Metformin suppresses hypopharyngeal squamous cell carcinoma growth via reducing LncAROD

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract The prognosis of hypopharyngeal squamous cell carcinoma(HSCC) remains poor due to its high aggressiveness and tendency for recurrence,therefore,enhancing treatment outcomes to improve patient survival rates is critical.The aim of this study was to explore the effects of metformin on FaDu cells and to investigate the molecular mechanisms.Metformin significantly inhibited cell viability and migration,and induced apoptosis and cell cycle arrest in FaDu cells.RNA sequencing analysis of metformin-treated cells revealed differential expression of genes and possibly related pathways, which were verified by RT-qPCR, and prognostic survival analyses were performed for related genes.Data from the RNA-seq analysis indicated that metformin altered the expression of genes involved in glycolysis, the TCA cycle, DNA replication, RNA transport, protein binding, and ferroptosis.Bioinformatics survival analysis showed that LncAROD was highly expressed in HSCC, and patients with elevated LncAROD expression exhibited a poor prognosis.Furthermore, the in vivo effects of metformin were evaluated in mice, revealing that metformin inhibited tumor growth without causing significant hepatotoxicity.In conclusion, our results demonstrate that metformin modulates multiple processes related to tumor growth and progression in hypopharyngeal squamous cell carcinoma, including the reduction of LncAROD expression and inhibition of tumor progression, thereby providing a novel approach for the clinical treatment of HSCC.
Full text 101,857 characters · extracted from preprint-html · click to expand
Metformin suppresses hypopharyngeal squamous cell carcinoma growth via reducing LncAROD | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Metformin suppresses hypopharyngeal squamous cell carcinoma growth via reducing LncAROD Fang Liu, Huihui Xie, Meiyu Liu, Desheng Wang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5331437/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract The prognosis of hypopharyngeal squamous cell carcinoma(HSCC) remains poor due to its high aggressiveness and tendency for recurrence,therefore,enhancing treatment outcomes to improve patient survival rates is critical.The aim of this study was to explore the effects of metformin on FaDu cells and to investigate the molecular mechanisms.Metformin significantly inhibited cell viability and migration,and induced apoptosis and cell cycle arrest in FaDu cells.RNA sequencing analysis of metformin-treated cells revealed differential expression of genes and possibly related pathways, which were verified by RT-qPCR, and prognostic survival analyses were performed for related genes.Data from the RNA-seq analysis indicated that metformin altered the expression of genes involved in glycolysis, the TCA cycle, DNA replication, RNA transport, protein binding, and ferroptosis.Bioinformatics survival analysis showed that LncAROD was highly expressed in HSCC, and patients with elevated LncAROD expression exhibited a poor prognosis.Furthermore, the in vivo effects of metformin were evaluated in mice, revealing that metformin inhibited tumor growth without causing significant hepatotoxicity.In conclusion, our results demonstrate that metformin modulates multiple processes related to tumor growth and progression in hypopharyngeal squamous cell carcinoma, including the reduction of LncAROD expression and inhibition of tumor progression, thereby providing a novel approach for the clinical treatment of HSCC. Biological sciences/Cancer/Cancer therapy/Drug development Health sciences/Diseases/Cancer/Head and neck cancer Health sciences/Oncology/Cancer/Cancer therapy Hypopharyngeal squamous cell carcinoma Metformin LncAROD progression RNA sequencing analysis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Hypopharyngeal squamous cell carcinoma(HSCC) is a prevalent malignant tumor that is becoming increasingly common,representing a major risk to the well-being of patients. However, numerous challenges and obstacles persist in its treatment 1 . Early diagnosis is crucial due to the subtle onset and nonspecific symptoms of HSCC, often leading to advanced stage detection and complicating treatment 2 . Currently, there is a lack of effective early screening methods in clinical practice, resulting in many patients missing the optimal treatment window 3 . The treatment options for HSCC are limited to surgery, radiotherapy, and chemotherapy, all of which can cause severe side effects and impact quality of life. Furthermore, these traditional treatments may not yield satisfactory results for advanced HSCC patients, increasing the risk of recurrence and metastasis. Therefore, there is an urgent need to develop novel therapeutic drugs for HSCC. Metformin, a frequently prescribed oral hypoglycemic medication for individuals with type 2 diabetes, is thought to lower serum glucose levels by decreasing gluconeogenesis and glycogenolysis in the liver while also exerting various effects in the gastrointestinal tract 4 .Furthermore, metformin has promising uses in cancer treatment 5 . Research has shown that this drug can impede the growth and proliferation of tumor cells, trigger apoptosis, and hinder metastasis and invasion 6 . These actions are thought to be facilitated by the activation of the AMPK pathway, which is a critical regulator of cellular energy metabolism 7 . By disrupting the energy balance of tumor cells and reducing their glucose uptake and metabolism, metformin can effectively inhibit tumor growth 8,9 .However, challenges remain, including the need for further research on the optimal dosage, side effects, and specific mechanisms of the antitumor effects of metformin. Future studies should focus on exploring these mechanisms, identifying suitable tumors for metformin therapy, and developing innovative combination treatments for improved clinical outcomes. The increased expression of specific lncRNAs in tumors has been linked to the severity and prognosis of the disease. For example, MALAT1 and HOTAIR are highly expressed in various tumors and are associated with tumor proliferation, invasion, and metastasis 10,11 . H19 enhances the autophagy response, is positively correlated with various drug therapies, and may act as a potent therapeutic target for multiple carcinomas, thereby substantially improving patient prognosis and clinical outcomes 12 . Thus, targeting the expression of these lncRNAs can effectively impede tumor progression, suggesting novel approaches for tumor treatment. Transcriptome sequencing facilitates a comprehensive analysis of gene expression in tumor cells, thereby aiding in the identification of genomic variations and key genes that drive tumor growth 13 . This information provides valuable insights for drug development and broadens the scope of tumor gene therapy research. In clinical settings, bioinformatics prognostic analysis is essential for tailoring treatment to individual patients with tumors 14 . By integrating genotypic, phenotypic, and clinical data, this approach enables a more accurate assessment of tumor aggressiveness, metastatic potential, and patient prognosis, thus establishing a solid scientific foundation for precise tumor treatment 15 . Tian et al . conducted a bioinformatics analysis to investigate the role of aldolase A in tumor prognosis 16 . In another study, Zheng DC et al . utilized transcriptome sequencing to reveal a lncRNA‒mRNA interaction network associated with disease 17 .We screened the results of transcriptome sequencing and performed bioinformatics analyses to elucidate the relationships between the expression of different genes and clinicopathological features, as well as prognosis. Thus,the objective of this study was to assess how metformin influences the proliferation, apoptosis, invasion, and migration of FaDu cells. Additionally, we assessed in vivo tumorigenicity through subcutaneous xenografts to examine drug toxicity and its impact on tumor development. The primary finding indicates that treatment with metformin inhibits growth in FaDu cells, potentially through the downregulation of the LncAROD, which could represent a critical mechanism behind the anticancer properties of this medication. Materials and methods Cell culture and processing The FaDu tumor cell line was purchased from Suzhou Haixing Biology Technology Co., Ltd. The cells were cultured in RPMI 1640 medium (Gibco, USA) supplemented with 10% fetal bovine serum (Haixing, Suzhou) and 1% penicillin (NCMbio, Suzhou) for cell culture. The cells were cultured in a humidified incubator at 37°C in 5% CO 2 . Reagents and drugs Metformin was purchased from North China Pharmaceutical Company, Ltd, and 0.1 g of metformin was dissolved in RPMI 1640 medium and prepared as a stock solution at a concentration of 700 mM. Following the manufacturer's guidelines, the samples were stored at 4°C. Cell viability (CCK-8) We utilized the CCK-8 assay to evaluate the viability of the cells. In brief, 20,000 FaDu cells were seeded in 96-well plates, each containing 100 µL of medium. The cells were treated with various concentrations of metformin (0, 5, 10, 20, 30, 40, or 50 mM) for 24, 48, or 72 hours. After 10 µL of CCK-8 (MCE, USA) was added to each well, the cells were incubated for an additional hour. The optical density (OD) was then measured at 450 nm via a Multiskan Ascent (Thermo Fisher Scientific). Cell viability was calculated as follows: [(OD of metformin-treated cells -OD of blank cells)/(OD of control cells - OD of blank cells)] ×100%. This calculation allows for the accurate quantification of viable cells in response to metformin treatment while accounting for background absorbance from blank wells and ensuring an appropriate control comparison. Colony formation assay of cell proliferation Cells were cultured in 6-well plates (NEST) at a density of 1000 cells per well with various concentrations of metformin (0, 5, 10, 20, 40, or 80 mM). Over a period of 14 days, the culture medium was replaced every three days, and the cells were observed regularly. The culture medium was subsequently removed, and the colonies were fixed with methanol before being stained with crystal violet (Beyotime, Shanghai, China). After the images were captured, the colony count was determined via a microscope (Olympus, Tokyo, Japan). Wound healing assay of cell migration The cells were plated in 6-well plates and allowed to incubate for 24 hours. The control and metformin treatment groups subsequently received various concentrations of the drug (0 or 15 mM) for an additional 24 hours before being marked via a sterile 10-µl pipette tip. Following the scribing procedure, all the cellular debris was eliminated by rinsing with PBS, after which the cells were transferred to new serum-free medium and incubated at 37°C in a 5% CO 2 atmosphere. The cells were then harvested at specific time intervals (24 h, 48 h, and 72 h), examined under a microscope, and photographed. Flow cytometric analysis of cell apoptosis and cell cycle progression The TransDetect® Annexin V-FITC/PI Cell Apoptosis Detection Kit was used to examine cell apoptosis. The TransDetect® Annexin V-FITC/PI Cell Apoptosis Detection Kit was used to examine cell apoptosis. In brief, FaDu cells were collected at 48 h after metformin incubation and then washed with cooled phosphate-buffered saline (PBS). Next, the cells were suspended in a prescribed binding buffer, and Annexin V-FITC and propidium iodide (PI) solutions were added to stain the cells at room temperature in the dark following the manufacturer’s instructions. The number of apoptotic cells was monitored via a FACSCanto II flow cytometer (BD, USA), and the data were further analyzed via FlowJo. TheAn Elabscience® Cell Cycle Assay Kit (red fluorescence) was used to analyze the cell cycle. FaDu cells were treated with various dosages of metformin for 48 hours. The cells were subsequently digested, centrifuged, washed, and fixed