J]. Pain 166(3):680–692 Zhou G, Zhang S, Jin M, et al (2022) Comprehensive analysis reveals COPB2 and RYK associated with tumor stages of larynx squamous cell carcinoma [J]. BMC Cancer 22(1):667 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7167954","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":524423024,"identity":"b01ec240-6d68-4f90-ae6f-5f94e54cd8d8","order_by":0,"name":"Yongan Fu","email":"","orcid":"","institution":"Quanzhou First Affiliated Hospital to Fujian Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yongan","middleName":"","lastName":"Fu","suffix":""},{"id":524423027,"identity":"3654fcd6-20db-4dee-bfd4-e160743272a8","order_by":1,"name":"Zongda Cai","email":"","orcid":"","institution":"Quanzhou First Affiliated Hospital to Fujian Medical University","correspondingAuthor":false,"prefix":"","firstName":"Zongda","middleName":"","lastName":"Cai","suffix":""},{"id":524423028,"identity":"9810272f-83a8-4843-bb15-cb46c90a59cb","order_by":2,"name":"Yangqiang Wang","email":"","orcid":"","institution":"Quanzhou First Affiliated Hospital to Fujian Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yangqiang","middleName":"","lastName":"Wang","suffix":""},{"id":524423029,"identity":"fbafdf7a-17ec-46b6-ba12-9dc9d9b3d3d1","order_by":3,"name":"Mingjin Huang","email":"","orcid":"","institution":"Quanzhou First Affiliated Hospital to Fujian Medical University","correspondingAuthor":false,"prefix":"","firstName":"Mingjin","middleName":"","lastName":"Huang","suffix":""},{"id":524423030,"identity":"28b63a0c-589d-4de4-ac65-a2ae04ce4df5","order_by":4,"name":"Jinghua Huang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAtElEQVRIiWNgGAWjYBACA4YzYFqOjb39AGlajPl4ziQQq4UHTCfOk3AwIE6LOePZgzd//Dmc3ibBkMDwo2IbYS2WDeeSLSTbDue2STceYOw5c5sIhx04YyZh2ADUInMggZmxjVgtCUCHsUkkGJCg5QDb4QSStBhbNralG7YBA/kgcX65ccYQGGLW8vLt7Qcf/KggQguDxAEGCQaGZjD7ABHqgYC/AaSljjjFo2AUjIJRMDIBAF23QWDxjnwWAAAAAElFTkSuQmCC","orcid":"","institution":"Quanzhou First Affiliated Hospital to Fujian Medical University","correspondingAuthor":true,"prefix":"","firstName":"Jinghua","middleName":"","lastName":"Huang","suffix":""}],"badges":[],"createdAt":"2025-07-20 06:53:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7167954/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7167954/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":92872034,"identity":"135fb1c8-1e9c-4522-b96c-743a7a815f93","added_by":"auto","created_at":"2025-10-06 14:11:54","extension":"doc","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2194668,"visible":true,"origin":"","legend":"","description":"","filename":"manuscriptFYA.doc","url":"https://assets-eu.researchsquare.com/files/rs-7167954/v1/d4b7037bce7b2e3a22249b96.doc"},{"id":92869438,"identity":"16ed4c2c-cfd9-4bff-b490-03ad0657f4e9","added_by":"auto","created_at":"2025-10-06 13:47:54","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6515,"visible":true,"origin":"","legend":"","description":"","filename":"21635eafadbf4f4d8c1ce0fe74f9a719.json","url":"https://assets-eu.researchsquare.com/files/rs-7167954/v1/0b4e73411f4f757b2cb0740f.json"},{"id":92870502,"identity":"7a8441fe-ee83-4ff2-821b-0d597cfdb9a4","added_by":"auto","created_at":"2025-10-06 13:55:54","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":74923,"visible":true,"origin":"","legend":"","description":"","filename":"21635eafadbf4f4d8c1ce0fe74f9a7191enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7167954/v1/92f358ebf26483fe62627190.xml"},{"id":92869443,"identity":"e95f4a44-940d-4930-a739-e687084dda7e","added_by":"auto","created_at":"2025-10-06 13:47:54","extension":"jpeg","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1074,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage10.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7167954/v1/d98fdb2cea957b1200aebf28.jpeg"},{"id":92869445,"identity":"de976eae-462c-4668-bd51-96af15d0fb8c","added_by":"auto","created_at":"2025-10-06 13:47:54","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1074,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage10.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7167954/v1/e05c605ff518316ae574846a.jpeg"},{"id":92869441,"identity":"3b608d96-0e0f-42c4-a583-880c8aa4e4e0","added_by":"auto","created_at":"2025-10-06 13:47:54","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1074,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage10.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7167954/v1/5249a5d8a17e853f2a2901f6.jpeg"},{"id":92870504,"identity":"5bc95e76-5a4f-400e-b876-95d60ad36def","added_by":"auto","created_at":"2025-10-06 13:55:54","extension":"jpeg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1074,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage10.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7167954/v1/ba3aac57b34999f1ee16cf8d.jpeg"},{"id":92870771,"identity":"dafe7195-f6f4-4be3-87a2-4a3d3c7529aa","added_by":"auto","created_at":"2025-10-06 14:03:54","extension":"jpeg","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1074,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage10.