Full text
40,545 characters
· extracted from
preprint-html
· click to expand
The Role of miR-125a-5p in the Function and Development of Regulatory T Cells | Authorea try { document.documentElement.classList.add('js'); } catch (e) { } var _gaq = _gaq || []; _gaq.push(['_setAccount', 'G-8VDV14Y67G']); _gaq.push(['_trackPageview']); (function() { var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s); })(); Skip to main content Preprints Collections Wiley Open Research IET Open Research Ecological Society of Japan All Collections About About Authorea FAQs Contact Us Quick Search anywhere Search for preprint articles, keywords, etc. Search Search ADVANCED SEARCH SCROLL This is a preprint and has not been peer reviewed. Data may be preliminary. 8 March 2025 V1 Latest version Share on The Role of miR-125a-5p in the Function and Development of Regulatory T Cells Authors : Cilan Wang , Jinfeng Fu , Haiping Huang , Liuling Chen , Mengyu Deng , Jingli Liu 0000-0002-3094-3021 [email protected] , and Jinpin Li Authors Info & Affiliations https://doi.org/10.22541/au.174144075.59676979/v1 216 views 98 downloads Contents Abstract Information & Authors Metrics & Citations View Options References Figures Tables Media Share Abstract MicroRNAs are a class of endogenous noncoding small RNAs that have emerged as critical posttranscriptional regulators of the immune system. However, there have been few functional studies of the relationship between microRNA and immunosuppression. Here, the microRNA miR-125a-5p was identified as a key regulator of Tregs. We used miR-125a-5p knockout mice to explore the relationship between miR-125a-5p and Treg function and development in vivo and examine the underlying biochemical mechanisms. PCR and Western blotting were used to verify the regulatory relationship between miR-125a-5p and Foxp3 in mice in vivo, and flow cytometry was used to explore the proportions and numbers of Tregs in immune organs. The immunosuppressive effect of Tregs on other lymphocytes was analysed by measuring the proliferation of splenic lymphocytes after Con A induction. ELISA kits were used to detect inflammatory cytokines in mouse serum. In miR-125a-5p knockout mice, deletion of miR-125a-5p caused a decrease in Foxp3 expression, reduced Treg numbers, and an imbalance in inflammatory cytokines. Overall, our results indicated that miR-125a-5p contributes to Treg homeostasis and function, providing insights into potential miRNA-based therapies for autoimmune diseases. The Role of miR-125a-5p in the Function and Development of Regulatory T Cells Cilan Wang 1 , Jinfeng Fu 1 , Haiping Huang, Liuling Chen, Mengyu Deng, Jingli Liu*, and Jinpin Li* Authors’ Affiliations: Department of Neurology, The First Affiliated Hospital of Guangxi Medical University, No. 6 Shuangyong Road, Nanning 530021, Guangxi, China. Email address: [email protected] (Cilan Wang) [email protected] (Jinfeng Fu) [email protected] (Haiping Huang) [email protected] (Liuling Chen) [email protected] (Mengyu Deng) [email protected] (Jingli Liu) [email protected] (Jinpin Li) * Corresponding Authors at: Department of Neurology, The First Affiliated Hospital of Guangxi Medical University, No 6, Shuangyong Road, Nanning 530021, Guangxi, China Tel: +86-136-0771-2144; Fax: +86-771-535-0031; Correspondence should be addressed to Jingli Liu*; [email protected] and Jinpin Li*; [email protected] * Designated as co-corresponding authors. 1 Designated as co-first authors, these authors contributed equally to this work. Abstract MicroRNAs are a class of endogenous noncoding small RNAs that have emerged as critical posttranscriptional regulators of the immune system. However, there have been few functional studies of the relationship between microRNA and immunosuppression. Here, the microRNA miR-125a-5p was identified as a key regulator of Tregs. We used miR-125a-5p knockout mice to explore the relationship between miR-125a-5p and Treg function and development in vivo and examine the underlying biochemical mechanisms. PCR and Western blotting were used to verify the regulatory relationship between miR-125a-5p and Foxp3 in mice in vivo, and flow cytometry was used to explore the proportions and numbers of Tregs in immune organs. The immunosuppressive effect of Tregs on other lymphocytes was analysed by measuring the proliferation of splenic lymphocytes after Con A induction. ELISA kits were used to detect inflammatory cytokines in mouse serum. In miR-125a-5p knockout mice, deletion of miR-125a-5p caused a decrease in Foxp3 expression, reduced Treg numbers, and an imbalance in inflammatory cytokines. Overall, our results indicated that miR-125a-5p contributes to Treg homeostasis and function, providing insights into potential miRNA-based therapies for autoimmune diseases. Keywords: miR-125a-5p, Foxp3, regulatory T cells, inflammation, cytokines Introduction Regulatory T cells (Treg cells or Tregs) are a lineage of CD4+ T cells that play indispensable roles in maintaining immunological unresponsiveness to