MusaDREB1G-like protein regulates cold and drought tolerance in Musa x paradisica

MusaDREB1G-like protein regulates cold and drought tolerance in Musa x paradisica | Authorea try { document.documentElement.classList.add('js'); } catch (e) { } var _gaq = _gaq || []; _gaq.push(['_setAccount', 'G-8VDV14Y67G']); _gaq.push(['_trackPageview']); (function() { var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s); })(); Skip to main content Preprints Collections Wiley Open Research IET Open Research Ecological Society of Japan All Collections About About Authorea FAQs Contact Us Quick Search anywhere Search for preprint articles, keywords, etc. Search Search ADVANCED SEARCH SCROLL Plant, Cell & Environment This is a preprint and has not been peer reviewed. Data may be preliminary. 13 March 2025 V1 Latest version Share on MusaDREB1G-like protein regulates cold and drought tolerance in Musa x paradisica Authors : Subham Bhakta , Sanjana Negi , Pooja Bhatt , Yogendra Singh Rajpurohit , Thumbali Ganapathi R , Sudhir Singh 0000-0001-9210-4605 , Himanshu Tak 0000-0001-6423-8809 [email protected] , and Anand Ballal 0000-0002-8776-3021 Authors Info & Affiliations https://doi.org/10.22541/au.174184400.00807002/v1 392 views 157 downloads Contents Abstract Supplementary Material Information & Authors Metrics & Citations View Options References Figures Tables Media Share Abstract To mitigate the adverse effects of climate change, development of stress-resilient crops has assumed widespread significance. Though, the dehydration-responsive element binding protein (DREB) transcription factors have been demonstrated to be crucial for stress tolerance in model plants, their role in economically important crops largely remain unclear. In the present study, the role of MusaDREB1G in overcoming drought or cold tolerance was investigated in banana, a plant that is vital for global agriculture and food security. Stress profiling revealed transcription of MusaDREB1G to alter in response to with drought, cold, salinity, or ABA exposures, which was corroborated with stress-induced activation of Pro MusaDREB1G -GUS. Pro MusaDREB1G , which harbors various-stress-associated cis-elements, was primarily active in vascular tissues under control growth conditions. Interestingly, in response to drought, salinity, or cold, the Pro MusaDREB1G was also activated in non-vascular tissues. Overexpression of MusaDREB1G led to a dwarf phenotype, but surprisingly these banana lines showed improved drought or cold tolerance. The overexpression line was characterized in detail to obtain mechanistic insights into this phenomenon. Results showed a distinct elevation in abscisic acid (ABA) and jasmonic acid (JA) content, which correlated well with enhanced expression of stress-related genes in transgenic lines. These findings unveil a novel MusaDREB1G-driven common mechanism for cold/drought tolerance and paves the way for engineering stress-resistant banana crops using MusaDREB1G. 1. Introduction The unfavorable environmental conditions (e.g. high temperature, drought, salinity etc.) that exist at different points during the lifecycle of a crop plant negatively impact its yield. Improving genetic makeup of crops, through classical breeding techniques or by altering specific genes/pathways, is an important approach to enhance yield under adverse environments. Modern gene-based approaches have played a crucial role in identifying and characterizing key regulators of abiotic stress tolerance, which have been utilized to improve genotype of suspectable crops. By leveraging the master regulators of stress tolerance pathways, transgenic crops capable of withstanding environmental stresses can be engineered. Transcription factors are the principal regulators of various developmental and stress-regulatory pathways (Manna et al., 2021). Transcription factors reported for stress tolerance in model crops majorly belong to dehydration-response element binding protein (DREB), NAC (NAM, ATAF1/2, CUC2), WRKY, MYC families. Among these transcription factors, members of DREB family are believed to