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7167954/v1/b1c8fa46912f14a1fc9f4268.jpeg"},{"id":92869454,"identity":"5a8bd8f1-070f-44b8-8965-be1e02a30382","added_by":"auto","created_at":"2025-10-06 13:47:54","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":46732,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7167954/v1/2bfa114f3f93518131289a41.png"},{"id":92869451,"identity":"acc43261-ad9d-416b-9d97-88cc0bb149ee","added_by":"auto","created_at":"2025-10-06 13:47:54","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":935,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-7167954/v1/2de72b34fb747ba7db0085f1.png"},{"id":92870506,"identity":"d67f86d7-5d1b-431b-a424-edd114f9c654","added_by":"auto","created_at":"2025-10-06 13:55:54","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":72035,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage11.png","url":"https://assets-eu.researchsquare.com/files/rs-7167954/v1/40e091c277ab8eb96556adb5.png"},{"id":92869458,"identity":"5730438a-ccc3-4de5-a578-42cc30105537","added_by":"auto","created_at":"2025-10-06 13:47:54","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":935,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-7167954/v1/08e1d913ef0ac536d14f8406.png"},{"id":92869461,"identity":"5c153479-b2e8-4df5-a704-c385bd6db501","added_by":"auto","created_at":"2025-10-06 13:47:54","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":118026,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7167954/v1/ce020e9ea6f9528b03b0bbbd.png"},{"id":92869463,"identity":"11e2bf71-1aa1-4ae3-b990-038d26bd119d","added_by":"auto","created_at":"2025-10-06 13:47:54","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":935,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-7167954/v1/80997e293637c5654726a07c.png"},{"id":92869460,"identity":"b60ca6c3-69a3-41c6-ac41-73d0b68090ad","added_by":"auto","created_at":"2025-10-06 13:47:54","extension":"png","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":103874,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7167954/v1/abf0f496c137b2e251b8b596.png"},{"id":92872035,"identity":"1f11ba08-47cc-4ed8-9baa-334b732b96bf","added_by":"auto","created_at":"2025-10-06 14:11:54","extension":"png","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":935,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-7167954/v1/073bedea4123b589c85865aa.png"},{"id":92869449,"identity":"8cd07770-80c8-4c5d-a8e3-a54334c5ddb9","added_by":"auto","created_at":"2025-10-06 13:47:54","extension":"png","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":59253,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7167954/v1/070855490f95245fb37e148f.png"},{"id":92870769,"identity":"12abc984-962e-400e-af1b-00b7b495381f","added_by":"auto","created_at":"2025-10-06 14:03:54","extension":"png","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":935,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-7167954/v1/264e06d672426a886e345e9c.png"},{"id":92869462,"identity":"34792456-acba-40c6-9b79-08198c4f8628","added_by":"auto","created_at":"2025-10-06 13:47:54","extension":"png","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":102021,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-7167954/v1/b3ea57e942a2aefc83d97436.png"},{"id":92869465,"identity":"fa5c0424-8a64-4202-a050-ea231708cb09","added_by":"auto","created_at":"2025-10-06 13:47:54","extension":"xml","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":73561,"visible":true,"origin":"","legend":"","description":"","filename":"21635eafadbf4f4d8c1ce0fe74f9a7191structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7167954/v1/90b1081b3c281b4ee049ebe1.xml"},{"id":92869464,"identity":"bef12cd2-3a34-4b1f-9a59-6f696a991133","added_by":"auto","created_at":"2025-10-06 13:47:54","extension":"html","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":79347,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7167954/v1/9dc293401d9ae64132ba6cc8.html"},{"id":92869439,"identity":"9b083551-3d61-4153-a832-b95c7f50658e","added_by":"auto","created_at":"2025-10-06 13:47:54","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":177334,"visible":true,"origin":"","legend":"\u003cp\u003eConstruction of RYK-silenced BMSCs. (\u003cstrong\u003eA\u003c/strong\u003e) Transfection efficiency of si-RYKs in BMSCs was verified by qRT-PCR, \u003cstrong\u003e(B)\u003c/strong\u003e Transfection efficiency of si-RYKs in BMSCs was verified by WB, (\u003cstrong\u003eC\u003c/strong\u003e) Quantitative analysis of RYK protein expression. Data are presented as the mean±SD. *P \u0026lt;0.05 vs. si-NC.\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7167954/v1/48b0c4ea0131c008562a2041.jpeg"},{"id":92870499,"identity":"34cc8434-fc54-48af-8f47-b7a70717189a","added_by":"auto","created_at":"2025-10-06 13:55:54","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":549505,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of RYK-silenced BMSCs on apoptosis of NCI-N87 cells. (\u003cstrong\u003eA-B\u003c/strong\u003e) The apoptosis of NCI-N87 cells was detected by flow cytometry, \u003cstrong\u003e(C-D\u003c/strong\u003e) The apoptosis-related protein expressions of Caspase3, Bax, and Bcl-2 in NCI-N87 cells were detected by WB. Data are presented as the mean±SD. *P \u0026lt;0.05 vs. N87; \u003csup\u003e#\u003c/sup\u003eP \u0026lt;0.05 vs. si-NC-BMSCs+N87.\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7167954/v1/43b8e073df18ef23a3fcd729.jpeg"},{"id":92870768,"identity":"efc031b5-0735-4196-9ac6-ec4639643578","added_by":"auto","created_at":"2025-10-06 14:03:54","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":656267,"visible":true,"origin":"","legend":"\u003cp\u003eIdentification of Metabolites in RYK-Silenced BMSCs. (\u003cstrong\u003eA\u003c/strong\u003e) Volcano plot showing the diferentially expressed metabolites between the BMSCs-si-NC and BMSCs-si-RYK groups (n=6), \u003cstrong\u003e(B\u003c/strong\u003e) Score plots of principal component analysis from the discovery set, (\u003cstrong\u003eC\u003c/strong\u003e) Heatmap analysis of cell metabolites in the BMSCs-si-NC and BMSCs-si-RYK groups (n=6).\u003c/p\u003e","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7167954/v1/164319c5d1bbef63b27017de.jpeg"},{"id":92870766,"identity":"68f76ea2-4cc6-4638-9b2d-095e7e52f744","added_by":"auto","created_at":"2025-10-06 14:03:54","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":285164,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of DHC on proliferation of NCI-N87 cells. (\u003cstrong\u003eA-C\u003c/strong\u003e) LC-MS was employed to quantify the differences in targeted metabolites across distinct cellular groups, (\u003cstrong\u003eA\u003c/strong\u003e) Anthraquinone, (\u003cstrong\u003eB\u003c/strong\u003e) Dihydrocapsaicin, \u0026nbsp;(\u003cstrong\u003eC\u003c/strong\u003e) Cerulenin, (\u003cstrong\u003eD\u003c/strong\u003e) The proliferation of NCI-N87 cells was detected by CCK-8 at 12, 24, and 48h. Data are presented as the mean±SD. *P \u0026lt;0.05 vs. BMSCs-si-NC or N87.