self-antigens and in suppressing excessive immune responses that are deleterious to the host [1] . There is a strong relationship between Foxp3 expression and Treg differentiation and immunosuppression [2] . By expressing the transcription factor Foxp3, Tregs inhibit the activation and expansion of autoreactive T cells and other pathogenic immune cells. Accumulating evidence suggests that Treg-mediated tolerance is critically dependent on microRNAs (miRNAs), which protect the functional program of Tregs under inflammatory conditions. In addition, a partial Treg-like miRNA profile is conferred by enforced expression of Foxp3 via the activation of conventional CD4+ T cells [3, 4] . MiRNAs are endogenous RNAs that are approximately 20 nucleotides in length and regulate the expression of protein-coding genes. They are universal posttranscriptional regulators in animals and plants that function via mRNA cleavage or translational repression[5]. After decades of research, more than 700 miRNAs have been identified in mammals and implicated in a variety of biological functions, including cell proliferation, differentiation and apoptosis[6-8]. However, knowledge of the specific miRNAs that are important for Treg function remains limited. The highly conserved miRNA-125 family has received extensive attention; furthermore, miR-125a-5p has been demonstrated to be involved in the pathogenesis of thymoma-associated myasthenia gravis (TAMG) and directly targets Foxp3[9]. Exploring the role of miR-125a-5p in Tregs is likely to lead to the identification of new treatment strategies for autoimmune diseases. Scholars have used in vitro culture of CD4+ T cells from the spleens of miR-125a knockout mice to explore the ability of miR-125a to control autoimmune diseases by stabilizing immune homeostasis mediated by Tregs[10]. To date, miR-125a-5p has not been reported to control Tregs in vivo. The actions of cytokines are required for immune homeostasis, as they direct the development, migration, and function of immune effector cells[11]. Recent evidence that GATA3 mediates miR-125a-5p expression to maintain the function of Tregs by regulating IL-6R and STAT3[12] prompted our interest in which cytokines are associated with miR-125a-5p deficiency in vivo. To systematically explore the function of miR-125a-5p in vivo, we developed miR-125a-5p knockout mice and investigated the contribution of miR-125a-5p to Treg development and function. In this study, we aimed to explore the regulatory mechanisms by which miR-125a-5p stabilizes Treg-mediated immune homeostasis and controls autoimmunity. 1. Materials and Methods 2. Mice. MiR-125a-5p knockout mice (KO mice) were created by GemPharmatech Co., Ltd., on the C57BL/6J background. The sequences of the primers used for genotyping the mouse miR-125a-5p-coding sequence were as follows: forwards primer 5’- TTGTATAGTTGAGGAAGACACCCGAG -3’ and reverse primer 5’- GCAGTGTAGCTATGGTGGACCAGAAA -3’. C57BL/6J wild-type mice (WT mice) (8–13 weeks old, 18–24 g) were purchased from Animal Experiment Central of Guangxi Medical University. All mice were paired with respect to body weight and age, and there were equal numbers of males and females. All mice were maintained in a specific pathogen-free laboratory animal room. Animal experiments were conducted in accordance with the guidelines of the Animal Care and Use Committee at Guangxi Medical University. 3. RNA isolation and qPCR. Mice were sacrificed by cervical dislocation after isoflurane anesthesia. The spleen and thymus gland of the mice were collected to extract RNA. Total RNA, containing miRNAs, was isolated from mouse tissues with RNAiso Plus (Takara, Dalian, China) according to the manufacturer’s instructions. cDNA was synthesized with the miRNA First-Strand cDNA Synthesis Tailing Reaction Kit (Sangon Biotech, Shanghai, China) and PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Dalian, China) according to the manufacturer’s instructions. The expression levels of miR-125a-5p and Foxp3 were assayed with TB GreenTM Premix Ex TaqTM II Tli RNaseH Plus (Takara, Dalian, China). Each sample was analysed in triplicate, and relative expression was normalized to the endogenous control U6 or GAPDH using the 2−ΔΔCt method. The sequences of the primers that were used are as follows: U6 forwards primer, 5’−AACGAGACGACGACAGAC−3’; universal miRNA qPCR reverse primer, 5’−GCAAATTCGTGAAGCGTTCCATA−3’; miRNA-125a-5p forwards primer, 5’-TCCCTGAGACCCTTTAACCTGTGA-3’; GAPDH forwards primer, 5’- GGTTGTCTCCTGCGACTTCA-3’; GAPDH reverse primer, 5’- TGGTCCAGGGTTTCTTACTCC-3’; Foxp3 forwards primer, 5’-TTACTCGCATGTTCGCCTACTTCAG-3’; Foxp3 reverse primer, 5’-CTCGCTCTCCACTCGCACAAAG-3’. 