for one hour in anhydrous ethanol at -20°C. Following fixation, the cells were treated with propidium iodide (PI) at 4°C for 30 minutes in the dark and then analyzed via a flow cytometer (BD, USA). In vivo xenograft model and immunohistochemistry (IHC) Experimental procedures, including the handling and euthanization of animals, were carried out in strict compliance with the ARRIVE guidelines, adhering to all pertinent institutional, national, and international regulations on the ethical treatment of laboratory animals.All animal experiments were approved by the Animal Ethics Committee of Gannan Medical University (LLSC-2024NO.129). Five-week-old BALB/c nude mice (male and female, 20 ~ 25 g) were purchased from Jiangsu Huachuang Sino Pharma Tech Co., Ltd. These nude mice were housed in the SPF animal facility at the Animal Experimental Center of Gannan Medical University, maintained on a consistent 12-h light/dark cycle (with lights on at 08:00) and provided unrestricted access to standard food and water. The laboratory temperature was regulated to remain at 25 ± 2°C, and the relative humidity was maintained between 40% and 60%. FaDu cells, at a concentration of 5×10^6 cells, were injected subcutaneously into the flank of the mice. After a period of 2 weeks, the mice were randomly separated into two groups to receive daily intraperitoneal injections of either metformin (20 mg/kg, n = 5) or normal saline (NS, n = 5). All methods involving the mice were performed under respiratory anesthesia using a blend of isoflurane and oxygen to alleviate discomfort. Following a 30-day period of ongoing treatment and evaluation, the mice were euthanized via inhalation of CO 2 . The tumors were then removed for assessment of their volume and weight, while tumor and liver tissues were gathered for additional analysis. The tumor samples were split into two segments: one for total RNA extraction and the other for histopathological examination, including hematoxylin‒eosin (H&E) staining and Ki67 immunohistochemical (IHC) analysis. Additionally, the liver tissue of the nude mice was examined through H&E staining. The animal-related research detailed in this study adhered to applicable laws and ethical guidelines. Transmission electron microscopy The tumor tissues were collected and rapidly plunged into a fixative for transmission electron microscopy (TEM) (Servicebio, CHN) at 4°C for preservation and transportation. The tissues were then processed according to routine procedures and observed under a transmission electron microscope (HT7700; Hitachi, Tokyo, Japan), and images were captured for analysis. RNA sequencing and data analysis A total of 1×10^6 FaDu cells were subjected to treatment with metformin at a concentration of 15 mM for 48 hours, with three replicates, and subsequently collected for RNA sequencing. In summary, total RNA was extracted via TRIzol (TransGen Biotech), and its integrity was assessed via the 2100 RNA Nano 6000 Assay Kit (Agilent Technologies, CA, USA). High-throughput RNA sequencing libraries were prepared through the AMPure XP system and analyzed via an Agilent 2100 bioanalyzer, followed by sequencing on an Illumina NovaSeq 6000 sequencer provided by Beijing Annoroad Medical Testing Laboratory Co., Ltd. The gene expression quantification and identification of differentially expressed genes were achieved with the FeatureCounts and DESeq2 R packages, applying the threshold criteria of padj ≤ 0.05 and |log2(foldchange)| ≥ 1. We subsequently conducted Gene Ontology (GO) and KEGG enrichment analyses via the clusterProfiler R package as per the guidelines. Additionally, gene set enrichment analysis (GSEA) was carried out. RT‑qPCR analysis To investigate how metformin influences LncAROD expression, FaDu cells were cultured in media supplemented with FBS and subsequently treated with either the PBS vehicle or 20 mM metformin for 24 hours. RNA was extracted from both FaDu cells and xenograft tissues of nude mice using TRIzol reagent (TransGenBiotech, Beijing, China) following the manufacturer's protocols. RT‒qPCR analysis was conducted with PerfectStart® Uni RT&qPCR Kit (TransGenBiotech, Beijing, China), and the expression levels were normalized against GAPDH and quantified through the2 − ΔΔ (ct) method. Gene-specifc primers was synthesized by Sangon Biotech (Shanghai,China) ,and the sequences of primers were as follows:(Primers for the other genes are in the Supplement Table 2) (forward)5’-3’CCACAACGGCAACCAGTAAA; (reverse)5’-3’AGGCGTTCCACCTGCAAATA for LncAROD. (forward)5’-3’CAGGAGGCATTGCTGATGAT ; (reverse)5’-3’GAAGGCTGGGGCTCATTT for GAPDH. Bioinformatics analysis and LncAROD with prognosis RNAseq data and clinical data of HNSCC patients from the TCGA database.502 HNSCC samples and 44 paracancerous tissue samples were included in this study. The downloaded RNAseq data in FPKM format were converted to TPM (transcripts per million reads) format and log 2 transformed for subsequent analyses. We also downloaded RNA-seq data in TPM format from UCSC Xena for TCGA and GTEx, which were uniformly processed by the Toil process.The database is publicly accessible and therefore does not require approval from the local ethics committee. Correlation analyses of LncAROD single genes were performed via the stat package in R. Pearson correlation coefficients were calculated, and the top 200 genes positively correlated with the LncAROD were used for downstream analyses. Gene Ontology (GO) enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses were conducted for the top 200 genes positively linked to LncAROD, utilizing the R package "ClusterProfiler" and visualization with the "ggplot2" package. P values less than 0.05 were considered statistically significant when the R package “survival” was used to perform univariate Cox analysis. To examine the differences between squamous cell carcinoma tissues and normal adjacent tissues in the head and neck, both paired t tests and Mann‒Whitney U tests were employed. ROC curves were generated with the pROC package to identify the cutoff value for LncAROD. The associations between clinicopathological features and the LncAROD were assessed through the Wilcoxon rank sum test, chi-square test, Fisher's exact test, and logistic regression analysis. The impact of LncAROD on survival rates was evaluated through Kaplan‒Meier plots and log-rank tests. Cox proportional hazard models were utilized for both univariate and multivariate analyses to investigate the relationships between clinical characteristics and overall survival (OS). Statistical analysis: All the experiments were performed at least three times. The results are shown as the mean ± standard deviation (SD). Analyses of the data were performed utilizing GraphPad Prism 8.0 and SPSS version 20.0. The R statistical environment version 3.6.3, as previously referenced, was utilized. Comparisons between the groups were assessed through one-way ANOVA or an unpaired Student’s t test. A p value less than 0.05 was considered statistically significant. Results Metformin reduces FaDu cells viability,proliferation and migration Assessment of cell viability, proliferation, and migration ability was carried out through CCK-8 assay, colony formation assay, and wound healing assays. The viability of Fadu cells was evaluated using the CCK-8 assay after exposing them to different concentrations of metformin for periods of 24, 48, and 72 hours. Our findings demonstrated significant dose-dependent inhibition of FaDu cell proliferation by metformin, with an IC50 value of 15 mM at 48 hours(Fig. 1 A). Therefore, 0 mM (control), 5 mM, 10 mM, 20 mM, 40 mM and 80 mM metformin were selected for subsequent functional experiments.The results of the cell wound healing assay are shown in Fig. 1 B. The number of FaDu cells that had moved toward the center at 48 h and 72 h significantly decreased after metformin treatment (Fig. 1 C). Additionally, results from plate clone formation assays indicated a significant reduction in colony formation due to metformin treatment(Fig. 1 D). Furthermore, as the concentration of metformin increased, there was a notable decrease in the number of cell aggregation clones formed(Fig. 1 E). This implies that metformin inhibits the proliferation of FaDu cells.In summary, metformin inhibited the viability, migration and invasion of HSCC cells in a dose-dependent manner. Metformin induces apoptosis and cell cycle arrest in FaDu cells To examine the effect of metformin on FaDu cells, we performed flow cytometric assessments of apoptosis after the cells were incubated with 10 mM, 20 mM, and 40 mM metformin solutions for 48 hours. As shown in Fig. 2 A, the apoptosis rates of FaDu cells increased following metformin treatment. Notably, as the concentration of metformin increased, the apoptosis rate of both cell lines also gradually increased, with the percentage of apoptotic cells increasing from 8–44%, which was a statistically significant difference (P < 0.05). These experimental results indicate that metformin induces apoptosis in FaDu cells and that the apoptosis ratio is positively correlated with the concentration of metformin (Fig. 2 B). Furthermore, we observed a dramatic increase in apoptosis when the metformin concentration exceeded 20 mM; by 40 mM, most cells had perished. To further elucidate the relationship between growth inhibition and cell cycle arrest, we subsequently analyzed the effect of metformin on cell cycle progression (Fig. 2 C). Compared with the control cells, the metformin-treated FaDu cells accumulated in the G2/M phase, which increased from 12.45 ± 0.35 to 21.49 ± 0.15, and the G0/G1 peak decreased after 48 hours, with the G2/M ratio increasing in conjunction with rising metformin concentrations.These results indicate that treatment with metformin hinders cell proliferation by preventing progression through the G2/M phase (Fig. 2 D, Supplement Table 1) In vivo xenograft model,HE and immunohistochemistry Our findings indicate that, compared with the control group, the metformin group presented lower tumor weights (Fig. 3 A and B). Furthermore, the metformin group demonstrated a greater necrotic areas than the control group (Fig. 3 C, Tumor). To evaluate safety and drug toxicity, the body weights of the mice were measured, and the livers of the nude mice were subjected to HE staining. No significant reduction in body weight was observed, and no hepatocellular necrosis was detected in the metformin group compared with the control group, indicating that treatment with metformin was safe (Fig. 3 C Liver). Examining the proliferative index in tumor sections through immunohistochemistry showed that metformin significantly reduced Ki67 expression, a marker for tumor proliferation, providing further evidence that metformin diminishes the proliferation of hypopharyngeal squamous cell carcinoma (HSCC) cells in vivo (Fig. 3 D). Transmission Electron Microscopy Metformin induced autophagy in vivo. To elucidate the potential effects of metformin on autophagy in transplanted tumor nude mice, the tumors were subjected to transmission electron microscopy (TEM) to examine their autophagic activity and mitochondrial structure. The TEM results revealed an increase in the accumulation of autophagosomes in tumor tissue treated with metformin compared with that in the untreated control. In the control group, the mitochondria (M) appeared slightly swollen, and the membrane remained mostly intact. In contrast, most of the mitochondria (M) in the metformin group were moderately swollen, exhibiting blurred membranes and individual vacuolar lesions. (Fig. 3 E) RNA sequencing and data analysis The RNA-seq data underwent KEGG and GO analysis. The KEGG enrichment analysis demonstrated that metformin-treated FaDu cells were significantly enriched in the ferroptosis,MAPK and TNF signaling pathways(Fig. 4 A).Furthermore, KEGG analyses indicated a considerable depletion in metformin-targeted FaDu cells concerning the cell cycle, DNA replication, pyrimidine metabolism, and the TCA cycle(Fig. 4 B). GO enrichment analysis indicated