\u003c/p\u003e","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7167954/v1/0b86684b0f578dc689b1c520.jpeg"},{"id":92870510,"identity":"a181cf3b-d276-48c1-8fd5-5d9b15675cc0","added_by":"auto","created_at":"2025-10-06 13:55:54","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":520014,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of DHC on apoptosis of NCI-N87 cells. (\u003cstrong\u003eA-B\u003c/strong\u003e) The apoptosis of NCI-N87 cells was detected by flow cytometry, \u003cstrong\u003e(C-D\u003c/strong\u003e) The apoptosis-related protein expressions of Bax, Caspase3, and Caspase9 in NCI-N87 cells were detected by WB. Data are presented as the mean±SD. *P \u0026lt;0.05 vs. N87.\u003c/p\u003e","description":"","filename":"floatimage9.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7167954/v1/88193bbcdc57a5b64abc263b.jpeg"},{"id":92869447,"identity":"4110a24a-2f16-4df8-9920-bb29a2167d6f","added_by":"auto","created_at":"2025-10-06 13:47:54","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":382004,"visible":true,"origin":"","legend":"\u003cp\u003eThe proposed model suggests that DHC secreted by RYK-silenced BMSCs promote the apoptosis of gastric cancer cells.\u003c/p\u003e","description":"","filename":"floatimage11.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7167954/v1/ef5fee30c28cbe81f3ad4054.jpeg"},{"id":95227704,"identity":"fa9b9d79-68cf-4054-8f99-6e68bdae1890","added_by":"auto","created_at":"2025-11-05 16:32:45","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3222156,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7167954/v1/52bb6f77-4f66-4784-93f8-4bcc41d7e17e.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Dihydrocapsaicin secreted by RYK silencing-modified bone marrow-derived mesenchymal stem cells trigger apoptosis of gastric cancer cells","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eGastric cancer (GC) ranks as one of the most prevalent malignancies globally, being the second leading cause of cancer-related mortality worldwide (Yasuda and Wang \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). It is also the most common cancer in East Asia, with approximately 990,000 new cases diagnosed annually (Wu et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). GC is a multifactorial disease influenced by both environmental and genetic factors. Key risk factors include age, sex, smoking, and Helicobacter pylori infection (Mamun et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Machlowska et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Yang et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Despite advancements in surgical resection and adjuvant chemotherapy that have improved patient survival, the overall prognosis for gastric cancer remains suboptimal (Thrift et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Therefore, it is urgent to elucidate the development mechanism of gastric cancer and find effective treatment strategies.\u003c/p\u003e\u003cp\u003eMesenchymal stem cells (MSCs) are intricately associated with the initiation and progression of tumors (Karami et al. \u003cb\u003e2023;\u003c/b\u003e Ridge et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Research has demonstrated that circulating MSCs can migrate and localize to tumor sites under the chemotactic influence of growth factors and chemokines secreted by tumor cells and other inflammatory cells, thereby contributing to the formation of the tumor microenvironment (Lin et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The biological properties of MSCs are modulated by the tumor microenvironment, which may enhance their angiogenic capacity, immunosuppressive functions, and anti-apoptotic activities (Fu et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Moreover, MSCs can facilitate the epithelial-mesenchymal transition in tumor cells and protect the survival of cancer stem cells, thereby contributing significantly to tumor initiation and progression. Earlier research has indicated that BMSCs can accelerate the development of gastric cancer (Qi et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Acting as a Wnt5a receptor in the non-canonical Wnt signaling pathway, RYK participates in the regulation of the onset and progression of various cancers (Keeble and Cooper \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Liang et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; FAdamo et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Our prior investigation also demonstrated that knocking down RYK in gastric cancer cells could suppress the malignant behavior of gastric cancer (Fu et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Nevertheless, no studies have explored the impact of RYK depletion in BMSCs on the apoptosis of gastric cancer cells. Consequently, this study was designed to examine how RYK-depleted BMSCs influence the apoptosis of gastric cancer cells and to elucidate the associated molecular mechanisms.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cp\u003e\u003cb\u003eMaterials.\u003c/b\u003e Human bone marrow mesenchymal stem cells (BMSCs) and the gastric cancer cell line NCI-N87 were obtained from Wuhan Pricella Biotechnology Co., Ltd. (Shanghai, China). The Cell Counting Kit-8 and the Annexin V-FITC Apoptosis Detection Kit were acquired from Solaibao Technology Co., Ltd. (Beijing, China). Antibodies targeting Caspase-3, Bax, Bcl-2, RYK, β-Actin, and Caspase-9 were sourced from Abcam (Cambridge, United Kingdom). Anthraquinone, Dihydrocapsaicin, and Cerulenin were purchased from MCE (New Jersey, USA). The siRNAs, including Si-RYK-1, Si-RYK-2, Si-RYK-3, and the negative control siRNA (si-NC), were provided by GenePharma (Shanghai, China).\u003c/p\u003e\u003cp\u003e\u003cb\u003eCell culture and transfection.