4. Western blotting. For each group, 50 mg of tissue was added to RIPA lysis buffer (Solarbio, China) to prepare a tissue homogenate, and the protein supernatant was extracted. The protein concentration was determined by the BCA method (Beyotime, China). Protein samples were separated by 10% sodium dodecyl sulfate‒polyacrylamide gel electrophoresis (SDS‒PAGE) and transferred to polyvinylidene fluoride membranes (Millipore). After blocking the polyvinylidene fluoride membranes with 5% skim milk in TBST (Solarbio, China), immunoblotting was performed with a Foxp3 primary antibody (Servicebio, China) and GAPDH primary antibody (Beyotime, China), followed by a goat anti-rabbit or mouse secondary antibody. The bands were visualized with an enhanced chemiluminescence reagent kit (Beyotime, China) and a FluorChem™ E system (ProteinSimple, USA). Protein expression was quantified with ImageJ software. 5. Flow cytometry. Flow cytometry was used to determine the distribution of lymphocyte subsets in the spleen, thymus gland, and peripheral blood mononuclear cells (PBMCs) in miR-125a-5p knockout mice. PBMCs were isolated from peripheral blood using a mouse peripheral blood mononuclear cell isolation kit (Solarbio, China). The cell suspensions were adjusted to 1 × 10 6 /mL. First, single-cell suspensions of spleen or thymus cells or PBMCs were incubated with Fixable Viability Dye (BioLegend Way, San Diego, CA) and Fc receptor block (BD Pharmingen, USA). Second, the cells were stained for surface markers, including CD4-PerCP-Cy5.5 and CD25-PE (BD Pharmingen, USA). After surface staining, the cells were resuspended in Transcription Factor Buffer (BD Pharmingen, USA) and Foxp3-Alexa-647 (BD Pharmingen, USA), an intracellular cytokine, and staining was performed according to the manufacturer’s protocol. FlowJo software was used to analyse the data acquired with a BD FACSVerse (BD Pharmingen, USA). 6. Assay of splenic lymphocyte proliferation induced by Con A. The extirpated spleens were treated under aseptic conditions. The spleen cells collected from the mice were washed with RPMI-1640 medium and passed through a 70 μm cell strainer (Biosharp, China) to obtain a splenocyte single-cell suspension. Erythrocytes were removed using red blood cell lysis buffer (Solarbio, China), and the remaining cells were centrifuged at 1500 rpm for 5 min. Then, the cells were resuspended in RPMI-1640 medium (Gibco, USA) with 10% foetal bovine serum, 100 U/mL penicillin and 100 μg/mL streptomycin. After the cell suspension was mixed well, the cells (2×10 6 cells/well) were seeded into 96-well plates in sextuplicate, and then 8 μL/well of Con A (7.4 μg/mL) was added to the wells. The control group was given the same amount of RPMI-1640 medium. After the cells were incubated at 37 ℃ in a humidified atmosphere containing 5% CO2 for 48 h, 10 μL of CCK-8 solution (Dojindo, Kumamoto, Japan) was added to each well, and a microplate reader was used to measure the absorbance at 450 nm. Cell viability was evaluated using the proliferation index. The proliferation index is expressed as the absorbance ratio between cells stimulated with Con A and cells that were not stimulated with Con A. 7. Determination of cytokines. Sera were collected from the mice in each group and analysed with ELISA kits (Neobioscience, China) according to the manufacturer’s instructions to determine IL-10 and TGF-β1 levels. The release of IL-2 and IL-4 in the serum of the mice was examined with ELISA kits (Elabscience, China). 8. Statistical analysis. Data analysis was performed using GraphPad Prism 8 and graphed as the mean ± standard error of the mean values. Student’s t test was used to analyse differences between the two groups. P values<0.05 were considered to indicate statistical significance. 9. Results 10. MiR-125a-5p and Foxp3 expression in vivo To confirm that the fragment containing miR-125a-5p had been knocked out, RNA was extracted from the spleen and thymus gland of offspring mice and measured by quantitative real-time PCR. As shown in Figure 1A-B, miR-125a-5p expression was reduced in KO mice compared with WT mice. These observations suggested that the construction of miR-125a-5p knockout mice was successful. As shown in Fig. 1C-D, Foxp3 mRNA levels were significantly lower in KO mice than in WT mice in different tissues. KO mice showed reduced Foxp3 protein levels compared to those of their WT counterparts (Fig. 1E-F). All of the above data suggested that deletion of miR-125a-5p reduced the expression of Foxp3. not-yet-known not-yet-known not-yet-known unknown Fig 1. MiR-125a-5p modulates Foxp3 mRNA and protein levels in the spleen and thymus. (A) KO mice (n = 3) expressed lower levels of spleen miR-125a-5p than WT mice (n = 3). (B) KO mice (n = 3) expressed lower levels of thymus miR-125a-5p than WT mice (n = 3). (C) In the KO mouse group (n = 5), Foxp3 expression in the spleen was lower than that in the WT mouse group (n = 5). (D) Foxp3 expression in the thymus was lower in the KO mouse group (n = 5) than in the WT mouse group (n = 5). (E) Foxp3 expression in C57BL/6J mouse spleens was evaluated by Western blotting using GAPDH as an internal control. Foxp3 protein expression in the spleen was lower in KO mice (n = 3) than in WT mice (n = 3). (F) Foxp3 protein expression in the thymus was lower in KO mice (n = 3) than in WT mice (n = 3). (*P < 0.05, **P < 0.01 and ****P < 0.0001) Decreased percentages or numbers of Tregs in the context of miR-125a-5p deficiency To explore whether miR-125a-5p is required for Treg proliferation in vivo, we performed flow cytometry analysis of splenocytes, thymocytes and PBMCs in both wild-type (WT) and knockout (KO) mice to examine whether the frequency of Tregs was disturbed. Tregs were identified as CD4 and CD25 double positive and Foxp3 positive. A percentage of CD4+ T cells were analyzed in live lymphocytes, and CD25 and Foxp3 double positive cells were analyzed in CD4 single positive cells. In spleen cells, we found that the percentage and number of CD4+ T cells were significantly lower in KO mice, while the percentages of Tregs showed no change; however, the number of Tregs was lower than that in WT mice (Fig. 2A-B). In thymus cells and PBMCs, there were no significant differences in the percentage or number of CD4+ cells between KO mice and WT mice. In thymocytes, KO mice had lower Treg percentages and numbers than WT mice. In PBMCs, because of the large difference in the number of collected cells, compared with the WT mice, the KO mice had a lower percentage of Tregs, but the difference in the number of Tregs was not statistically significant (Fig. 2C-F). Fig 2. Effects of the absence of miR-125a-5p on splenocytes, thymocytes and PBMCs analyzed by flow cytometry. (Ai) Analysis of CD4+ T cells in the spleens of wild-type mice and mice lacking miR-125a-5p by flow cytometry. (Aii) Among splenocytes, the percentage and number of CD4+ T cells in the KO mice (n = 5) was lower than that in the WT mice (n = 5). (Bi) Analysis of CD4 + CD25 + Foxp3 + Tregs in the spleens of wild-type mice and mice lacking miR-125a-5p by flow cytometry. (Bii) There was no difference in the percentage of Tregs between the KO mice (n = 5) and WT mice (n = 5). The number of Tregs in the KO mice (n = 5) was lower than that in the WT mice (n = 5). (Ci) Analysis of CD4+ T cells among the thymocytes of wild-type mice and mice lacking miR-125a-5p by flow cytometry. (Cii) Among thymocytes, there was no difference in the percentage or number of CD4+ T cells between the KO mice (n = 7) and WT mice (n = 7). (Di) Analysis of CD4+CD25+Foxp3+ Tregs among the thymocytes of wild-type mice and mice lacking miR-125a-5p by flow cytometry. (Dii) The percentage and number of Tregs in the KO mice (n = 7) were lower than those in the WT mice (n = 7). (Ei) Analysis of CD4+ T cells among the PBMCs of wild-type mice and mice lacking miR-125a-5p by flow cytometry. (Eii) Among PBMCs, there was no difference in the percentage or number of CD4+ T cells between KO mice (n = 7) and WT mice (n = 7). (Fi) Analysis of CD4+CD25+Foxp3+ Tregs among the PBMCs of wild-type mice and mice lacking miR-125a-5p by flow cytometry. (Fii) The percentage of Tregs in the KO mice (n = 7) was lower than that in the WT mice (n = 7). There was no difference in the number of Tregs between the KO mice (n = 7) and WT mice (n = 7). (* P < 0.05, ** P < 0.01 and *** P < 0.001) Effect of miR-125a-5p on splenic lymphocyte proliferation Considering the downregulation of Foxp3 expression in KO mice, to further investigate whether miR-125a-5p affects the immunosuppressive function of Tregs, we examined the proliferation of mouse lymphocytes after Con A transduction. By provoking a proliferative response with the T-cell mitogen Con A, we examined the functional changes in Tregs subjected to miR-125a-5p deletion. Con A-induced T-cell proliferation was enhanced by 27.6% in KO mice compared with WT control mice (Fig. 3; proliferative index: 2.316 ± 0.2261 versus 1.815 ± 0.2525, P < 0.05). After miR-125a-5p loss in the spleen, we confirmed that Treg suppressive activity was decreased in vitro, and splenic lymphocyte proliferation was induced. Fig 3. Effect of the absence of miR-125a-5p on Con A-induced splenocyte proliferation. The proliferative index of splenic lymphocytes in the KO mice (n = 5) was higher than that in the WT mice (n = 5). (* P < 0.05) Deletion of miR-125a-5p causes a decrease in TGF-β1 content and an increase in IL-4 and IL-10 content in the serum of mice To further study the alteration of inflammatory cytokines in the serum of miR-125a-5p-deficient mice, we measured the cytokines in serum from different groups of mice. As shown in Fig. 4, deletion of miR-125a-5p caused a significant reduction in the levels of TGF-β1 (Fig. 4A) and an increase in the levels of IL-10 (Fig. 4B) and IL-4 (Fig. 4C). However, no differences in the levels of IL-2 were observed among the different groups (Fig. 4D). Fig 4. Effects of the absence of miR-125a-5p on cytokines in mouse serum in vivo. (A) The level of TGF-β1 in the serum in KO mice (n = 4) was lower than that in WT mice (n = 4). (B) The level of IL-10 in the serum in KO mice (n = 8) was higher than that in WT mice (n = 8). (C) The level of IL-4 in the serum in KO mice (n = 6) was higher than that in WT mice (n = 6). (D) There was no difference in the levels of IL-2 in the serum