a decrease in potential functions related to DNA replication, nucleoplasm, and protein binding(Fig. 4 C).Volcano plot analysis of some of the DEGs identified via transcriptome sequencing revealed that PCAT1, SIK1, and SNHG12 were highly expressed, whereas LncAROD was expressed at low levels(Fig. 4 D). The qPCR results showed that LncAROD expression was decreased in both metformin-treated cells and transplanted tumors in nude mice, whereas LncAROD expression was lower in cells than in transplanted tumors (Fig. 4 E).We also used qPCR experiments to verify several other genes in the RNA-seq analysis, such as PCAT1, MALAT1, ZFAS1, and SIK1,which were highly expressed in metformin-treated FaDu cells(Figure S1 ). Bioinformatics analysis and LncAROD with prognosis This study examined the expression levels of the LncAROD in 502 head and neck squamous cell carcinoma (HNSCC) tissues and 44 paracancerous tissues and revealed significant overexpression of the LncAROD in HNSCC tissues (P < 0.001, Fig. 5 A). Additionally, analysis of 44 HNSCC tissues and their adjacent normal tissues further confirmed the high expression of LncAROD in HNSCC tissues (P < 0.001, Fig. 5 B). This study assessed the clinical utility of the LncAROD evaluation by employing ROC curve analysis to demonstrate its efficacy in the differential diagnosis of HNSCC. The calculation of the area under the curve (AUC) yielded a value of 0.839, reflecting that LncAROD demonstrates considerable sensitivity and specificity in diagnosing HNSCC(Fig. 5 C). Moreover, utilizing data from the TCGA and GTEx databases, this study compared LncAROD expression across different cancer types and normal tissues and reported elevated expression levels in multiple cancers as opposed to normal tissues. Specifically, LncAROD was notably highly expressed in 19 out of 33 cancer types, with particularly high expression in HNSCC, followed by esophageal cancer (ESCA) and lung squamous cell carcinoma (LUSC) (Fig. 5 D). To assess the prognostic significance of LncAROD expression in these patients, Kaplan-Meier curves were employed, which indicated that individuals with elevated expression levels experienced a shorter median overall survival time than those with lower expression levels(58.3 vs. 43 months).These results imply that heightened LncAROD expression correlates with tumor advancement and unfavorable survival rates in patients with head and neck squamous cell carcinoma(HNSCC) (Fig. 5 E). Discussion Individualized treatment of hypopharyngeal squamous cell carcinoma(HSCC) is currently in the exploratory stage due to the complex causes of the disease and the unique conditions of each patient. The challenge lies in selecting the most appropriate treatment plan on the basis of individual patient characteristics. Conventional treatment approaches fall short in meeting the personalized treatment requirements of each patient, posing significant challenges in the treatment process. Metformin reportedly improves the overall survival of HNSCC patients 18,19 . An opportunity trial for HNSCC has demonstrated that metformin modulates metabolism in the HNSCC microenvironment 20 and that metformin may positively interact with the immune TME in HNSCC, regardless of HPV status.Metformin can promote HNSCC cell resistance to gefitinib under hypoxic conditions through the NF-κB pathway 21 .Metformin can influence the hallmarks of cancer, including the regulation of the cell cycle, cell death, CSCs, cancer cell migration, invasion and metastasis, cancer metabolism, and cancer immunity 22 .However,few studies have been conducted on metformin in patients with HSCC. In this study, we observed that metformin markedly reduced cell proliferation, as assessed by the CCK-8 assay, colony formation assay, and wound healing assay. Additionally, flow cytometry analyses revealed an increase in apoptosis and the induction of cell cycle arrest, which aligns with findings from numerous prior studies conducted by other researchers 23 . However,when the metformin concentration was 10mM,the results of the colony formation experiment revealed that cell proliferation clearly decreased, which was more obvious than the results of the wound healing assay and the CCK-8 experiment. This may be due to the longer duration of the colony formation experiment, 14 days, and the same concentration of metformin for a long period of time enhancing the inhibition of the cell effect. Nonetheless,our limited grasp of the mechanisms that underlie the antitumor properties of metformin makes identifying patients who might benefit from treatment regimens that include this medication challenging 24 . To further our comprehension, our team utilized RNA-seq analysis to examine the molecular alterations provoked by metformin in FaDu cells. Transcriptome sequencing can help reveal the molecular mechanisms of drug action on tumor cells. By analyzing the transcriptome changes in tumor cells before and after drug action, insights can be gained into how drugs affect gene expression in tumor cells, thus revealing the mechanism of drug action. For example, studies can reveal how drugs regulate metabolic pathways 25 , signaling pathways 26 and the cell cycle in tumor cells, which is crucial for optimizing drug design and improving therapeutic efficacy. The results from this investigation demonstrated that metformin influences various signaling pathways that play a role in the suppression of tumor cells, including decreased DNA replication, RNA transport, and protein processing. KEGG enrichment analysis showed a positive role for metformin in COVID-19 treatment, which is also consistent with many studies 27,28 . As anticipated, metformin modifies the expression of genes such as SIK1,and MALAT1, which are implicated in metabolic processes. Bioinformatics analysis of transcriptome sequencing data revealed that LncAROD was one of the genes whose expression was most significantly downregulated.The LncAROD has been identified as a significant player in tumor progression, particularly in head and neck squamous cell carcinoma (HNSCC). The upregulation of LncAROD has been associated with poor prognosis and malignant tumorigenesis in various cancers, including hepatocellular carcinoma (HCC) and HNSCC 29 .The dysregulation of LncAROD has been implicated in various cancers, indicating its potential as a diagnostic and prognostic marker in cancer management 30,31 . LncAROD is the lncRNA-activating regulator of DKK1 32 , whereas DKK1 has been reported to be an extracellular inhibitor of the Wnt/β-catenin pathway 33 , thereby regulating tumor cell growth. We downloaded HNSCC data from the TCGA and GTEx databases. The analysis revealed that high expression levels of LncAROD were associated with a shorter median overall survival time. We extracted PCR products from FaDu cells and tumor tissues from nude mice, and RT-qPCR experiments demonstrated that LncAROD was highly expressed in both FaDu cells and tumor tissue but was downregulated following metformin treatment. These results suggest that metformin may inhibit tumor growth by reducing LncAROD expression.LncAROD, through its interactions with proteins and its role in metabolic pathways such as aerobic glycolysis, has emerged as a critical regulator of tumor progression, particularly in HNSCC. Understanding the mechanisms by which the LncAROD influences cancer development will shed light on potential therapeutic targets and diagnostic strategies for combating cancer. Additionally, the in vivo xenograft model further validated the tumor-suppressive effects of metformin. In the transplanted tumor model in nude mice, the visceral organs appeared normal, and hematoxylin and eosin (HE) staining of the liver revealed no evidence of liver damage. Additionally, HE staining and Ki67 analysis of the tumors indicated significant apoptosis in the metformin experimental group. Ki67 is a cell proliferation-associated antigen, and Ki-67 positivity typically indicates a more rapid rate of cell proliferation within the subject's body, a relatively high degree of tumor malignancy, and a poorer prognosis 34 . In contrast, metformin primarily manifests in vivo as a reducer of blood glucose levels, which may inhibit the proliferation of tumor cells. However, the results from TEM and HE staining of the tumor did not reveal a clear tendency to inhibit tumor growth, as indicated by Ki67. These findings suggest that the inhibition of tumor cells in vivo involves a combination of multiple mechanisms. On the basis of these results, the effects of metformin on HSCC are clearly multifaceted, and further research is necessary to elucidate each mechanism of the drug, particularly through in vivo experiments. Several studies have indicated that metformin can enhance the efficacy of chemotherapy in tumor cells 35 , improve sensitivity to chemotherapeutic agents, and augment the effects of immunotherapeutic drugs 36 . Additional studies employing various siRNAs, alternative knockdown strategies, and diverse functional analyses will be necessary to accurately determine the mechanism by which the LncAROD promotes the progression of HSCC. Conclusion In summary, we explored the biological impacts of metformin on hypopharyngeal squamous cell carcinoma(HSCC) and examined its mechanisms of action on FaDu cells via transcriptome sequencing. Bioinformatics analysis revealed that elevated levels of LncAROD correlate with a poor prognosis in patients with HSCC. Moreover, it was discovered that metformin reduces the expression of LncAROD in HSCC. These results imply that LncAROD may represent a valuable prognostic biomarker and an effective therapeutic target. Declarations Competing interests statement The authors declare no competing interests. Additional Information Additional Information is available in Supplementary Information. Author Contribution Fang Liu:Conceptualized the project, lead the project, wrote the original version of the manuscript, revised manuscript.Huihui Xie:Performed the Pathological experiments, analyzed the data.Meiyu Liu:Performed the Molecular experiments, analyzed the data.DW:Conceptualized the project, lead the project, provided funding, revised manuscript. All authors contributed to the revision and editing of the manuscript. All authors reviewed this final version of the manuscript. Acknowledgements This work was supported by Major Projects on Science and Technology Innovation in Fujian Province(2020Y9085) and Ganzhou Science and Technology Programme (GZ2023ZSF179). Data Availability Data is provided within the manuscript or supplementary information files References Visini, M., Giger, R., Shelan, M., Elicin, O. & Anschuetz, L., Predicting Factors for Oncological and Functional Outcome in Hypopharyngeal Cancer. LARYNGOSCOPE 131 E1543 (2021). Tassler, A. B., Gooding, W. E. & Ferris, R. L., hypopharyngeal squamous cell carcinoma treatment: Does initial surgery confer survival benefit? Head Neck 41 2167 (2019). Kwon, D. I. & Miles, B. A., Hypopharyngeal carcinoma: Do you know your guidelines? Head Neck 41 569 (2019). Foretz, M., Guigas, B. & Viollet, B., Metformin: update on mechanisms of action and repurposing potential. NAT REV ENDOCRINOL 19 460 (2023). Coyle, C., Cafferty, F. H., Vale, C. & Langley, R. E., Metformin as an adjuvant treatment for cancer: a systematic review and meta-analysis. ANN ONCOL 27 2184 (2016). Sun, Y. et al. , Metformin inhibits cell proliferation and ACTH secretion in AtT20 cells via regulating the MAPK pathway. MOL CELL ENDOCRINOL 582 112140 (2024). Chen, Y. H. et al. , Metformin induces apoptosis and inhibits migration by activating the AMPK/p53 axis and suppressing PI3K/AKT signaling in human cervical cancer cells. MOL MED REP 23 (2021). Yang, J. et al. , Metformin induces Ferroptosis by inhibiting UFMylation of SLC7A11 in breast cancer. J Exp Clin Cancer Res 40 206 (2021). Padilla, J. & Lee, J., A Novel Therapeutic Target, BACH1, Regulates Cancer Metabolism. CELLS-BASEL 10 (2021). Li, D. et al. , Long intergenic noncoding RNA HOTAIR is overexpressed and regulates PTEN methylation in laryngeal