Preliminary Survey of Fungal Communities Across a Plastics/No Plastics Transition on an Oregon Beach

preprint OA: closed
📄 Open PDF Full text JSON View at publisher
Full text 20,224 characters · extracted from preprint-html · click to expand
Preliminary Survey of Fungal Communities Across a Plastics/No Plastics Transition on an Oregon Beach | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Preliminary Survey of Fungal Communities Across a Plastics/No Plastics Transition on an Oregon Beach Ken Cullings , Karisa Boyce Arterbury , Richard Arterbury doi: https://doi.org/10.1101/2024.01.18.576272 Ken Cullings 1 Ocean Blue Project, 6699 Fox Centre Pkwy Unit 104-146 , Gloucester, VA 23061 Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: cullings1{at}earthlink.net Karisa Boyce Arterbury 1 Ocean Blue Project, 6699 Fox Centre Pkwy Unit 104-146 , Gloucester, VA 23061 Find this author on Google Scholar Find this author on PubMed Search for this author on this site Richard Arterbury 1 Ocean Blue Project, 6699 Fox Centre Pkwy Unit 104-146 , Gloucester, VA 23061 Find this author on Google Scholar Find this author on PubMed Search for this author on this site Abstract Full Text Info/History Metrics Preview PDF Abstract Plastics pose an increasing and significant threat to both human and environmental health. While many fungi can degrade a variety of organic polymers, investigations into which fungi possess the potential to remediate environmental plastics contamination have only recently become a priority. To help address this need, we tested the null hypothesis that chronic plastics contamination has no impact on the fungal communities across a plastics/no plastics transition in a beach sand in northern Oregon. We used sieving and binocular microscopy of microplastics (particle size, 12.6µm +/-5.5µm, detection range 1-5000µm) to confirm the plastics/no plastics transition. We used paired plot design to collect samples across this transition and analyzed the fungal communities using high-throughput DNA sequencing methods for fungal ITS-2. Results indicated that the beach sand contaminated with plastics held an extensive fungal community, while un-contaminated sand held no fungal community at all. System dominants included Acremonium and Penicillium , both free-living ascomycete fungi that have shown plastics-degrading capabilities in lab studies, and the ectomycorrhizal genus, Russula a symbiotic fungus that has known plastics-degrading enzyme capabilities. Also amongst dominant genera was a human fungal pathogen (genus Malassezia ) that causes chronic skin disease. These results provide new fungal models for further studies of fungal and ectomycorrhizal remediation of plastics contaminated contaminated beach sand. Introduction Plastics and microplastics represent a persistent and growing global environmental health problem (Reviewed by 1) Hence, managing this problem is of paramount importance. To date, landfilling remains the most often used method of disposal and though methods such as incineration and recycling are both expensive and environmentally hazardous, and hence lack the scale to provide a sufficient solution. In light of this, focus has been shifting to the use of microbes, including fungi, as vehicles for plastics degradation and elimination. Fungi are widespread and resilient, inhabiting both terrestrial and aquatic habitats, and function as the Earth’s recyclers able to break down some of the most recalcitrant polymers, including plastics ( 1 ). Research is showing that some fungi may possess the capability in the lab, not all fungi are adapted to conditions necessary to perform the functions in nature or under conditions created by industrial processes (e.g. 2). Thus, using metagenomic methods to identify fungi in the “plastisphere” that could be effective either as free-living degraders in plastics-polluted areas and/or as sources of enzymes for use in engineered recycling methods is of paramount importance ( 1 ). In this study we performed a preliminary survey of the fungal communities across a plastics/no plastics transition in a beach