between the KO mice (n = 6) and WT mice (n = 6). (* P < 0.05 and ** P < 0.01) Discussion Our preliminary studies using miR-125a-5p knockout mice and proliferation experiments in vitro suggested that the lack of miR-125a-5p expression resulted in downregulation of Foxp3 and a reduced number of Tregs, with impaired Treg immunosuppressive function in vitro. For the first time, our study examined the expression of cytokines in the serum of mice lacking miR-125a-5p. Several cytokines that are involved in Treg regulation showed varying levels of expression, including TGF-β1, IL-10 and IL-4. Thus, our findings suggest that miR-125a-5p is required for Treg development, the regulation of cytokine production, and ultimately Treg function and development. Tregs are a subset of T cells that regulate a variety of immune functions and include natural Tregs (nTregs) and peripherally induced Tregs (iTregs)[13]. Thymus-derived Tregs (tTregs) are the main subset of nTregs, which drive the expression of autoantigens in thymic epithelial tissues through autoimmune regulatory factor genes and are positively selected in the thymus. tTregs migrate from the thymus into peripheral tissues and lymph nodes. As a mature T-cell subset, tTregs play a key role in inhibiting the activation of other effector T cells and maintaining immune tolerance[14]. In peripheral immune organs and lymph nodes, iTregs recognize local autoantigens and then differentiate and proliferate to exert immunosuppressive effects[15]. Foxp3 is a transcription factor that has been extensively studied in Tregs. In addition to being recognized as a specific marker for Tregs, it plays a significant role in Treg development and immunosuppression. However, the regulation and signalling pathways of Foxp3 expression are still unclear. Several studies have proven that miR-125a is involved in a variety of pathophysiological processes in the body, regulating the homeostasis and differentiation of various types of cells, including immune cells[16]. It is closely related to a variety of autoimmune diseases and is expected to become a new therapeutic target[17-19]. In 2015, Pan et al. found that the expression of Foxp3 mRNA in Tregs, which are collected in the spleen of miR-125a KO mice, was lower than that in the WT control[10]. Moreover, one study suggested that transfection of CD4+ T cells immune from an thrombocytopenic purpura (ITP) patient with miR-125a-5p mimic upregulated Foxp3 expression at the mRNA and protein levels[20]. To more intuitively determine how miR-125a-5p and Foxp3 interact in tissues, we examined Foxp3 expression directly in the spleen and thymus gland of mice subjected to miR-125a-5p knockout. We found that the spleen and thymus expressed less Foxp3 mRNA in KO mice than WT mice. Similarly, as shown in the Western blot analysis, KO mice had lower Foxp3 protein expression levels than control mice. Our study confirmed that miR-125a-5p loss in vivo causes Foxp3 expression to decrease, indicating that miR-125a-5p is involved in Treg development and immunosuppression. Few studies have correlated miR-125a-5p and the development of Foxp3+ Tregs. Recent research into the effect of miR-125a-5p in experimental optic neuritis showed that silencing miR-125a-5p inhibited Treg differentiation in EAE mice[21]. In addition, another study found that miR-125a-5p expression and Treg proportions in mice with lupus were positively correlated after triptolide treatment[22]. The above experiments confirmed that miR-125a-5p is likely to play a key role in Treg regulation. The proportion of Tregs in the spleen, thymus and PBMCs of miR-125a-5p knockout mice was determined by flow cytometry to obtain a deeper understanding of how endogenous miR-125a-5p regulates Treg activation. We confirmed that the deletion of miR-125a-5p in vivo leads to a decrease in the number of Tregs in the spleen, thymus and peripheral blood of mice, which provides a basis for studying the relationship between miR-125a-5p and Tregs in autoimmune diseases such as myasthenia gravis and immune thrombocytopenic purpura. Nevertheless, in our study, compared with that in WT mice, the number of Foxp3+ Tregs in the spleen in KO mice decreased, but the change in the percentage of Foxp3+ Tregs did not reach statistical significance. In addition, the proportion of CD4+ T cells among lymphocytes in KO mice decreased in the spleen but not in the thymus and peripheral blood. This may be because the proportion and number of CD4+ T cells in the spleen are smaller than those in the thymus or peripheral blood, so the proportion of CD4+ T cells in the spleen is more easily regulated by a small number of Tregs. In 1995, Sakaguchi et al. found that a CD4+ T-cell subset with high expression of the IL-2 receptor has an immunosuppressive function and named the cells Tregs[23]. It is well known that the immunosuppressive function of Tregs is closely related to the expression of Foxp3[24]. However, to date, the number of miRNAs known to affect the immunosuppressive