squamous cell carcinoma. AM J PATHOL 182 64 (2013). Xu, E. et al. , Blocking long noncoding RNA MALAT1 restrained the development of laryngeal and hypopharyngeal carcinoma. Eur Arch Otorhinolaryngol 277 611 (2020). Garcia-Padilla, C. et al. , LncRNA H19 Impairs Chemo and Radiotherapy in Tumorigenesis. INT J MOL SCI 23 (2022). Lin, D. et al. , Circulating tumor cells: biology and clinical significance. Signal Transduct Target Ther 6 404 (2021). Zhang, H., Lu, X., Lu, B., Gullo, G. & Chen, L., Measuring the composition of the tumor microenvironment with transcriptome analysis: past, present and future. FUTURE ONCOL 20 1207 (2024). Mollaei, M., Hassan, Z. M., Khorshidi, F. & Langroudi, L., Chemotherapeutic drugs: Cell death- and resistance-related signaling pathways. Are they really as smart as the tumor cells? TRANSL ONCOL 14 101056 (2021). Tian, W. et al. , Bioinformatics analysis of the role of aldolase A in tumor prognosis and immunity. Sci Rep 12 11632 (2022). Zheng, D. C. et al. , Transcriptome sequencing reveals a lncRNA-mRNA interaction network in extramammary Paget's disease. BMC MED GENOMICS 14 291 (2021). Rêgo, D. F., Pavan, L. M., Elias, S. T., De Luca, C. G. & Guerra, E. N., Effects of metformin on head and neck cancer: a systematic review. ORAL ONCOL 51 416 (2015). Wu, X. et al. , Metformin Inhibits Progression of Head and Neck Squamous Cell Carcinoma by Acting Directly on Carcinoma-Initiating Cells. CANCER RES 79 4360 (2019). Curry, J. et al. , Metformin effects on head and neck squamous carcinoma microenvironment: Window of opportunity trial. LARYNGOSCOPE 127 1808 (2017). Yin, X. et al. , Metformin enhances gefitinib efficacy by interfering with interactions between tumor-associated macrophages and head and neck squamous cell carcinoma cells. Cell Oncol (Dordr) 42 459 (2019). Hua, Y. et al. , Metformin and cancer hallmarks: shedding new lights on therapeutic repurposing. J TRANSL MED 21 403 (2023). Di Matteo, S. et al. , Metformin exerts anti-cancerogenic effects and reverses epithelial-to-mesenchymal transition trait in primary human intrahepatic cholangiocarcinoma cells. SCI REP-UK 11 2557 (2021). Olokpa, E., Mandape, S. N., Pratap, S. & Stewart, L. M. V., Metformin regulates multiple signaling pathways within castration-resistant human prostate cancer cells. BMC CANCER 22 1 (2022). Yang, C., Huang, X., Liu, Z., Qin, W. & Wang, C., Metabolism-associated molecular classification of hepatocellular carcinoma. MOL ONCOL 14 896 (2020). Cai, J. et al. , Fatostatin induces ferroptosis through inhibition of the AKT/mTORC1/GPX4 signaling pathway in glioblastoma. CELL DEATH DIS 14 211 (2023). Kamyshnyi, O. et al. , Metformin to decrease COVID-19 severity and mortality: Molecular mechanisms and therapeutic potential. BIOMED PHARMACOTHER 144 112230 (2021). Shestakova, M. V. et al. , Risk factors for COVID-19 case fatality rate in people with type 1 and type 2 diabetes mellitus: A nationwide retrospective cohort study of 235,248 patients in the Russian Federation. Front Endocrinol (Lausanne) 13 909874 (2022). Tang, J. et al. , Novel insights into the multifaceted roles of m(6)A-modified LncRNAs in cancers: biological functions and therapeutic applications. Biomark Res 11 42 (2023). Cerk, S. et al. , Current Status of Long Non-Coding RNAs in Human Breast Cancer. INT J MOL SCI 17 (2016). Qian, Y., Shi, L. & Luo, Z., Long Non-coding RNAs in Cancer: Implications for Diagnosis, Prognosis, and Therapy. Front Med (Lausanne) 7 612393 (2020). Ntini, E. et al. , Long ncRNA A-ROD activates its target gene DKK1 at its release from chromatin. NAT COMMUN 9 1636 (2018). Liang, L. et al. , Dkk1 exacerbates doxorubicin-induced cardiotoxicity by inhibiting the Wnt/β-catenin signaling pathway. J CELL SCI 132 (2019). Zhang, T. et al. , Proliferative potential and response to nivolumab in clear cell renal cell carcinoma patients. ONCOIMMUNOLOGY 9 1773200 (2020). Triggle, C. R. et al. , Metformin: Is it a drug for all reasons and diseases? METABOLISM 133 155223 (2022). Huang, X. et al. , Metformin Reprograms Tryptophan Metabolism to Stimulate CD8+ T-cell Function in Colorectal Cancer. CANCER RES 83 2358 (2023). Additional Declarations No competing interests reported. Supplementary Files Supplementaryinformation.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5331437","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":382375225,"identity":"e620ef54-c46a-4ff6-a7d4-ca3fa9a9ad93","order_by":0,"name":"Fang Liu","email":"","orcid":"","institution":"Fujian Medical University Union Hospital","correspondingAuthor":false,"prefix":"","firstName":"Fang","middleName":"","lastName":"Liu","suffix":""},{"id":382375226,"identity":"6916763b-5b56-43af-b5af-7fbac81030d9","order_by":1,"name":"Huihui Xie","email":"","orcid":"","institution":"First Affiliated Hospital of Gannan Medical University","correspondingAuthor":false,"prefix":"","firstName":"Huihui","middleName":"","lastName":"Xie","suffix":""},{"id":382375227,"identity":"27645cd9-a8c3-47b6-9a13-8404bf6c913b","order_by":2,"name":"Meiyu Liu","email":"","orcid":"","institution":"First Affiliated Hospital of Gannan Medical University","correspondingAuthor":false,"prefix":"","firstName":"Meiyu","middleName":"","lastName":"Liu","suffix":""},{"id":382375228,"identity":"39528c63-4a40-4e08-b07e-157e0195bf91","order_by":3,"name":"Desheng Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA00lEQVRIiWNgGAWjYLACHgYbfsYGEIuNeC1pko2kajksCdZBlBaD42cPv3jz57wE87QzBgwfyg4z8M9uIKDlTF6a5dy22xKMs3MMGGecO8wgcecAfi1mB3LMjHkbbteBtDDzth1mMJBIIKDl/BszY54/58C2MP8lSsuNHOPHPGwHIFoYidFif+ONGePctmSglrSCgz3n0nkkbhDQItmfY/zhzR87CcPZyRsf/CizluOfQUALELBJgEjDBgaGAwygOCICMH8AkfLEKB0Fo2AUjIKRCQCxcUQUTIAc9QAAAABJRU5ErkJggg==","orcid":"","institution":"Fujian Medical University Union Hospital","correspondingAuthor":true,"prefix":"","firstName":"Desheng","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2024-10-25 09:53:30","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5331437/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5331437/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":71144691,"identity":"8be860d4-14ba-49b8-ace2-71513f0ef7c5","added_by":"auto","created_at":"2024-12-11 14:13:44","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":159630,"visible":true,"origin":"","legend":"\u003cp\u003eMetformin inhibited the growth of FaDu cells.\u003c/p\u003e\n\u003cp\u003e(A) For 24h-72h,FaDu cells were incubated with 5-50 mM metformin followed by quantifying cell number with CCK-8 assay. (B)The migration of FaDu cells treated by metformin was determined by the wound-healing assay.(C)Relative migration distances in the control and metformin groups in wound-healing assay.P \u0026lt; 0.05.(D) The ability of FaDu cells to form clones after metformin and relative control treatment assessed by colony formation assay.\u003c/p\u003e","description":"","filename":"Figure1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5331437/v1/dc167fb71accd685b6562cf5.jpeg"},{"id":71144697,"identity":"b72081f3-7338-4172-9a5e-8a969c1177a7","added_by":"auto","created_at":"2024-12-11 14:13:44","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":148040,"visible":true,"origin":"","legend":"\u003cp\u003eMetformin induced apoptosis and of \u0026nbsp;FaDu cells.(A)FaDu cells were used for flow cytometric analysis to evaluate the percentage of apoptosis. (B) FaDu cells were used for flow cytometric analysis to evaluate the percentage of apoptosis.(C)Cell cycle analysis of FaDu cells treated with 0,10 mM,20mM,40mM metformin for 48 h (n = 3).(D)Flow cytometry showed G0/G1 cell-cycle was decreased significantly in metformin-treated cells, while increased G2/M phase cells.Data was demonstrated as the mean values ± SD of 3 independently performed experiments in duplicates.\u003c/p\u003e","description":"","filename":"Figure2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5331437/v1/b10c47ed9d149ededc3d1040.jpeg"},{"id":71144692,"identity":"777b4716-57a7-4d69-8213-48661566da2b","added_by":"auto","created_at":"2024-12-11 14:13:44","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":308857,"visible":true,"origin":"","legend":"\u003cp\u003eMetformin repressed the growth and caused the apoptosis of FaDu cells in vivo. (A) Representative images of BALB/c-nude mice following the injections of 143B cells vehicle or metformin group. (B) Tumor volume was recorded every 3 days after metformin treatment. (A)The tumor was removed after all mice were killed.(B) Tumor weight after metformin treatment. (C) H\u0026amp;E staining was done to assess the histological aspects of tumor and liver.(D) The expression of Ki-67 in tumor were observed by immunohistochemistry.(E)Transmission Electron Microscope(TEM) of metformin-promoted apoptosis and autophagy in vivo.**P \u0026lt; 0.01, *P \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"Figure3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5331437/v1/16545da3e7a307429fb57061.jpeg"},{"id":71145700,"identity":"196cc621-fd7a-49c6-9643-7dd87f88f2a6","added_by":"auto","created_at":"2024-12-11 14:21:44","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":223934,"visible":true,"origin":"","legend":"\u003cp\u003eTranscriptome sequencing revealed metformin (15 mM, 48 h) in FaDu cells. (A) KEGG enrichment analyses(up 20) showed metformin targets FaDu cells were markedly enriched in ferroptosis MAPK, and TNF signaling pathways;(B)KEGG enrichment analyses(down 20) showed metformin targets FaDu cells were markedly ‌diminished in cell cycle,DNA replication,Pyrimidine metabolism and TCA cycle. (C)The GO enrichment analysis potential functions were decreased in ‌DNA replication,nucleoplasm and protein binding.(D)Volcano map analysis of selected differential genes from transcriptome sequencing.(E)The qPCR detection of LncAROD expression in metformin-treated cells and transplanted tumors.\u003c/p\u003e","description":"","filename":"Figure4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5331437/v1/7212b35a1605a4f4854f3dd9.jpeg"},{"id":71144695,"identity":"6ba1b847-6c37-4c64-86c0-abc52def3ff2","added_by":"auto","created_at":"2024-12-11 14:13:44","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":151888,"visible":true,"origin":"","legend":"\u003cp\u003eBioinformatics analysis of LncAROD expression in HNSCC and its association with survival prognosis.(A)The levels of expression of the LncAROD in clinical tissues of HNSCC.(B)Expression of LncAROD in 44 pairs of tumors and paracancerous tissues.(C) ROC curve showed the efficiency of LncAROD expression level to distinguishing HNSCC tissue from non-tumor tissue. X-axis represents false positive rate, and Y-axis represents true positive rate.(D)LncAROD expression in different tumour tissues.(E)The Kaplan-Meier analysis the relationship between LncAROD expression level and the overall survival of HNSCC patients.\u003c/p\u003e","description":"","filename":"Figure5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5331437/v1/c64d03499f0a5cfd936e64d4.jpeg"},{"id":72820017,"identity":"1a04e90c-295e-419e-bfa6-21ecd4bc9b67","added_by":"auto","created_at":"2025-01-02 13:09:07","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1612944,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5331437/v1/181bd405-bf7c-43f3-9926-4b40199fb3cb.pdf"},{"id":71144693,"identity":"02132a51-1a23-4029-a33d-05c7ddcca54e","added_by":"auto","created_at":"2024-12-11 14:13:44","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":133925,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementaryinformation.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5331437/v1/dcf6c740d5ababa5de8fa302.