be the most important stress regulators in plants (Joshi et al., 2016). DREB transcription factors bind directly to the dehydration-response element/C-repeat elements in the promoter region of target genes to activate the stress regulatory/detoxification pathways (Fan et al., 2016). In model plant Arabidopsis thaliana, the family of DREB transcription factors is subdivided into six divisions, A1-A6. Among these six subdivisions, the DREBs of A-1, A-3 and A-4 clades are responsible for cold tolerance, whereas the DREB2-type transcription factors are involved in freezing tolerance (Huang et al., 2020; Sakuma et al., 2006). Overexpression of DREB1 transcription factors in different crops such as Zea mays , tomato, Brassica napus improved their cold tolerance ability, indicting their protective role in overcoming these stresses (June et al., 2024; Ito et al., 2006; Qin et al., 2004; Savitch et al., 2005; Zhang et al., 2004). Overexpression of orthologs of Oryza Sativa DREBs in Arabidopsis resulted in drought and chilling tolerance, indicating their utility in crop improvement (Zhang et al., 2009). Transcriptomics studies involving different DREBs, suggest that DREBs potentially control cold or drought stress through induction of cold responsive genes (COR) (Hussain et al., 2023. Suo et al., 2012). The major COR genes reportedly induced by DREBs are “Late Embryogenesis Abundant Protein” encoding genes (LEA), “Responsive-to-Desiccation” genes (RD), “Low-Temperature Induced” genes (LTI) and “Early Responsive to Dehydration” genes (ERD) (Liu, et al., 2019; Shi, Ding, and Yang, 2018; D.-Z. Wang et al., 2017). These COR genes synthesize different heat shock proteins, proteins involved in lipid metabolism, lipid transport and various other metabolic activities thereby controlling the stress responses (Hu et al.,2021). The 5’- promoter region of these COR genes harbors DRE/CRT cis-elements to facilitate their transcriptional regulation by DREB transcription factors (Qian et al., 2023; Yamaguchi-Shinozaki & Shinozaki, 2005). Banana stands out as one of the most nourishing fruits that is consumed by all age groups. It is also extensively grown and is an economically important cash crop. Due to expanding arid lands, erratic temperature shifts and drought-like conditions, banana production is facing significant economic setbacks. In spite of its obvious importance, unfortunately, there is very scanty knowledge pertaining to the stress-responsive transcription factors, which can play a crucial role in stress adaptation in banana. Among the DREB family, only MaDREB1F has been identified and characterized in banana (Xu et al., 2023); Additionally, aside from MaDREB1F, only a few NAC transcription factors, such as MusaNAC29, have been documented to contribute towards stress tolerance in banana through regulation of phytohormones (Negi et al., 2023). Therefore, it is imperative to conduct research on identifying and functionally characterizing master regulators of stress tolerance in banana plant. In this work, we have characterized MusaDREB1G and studied the consequences of over expressing it in banana cv Rasthali. The 5’-regulatory region of MusaDREB1G was shown to respond to various stresses. Overexpression of MusaDREB1G conferred a significant advantage with respect to drought or cold tolerance of banana plants, which could be attributed to increased ABA and JA levels along with constitutive expression of several stress responsive genes. Furthermore, the specific core elements that bind to the MusaDREB1G were delineated and the influence of MusaDREB1G on ROS mediated stress tolerance pathway was also elucidated. Put together, our findings indicate that the stress tolerance response of MusaDREB1G operates via ABA and JA pathways, with MusaDREB1G potentially acting as a convergence point for these regulatory pathways. Thus, the current work has uncovered a new mechanism through which the MusaDREB1G enhances stress tolerance in banana and illuminated the shared regulatory mechanisms underlying drought and cold tolerance in this plant. 