\u003c/b\u003e Human BMSCs and NCI-N87 cells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin at 37\u0026deg;C in an atmosphere containing 5% CO\u003csub\u003e2\u003c/sub\u003e.\u003c/p\u003e\u003cp\u003eThe transfection procedure was initiated when the confluence of BMSCs reached 70%. Initially, the culture medium was replaced with 1 ml of serum-free medium. Two sterilized EP tubes were prepared, and each tube received 125 \u0026micro;l of Opti-MEM diluent. To one EP tube, 5 \u0026micro;l of Lipofectamine 3000 reagent was added, while to the other, 12.5 \u0026micro;l of siRNA was introduced (the siRNA powder should be pre-dissolved in DEPC water at a concentration of 1 OD/125 \u0026micro;l). After thorough mixing, both EP tubes were incubated at room temperature for 5 minutes. The contents of the two EP tubes were then combined and mixed evenly, followed by an additional incubation at room temperature for 15 minutes. Drops of this combined solution were subsequently added to the appropriate wells of a six-well plate, after which the cells were returned to the incubator for further growth. Four to six hours post-transfection, 1 ml of complete medium containing 20% serum was added to the six-well plate. After 48 hours, the conditioned medium required for the experiment was harvested. This experiment included three control groups: the first group, labeled as si-NC-BMSCs\u0026thinsp;+\u0026thinsp;N87, involved treating NCI-N87 cells with the conditioned medium from the si-NC group of BMSCs for 24 hours; the second group, designated as si-RYK-BMSCS\u0026thinsp;+\u0026thinsp;N87, entailed treating NCI-N87 cells with the conditioned medium from the si-RYK group of BMSCs for 24 hours; the third group, simply referred to as the N87 group, consisted of untreated normal NCI-N87 cells cultured for 24 hours as a baseline comparison.\u003c/p\u003e\u003cp\u003e\u003cb\u003eQuantitative real-time PCR (qRT-PCR).\u003c/b\u003e Samples were collected and the total RNA was isolated using a Total RNA Miniprep Kit. Subsequently, cDNA synthesis was carried out following the instructions provided by the manufacturer. The qRT-PCR analysis was performed under these conditions: an initial denaturation step at 95\u0026deg;C for 5 minutes, then denaturation at 95\u0026deg;C for 10 seconds, annealing at 60\u0026deg;C for 30 seconds, and a final extension phase from 65 to 95\u0026deg;C, increasing the temperature by 0.5\u0026deg;C every 5 seconds. After completion of the reaction, average cycle threshold (Ct) values were determined for each gene as well as for the reference gene. The relative expression levels of genes were evaluated using the widely accepted method known as 2\u003csup\u003e\u0026minus; ΔΔCT\u003c/sup\u003e. The sequences of the primers were showed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimer sequence\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene symbol\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward Primer\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eReverse primer\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRYK\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCAACTCCTATCACCAGTTATCCT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTAAAATCCCATGGAAAATACGCCC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eβ-actin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGGCACCCAGCACAATGAA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTAAGTCATAGTCCGCCTAGAAGCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eCell apoptosis assay.\u003c/b\u003e The harvested cells (1\u0026times;10\u003csup\u003e6\u003c/sup\u003e) were first centrifuged at 1500 rpm for 3 minutes using PBS, followed by two rinsing steps. Next, the cell pellet was re-suspended in 300 \u0026micro;L of pre-chilled 1\u0026times; Annexin V-FITC binding buffer. Afterwards, 5 \u0026micro;L of Annexin V-FITC and 10 \u0026micro;L of propidium iodide (PI) were added to each sample well. The mixture was gently vortexed and then incubated in the dark at room temperature for 10 minutes. Finally, the samples were subjected to analysis via NovoCyte flow cytometry.\u003c/p\u003e\u003cp\u003e\u003cb\u003eWestern Blotting.\u003c/b\u003e According to the method proposed by Wu et al. (Wu et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), the detection of apoptosis-related proteins was conducted across different cell groups.\u003c/p\u003e\u003cp\u003e\u003cb\u003eNon-targeted metabolomics assay.\u003c/b\u003e Differential metabolites in various cell types were detected using liquid chromatography-mass spectrometry (LC-MS) as previously described (Yang et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cb\u003eTargeted differential metabolites were detected by LC-MS.\u003c/b\u003e Take 100 \u0026micro;L of the cell supernatant sample and add 300 \u0026micro;L of methanol. Vortex for 60 seconds, then centrifuge at 17,000 \u0026times; g for 15 minutes. Collect the supernatant for subsequent analysis. Standard solutions of varying concentrations were prepared using 75% methanol, and mixed with the internal standard in a 1:1 ratio to generate the calibration standards. The sample loading was performed under the following conditions: the column temperature was maintained at 40\u0026deg;C, with an injection volume of 3 \u0026micro;L and utilizing the positive ion mode. The mobile phase was composed of two components: A (water containing 0.1% formic acid) and B (acetonitrile). Gradient elution was carried out as follows: 4% B (from 0 to 3 min), increasing from 4\u0026ndash;70% B (from 3 to 10 min), further increasing from 70\u0026ndash;100% B (from 10 to 36 min), decreasing from 100\u0026ndash;4% B (from 36 to 37 min), and maintaining 4% B (from 37 to 40 min). The flow rate was kept constant at 400 \u0026micro;L/min. For mass spectrometry, data were collected using an AB 6600 mass spectrometer in positive ion mode. The ESI ion source settings were adjusted as follows: gas temperature set to 500\u0026deg;C, curtain gas pressure at 25 Psi, collision gas pressure at 10 Psi, ion spray voltage at 5500 V, and atomization temperature at 500\u0026deg;C.