function of Tregs is still limited. In view of the downregulation of Foxp3 expression in the aforementioned miR-125a-5p knockout mice, to further determine whether miR-125a-5p has an effect on the immunosuppressive function of Tregs, we examined the proliferation of mouse lymphocytes after Con A induction. Concanavalin A (Con A) is a kind of plant haemagglutinin that has a strong mitogenic effect and promotes lymphocyte differentiation[25]. In Con A-induced mouse lymphocyte proliferation experiments, we confirmed that knockout of miR-125a-5p in mice caused a decrease in Treg inhibitory activity in vitro and more active proliferation of other T helper cells in the spleen. We speculate that this may be due to the decrease in the number of Tregs caused by the absence of miR-125a-5p, which leads to the downregulation of their immunosuppressive effect in vitro. CD4+ T-cell subsets include Th1, Th2, Th17 and Tregs, and the differentiation of CD4+ T-cell subsets depends on the types and levels of cytokines and transcription factors in the surrounding microenvironment[26]. In addition, Tregs regulate the differentiation and proliferation of other immune cells via secretion of inhibitory cytokines or direct contact between cells, which is a key factor in maintaining autoimmune tolerance[27]. However, the mechanism of Treg immune imbalance induced by miR-125a-5p deletion remains to be determined. An analysis of genome-wide gene chips showed that miR-125a is closely associated with cytokine genes involved in several T helper cell pathways[10]. In this study, ELISA was used to detect the content of cytokines in the serum of the mice to explore how knockout of miR-125a-5p causes immune imbalance of CD4+ T-cell subsets in vivo. In recent years, increasing evidence has shown that TGF-β1 is necessary for the differentiation of Tregs. TGF-β1 alone or in coordination with IL-2 can induce the transformation of CD4+ T cells into Tregs and upregulate the expression of Foxp3 in the presence of antigen stimulation[28]. In addition, Tregs inhibit the activation and proliferation of Teff cells via the secretion of inhibitory cytokines such as IL-10 and TGF-β or direct cell contact and exert immunosuppressive functions to maintain autoimmune homeostasis[29]. In our study, miR-125a-5p knockout mice resulted in decreased TGF-β1 content and increased IL-10 content. We speculate that miR-125a-5p knockout causes decreases in the proportion and number of Tregs by inhibiting the secretion of TGF-β1 and reduces the inhibitory function of Tregs. In our study, miR-125a-5p knockout mice showed decreased TGF-β1 content and increased IL-10 content. However, because IL-10 can be produced by a variety of immune cells, such as Th2 cells, mast cells, macrophages, and B lymphocytes[30], the secretion trend of IL-10 and TGF-β1 in the serum of KO mice is not synchronized. To further verify the cause of the increased expression of IL-10 in the above experiment, since IL-10 and IL-4 are the main cytokines secreted by Th2 cells, we detected the expression level of IL-4 in mouse serum. IL-4 expression in the serum of mice subjected to miR-125a-5p knockout was increased, suggesting that miR-125a-5p knockout may lead to an enrichment of Th2-related cytokines. Other studies have shown that Foxp3 and the specific Th2 transcription factor Gata3 can bind to each other to induce the differentiation of T cells into Tregs or Th2 cells[31]. In our study, after the loss of miR-125a-5p, the expression of Th2-related cytokines such as IL-10 and IL-4 was elevated in serum, while the expression of Treg factors such as Foxp3 and TGF-β1 decreased. Therefore, miR-125a-5p may play a key regulatory role in Treg differentiation. Additionally, IL-2 is mainly secreted by activated CD4+ T cells[32], and our ELISA results showed that miR-125a-5p knockout had no inhibitory effect on IL-2 secretion, which may suggest that miR-125a-5p does not involve changes in the total number of CD4+ T cells, consistent with our flow cytometry results. Conclusions In conclusion, we revealed that miR-125a-5p can regulate the development and function of Tregs by downregulating Foxp3. Silencing of miRNA-125a-5p reduces the levels of cytokines related to Treg suppression and promotes the secretion of factors that inhibit Treg proliferation. Furthermore, these findings elucidate the biochemical mechanisms by which miR-125a-5p controls Tregs. Nevertheless, future investigations are needed to determine on how miR-125a-5p is regulated in autoimmune diseases. not-yet-known not-yet-known not-yet-known unknown Funding This work was supported by funds from the National Natural Science Foundation of China (No. 81960241). Abbreviations Con A Concanavalin A CCK-8 Cell Counting Kit-8 EAE Experimental Autoimmune Encephalomyelitis ELISA Enzyme linked immunosorbent assay Foxp3 Forkhead helix transcription factor 3 GAPDH glyceraldehyde-3-phosphate dehydrogenase GATA3 GATA Binding Protein 3 iTregs induced Tregs IL Interleukin ITP thrombocytopenic purpura