2. Materials and Methods 2.1 Stress treatment Uniformly grown banana plants under in-vitro conditions were rooted and hardened under greenhouse conditions. Plants with similar growth and morphology were selected for various stress treatments. In independent experiments, selected plants were treated with salinity (250mM NaCl), cold (4℃), drought (drying on a blotting paper) or abscisic acid application (100µM). Leaves of the treated plants were then collected at different time points (3, 6, 12, 24, 30, and 48 h) for RNA isolation. 2.2 Generation of binary vectors The coding sequence of MusaDREB1G-like and its 5′- regulatory region were amplified from banana cDNA and genomic DNA, respectively. The coding sequence was amplified from cDNA using 2X PCR master mix using the following temperature conditions: 94 °C (5 min), 35 cycles of 95°C (40s), 55°C (60s), 72°C (60s) and 72°C (10min). After sequence confirmation, the complete coding sequence was placed under the control of maize polyubiquitin promoter ( P ZmUbi ) with a nos-terminator downstream of coding sequence generating pCAMBIA1301-P ZmUbi -MusaDREB1G–nosT . Genomic DNA was isolated from the leaves of banana plants using GeneElute Plant Genomic-DNA Miniprep-Kit (Sigma, USA). The 5′-regulatory region was amplified using 2X PCR master mix with the following cycling parameters: 94°C (8min), 35 cycles of 94°C (50s), 55°C (60s), 72°C (60s) and 72°C (10min). The amplified fragment was ligated upstream of GUS reporter gene in pCAMBIA301 and the construct was sequenced for confirmation. The recombinant vectors, pCAMBIA1301-pZmUbi-MusaDREB1G–nosT and pCAMBIA1301-Pro MusaDREB1G -GUS were transformed into Agrobacterium tumefaciens strain EHA105. The sequences of coding region and the 5’regulatory region have been submitted to the gene bank. 2.3 Generation of transgenic banana and tobacco plants Following Agrobacterium transformation, banana embryogenic cell suspension (ECS) were co-cultured with the recombinant Agrobacterium for 3 days in dark on M2 medium (Côte et al., 1996). Further, the cells were allowed to develop into embryos by subculturing on BEM (banana embryogenic medium) for three rounds for 21 days (Ganapathi et al., 2001). Embryos to shoot organogenesis was performed on the medium supplemented with BAP (0.5mg/L) and the lines with high multiplication potentials were further selected for rooting, hardening and detailed analyses. Tobacco leaf disks were co-cultured with recombinant EHA105 harboring pCAMBIA1301-Pro MusaDREB1G -GUS and the transgenic plants were grown as detailed earlier (Dixit et al., 2010). 2.4 GUS staining and MUG assay The transgenic lines of banana and tobacco were confirmed and analyzed by staining with GUS (Negi, Tak, and Ganapathi, 2018). Transgenic tobacco plants were subjected to drought, cold or salinity stresses for defined time periods (1, 3, 6, 12, 24 h) and subsequently were incubated in GUS staining buffer for 24 hours at 37℃. GUS-stained tissues were photographed under a stereomicroscope (Negi et al., 2021). After the application of various stresses, the GUS activity of the leaf tissues were assessed and compared with the control plants as per the protocol established by Jefferson (1987). All the experiments were conducted with at least three biological and three technical replicates. 2.5 RNA isolation and expression analysis RNA was isolated with the Concert plant RNA-reagent (Invitrogen, USA), as per the manufacturer’s protocol. The RNA, purified by passing through Nucleopore spin columns (Make: Genetix. Cat No:NP-84905), were subjected to on-column DNAase digestion (Qiagen) to remove traces of genomic DNA. First strand cDNA synthesis was performed using Thermoscript AMV RT kit (Invitrogen: Cat.No.12236-014) and the cDNAs were diluted to 1:50 with milli-Q grade water before performing transcript abundant analysis. The RT-qPCR analysis was carried out using kappa SYBR green PCR master mix with following cycling parameters: 95°C (5min) followed by 94°C (15s), 58°C (20s) and 72°C (20 sec) (30 cycles) and an ending with a melting curve analysis. EF1α gene was used as a reference gene for normalization during fold value change calculation of the target genes as per the 2 −ΔΔCt method (Schmittgen & Livak, 2008). Primer sequences with gene identification numbers are provided in the supplementary Tables S1, S2 and S5. 