\u003c/p\u003e\u003cp\u003e\u003cb\u003eCCK-8 assay.\u003c/b\u003e Cell viability was measured using a cell counting kit-8. Briefly, cells (2\u0026times;10\u003csup\u003e4\u003c/sup\u003e/well) were seeded in 96-well plate and cultured for 48 h. Then, each well was supplement with 10 \u0026micro;l CCK8 solution and incubated for 1 h. Afterwards, the absorbance was measured using a microplate reader at the wavelength of 450 nm.\u003c/p\u003e\u003cp\u003e\u003cb\u003eStatistical Analyses.\u003c/b\u003e The statistical analysis was conducted using SPSS 26.0, with experimental data presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (x\u0026thinsp;\u0026plusmn;\u0026thinsp;s). Inter group comparisons were analyzed through One-Way ANOVA, while two-group comparisons were performed using a t-test. A p-value of less than 0.05 was regarded as indicating a statistically significant difference.\u003c/p\u003e"},{"header":"RESULTS","content":"\u003cp\u003e\u003cb\u003eConstruction of RYK-silenced BMSCs.\u003c/b\u003e Si-NC and three different si-RYK was transfected into BMSCs, and the silencing effect of RYK was verified by qPCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA) and WB (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB-C). Compared with the si-NC group, the mRNA and protein expression of RYK in si-RYK-1, si-RYK-2, and si-RYK-3 group were significantly decreased in BMSCs (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). According to the results of silencing RKY, we used si-RYK-3 for follow-up experiments.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eEffect of RYK-silenced BMSCs on apoptosis of NCI-N87 cells.\u003c/b\u003e As illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, flow cytometry was employed to assess the apoptosis of various NCI-N87 cells. In comparison with the N87 group, a significant reduction in apoptosis was observed in the si-NC-BMSCs\u0026thinsp;+\u0026thinsp;N87 group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). These findings indicate that BMSCs possess the ability to suppress apoptosis in NCI-N87 cells. Furthermore, when compared to the si-NC-BMSCs\u0026thinsp;+\u0026thinsp;N87 group, there was a marked increase in apoptosis in the si-RYK-BMSCs\u0026thinsp;+\u0026thinsp;NCI-N87 group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Additionally, we conducted further analysis on the expression levels of proteins associated with apoptosis (Caspase3, Bax, and Bcl-2) using Western blotting (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). The quantitative protein analysis results are displayed in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD. Relative to the N87 group, the expression levels of Caspase3 and Bax proteins in NCI-N87 cells were notably reduced in the si-NC-BMSCs\u0026thinsp;+\u0026thinsp;N87 group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), whereas Bcl-2 protein expression was significantly elevated (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Conversely, in comparison with the si-NC-BMSCs\u0026thinsp;+\u0026thinsp;N87 group, the si-RYK-BMSCs\u0026thinsp;+\u0026thinsp;N87 group exhibited a significant increase in Caspase3 and Bax protein expression (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), while Bcl-2 protein expression was substantially decreased (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eIdentification of Metabolites in RYK-Silenced BMSCs.\u003c/b\u003e To further analyze the metabolic components of si-RYK-BMSCs in inhibiting the apoptosis of NCI-N87 cells, we used metabolomics to analyze the differential metabolites between si-RYK-BMSCs and si-NC-BMSCs. The volcano plot in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA showed that there were 104 up-regulated metabolites and 306 down-regulated metabolites in the RYR group (si-RYK-BMSCs) compared with the NC group (si-NC-BMSCs). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB, We employed principal component analysis (PCA) to visualize the clustering between the NC and RYR groups and observed a significant separation in the PCA score plots between the two groups. Subsequently, we normalized the metabolites exhibiting the most significant differences, identified the top 10 metabolites with the most substantial up-regulation and the top 12 metabolites with the most pronounced down-regulation, and generated a cluster heatmap to visualize the results (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eEffect of DHC on proliferation of NCI-N87 cells.\u003c/b\u003e To further validate the elevated levels of differential metabolites in the BMSCs-si-RYK group, we employed liquid chromatography-mass spectrometry (LC-MS) to quantify the concentrations of three specific metabolites (Anthraquinone, Dihydrocapsaicin, and Cerulenin) in different cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-C). The results showed that compared with the BMSCs-si-NC group, the level of dihydrocapsaicin (DHC) in the BMSCs-si-RYK group was significantly increased (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), whereas the levels of the other two metabolites showed no significant differences (P\u0026thinsp;\u0026gt;\u0026thinsp;0.05). Additionally, we used a CCK-8 assay to investigate the effect of DHC on the proliferation of NCI-N87 cells at 12, 24, 48h (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). Compared with the N87 group, the proliferation of NCI-N87 cells were significantly decreased in the 60 \u0026micro;M DHC and 80 \u0026micro;M DHC group at 12, 24, 48h (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The results showed that DHC can inhibit the proliferation of NCI-N87 cells.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eEffect of DHC on apoptosis of NCI-N87 cells.