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Metformin suppresses hypopharyngeal squamous cell carcinoma growth via reducing LncAROD","fulltext":[{"header":"Introduction","content":"\u003cp\u003eHypopharyngeal squamous cell carcinoma(HSCC) is a prevalent malignant tumor that is becoming increasingly common,representing a major risk to the well-being of patients. However, numerous challenges and obstacles persist in its treatment\u003csup\u003e1\u003c/sup\u003e. Early diagnosis is crucial due to the subtle onset and nonspecific symptoms of HSCC, often leading to advanced stage detection and complicating treatment\u003csup\u003e2\u003c/sup\u003e. Currently, there is a lack of effective early screening methods in clinical practice, resulting in many patients missing the optimal treatment window\u003csup\u003e3\u003c/sup\u003e. The treatment options for HSCC are limited to surgery, radiotherapy, and chemotherapy, all of which can cause severe side effects and impact quality of life. Furthermore, these traditional treatments may not yield satisfactory results for advanced HSCC patients, increasing the risk of recurrence and metastasis. Therefore, there is an urgent need to develop novel therapeutic drugs for HSCC.\u003c/p\u003e \u003cp\u003eMetformin, a frequently prescribed oral hypoglycemic medication for individuals with type 2 diabetes, is thought to lower serum glucose levels by decreasing gluconeogenesis and glycogenolysis in the liver while also exerting various effects in the gastrointestinal tract\u003csup\u003e4\u003c/sup\u003e.Furthermore, metformin has promising uses in cancer treatment\u003csup\u003e5\u003c/sup\u003e. Research has shown that this drug can impede the growth and proliferation of tumor cells, trigger apoptosis, and hinder metastasis and invasion\u003csup\u003e6\u003c/sup\u003e. These actions are thought to be facilitated by the activation of the AMPK pathway, which is a critical regulator of cellular energy metabolism\u003csup\u003e7\u003c/sup\u003e. By disrupting the energy balance of tumor cells and reducing their glucose uptake and metabolism, metformin can effectively inhibit tumor growth\u003csup\u003e8,9\u003c/sup\u003e.However, challenges remain, including the need for further research on the optimal dosage, side effects, and specific mechanisms of the antitumor effects of metformin. Future studies should focus on exploring these mechanisms, identifying suitable tumors for metformin therapy, and developing innovative combination treatments for improved clinical outcomes.\u003c/p\u003e \u003cp\u003eThe increased expression of specific lncRNAs in tumors has been linked to the severity and prognosis of the disease. For example, MALAT1 and HOTAIR are highly expressed in various tumors and are associated with tumor proliferation, invasion, and metastasis\u003csup\u003e10,11\u003c/sup\u003e. H19 enhances the autophagy response, is positively correlated with various drug therapies, and may act as a potent therapeutic target for multiple carcinomas, thereby substantially improving patient prognosis and clinical outcomes\u003csup\u003e12\u003c/sup\u003e. Thus, targeting the expression of these lncRNAs can effectively impede tumor progression, suggesting novel approaches for tumor treatment.\u003c/p\u003e \u003cp\u003eTranscriptome sequencing facilitates a comprehensive analysis of gene expression in tumor cells, thereby aiding in the identification of genomic variations and key genes that drive tumor growth\u003csup\u003e13\u003c/sup\u003e. This information provides valuable insights for drug development and broadens the scope of tumor gene therapy research. In clinical settings, bioinformatics prognostic analysis is essential for tailoring treatment to individual patients with tumors\u003csup\u003e14\u003c/sup\u003e. By integrating genotypic, phenotypic, and clinical data, this approach enables a more accurate assessment of tumor aggressiveness, metastatic potential, and patient prognosis, thus establishing a solid scientific foundation for precise tumor treatment\u003csup\u003e15\u003c/sup\u003e. Tian \u003cem\u003eet al\u003c/em\u003e. conducted a bioinformatics analysis to investigate the role of aldolase A in tumor prognosis\u003csup\u003e16\u003c/sup\u003e. In another study, Zheng DC \u003cem\u003eet al\u003c/em\u003e. utilized transcriptome sequencing to reveal a lncRNA‒mRNA interaction network associated with disease\u003csup\u003e17\u003c/sup\u003e.We screened the results of transcriptome sequencing and performed bioinformatics analyses to elucidate the relationships between the expression of different genes and clinicopathological features, as well as prognosis.\u003c/p\u003e \u003cp\u003eThus,the objective of this study was to assess how metformin influences the proliferation, apoptosis, invasion, and migration of FaDu cells. Additionally, we assessed in vivo tumorigenicity through subcutaneous xenografts to examine drug toxicity and its impact on tumor development. The primary finding indicates that treatment with metformin inhibits growth in FaDu cells, potentially through the downregulation of the LncAROD, which could represent a critical mechanism behind the anticancer properties of this medication.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell culture and processing\u003c/h2\u003e \u003cp\u003eThe FaDu tumor cell line was purchased from Suzhou Haixing Biology Technology Co., Ltd. The cells were cultured in RPMI 1640 medium (Gibco, USA) supplemented with 10% fetal bovine serum (Haixing, Suzhou) and 1% penicillin (NCMbio, Suzhou) for cell culture. The cells were cultured in a humidified incubator at 37\u0026deg;C in 5% CO\u003csub\u003e2\u003c/sub\u003e.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eReagents and drugs\u003c/h3\u003e\n\u003cp\u003eMetformin was purchased from North China Pharmaceutical Company, Ltd, and 0.1 g of metformin was dissolved in RPMI 1640 medium and prepared as a stock solution at a concentration of 700 mM. Following the manufacturer's guidelines, the samples were stored at 4\u0026deg;C.\u003c/p\u003e\n\u003ch3\u003eCell viability (CCK-8)\u003c/h3\u003e\n\u003cp\u003eWe utilized the CCK-8 assay to evaluate the viability of the cells. In brief, 20,000 FaDu cells were seeded in 96-well plates, each containing 100 \u0026micro;L of medium. The cells were treated with various concentrations of metformin (0, 5, 10, 20, 30, 40, or 50 mM) for 24, 48, or 72 hours. After 10 \u0026micro;L of CCK-8 (MCE, USA) was added to each well, the cells were incubated for an additional hour. The optical density (OD) was then measured at 450 nm via a Multiskan Ascent (Thermo Fisher Scientific).\u003c/p\u003e \u003cp\u003eCell viability was calculated as follows: [(OD of metformin-treated cells -OD of blank cells)/(OD of control cells - OD of blank cells)] \u0026times;100%.\u003c/p\u003e \u003cp\u003eThis calculation allows for the accurate quantification of viable cells in response to metformin treatment while accounting for background absorbance from blank wells and ensuring an appropriate control comparison.\u003c/p\u003e\n\u003ch3\u003eColony formation assay of cell proliferation\u003c/h3\u003e\n\u003cp\u003eCells were cultured in 6-well plates (NEST) at a density of 1000 cells per well with various concentrations of metformin (0, 5, 10, 20, 40, or 80 mM). Over a period of 14 days, the culture medium was replaced every three days, and the cells were observed regularly. The culture medium was subsequently removed, and the colonies were fixed with methanol before being stained with crystal violet (Beyotime, Shanghai, China). After the images were captured, the colony count was determined via a microscope (Olympus, Tokyo, Japan).\u003c/p\u003e\n\u003ch3\u003eWound healing assay of cell migration\u003c/h3\u003e\n\u003cp\u003eThe cells were plated in 6-well plates and allowed to incubate for 24 hours. The control and metformin treatment groups subsequently received various concentrations of the drug (0 or 15 mM) for an additional 24 hours before being marked via a sterile 10-\u0026micro;l pipette tip. Following the scribing procedure, all the cellular debris was eliminated by rinsing with PBS, after which the cells were transferred to new serum-free medium and incubated at 37\u0026deg;C in a 5% CO\u003csub\u003e2\u003c/sub\u003e atmosphere. The cells were then harvested at specific time intervals (24 h, 48 h, and 72 h), examined under a microscope, and photographed.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eFlow cytometric analysis of cell apoptosis and cell cycle progression\u003c/h2\u003e \u003cp\u003eThe TransDetect\u0026reg; Annexin V-FITC/PI Cell Apoptosis Detection Kit was used to examine cell apoptosis. The TransDetect\u0026reg; Annexin V-FITC/PI Cell Apoptosis Detection Kit was used to examine cell apoptosis. In brief, FaDu cells were collected at 48 h after metformin incubation and then washed with cooled phosphate-buffered saline (PBS). Next, the cells were suspended in a prescribed binding buffer, and Annexin V-FITC and propidium iodide (PI) solutions were added to stain the cells at room temperature in the dark following the manufacturer\u0026rsquo;s instructions. The number of apoptotic cells was monitored via a FACSCanto II flow cytometer (BD, USA), and the data were further analyzed via FlowJo.\u003c/p\u003e \u003cp\u003eTheAn Elabscience\u0026reg; Cell Cycle Assay Kit (red fluorescence) was used to analyze the cell cycle. FaDu cells were treated with various dosages of metformin for 48 hours. The cells were subsequently digested, centrifuged, washed, and fixed for one hour in anhydrous ethanol at -20\u0026deg;C. Following fixation, the cells were treated with propidium iodide (PI) at 4\u0026deg;C for 30 minutes in the dark and then analyzed via a flow cytometer (BD, USA).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eIn vivo xenograft model and immunohistochemistry (IHC)\u003c/h3\u003e\n\u003cp\u003e Experimental procedures, including the handling and euthanization of animals, were carried out in strict compliance with the ARRIVE guidelines, adhering to all pertinent institutional, national, and international regulations on the ethical treatment of laboratory animals.All animal experiments were approved by the Animal Ethics Committee of Gannan Medical University (LLSC-2024NO.129).\u003c/p\u003e \u003cp\u003eFive-week-old BALB/c nude mice (male and female, 20\u0026thinsp;~\u0026thinsp;25 g) were purchased from Jiangsu Huachuang Sino Pharma Tech Co., Ltd. These nude mice were housed in the SPF animal facility at the Animal Experimental Center of Gannan Medical University, maintained on a consistent 12-h light/dark cycle (with lights on at 08:00) and provided unrestricted access to standard food and water. The laboratory temperature was regulated to remain at 25\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C, and the relative humidity was maintained between 40% and 60%. FaDu cells, at a concentration of 5\u0026times;10^6 cells, were injected subcutaneously into the flank of the mice. After a period of 2 weeks, the mice were randomly separated into two groups to receive daily intraperitoneal injections of either metformin (20 mg/kg, n\u0026thinsp;=\u0026thinsp;5) or normal saline (NS, n\u0026thinsp;=\u0026thinsp;5).\u003c/p\u003e \u003cp\u003eAll methods involving the mice were performed under respiratory anesthesia using a blend of isoflurane and oxygen to alleviate discomfort. Following a 30-day period of ongoing treatment and evaluation, the mice were euthanized via inhalation of CO\u003csub\u003e2\u003c/sub\u003e. The tumors were then removed for assessment of their volume and weight, while tumor and liver tissues were gathered for additional analysis.\u003c/p\u003e \u003cp\u003eThe tumor samples were split into two segments: one for total RNA extraction and the other for histopathological examination, including hematoxylin‒eosin (H\u0026amp;E) staining and Ki67 immunohistochemical (IHC) analysis. Additionally, the liver tissue of the nude mice was examined through H\u0026amp;E staining. The animal-related research detailed in this study adhered to applicable laws and ethical guidelines.\u003c/p\u003e\n\u003ch3\u003eTransmission electron microscopy\u003c/h3\u003e\n\u003cp\u003eThe tumor tissues were collected and rapidly plunged into a fixative for transmission electron microscopy (TEM) (Servicebio, CHN) at 4\u0026deg;C for preservation and transportation. The tissues were then processed according to routine procedures and observed under a transmission electron microscope (HT7700; Hitachi, Tokyo, Japan), and images were captured for analysis.