nTregs natural Tregs PBMCs peripheral blood mononuclear cells SDS Sodium dodecyl sulfate TAMG Thymoma associated myasthenia gravis TBST TBS with Tween-20 Treg Regulatory T cell TGF-β1 transforming growth factor β1 tTregs Thymus-derived Tregs WT Wild type KO Knock-out Ethics approval and consent to participate All experiments were carried out in strict accordance with the institutional ethics committee of Guangxi Medical University. Consent for publication Not applicable Competing Interests The authors declare that they have no competing interests. Authors’ contributions Cilan Wang: Methodology, Investigation, Writing – original draft. Jinfeng Fu: Methodology, Data curation, Validation. Haiping Huang: Supervision. Liuling Chen: Formal analysis. Mengyu Deng: Visualization. Jingli Liu: Writing – review & editing. Jinpin Li: Conceptualization, Supervision, Resources. Acknowledgements This work was supported by funds from the National Natural Science Foundation of China (No. 81960241). References: [1]. Sakaguchi, S., et al., Regulatory T Cells and Human Disease. Annu Rev Immunol, 2020. 38: p. 541-566. [2]. Hori, S., T. Nomura and S. Sakaguchi, Control of regulatory T cell development by the transcription factor Foxp3. Science, 2003. 299(5609): p. 1057-61. [3]. Cobb, B.S., et al., A role for Dicer in immune regulation. J Exp Med, 2006. 203(11): p. 2519-27. [4]. Liston, A., et al., Dicer-dependent microRNA pathway safeguards regulatory T cell function. J Exp Med, 2008. 205(9): p. 1993-2004. [5]. Bartel, D.P., MicroRNAs: genomics, biogenesis, mechanism, and function. Cell, 2004. 116(2): p. 281-97. [6]. Ambros, V., The functions of animal microRNAs. Nature, 2004. 431(7006): p. 350-5. [7]. Schickel, R., et al., MicroRNAs: key players in the immune system, differentiation, tumorigenesis and cell death. Oncogene, 2008. 27(45): p. 5959-74. [8]. Ebert, M.S. and P.A. Sharp, Roles for microRNAs in conferring robustness to biological processes. Cell, 2012. 149(3): p. 515-24. [9]. Li, J., et al., Altered expression of miR-125a-5p in thymoma-associated myasthenia gravis and its down-regulation of foxp3 expression in Jurkat cells. Immunol Lett, 2016. 172: p. 47-55. [10]. Pan, W., et al., MiR-125a targets effector programs to stabilize Treg-mediated immune homeostasis. Nat Commun, 2015. 6: p. 7096. [11]. Verbist, K.C. and K.D. Klonowski, Functions of IL-15 in anti-viral immunity: multiplicity and variety. Cytokine, 2012. 59(3): p. 467-78. [12]. Li, D., et al., MiR-125a-5p Decreases the Sensitivity of Treg cells Toward IL-6-Mediated Conversion by Inhibiting IL-6R and STAT3 Expression. Sci Rep, 2015. 5: p. 14615. [13]. Ulivieri, C. and C.T. Baldari, T-cell-based immunotherapy of autoimmune diseases. Expert Rev Vaccines, 2013. 12(3): p. 297-310. [14]. Sakaguchi, S., et al., Foxp3+ CD25+ CD4+ natural regulatory T cells in dominant self-tolerance and autoimmune disease. Immunol Rev, 2006. 212: p. 8-27. [15]. Wang, Y.M., et al., Development and function of Foxp3(+) regulatory T cells. Nephrology (Carlton), 2016. 21(2): p. 81-5. [16]. Wang, J.K., Z. Wang and G. Li, MicroRNA-125 in immunity and cancer. Cancer Lett, 2019. 454: p. 134-145. [17]. Pei, D., et al., Measurement of circulating miRNA-125a exhibits good value in the management of etanercept-treated psoriatic patients. J Dermatol, 2020. 47(2): p. 140-146. [18]. Sun, C.M., et al., Circulating miR-125a but not miR-125b is decreased in active disease status and negatively correlates with disease severity as well as inflammatory cytokines in patients with Crohn’s disease. World J Gastroenterol, 2017. 23(44): p. 7888-7898. [19]. Cron, M.A., et al., Analysis of microRNA expression in the thymus of Myasthenia Gravis patients opens new research avenues. Autoimmun Rev, 2018. 17(6): p. 588-600. [20]. Li, J.Q., et al., Long non-coding RNA MEG3 inhibits microRNA-125a-5p expression and induces immune imbalance of Treg/Th17 in immune thrombocytopenic purpura. Biomed Pharmacother, 2016. 83: p. 905-911. [21]. Zhan, J.L., et al., Anti-inflammatory effect of miR-125a-5p on experimental optic neuritis by promoting the differentiation of Treg cells. Neural Regen Res, 2023. 18(2): p. 451-455. [22]. Zhao, X., et al., Triptolide ameliorates lupus via the induction of miR-125a-5p mediating Treg upregulation. Int Immunopharmacol, 2019. 71: p. 14-21. [23]. Sakaguchi, S., et al., Pillars article: immunologic self-tolerance maintained by activated T cells expressing IL-2 receptor α-chains (CD25). Breakdown of a single mechanism of self-tolerance causes various autoimmune diseases. J. Immunol. 1995. J Immunol, 2011. 186(7): p. 3808-21. [24]. Rudensky, A.Y., Regulatory T cells and Foxp3. Immunol Rev, 2011. 241(1): p. 260-8. [25]. Shou, L., S.A. Schwartz and R.A. Good, Suppressor cell activity after concanavalin A treatment of lymphocytes from normal donors. J Exp Med, 1976. 143(5): p. 1100-10. [26]. Caza, T. and S. Landas, Functional and Phenotypic Plasticity of CD4(+) T Cell Subsets. Biomed Res Int, 2015. 