\u003c/b\u003e Subsequently, flow cytometry and WB were used to detect the apoptosis of different treated cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). The analysis results of flow cytometry were shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB. Compared with the N87 group, the apoptosis of NCI-N87 cells were significantly increased in the 60 \u0026micro;M DHC and 80 \u0026micro;M DHC group (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). The apoptosis level of NCI-N87 cells also increased with the increase in DHC dose. Moreover, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD, the Bax, Caspase3, and Caspase9 protein expression in the 60 \u0026micro;M DHC and 80 \u0026micro;M DHC group were significantly increased (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) compared with the N87 group.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTaken together, we concluded that si-RYK intervention in BMSCs promotes the apoptosis in gastric cancer cells by enhancing the release of DHC from BMSCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eWhen a tumor develops within the body, non-cancerous tissue-derived mesenchymal stem cells (MSCs), such as BMSCs, are recruited to the cancerous tissue and become an integral component of the tumor microenvironment (Zhang et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Subsequently, under the influence of inflammatory cytokines and other stromal cells present at the local cancer site, BMSCs undergo differentiation, acquiring novel characteristics, and transform into resident MSCs within the tumor tissue (Taheri et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Mu et al. found that co-culture of BMSCs with SGC7901 gastric cancer cells could significantly promote the apoptosis of gastric cancer cells (Mu et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). In this paper, we found that treating NCI-N87 cells with the conditioned medium from BMSCs could inhibit their apoptosis, which is consistent with the results of Mu et al. However, BMSCs modified by gene editing exhibit the ability to suppress tumor progression. Liu et al. found that treatment of breast cancer cells with Rictor knockout BMSCs inhibited bone metastasis of breast cancer (Liu et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Chang et al. demonstrated that treating gastric cancer cells with BMSC-derived exosomes overexpressing miR-1228 significantly suppressed the apoptosis of gastric cancer cells (Chang et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Thus, inhibiting gastric cancer progression by utilizing genetically modified BMSCs holds significant potential for the treatment of gastric cancer.\u003c/p\u003e\u003cp\u003eRYK belongs to the family of receptor tyrosine kinases, a group of genes that encode proteins typically located on cell membranes. These proteins are capable of detecting external signals and converting them into intracellular biochemical reactions (Zhai et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2025\u003c/span\u003e; Gonzalez et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Zhou et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). A series of studies have demonstrated that the abnormal expression of RYK is significantly associated with various types of cancer, including breast, colorectal, and gastric cancers (Wow et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Gorro\u0026ntilde;o-Etxebarria et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Our earlier research also demonstrated that reducing RYK expression in gastric cancer cells can inhibit liver metastasis of gastric cancer (Fu et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). However, there are few studies that have reported the effect of si-RYK modified BMSCs on apoptosis of gastric cancer cells. In this paper, we found that treating NCI-N87 cells with the conditioned medium from si-RYK modified BMSCs could promote the apoptosis compared with the si-NC-BMSCs\u0026thinsp;+\u0026thinsp;N87 group.\u003c/p\u003e\u003cp\u003eDihydrocapsaicin, as a spicy component of capsicum, has been found to have analgesic, anti-inflammatory, antioxidant, anti-obesity and anti-cancer effects (Lai et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Laorob et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Hud\u0026aacute;kov\u0026aacute; et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). Shi et al. found that treating melanoma cell lines with dihydrocapsaicin could significantly inhibit the proliferation, migration and metastasis of melanoma cells (Shi et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Xie et al. demonstrated that treatment of glioma cell lines with dihydrocapsaicin significantly enhanced the apoptosis of glioma cells (Xie et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). However, no studies have reported the effect of dihydrocapsaicin on the development of gastric cancer. In this study, metabolomics analysis was employed to investigate the metabolite profiles of Si-RyK-modified BMSCs, revealing a significant increase in dihydrocapsaicin levels within these modified cells. Subsequently, we treated gastric cancer cell line NCI-N87 with different concentrations of dihydrocapsaicin, and found that dihydrocapsaicin could significantly promote the apoptosis of NCI-N87 cells and increase the expression of pro-apoptotic protein (Bax, Caspase3, and Caspase9). Taken together, our results suggest that RYK silencing-modified BMSCs can induce the apoptosis of NCI-N87 cells, potentially through increased secretion of DHC. However, this study also has some limitations. This study did not investigate the potential signaling pathways involved in the effect of dihydrocapsaicin on apoptosis of gastric cancer cells. We will conduct an in-depth analysis of the signaling pathway by which dihydrocapsaicin promotes apoptosis in gastric cancer cells and validate it through both in vivo and in vitro experiments in our subsequent study.