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eRNA sequencing and data analysis\u003c/h2\u003e \u003cp\u003eA total of 1\u0026times;10^6 FaDu cells were subjected to treatment with metformin at a concentration of 15 mM for 48 hours, with three replicates, and subsequently collected for RNA sequencing. In summary, total RNA was extracted via TRIzol (TransGen Biotech), and its integrity was assessed via the 2100 RNA Nano 6000 Assay Kit (Agilent Technologies, CA, USA). High-throughput RNA sequencing libraries were prepared through the AMPure XP system and analyzed via an Agilent 2100 bioanalyzer, followed by sequencing on an Illumina NovaSeq 6000 sequencer provided by Beijing Annoroad Medical Testing Laboratory Co., Ltd. The gene expression quantification and identification of differentially expressed genes were achieved with the FeatureCounts and DESeq2 R packages, applying the threshold criteria of padj\u0026thinsp;\u0026le;\u0026thinsp;0.05 and |log2(foldchange)| \u0026ge; 1. We subsequently conducted Gene Ontology (GO) and KEGG enrichment analyses via the clusterProfiler R package as per the guidelines. Additionally, gene set enrichment analysis (GSEA) was carried out.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eRT‑qPCR analysis\u003c/h2\u003e \u003cp\u003eTo investigate how metformin influences LncAROD expression, FaDu cells were cultured in media supplemented with FBS and subsequently treated with either the PBS vehicle or 20 mM metformin for 24 hours. RNA was extracted from both FaDu cells and xenograft tissues of nude mice using TRIzol reagent (TransGenBiotech, Beijing, China) following the manufacturer's protocols. RT‒qPCR analysis was conducted with PerfectStart\u0026reg; Uni RT\u0026amp;qPCR Kit (TransGenBiotech, Beijing, China), and the expression levels were normalized against GAPDH and quantified through the2\u0026thinsp;\u0026minus;\u0026thinsp;\u003csup\u003eΔΔ (ct)\u003c/sup\u003e method.\u003c/p\u003e \u003cp\u003eGene-specifc primers was synthesized by Sangon Biotech (Shanghai,China) ,and the sequences of primers were as follows:(Primers for the other genes are in the Supplement Table\u0026nbsp;2)\u003c/p\u003e \u003cp\u003e(forward)5\u0026rsquo;-3\u0026rsquo;CCACAACGGCAACCAGTAAA;\u003c/p\u003e \u003cp\u003e(reverse)5\u0026rsquo;-3\u0026rsquo;AGGCGTTCCACCTGCAAATA for LncAROD.\u003c/p\u003e \u003cp\u003e(forward)5\u0026rsquo;-3\u0026rsquo;CAGGAGGCATTGCTGATGAT ;\u003c/p\u003e \u003cp\u003e(reverse)5\u0026rsquo;-3\u0026rsquo;GAAGGCTGGGGCTCATTT for GAPDH.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eBioinformatics analysis and LncAROD with prognosis\u003c/h2\u003e \u003cp\u003eRNAseq data and clinical data of HNSCC patients from the TCGA database.502 HNSCC samples and 44 paracancerous tissue samples were included in this study. The downloaded RNAseq data in FPKM format were converted to TPM (transcripts per million reads) format and log 2 transformed for subsequent analyses. We also downloaded RNA-seq data in TPM format from UCSC Xena for TCGA and GTEx, which were uniformly processed by the Toil process.The database is publicly accessible and therefore does not require approval from the local ethics committee.\u003c/p\u003e \u003cp\u003eCorrelation analyses of LncAROD single genes were performed via the stat package in R. Pearson correlation coefficients were calculated, and the top 200 genes positively correlated with the LncAROD were used for downstream analyses. Gene Ontology (GO) enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses were conducted for the top 200 genes positively linked to LncAROD, utilizing the R package \"ClusterProfiler\" and visualization with the \"ggplot2\" package.\u003c/p\u003e \u003cp\u003eP values less than 0.05 were considered statistically significant when the R package \u0026ldquo;survival\u0026rdquo; was used to perform univariate Cox analysis.\u003c/p\u003e \u003cp\u003eTo examine the differences between squamous cell carcinoma tissues and normal adjacent tissues in the head and neck, both paired t tests and Mann‒Whitney U tests were employed. ROC curves were generated with the pROC package to identify the cutoff value for LncAROD. The associations between clinicopathological features and the LncAROD were assessed through the Wilcoxon rank sum test, chi-square test, Fisher's exact test, and logistic regression analysis. The impact of LncAROD on survival rates was evaluated through Kaplan‒Meier plots and log-rank tests. Cox proportional hazard models were utilized for both univariate and multivariate analyses to investigate the relationships between clinical characteristics and overall survival (OS).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis:\u003c/h2\u003e \u003cp\u003eAll the experiments were performed at least three times. The results are shown as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). Analyses of the data were performed utilizing GraphPad Prism 8.0 and SPSS version 20.0. The R statistical environment version 3.6.3, as previously referenced, was utilized. Comparisons between the groups were assessed through one-way ANOVA or an unpaired Student\u0026rsquo;s t test. A p value less than 0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eMetformin reduces FaDu cells viability,proliferation and migration\u003c/h2\u003e \u003cp\u003eAssessment of cell viability, proliferation, and migration ability was carried out through CCK-8 assay, colony formation assay, and wound healing assays.\u003c/p\u003e \u003cp\u003eThe viability of Fadu cells was evaluated using the CCK-8 assay after exposing them to different concentrations of metformin for periods of 24, 48, and 72 hours.\u003c/p\u003e \u003cp\u003eOur findings demonstrated significant dose-dependent inhibition of FaDu cell proliferation by metformin, with an IC50 value of 15 mM at 48 hours(Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Therefore, 0 mM (control), 5 mM, 10 mM, 20 mM, 40 mM and 80 mM metformin were selected for subsequent functional experiments.The results of the cell wound healing assay are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB. The number of FaDu cells that had moved toward the center at 48 h and 72 h significantly decreased after metformin treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eAdditionally, results from plate clone formation assays indicated a significant reduction in colony formation due to metformin treatment(Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Furthermore, as the concentration of metformin increased, there was a notable decrease in the number of cell aggregation clones formed(Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). This implies that metformin inhibits the proliferation of FaDu cells.In summary, metformin inhibited the viability, migration and invasion of HSCC cells in a dose-dependent manner.\u003c/p\u003e\u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eMetformin induces apoptosis and cell cycle arrest in FaDu cells\u003c/h2\u003e \u003cp\u003eTo examine the effect of metformin on FaDu cells, we performed flow cytometric assessments of apoptosis after the cells were incubated with 10 mM, 20 mM, and 40 mM metformin solutions for 48 hours. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, the apoptosis rates of FaDu cells increased following metformin treatment. Notably, as the concentration of metformin increased, the apoptosis rate of both cell lines also gradually increased, with the percentage of apoptotic cells increasing from 8\u0026ndash;44%, which was a statistically significant difference (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). These experimental results indicate that metformin induces apoptosis in FaDu cells and that the apoptosis ratio is positively correlated with the concentration of metformin (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Furthermore, we observed a dramatic increase in apoptosis when the metformin concentration exceeded 20 mM; by 40 mM, most cells had perished. To further elucidate the relationship between growth inhibition and cell cycle arrest, we subsequently analyzed the effect of metformin on cell cycle progression (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Compared with the control cells, the metformin-treated FaDu cells accumulated in the G2/M phase, which increased from 12.45\u0026thinsp;\u0026plusmn;\u0026thinsp;0.35 to 21.49\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15, and the G0/G1 peak decreased after 48 hours, with the G2/M ratio increasing in conjunction with rising metformin concentrations.These results indicate that treatment with metformin hinders cell proliferation by preventing progression through the G2/M phase (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD, Supplement Table\u0026nbsp;1)\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eIn vivo xenograft model,HE and immunohistochemistry\u003c/h2\u003e \u003cp\u003eOur findings indicate that, compared with the control group, the metformin group presented lower tumor weights (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and B). Furthermore, the metformin group demonstrated a greater necrotic areas than the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC, Tumor). To evaluate safety and drug toxicity, the body weights of the mice were measured, and the livers of the nude mice were subjected to HE staining. No significant reduction in body weight was observed, and no hepatocellular necrosis was detected in the metformin group compared with the control group, indicating that treatment with metformin was safe (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC Liver).\u003c/p\u003e \u003cp\u003eExamining the proliferative index in tumor sections through immunohistochemistry showed that metformin significantly reduced Ki67 expression, a marker for tumor proliferation, providing further evidence that metformin diminishes the proliferation of hypopharyngeal squamous cell carcinoma (HSCC) cells in vivo (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eTransmission Electron Microscopy\u003c/h2\u003e \u003cp\u003eMetformin induced autophagy in vivo. To elucidate the potential effects of metformin on autophagy in transplanted tumor nude mice, the tumors were subjected to transmission electron microscopy (TEM) to examine their autophagic activity and mitochondrial structure. The TEM results revealed an increase in the accumulation of autophagosomes in tumor tissue treated with metformin compared with that in the untreated control. In the control group, the mitochondria (M) appeared slightly swollen, and the membrane remained mostly intact. In contrast, most of the mitochondria (M) in the metformin group were moderately swollen, exhibiting blurred membranes and individual vacuolar lesions. (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE)\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eRNA sequencing and data analysis\u003c/h2\u003e \u003cp\u003eThe RNA-seq data underwent KEGG and GO analysis. The KEGG enrichment analysis demonstrated that metformin-treated FaDu cells were significantly enriched in the ferroptosis,MAPK and TNF signaling pathways(Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA).Furthermore, KEGG analyses indicated a considerable depletion in metformin-targeted FaDu cells concerning the cell cycle, DNA replication, pyrimidine metabolism, and the TCA cycle(Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). GO enrichment analysis indicated a decrease in potential functions related to DNA replication, nucleoplasm, and protein binding(Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC).Volcano plot analysis of some of the DEGs identified via transcriptome sequencing revealed that PCAT1, SIK1, and SNHG12 were highly expressed, whereas LncAROD was expressed at low levels(Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003eThe qPCR results showed that LncAROD expression was decreased in both metformin-treated cells and transplanted tumors in nude mice, whereas LncAROD expression was lower in cells than in transplanted tumors (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE).We also used qPCR experiments to verify several other genes in the RNA-seq analysis, such as PCAT1, MALAT1, ZFAS1, and SIK1,which were highly expressed in metformin-treated FaDu cells(Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eBioinformatics analysis and LncAROD with prognosis\u003c/h2\u003e \u003cp\u003eThis study examined the expression levels of the LncAROD in 502 head and neck squamous cell carcinoma (HNSCC) tissues and 44 paracancerous tissues and revealed significant overexpression of the LncAROD in HNSCC tissues (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Additionally, analysis of 44 HNSCC tissues and their adjacent normal tissues further confirmed the high expression of LncAROD in HNSCC tissues (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001, Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). This study assessed the clinical utility of the LncAROD evaluation by employing ROC curve analysis to demonstrate its efficacy in the differential diagnosis of HNSCC.