sand habitat in Oregon in order to ascertain impacts of plastics contamination on fungal communities in this habitat. The overall goal of our work is to not only study impacts of plastics contamination on beach sands, but also to locate fungal candidates for use in plastics degradation and remediation. Methods Collections Samples were taken at a beach in Oregon (45.722568, -123.941561) across a transition of sand containing no plastics to sand chronically contaminated by plastics. To confirm the state of contamination in the two habitat types, three samples from each of three plots in each sand type were collected into sterile 50ML Falcon tubes and sent to EMSL Analytical, Inc in Cinnaminsom NJ for analysis by sieve separation and stereoscopic microscopic analysis, particle size range 1µm -5000µm diameter. Molecular Methods Three samples from each of three plots on each side of the transition were collected into sterile 50ML Falcon tubes and sent to Novogene Corp for analysis. The fungal microbiomes of the three beach sand types were determined via Internal Transcribed Spacer (ITS-2) amplicon sequencing (itags) using fungal-specific primers (ITS3F; GCATCGATGAAGAACGCAGC-ITS4R; TCCTCCGCTTATTGATATGC ) . PCR reactions were undertaken using sand extractions using the PHusion High-Fidelity PCR Master Mix (New England Biolabs). Libraries were generated using the TruSeq DNA PCR-Free Prep Kit (Illumina) and quality was assessed using Qubit 2.0 on a Thermo Scientific Fluorometer and Agilent Bioanalyzer 2100 system. The library was sequenced using an IlluminHiSeq2500 platform. ITS-2 itags were generated by Novogene Corporation. Sequences were assembled using FLASH V1.2.7 ( 3 ) and data were quality filtered using QIIME V2 using the default parameters ( 4 ). Chimeras were removed using UCHIME ( 5 ). Sequences were analyzed using UPARSE v7.0.1001 ( 6 ) and sequences with >97% similarity were clustered as OTUs. Multiple sequence alignments were performed using MUSCLE V3.8.31 ( 7 ). Taxonomic annotation was accomplished using the GreenGene Database version 13_8 (included in the QIIME software package mentioned above), based on the RDP Classifier v2.2, and also by using QIIME-compatible SILVA ( 8 ) and BLAST ( 9 ). Results indicated that there were no fungi in the beach sand without plastics no alpha and beta diversity statistics were performed. Good’s Coverage was used to estimate the percent of total species represented in the sampling. Results Results of plastics measurements confirmed the transition between contaminated and uncontaminated beach sands (See Table). High throughput DNA sequencing resulted in 80,000-200,000 unique tags, and with >99.9% Good’s Coverage. Analysis indicated that no fungi were present in the beach sand without plastics, thus no alpha or beta diversity analyses could be performed on this dataset. In contrast, the plastic-contaminated beach sand had a fungal community comprised of both free-living and ostensibly plant-associated fungi, dominated by only a few taxa (Figure). Of particular interest are Acremonium, Penicillium, Malassezia and Russula . Discussion We have indications of at least two free-living fungi that show promise for plastics degradation in beach sands, namely Acremonium and Penicillium. Acremonium is known to degrade petrochemical contaminants in the lab (e.g., 10). The species of Acremonium present here, A tubakii is a marine fungus that is known to produce high levels of laccase, an enzyme that is known to degrade plastics (e.g., 11). Similarly, our data support earlier indications that Penicillium (e.g., 12) could be a good candidate for plastics breakdown in a wide range of habitats. Both fungi will therefore be put forward for future study by our lab as both free-living solutions to plastics contamination and as enzyme sources. Malassezia is a yeast-like pathogenic fungus that causes peritonitis, blood infections and an assortment of chronic and recurrent skin diseases ( e.g., 13, 14). While this fungus may be utility as an enzyme source, the human health implications most likely preclude its use in field settings