\u003c/p\u003e"},{"header":"CONCLUSIONS","content":"\u003cp\u003eAccording to the findings of this study, we conclude that BMSCs modified by RYK silencing are capable of triggering apoptosis in NCI-N87 cells, possibly by enhancing the secretion of DHC.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYongan Fu conceived and designed the experiments. Yongan Fu, Zongda Cai, and Yangqiang Wang carried out the experiments. Yongan Fu and Mingjin Huang drafted the manuscript. Jinghua Huang revised the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by grants from the Fujian Provincial Natural Science Foundation of China [grant numbers: 2021J011405; 2024J011522].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData will be made available on request.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interests\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing financial interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical Approval and Consent to participate:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePatient consent for publication\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eChang L, Gao H, Wang L, et al (2021) Exosomes derived from miR-1228 overexpressing bone marrow-mesenchymal stem cells promote growth of gastric cancer cells [J]. Aging (Albany NY) 13(8):11808\u0026ndash;11821\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFAdamo A, Fiore D, De Martino F, et al (2017) RYK promotes the stemness of glioblastoma cells via the WNT/ β-catenin pathway [J]. Oncotarget 8(8):13476\u0026ndash;13487\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFu Y, Chen Y, Huang J, et al (2020) RYK, a receptor of noncanonical Wnt ligand Wnt5a, is positively correlated with gastric cancer tumorigenesis and potential of liver metastasis [J]. Am J Physiol Gastrointest Liver Physiol 318(2):G352-G360\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFu Y, Zhang M, Sui B, et al (2024) Mesenchymal stem cell-derived apoptotic vesicles ameliorate impaired ovarian folliculogenesis in polycystic ovary syndrome and ovarian aging by targeting WNT signaling [J]. Theranostics 14(8):3385\u0026ndash;3403\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGonzalez RD, Small GW, Green AJ, et al (2023) RYK Gene Expression Associated with Drug Response Variation of Temozolomide and Clinical Outcomes in Glioma Patients [J]. Pharmaceuticals (Basel) 16(5):726\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGorro\u0026ntilde;o-Etxebarria I, Aguirre U, Sanchez S, et al (2019) Wnt-11 as a Potential Prognostic Biomarker and Therapeutic Target in Colorectal Cancer [J]. Cancers (Basel) 11(7):908\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHud\u0026aacute;kov\u0026aacute; T, Šemel\u0026aacute;kov\u0026aacute; M, Očen\u0026aacute;š P, et al (2024) Chili pepper extracts, capsaicin, and dihydrocapsaicin as potential anticancer agents targeting topoisomerases [J]. BMC Complement Med Ther 24(1):96\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKarami Fath M, Moayedi Banan Z, Barati R, et al (2023) Recent advancements to engineer mesenchymal stem cells and their extracellular vesicles for targeting and destroying tumors [J]. Prog Biophys Mol Biol 178:1\u0026ndash;16\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKeeble TR, Cooper HM (2006) Ryk: a novel Wnt receptor regulating axon pathfinding [J]. Int J Biochem Cell Biol 38(12):2011\u0026ndash;7\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLai Y, Yang N, Chen X, et al (2024) Dihydrocapsaicin suppresses the STING-mediated accumulation of ROS and NLRP3 inflammasome and alleviates apoptosis after ischemia-reperfusion injury of perforator skin flap [J]. Phytother Res 38(5):2539\u0026ndash;2559\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLaorob T, Ngoenkam J, Nuiyen A, et al (2024) Comparative effectiveness of nitro dihydrocapsaicin, new synthetic derivative capsaicinoid, and capsaicin in alleviating oxidative stress and inflammation on lipopolysaccharide-stimulated corneal epithelial cells [J]. Exp Eye Res 244:109950\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiang Z, Liu L, Gao R, et al (2022) Downregulation of exosomal miR-7-5p promotes breast cancer migration and invasion by targeting RYK and participating in the atypical WNT signalling pathway [J]. Cell Mol Biol Lett 27(1):88\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLin W, Huang L, Li Y, et al (2019) Mesenchymal Stem Cells and Cancer: Clinical Challenges and Opportunities [J]. Biomed Res Int 2019:2820853\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu Z, Wang H, He J, et al (2019) Rictor ablation in BMSCs inhibits bone metastasis of TM40D cells by attenuating osteolytic destruction and CAF formation [J]. Int J Biol Sci 15(11):2448\u0026ndash;2460\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMachlowska J, Baj J, Sitarz M, et al (2020) Gastric Cancer: Epidemiology, Risk Factors, Classification, Genomic Characteristics and Treatment Strategies [J]. Int J Mol Sci 21(11):4012\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMamun TI, Younus S, Rahman MH (2024) Gastric cancer-Epidemiology, modifiable and non-modifiable risk factors, challenges and opportunities: An updated review [J]. Cancer Treat Res Commun 41:100845\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMu L, Sui W, Lin Y, et al (2019) Androgen attenuates antitumor effects of gastric cancer cells by bone marrow mesenchymal stem cells via restricting the JNK signaling activation [J]. Transl Cancer Res 8(3):917\u0026ndash;927\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eQi C, Shi H, Fan M, et al (2023) Microvesicles from bone marrow-derived mesenchymal stem cells promote Helicobacter pylori-associated gastric cancer progression by transferring thrombospondin-2 [J]. Cell Commun Signal 21(1):274\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRidge SM, Sullivan FJ, Glynn SA (2017) Mesenchymal stem cells: key players in cancer progression [J]. Mol Cancer 16(1):31\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShi S, Li C, Zhang Y, et al (2021) Dihydrocapsaicin Inhibits Cell Proliferation and Metastasis in Melanoma via Down-regulating β-Catenin Pathway [J]. Front Oncol 11:648052\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTaheri M, Tehrani HA, Dehghani S, et al (2024) Nanotechnology and bioengineering approaches to improve the potency of mesenchymal stem cell as an off-the-shelf versatile tumor delivery vehicle [J]. Med Res Rev 44(4):1596\u0026ndash;1661\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eThrift AP, Wenker TN, El-Serag HB (2023) Global burden of gastric cancer: epidemiological trends, risk factors, screening and prevention [J]. Nat Rev Clin Oncol 20(5):338\u0026ndash;349\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWow T, Murawa D, Boguszewska-Byczkiewicz K, et al (2023) Retrospective analysis of treatment, including access to breast reconstructions, of breast cancer patients - war refugees from Ukraine in Poland - the experience of a single tertiary care institution [J]. Pol Przegl Chir 95(6):20\u0026ndash;23\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWu M, Yuan S, Liu K et al (2024) Gastric Cancer Signaling Pathways and Therapeutic Applications [J]. Technol Cancer Res Treat 23:15330338241271935\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWu YJ, Wong BS, Yea SH, et al (2016) Sinularin Induces Apoptosis through Mitochondria Dysfunction and Inactivation of the pI3K/Akt/mTOR Pathway in Gastric Carcinoma Cells [J]. Mar Drugs 14(8):142\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXie L, Xiang GH, Tang T, et al (2016) Capsaicin and dihydrocapsaicin induce apoptosis in human glioma cells via ROS and Ca2+\u0026ndash;mediated mitochondrial pathway [J]. Mol Med Rep 14(5):4198\u0026ndash;4208\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang L, Hou Y, Du YE, et al (2021) Mirtronic miR-4646-5p promotes gastric cancer metastasis by regulating ABHD16A and metabolite lysophosphatidylserines [J]. Cell Death Differ 28(9):2708\u0026ndash;2727\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYang WJ, Zhao HP, Yu Y, et al (2023) Updates on global epidemiology, risk and prognostic factors of gastric cancer [J]. World J Gastroenterol 29(16):2452\u0026ndash;2468\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYasuda T, Wang YA (2024) Gastric cancer immunosuppressive microenvironment heterogeneity: implications for therapy development [J]. Trends Cancer 10(7):627\u0026ndash;642\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang H, Cao X, Gui R, et al (2024) Mesenchymal Stem/Stromal cells in solid tumor Microenvironment: Orchestrating NK cell remodeling and therapeutic insights [J]. Int Immunopharmacol 142(Pt B):113181\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhai M, Peng B, Zhu H, et al (2025) Wnt5a/Ryk signaling contributes to bone cancer pain by sensitizing the peripheral nociceptors through JNK-mediated TRPV1 pathway in rats [J]. Pain 166(3):680\u0026ndash;692\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhou G, Zhang S, Jin M, et al (2022) Comprehensive analysis reveals COPB2 and RYK associated with tumor stages of larynx squamous cell carcinoma [J]. BMC Cancer 22(1):667\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Dihydrocapsaicin, RYK, Bone marrow-derived mesenchymal stem cells, Gastric cancer, apoptosis","lastPublishedDoi":"10.21203/rs.3.rs-7167954/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7167954/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBone marrow-derived mesenchymal stem cells (BMSCs) have been proven to be recruited into the tumor microenvironment and contribute to gastric cancer (GC) progression, However, the exact mechanisms remain poorly understood. This study explored the potential mechanism of RYK-silenced BMSCs on gastric cancer cell apoptosis. Firstly, BMSCs were transfected with the RYK siRNA and their corresponding negative controls, and cell co-culture were used to explore the interaction between different BMSCs and NCI-N87 cells. Then, Cancer cell cycle apoptosis was evaluated by flow cytometry. Western blot analysis was performed to determine the protein levels of Caspase3, Bax, and Bcl-2 in NCI-N87 cells. Then metabolomics was used to analyze the differential metabolites in different BMSCs. Furthermore, the NCI-N87 cells were treated with dihydrocapsaicin (DHC), and the proliferation activity, apoptosis level, and expression of apoptosis-related proteins in the NCI-N87 cells were detected after different DHC treatments. Compared to NCI-N87 cells cultured alone, co-culture with si-NC-modified BMSCs reduced apoptosis in NCI-N87 cells. However, co-culture with si-RYK-BMSCs significantly increased apoptosis. Additionally, DHC, a metabolic product secreted by BMSCs after RYK interference, suppresses NCI-N87 cell growth, promotes cell death, and increases the expression of apoptosis-related proteins. These findings suggest that RYK silencing-modified BMSCs can induce the apoptosis of NCI-N87 cells, potentially through increased secretion of DHC.\u003c/p\u003e","manuscriptTitle":"Dihydrocapsaicin secreted by RYK silencing-modified bone marrow-derived mesenchymal stem cells trigger apoptosis of gastric cancer cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-06 13:47:49","doi":"10.21203/rs.3.rs-7167954/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"2d903794-4da1-4622-b7b2-d8def4f40737","owner":[],"postedDate":"October 6th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-11-05T03:23:38+00:00","versionOfRecord":[],"versionCreatedAt":"2025-10-06 13:47:49","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7167954","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7167954","identity":"rs-7167954","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00