\u003c/p\u003e \u003cp\u003eThe calculation of the area under the curve (AUC) yielded a value of 0.839, reflecting that LncAROD demonstrates considerable sensitivity and specificity in diagnosing HNSCC(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eMoreover, utilizing data from the TCGA and GTEx databases, this study compared LncAROD expression across different cancer types and normal tissues and reported elevated expression levels in multiple cancers as opposed to normal tissues. Specifically, LncAROD was notably highly expressed in 19 out of 33 cancer types, with particularly high expression in HNSCC, followed by esophageal cancer (ESCA) and lung squamous cell carcinoma (LUSC) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003eTo assess the prognostic significance of LncAROD expression in these patients, Kaplan-Meier curves were employed, which indicated that individuals with elevated expression levels experienced a shorter median overall survival time than those with lower expression levels(58.3 vs. 43 months).These results imply that heightened LncAROD expression correlates with tumor advancement and unfavorable survival rates in patients with head and neck squamous cell carcinoma(HNSCC) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIndividualized treatment of hypopharyngeal squamous cell carcinoma(HSCC) is currently in the exploratory stage due to the complex causes of the disease and the unique conditions of each patient. The challenge lies in selecting the most appropriate treatment plan on the basis of individual patient characteristics. Conventional treatment approaches fall short in meeting the personalized treatment requirements of each patient, posing significant challenges in the treatment process. Metformin reportedly improves the overall survival of HNSCC patients\u003csup\u003e18,19\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eAn opportunity trial for HNSCC has demonstrated that metformin modulates metabolism in the HNSCC microenvironment\u003csup\u003e20\u003c/sup\u003e and that metformin may positively interact with the immune TME in HNSCC, regardless of HPV status.Metformin can promote HNSCC cell resistance to gefitinib under hypoxic conditions through the NF-κB pathway\u003csup\u003e21\u003c/sup\u003e.Metformin can influence the hallmarks of cancer, including the regulation of the cell cycle, cell death, CSCs, cancer cell migration, invasion and metastasis, cancer metabolism, and cancer immunity\u003csup\u003e22\u003c/sup\u003e.However,few studies have been conducted on metformin in patients with HSCC.\u003c/p\u003e \u003cp\u003eIn this study, we observed that metformin markedly reduced cell proliferation, as assessed by the CCK-8 assay, colony formation assay, and wound healing assay. Additionally, flow cytometry analyses revealed an increase in apoptosis and the induction of cell cycle arrest, which aligns with findings from numerous prior studies conducted by other researchers\u003csup\u003e23\u003c/sup\u003e. However,when the metformin concentration was 10mM,the results of the colony formation experiment revealed that cell proliferation clearly decreased, which was more obvious than the results of the wound healing assay and the CCK-8 experiment. This may be due to the longer duration of the colony formation experiment, 14 days, and the same concentration of metformin for a long period of time enhancing the inhibition of the cell effect.\u003c/p\u003e \u003cp\u003eNonetheless,our limited grasp of the mechanisms that underlie the antitumor properties of metformin makes identifying patients who might benefit from treatment regimens that include this medication challenging\u003csup\u003e24\u003c/sup\u003e. To further our comprehension, our team utilized RNA-seq analysis to examine the molecular alterations provoked by metformin in FaDu cells. Transcriptome sequencing can help reveal the molecular mechanisms of drug action on tumor cells. By analyzing the transcriptome changes in tumor cells before and after drug action, insights can be gained into how drugs affect gene expression in tumor cells, thus revealing the mechanism of drug action. For example, studies can reveal how drugs regulate metabolic pathways\u003csup\u003e25\u003c/sup\u003e, signaling pathways\u003csup\u003e26\u003c/sup\u003e and the cell cycle in tumor cells, which is crucial for optimizing drug design and improving therapeutic efficacy.\u003c/p\u003e \u003cp\u003eThe results from this investigation demonstrated that metformin influences various signaling pathways that play a role in the suppression of tumor cells, including decreased DNA replication, RNA transport, and protein processing. KEGG enrichment analysis showed a positive role for metformin in COVID-19 treatment, which is also consistent with many studies \u003csup\u003e27,28\u003c/sup\u003e. As anticipated, metformin modifies the expression of genes such as SIK1,and MALAT1, which are implicated in metabolic processes.\u003c/p\u003e \u003cp\u003eBioinformatics analysis of transcriptome sequencing data revealed that LncAROD was one of the genes whose expression was most significantly downregulated.The LncAROD has been identified as a significant player in tumor progression, particularly in head and neck squamous cell carcinoma (HNSCC). The upregulation of LncAROD has been associated with poor prognosis and malignant tumorigenesis in various cancers, including hepatocellular carcinoma (HCC) and HNSCC \u003csup\u003e29\u003c/sup\u003e.The dysregulation of LncAROD has been implicated in various cancers, indicating its potential as a diagnostic and prognostic marker in cancer management\u003csup\u003e30,31\u003c/sup\u003e. LncAROD is the lncRNA-activating regulator of DKK1\u003csup\u003e32\u003c/sup\u003e, whereas DKK1 has been reported to be an extracellular inhibitor of the Wnt/β-catenin pathway\u003csup\u003e33\u003c/sup\u003e, thereby regulating tumor cell growth.\u003c/p\u003e \u003cp\u003eWe downloaded HNSCC data from the TCGA and GTEx databases. The analysis revealed that high expression levels of LncAROD were associated with a shorter median overall survival time. We extracted PCR products from FaDu cells and tumor tissues from nude mice, and RT-qPCR experiments demonstrated that LncAROD was highly expressed in both FaDu cells and tumor tissue but was downregulated following metformin treatment. These results suggest that metformin may inhibit tumor growth by reducing LncAROD expression.LncAROD, through its interactions with proteins and its role in metabolic pathways such as aerobic glycolysis, has emerged as a critical regulator of tumor progression, particularly in HNSCC. Understanding the mechanisms by which the LncAROD influences cancer development will shed light on potential therapeutic targets and diagnostic strategies for combating cancer.\u003c/p\u003e \u003cp\u003eAdditionally, the in vivo xenograft model further validated the tumor-suppressive effects of metformin. In the transplanted tumor model in nude mice, the visceral organs appeared normal, and hematoxylin and eosin (HE) staining of the liver revealed no evidence of liver damage. Additionally, HE staining and Ki67 analysis of the tumors indicated significant apoptosis in the metformin experimental group. Ki67 is a cell proliferation-associated antigen, and Ki-67 positivity typically indicates a more rapid rate of cell proliferation within the subject's body, a relatively high degree of tumor malignancy, and a poorer prognosis\u003csup\u003e34\u003c/sup\u003e. In contrast, metformin primarily manifests in vivo as a reducer of blood glucose levels, which may inhibit the proliferation of tumor cells. However, the results from TEM and HE staining of the tumor did not reveal a clear tendency to inhibit tumor growth, as indicated by Ki67. These findings suggest that the inhibition of tumor cells in vivo involves a combination of multiple mechanisms.\u003c/p\u003e \u003cp\u003eOn the basis of these results, the effects of metformin on HSCC are clearly multifaceted, and further research is necessary to elucidate each mechanism of the drug, particularly through in vivo experiments. Several studies have indicated that metformin can enhance the efficacy of chemotherapy in tumor cells\u003csup\u003e35\u003c/sup\u003e, improve sensitivity to chemotherapeutic agents, and augment the effects of immunotherapeutic drugs\u003csup\u003e36\u003c/sup\u003e. Additional studies employing various siRNAs, alternative knockdown strategies, and diverse functional analyses will be necessary to accurately determine the mechanism by which the LncAROD promotes the progression of HSCC.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn summary, we explored the biological impacts of metformin on hypopharyngeal squamous cell carcinoma(HSCC) and examined its mechanisms of action on FaDu cells via transcriptome sequencing. Bioinformatics analysis revealed that elevated levels of LncAROD correlate with a poor prognosis in patients with HSCC. Moreover, it was discovered that metformin reduces the expression of LncAROD in HSCC. These results imply that LncAROD may represent a valuable prognostic biomarker and an effective therapeutic target.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eCompeting interests statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\u003ch2\u003eAdditional Information\u003c/h2\u003e \u003cp\u003eAdditional Information is available in Supplementary Information.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eFang Liu:Conceptualized the project, lead the project, wrote the original version of the manuscript, revised manuscript.Huihui Xie:Performed the Pathological experiments, analyzed the data.Meiyu Liu:Performed the Molecular experiments, analyzed the data.DW:Conceptualized the project, lead the project, provided funding, revised manuscript.\u0026nbsp;All authors contributed to the revision and editing of the manuscript. All authors reviewed this final version of the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e \u003cp\u003eThis work was supported by Major Projects on Science and Technology Innovation in Fujian Province(2020Y9085) and Ganzhou Science and Technology Programme (GZ2023ZSF179).\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eData is provided within the manuscript or supplementary information files\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eVisini, M., Giger, R., Shelan, M., Elicin, O. \u0026amp; Anschuetz, L., Predicting Factors for Oncological and Functional Outcome in Hypopharyngeal Cancer. \u003cem\u003eLARYNGOSCOPE\u003c/em\u003e \u003cstrong\u003e131\u003c/strong\u003e E1543 (2021).\u003c/li\u003e\n\u003cli\u003eTassler, A. B., Gooding, W. E. \u0026amp; Ferris, R. L., hypopharyngeal squamous cell carcinoma treatment: Does initial surgery confer survival benefit? \u003cem\u003eHead Neck\u003c/em\u003e \u003cstrong\u003e41\u003c/strong\u003e 2167 (2019).