and this result has interesting implications for the impacts of marine plastics on human health. Interestingly two ectomycorrizal fungi Russula and Inocybe , were found in the Top 10 most abundant fungi in plastics-contaminated beach sand. Ectomycorrhizal fungi are endosymbionts of most flowering plants and conifers and provide these plant hosts with the nitrogen necessary for survival ( 15 ). Some ectomycorrhizal fungi appear to be capable of enzymatic breakdown of at least small polymers in soils as a replacement for host plant carbon in times of need ( 16 , 17 ). These results imply that some ectomycorrhizal fungi might also be attracted to microplastics as a nutrient source. The anatomy and physiology of Russula in particular suggests that species in this genus could prove useful in addressing plastics contamination, particularly when used in combination with host plants. These fungi form a contact exploration type of hyphal network that is known to interact closely with nutrient substrates and to produce enzymes that could be useful in plastics degradation (18). When used in combination with host plants they could be used not only for plastics remediation, but also in combined plastics degradation-reforestation efforts. To summarize, this preliminary survey provides models for at least two free-living fungi ( Acremonium and Penicillium ) that could be useful in plastics remediation efforts and at least one ectomycorrhizal fungal genus ( Russula) that could be used in combination with native plants for phytoremediation strategies. In addition, a severe human pathogen was apparently attracted to the conditions created by plastics in beach sand, a finding that has interesting health implications for beach goers. This survey was only preliminary and we plan a broader survey across plastics no-plastics transitions in beach habitats at this site comparing sand with and without native pines and willows to further our pool of potential fungal remediation agents. Table and Figure View this table: View inline View popup Download powerpoint Download figure Open in new tab Figure : Absolute frequency of top 10 fungal genera in beach sand contaminated by plastic. Acknowledgements We thank the non-profit SumOfUs for funding for this project. References 1). ↵ Khatua , S. , Simal-Gandara , J. and Acharya , K. , 2023 . Myco-remediation of plastic pollution: current knowledge and future prospects . Biodegradation , pp. 1 – 31 . Niehaus , F. , Bertoldo , C. , Kähler , M. and Antranikian , G. , 1999 . Extremophiles as a source of novel enzymes for industrial application . Applied microbiology and biotechnology , 51 , pp. 711 – 729 . OpenUrl CrossRef PubMed Web of Science 2). Grayston , S.J. and Wainwright , M. , 1988 . Sulphur oxidation by soil fungi including some species of mycorrhizae and wood-rotting basidiomycetes . FEMS Microbiology Ecology , 4 ( 1 ), pp. 1 – 8 . OpenUrl CrossRef 3). ↵ Bolyen , E. , Rideout , J.R. , Dillon , M.R. , Bokulich , N.A. , Abnet , C.C. , Al-Ghalith , G.A. , Alexander , H. , Alm , E.J. , Arumugam , M. , Asnicar , F. and Bai , Y. , 2019 . Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2 . Nature biotechnology , 37 ( 8 ), pp. 852 – 857 . OpenUrl CrossRef PubMed 4). ↵ Edgar , R.C. , Haas , B.J. , Clemente , J.C. , Quince , C. and Knight , R. , 2011 . UCHIME improves sensitivity and speed of chimera detection . Bioinformatics , 27 ( 16 ), pp. 2194 – 2200 . OpenUrl CrossRef PubMed Web of Science 5). ↵ Edgar , R.C. , 2013 . UPARSE: highly accurate OTU sequences from microbial amplicon reads . Nature methods , 10 ( 10 ), pp. 996 – 998 . OpenUrl 6). ↵ Edgar , R.C. , Aug 2004b . MUSCLE: a multiple sequence alignment method with reduced time and space complexity . BMC Bioinformatics , 5 , pp. 113 – 113 . OpenUrl CrossRef PubMed 7). ↵ Yilmaz , P. , Parfrey , L.W. , Yarza , P. , Gerken , J. , Pruesse , E. , Quast , C. , Schweer , T. , Peplies , J. , Ludwig , W. and Glöckner , F.O. , 2014 . The SILVA and “all-species living tree project (LTP)” taxonomic frameworks . Nucleic acids research , 42 ( D1 ), pp. D643 – D648 . OpenUrl CrossRef