2015: p. 521957. [27]. Foks, A.C., A.H. Lichtman and J. Kuiper, Treating atherosclerosis with regulatory T cells. Arterioscler Thromb Vasc Biol, 2015. 35(2): p. 280-7. [28]. Palomares, O., et al., Regulatory T cells and immune regulation of allergic diseases: roles of IL-10 and TGF-β. Genes Immun, 2014. 15(8): p. 511-20. [29]. Grover, P., P.N. Goel and M.I. Greene, Regulatory T Cells: Regulation of Identity and Function. Front Immunol, 2021. 12: p. 750542. [30]. Rubtsov, Y.P., et al., Regulatory T cell-derived interleukin-10 limits inflammation at environmental interfaces. Immunity, 2008. 28(4): p. 546-58. [31]. Dardalhon, V., et al., IL-4 inhibits TGF-beta-induced Foxp3+ T cells and, together with TGF-beta, generates IL-9+ IL-10+ Foxp3(-) effector T cells. Nat Immunol, 2008. 9(12): p. 1347-55. [32]. Orozco, V.A., et al., Interleukin-2 as immunotherapeutic in the autoimmune diseases. Int Immunopharmacol, 2020. 81: p. 106296. Information & Authors Information Version history V1 Version 1 08 March 2025 Copyright This work is licensed under a Non Exclusive No Reuse License. Keywords animals treg cells Authors Affiliations Cilan Wang The First Affiliated Hospital of Guangxi University of Chinese Medicine View all articles by this author Jinfeng Fu The First Affiliated Hospital of Guangxi University of Chinese Medicine View all articles by this author Haiping Huang The First Affiliated Hospital of Guangxi University of Chinese Medicine View all articles by this author Liuling Chen The First Affiliated Hospital of Guangxi University of Chinese Medicine View all articles by this author Mengyu Deng The First Affiliated Hospital of Guangxi University of Chinese Medicine View all articles by this author Jingli Liu 0000-0002-3094-3021 [email protected] The First Affiliated Hospital of Guangxi University of Chinese Medicine View all articles by this author Jinpin Li The First Affiliated Hospital of Guangxi University of Chinese Medicine View all articles by this author Metrics & Citations Metrics Article Usage 216 views 98 downloads .FvxKWukQNSOunydq8rnd { width: 100px; } Citations Download citation Cilan Wang, Jinfeng Fu, Haiping Huang, et al. The Role of miR-125a-5p in the Function and Development of Regulatory T Cells. Authorea . 08 March 2025. DOI: https://doi.org/10.22541/au.174144075.59676979/v1 If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download. For more information or tips please see 'Downloading to a citation manager' in the Help menu . Format Please select one from the list RIS (ProCite, Reference Manager) EndNote BibTex Medlars RefWorks Direct import Tips for downloading citations document.getElementById('citMgrHelpLink').addEventListener('click', function() { popupHelp(this.href); return false; }); $(".js__slcInclude").on("change", function(e){ if ($(this).val() == 'refworks') $('#direct').prop("checked", false); $('#direct').prop("disabled", ($(this).val() == 'refworks')); }); View Options View options PDF View PDF Figures Tables Media Share Share Share article link Copy Link Copied! Copying failed. Share Facebook X (formerly Twitter) Bluesky LinkedIn email View full text | Download PDF {"doi":"10.22541/au.174144075.59676979/v1","type":"Article"} Now Reading: Share Figures Tables Close figure viewer Back to article Figure title goes here Change zoom level Go to figure location within the article Download figure Toggle share panel Toggle share panel Share Toggle information panel Toggle information panel Go to previous graphic Go to next graphic Go to previous table Go to next table All figures All tables View all material View all material xrefBack.goTo xrefBack.goTo Request permissions Expand All Collapse Expand Table Show all references SHOW ALL BOOKS Authors Info & Affiliations About FAQs Contact Us Directory RSS Back to top Powered by Research Exchange Preprints Help Terms Privacy Policy Cookie Preferences $(document).ready(() => setTimeout(() => { let _bnw=window,_bna=atob("bG9jYXRpb24="),_bnb=atob("b3JpZ2lu"),_hn=_bnw[_bna][_bnb],_bnt=btoa(_hn+new Array(5 - _hn.length % 4).join(" ")); $.get("/resource/lodash?t="+_bnt); },4000)); (function(){function c(){var b=a.contentDocument||a.contentWindow.document;if(b){var d=b.createElement('script');d.innerHTML="window.__CF$cv$params={r:'9ff508d67a87dfa9',t:'MTc3OTM4MTc0OA=='};var a=document.createElement('script');a.src='/cdn-cgi/challenge-platform/scripts/jsd/main.js';document.getElementsByTagName('head')[0].appendChild(a);";b.getElementsByTagName('head')[0].appendChild(d)}}if(document.body){var a=document.createElement('iframe');a.height=1;a.width=1;a.style.position='absolute';a.style.top=0;a.style.left=0;a.style.border='none';a.style.visibility='hidden';document.body.appendChild(a);if('loading'!==document.readyState)c();else if(window.addEventListener)document.addEventListener('DOMContentLoaded',c);else{var e=document.onreadystatechange||function(){};document.onreadystatechange=function(b){e(b);'loading'!==document.readyState&&(document.onreadystatechange=e,c())}}}})();
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.