\u003c/li\u003e\n\u003cli\u003eKwon, D. I. \u0026amp; Miles, B. A., Hypopharyngeal carcinoma: Do you know your guidelines? \u003cem\u003eHead Neck\u003c/em\u003e \u003cstrong\u003e41\u003c/strong\u003e 569 (2019).\u003c/li\u003e\n\u003cli\u003eForetz, M., Guigas, B. \u0026amp; Viollet, B., Metformin: update on mechanisms of action and repurposing potential. \u003cem\u003eNAT REV ENDOCRINOL\u003c/em\u003e \u003cstrong\u003e19\u003c/strong\u003e 460 (2023).\u003c/li\u003e\n\u003cli\u003eCoyle, C., Cafferty, F. H., Vale, C. \u0026amp; Langley, R. E., Metformin as an adjuvant treatment for cancer: a systematic review and meta-analysis. \u003cem\u003eANN ONCOL\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e 2184 (2016).\u003c/li\u003e\n\u003cli\u003eSun, Y.\u003cem\u003e et al.\u003c/em\u003e, Metformin inhibits cell proliferation and ACTH secretion in AtT20 cells via regulating the MAPK pathway. \u003cem\u003eMOL CELL ENDOCRINOL\u003c/em\u003e \u003cstrong\u003e582\u003c/strong\u003e 112140 (2024).\u003c/li\u003e\n\u003cli\u003eChen, Y. H.\u003cem\u003e et al.\u003c/em\u003e, Metformin induces apoptosis and inhibits migration by activating the AMPK/p53 axis and suppressing PI3K/AKT signaling in human cervical cancer cells. \u003cem\u003eMOL MED REP\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e (2021).\u003c/li\u003e\n\u003cli\u003eYang, J.\u003cem\u003e et al.\u003c/em\u003e, Metformin induces Ferroptosis by inhibiting UFMylation of SLC7A11 in breast cancer. \u003cem\u003eJ Exp Clin Cancer Res\u003c/em\u003e \u003cstrong\u003e40\u003c/strong\u003e 206 (2021).\u003c/li\u003e\n\u003cli\u003ePadilla, J. \u0026amp; Lee, J., A Novel Therapeutic Target, BACH1, Regulates Cancer Metabolism. \u003cem\u003eCELLS-BASEL\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e (2021).\u003c/li\u003e\n\u003cli\u003eLi, D.\u003cem\u003e et al.\u003c/em\u003e, Long intergenic noncoding RNA HOTAIR is overexpressed and regulates PTEN methylation in laryngeal squamous cell carcinoma. \u003cem\u003eAM J PATHOL\u003c/em\u003e \u003cstrong\u003e182\u003c/strong\u003e 64 (2013).\u003c/li\u003e\n\u003cli\u003eXu, E.\u003cem\u003e et al.\u003c/em\u003e, Blocking long noncoding RNA MALAT1 restrained the development of laryngeal and hypopharyngeal carcinoma. \u003cem\u003eEur Arch Otorhinolaryngol\u003c/em\u003e \u003cstrong\u003e277\u003c/strong\u003e 611 (2020).\u003c/li\u003e\n\u003cli\u003eGarcia-Padilla, C.\u003cem\u003e et al.\u003c/em\u003e, LncRNA H19 Impairs Chemo and Radiotherapy in Tumorigenesis. \u003cem\u003eINT J MOL SCI\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e (2022).\u003c/li\u003e\n\u003cli\u003eLin, D.\u003cem\u003e et al.\u003c/em\u003e, Circulating tumor cells: biology and clinical significance. \u003cem\u003eSignal Transduct Target Ther\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e 404 (2021).\u003c/li\u003e\n\u003cli\u003eZhang, H., Lu, X., Lu, B., Gullo, G. \u0026amp; Chen, L., Measuring the composition of the tumor microenvironment with transcriptome analysis: past, present and future. \u003cem\u003eFUTURE ONCOL\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e 1207 (2024).\u003c/li\u003e\n\u003cli\u003eMollaei, M., Hassan, Z. M., Khorshidi, F. \u0026amp; Langroudi, L., Chemotherapeutic drugs: Cell death- and resistance-related signaling pathways. Are they really as smart as the tumor cells? \u003cem\u003eTRANSL ONCOL\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e 101056 (2021).\u003c/li\u003e\n\u003cli\u003eTian, W.\u003cem\u003e et al.\u003c/em\u003e, Bioinformatics analysis of the role of aldolase A in tumor prognosis and immunity. \u003cem\u003eSci Rep\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e 11632 (2022).\u003c/li\u003e\n\u003cli\u003eZheng, D. C.\u003cem\u003e et al.\u003c/em\u003e, Transcriptome sequencing reveals a lncRNA-mRNA interaction network in extramammary Paget\u0026apos;s disease. \u003cem\u003eBMC MED GENOMICS\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e 291 (2021).\u003c/li\u003e\n\u003cli\u003eR\u0026ecirc;go, D. F., Pavan, L. M., Elias, S. T., De Luca, C. G. \u0026amp; Guerra, E. N., Effects of metformin on head and neck cancer: a systematic review. \u003cem\u003eORAL ONCOL\u003c/em\u003e \u003cstrong\u003e51\u003c/strong\u003e 416 (2015).\u003c/li\u003e\n\u003cli\u003eWu, X.\u003cem\u003e et al.\u003c/em\u003e, Metformin Inhibits Progression of Head and Neck Squamous Cell Carcinoma by Acting Directly on Carcinoma-Initiating Cells. \u003cem\u003eCANCER RES\u003c/em\u003e \u003cstrong\u003e79\u003c/strong\u003e 4360 (2019).\u003c/li\u003e\n\u003cli\u003eCurry, J.\u003cem\u003e et al.\u003c/em\u003e, Metformin effects on head and neck squamous carcinoma microenvironment: Window of opportunity trial. \u003cem\u003eLARYNGOSCOPE\u003c/em\u003e \u003cstrong\u003e127\u003c/strong\u003e 1808 (2017).\u003c/li\u003e\n\u003cli\u003eYin, X.\u003cem\u003e et al.\u003c/em\u003e, Metformin enhances gefitinib efficacy by interfering with interactions between tumor-associated macrophages and head and neck squamous cell carcinoma cells. \u003cem\u003eCell Oncol (Dordr)\u003c/em\u003e \u003cstrong\u003e42\u003c/strong\u003e 459 (2019).\u003c/li\u003e\n\u003cli\u003eHua, Y.\u003cem\u003e et al.\u003c/em\u003e, Metformin and cancer hallmarks: shedding new lights on therapeutic repurposing. \u003cem\u003eJ TRANSL MED\u003c/em\u003e \u003cstrong\u003e21\u003c/strong\u003e 403 (2023).\u003c/li\u003e\n\u003cli\u003eDi Matteo, S.\u003cem\u003e et al.\u003c/em\u003e, Metformin exerts anti-cancerogenic effects and reverses epithelial-to-mesenchymal transition trait in primary human intrahepatic cholangiocarcinoma cells. \u003cem\u003eSCI REP-UK\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e 2557 (2021).\u003c/li\u003e\n\u003cli\u003eOlokpa, E., Mandape, S. N., Pratap, S. \u0026amp; Stewart, L. M. V., Metformin regulates multiple signaling pathways within castration-resistant human prostate cancer cells. \u003cem\u003eBMC CANCER\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e 1 (2022).\u003c/li\u003e\n\u003cli\u003eYang, C., Huang, X., Liu, Z., Qin, W. \u0026amp; Wang, C., Metabolism-associated molecular classification of hepatocellular carcinoma. \u003cem\u003eMOL ONCOL\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e 896 (2020).\u003c/li\u003e\n\u003cli\u003eCai, J.\u003cem\u003e et al.\u003c/em\u003e, Fatostatin induces ferroptosis through inhibition of the AKT/mTORC1/GPX4 signaling pathway in glioblastoma. \u003cem\u003eCELL DEATH DIS\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e 211 (2023).\u003c/li\u003e\n\u003cli\u003eKamyshnyi, O.\u003cem\u003e et al.\u003c/em\u003e, Metformin to decrease COVID-19 severity and mortality: Molecular mechanisms and therapeutic potential. \u003cem\u003eBIOMED PHARMACOTHER\u003c/em\u003e \u003cstrong\u003e144\u003c/strong\u003e 112230 (2021).\u003c/li\u003e\n\u003cli\u003eShestakova, M. V.\u003cem\u003e et al.\u003c/em\u003e, Risk factors for COVID-19 case fatality rate in people with type 1 and type 2 diabetes mellitus: A nationwide retrospective cohort study of 235,248 patients in the Russian Federation. \u003cem\u003eFront Endocrinol (Lausanne)\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e 909874 (2022).\u003c/li\u003e\n\u003cli\u003eTang, J.\u003cem\u003e et al.\u003c/em\u003e, Novel insights into the multifaceted roles of m(6)A-modified LncRNAs in cancers: biological functions and therapeutic applications. \u003cem\u003eBiomark Res\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e 42 (2023).\u003c/li\u003e\n\u003cli\u003eCerk, S.\u003cem\u003e et al.\u003c/em\u003e, Current Status of Long Non-Coding RNAs in Human Breast Cancer. \u003cem\u003eINT J MOL SCI\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e (2016).\u003c/li\u003e\n\u003cli\u003eQian, Y., Shi, L. \u0026amp; Luo, Z., Long Non-coding RNAs in Cancer: Implications for Diagnosis, Prognosis, and Therapy. \u003cem\u003eFront Med (Lausanne)\u003c/em\u003e \u003cstrong\u003e7\u003c/strong\u003e 612393 (2020).\u003c/li\u003e\n\u003cli\u003eNtini, E.\u003cem\u003e et al.\u003c/em\u003e, Long ncRNA A-ROD activates its target gene DKK1 at its release from chromatin. \u003cem\u003eNAT COMMUN\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e 1636 (2018).\u003c/li\u003e\n\u003cli\u003eLiang, L.\u003cem\u003e et al.\u003c/em\u003e, Dkk1 exacerbates doxorubicin-induced cardiotoxicity by inhibiting the Wnt/\u0026beta;-catenin signaling pathway. \u003cem\u003eJ CELL SCI\u003c/em\u003e \u003cstrong\u003e132\u003c/strong\u003e (2019).\u003c/li\u003e\n\u003cli\u003eZhang, T.\u003cem\u003e et al.\u003c/em\u003e, Proliferative potential and response to nivolumab in clear cell renal cell carcinoma patients. \u003cem\u003eONCOIMMUNOLOGY\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e 1773200 (2020).\u003c/li\u003e\n\u003cli\u003eTriggle, C. R.\u003cem\u003e et al.\u003c/em\u003e, Metformin: Is it a drug for all reasons and diseases? \u003cem\u003eMETABOLISM\u003c/em\u003e \u003cstrong\u003e133\u003c/strong\u003e 155223 (2022).\u003c/li\u003e\n\u003cli\u003eHuang, X.\u003cem\u003e et al.\u003c/em\u003e, Metformin Reprograms Tryptophan Metabolism to Stimulate CD8+ T-cell Function in Colorectal Cancer. \u003cem\u003eCANCER RES\u003c/em\u003e \u003cstrong\u003e83\u003c/strong\u003e 2358 (2023).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Hypopharyngeal squamous cell carcinoma, Metformin, LncAROD, progression, RNA sequencing analysis","lastPublishedDoi":"10.21203/rs.3.rs-5331437/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5331437/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe prognosis of hypopharyngeal squamous cell carcinoma(HSCC) remains poor due to its high aggressiveness and tendency for recurrence,therefore,enhancing treatment outcomes to improve patient survival rates is critical.The aim of this study was to explore the effects of metformin on FaDu cells and to investigate the molecular mechanisms.Metformin significantly inhibited cell viability and migration,and induced apoptosis and cell cycle arrest in FaDu cells.RNA sequencing analysis of metformin-treated cells revealed differential expression of genes and possibly related pathways, which were verified by RT-qPCR, and prognostic survival analyses were performed for related genes.Data from the RNA-seq analysis indicated that metformin altered the expression of genes involved in glycolysis, the TCA cycle, DNA replication, RNA transport, protein binding, and ferroptosis.Bioinformatics survival analysis showed that LncAROD was highly expressed in HSCC, and patients with elevated LncAROD expression exhibited a poor prognosis.Furthermore, the in vivo effects of metformin were evaluated in mice, revealing that metformin inhibited tumor growth without causing significant hepatotoxicity.In conclusion, our results demonstrate that metformin modulates multiple processes related to tumor growth and progression in hypopharyngeal squamous cell carcinoma, including the reduction of LncAROD expression and inhibition of tumor progression, thereby providing a novel approach for the clinical treatment of HSCC.\u003c/p\u003e","manuscriptTitle":"Metformin suppresses hypopharyngeal squamous cell carcinoma growth via reducing LncAROD","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-12-11 14:13:39","doi":"10.21203/rs.3.rs-5331437/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"afc1652a-21a4-4417-a378-8792bde0278e","owner":[],"postedDate":"December 11th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":40722483,"name":"Biological sciences/Cancer/Cancer therapy/Drug development"},{"id":40722484,"name":"Health sciences/Diseases/Cancer/Head and neck cancer"},{"id":40722485,"name":"Health sciences/Oncology/Cancer/Cancer therapy"}],"tags":[],"updatedAt":"2025-01-02T13:08:42+00:00","versionOfRecord":[],"versionCreatedAt":"2024-12-11 14:13:39","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-5331437","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5331437","identity":"rs-5331437","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00