PubMed Web of Science 8). ↵ Altschul , S.F. , Madden , T.L. , Schäffer , A.A. , Zhang , J. , Zhang , Z. , Miller , W. and Lipman , D.J. , 1997 . Gapped BLAST and PSI-BLAST: a new generation of protein database search programs . Nucleic acids research , 25 ( 17 ), pp. 3389 – 3402 . OpenUrl CrossRef PubMed Web of Science 9). ↵ Bhatt , P. , Pathak , V.M. , Bagheri , A.R. and Bilal , M. , 2021 . Microplastic contaminants in the aqueous environment, fate, toxicity consequences, and remediation strategies . Environmental Research , 200 , p. 111762 . OpenUrl 10). Miyata , N. , Tani , Y. , Maruo , K. , Tsuno , H. , Sakata , M. and Iwahori , K. , 2006 . Manganese (IV) oxide production by Acremonium sp. strain KR21-2 and extracellular Mn (II) oxidase activity . Applied and Environmental Microbiology , 72 ( 10 ), pp. 6467 – 6473 . OpenUrl Abstract / FREE Full Text 11). Srikanth , M. , Sandeep , T.S.R.S. , Sucharitha , K. and Godi , S. , 2022 . Biodegradation of plastic polymers by fungi: a brief review . Bioresources and Bioprocessing , 9 ( 1 ), p. 42 . OpenUrl 12). Thayikkannu , A.B. , Kindo , A.J. and Veeraraghavan , M. , 2015 . Malassezia—can it be ignored? . Indian journal of dermatology , 60 ( 4 ), p. 332 . OpenUrl 13). Gupta , A.K. , Batra , R. , Bluhm , R. , Boekhout , T. and Dawson Jr , T.L., 2004 . Skin diseases associated with Malassezia species . Journal of the American Academy of Dermatology , 51 ( 5 ), pp. 785 – 798 . OpenUrl CrossRef PubMed Web of Science 14). Cullings , K.E.N. and Makhija , S. , 2001 . Ectomycorrhizal fungal associates of Pinus contorta in soils associated with a hot spring in Norris Geyser Basin, Yellowstone National Park, Wyoming . Applied and environmental microbiology , 67 ( 12 ), pp. 5538 – 5543 . OpenUrl Abstract / FREE Full Text 15). ↵ Cullings , K. , Raleigh , C. and Vogler , D.R. , 2005 . Effects of severe dwarf mistletoe infection on the ectomycorrhizal community of a Pinus contorta stand in Yellowstone Park . Botany , 83 ( 9 ), pp. 1174 – 1180 . OpenUrl 16). ↵ Cullings , K. and Hanely , J. , 2010 . Dwarf mistletoe effects on soil basidiomycete community structure, soil fungal functional diversity, and soil enzyme function: Implications for climate change . Soil Biology and Biochemistry , 42 ( 11 ), pp. 1976 – 1981 . OpenUrl 17). ↵ Agerer , R. , 2001 . Exploration types of ectomycorrhizae: a proposal to classify ectomycorrhizal mycelial systems according to their patterns of differentiation and putative ecological importance . Mycorrhiza , 11 , pp. 107 – 114 . OpenUrl CrossRef Web of Science View the discussion thread. Back to top Previous Next Posted January 23, 2024. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Preliminary Survey of Fungal Communities Across a Plastics/No Plastics Transition on an Oregon Beach Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Preliminary Survey of Fungal Communities Across a Plastics/No Plastics Transition on an Oregon Beach Ken Cullings , Karisa Boyce Arterbury , Richard Arterbury bioRxiv 2024.01.18.576272; doi: https://doi.org/10.1101/2024.01.18.576272 Share This Article: Copy Citation Tools Preliminary Survey of Fungal Communities Across a Plastics/No Plastics Transition on an Oregon Beach Ken Cullings , Karisa Boyce Arterbury , Richard Arterbury bioRxiv 2024.01.18.576272; doi: https://doi.org/10.1101/2024.01.18.576272 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Ecology Subject Areas All Articles Animal Behavior and Cognition (7644) Biochemistry (17728) Bioengineering (13916) Bioinformatics (42037) Biophysics (21489) Cancer Biology (18637) Cell Biology (25553) Clinical Trials (138) Developmental Biology (13401) Ecology (19941) Epidemiology (2067) Evolutionary Biology (24367) Genetics (15622) Genomics (22547) Immunology (17764) Microbiology (40475) Molecular Biology (17208) Neuroscience (88747) Paleontology (667) Pathology (2842) Pharmacology and Toxicology (4834) Physiology (7659) Plant Biology (15175) Scientific Communication and Education (2047) Synthetic Biology (4304) Systems Biology (9835) Zoology (2272)

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00