2.6 Estimation of phytohormones Leaves from uniformly grown rooted plants were used for phytohormone estimation, and the extraction was performed as described earlier (Bhakta et al., 2022). The mass spectrometry and separations were carried out using AQ-Exactive Orbitrap (Thermo Fisher Scientific) mass spectrometer coupled to a Dionex UltiMate 3000 UHPLC system (Thermo Fisher Scientific) having a column oven (temperature maintained at 40°C) and an auto-sampler maintained at 4°C. A mixture of 10mM ammonium acetate with 0.1% formic acid and acetonitrile was used as mobile phase. Peaks of each hormone was analyzed using the corresponding standard curve of that hormone. 2.7 In vitro stress assay Complete roots were removed from small uniformly rooted transgenic or control banana shoots. These shoots were subjected to various stresses such as 10% PEG 6000, 4℃ cold and 250mM NaCl for 7 days under in vitro conditions in semi-solid MS medium. Post stress, the plants were recovered by sub-culturing them in NAA-supplemented rooting medium. After 30 days, different parameters such as plant weight, root length, root numbers were measured and analyzed for stress tolerance. 2.8 Leaf disk assay Leaves from control or transgenic banana lines were punched (to form discs) with a sterile cork borer. These disks were then subjected to salinity (250mM NaCl), drought stress (10% PEG 6000) or cold stress (4℃) for 10 days. After this period, the chlorophyll content of the control and transgenic lines were measured as described earlier (Bhakta et al., 2022). 2.9 Preparation of MusaDREB1G- like protein and its purification MusaDREB1G-like coding region was ligated in the BamH I and Nde I sites of pET28a vector under the control of T7 promoter. The pET28a - MusaDREB1G­-like construct was transformed into E. coli BL-21-DE3 and MusaDREB1G­-like protein was overexpressed after induction with 1mM IPTG at 37℃ for 4h. The overexpressed protein was solubilized using N-lauryl sarcosine as per the protocol described earlier (Negi et al., 2018). Soluble MusaDREB1G­-like protein was purified using Ni-NTA affinity chromatography and pure protein was eluted with 200mM imidazole. The purification profile of the eluted protein was verified on 12% SDS-PAGE and the presence of His-tag in the purified MusaDREB1G­-like protein was confirmed on Western blots with the mouse anti-His antibody followed by detection with the NBT/BCIP chromogenic substrate . 2.10 Gel shift assays Complementary oligonucleotides that harbored putative DREB binding sites were designed and synthesized. These oligonucleotides were incubated at 90℃ for 5 minutes and then annealed by slow cooling at room temperature to convert into ds-oligonucleotides. The purified MusaDREB1G-like protein at a concentration of 2µg/µl was incubated with different ds-DNA substrates at 25℃ for 25min in a reaction buffer containing 5mM MgCl 2 , 10mM Tris pH-8 and 10mM KCl. After incubation, the protein and substrates were resolved on a native 15% polyacrylamide gel (0.5X TBE running buffer buffer) and visualized after staining with ethidium bromide. The list of all the oligonucleotides used for these assays provided in the supplementary Table S3. 2.11 H 2 O 2 estimation Leaves from 30-day old, uniformly grown plants were collected from the transgenic or control banana plants. One gram of fresh tissue was homogenized under liquid nitrogen, and H 2 O 2 was estimated as per the protocol described by Loreto & Velikova,2001. 2.12 Transcriptome analysis Total RNA was extracted from uniformly-growing plants (control or transgenic banana line -2) of similar age plants using “Concert plant RNA-reagent” (Invitrogen). A library was constructed and paired end reads (2X150 bp) were obtained employing the Illumina Platform. The raw reads were processed with fastp tool where the quality of the reads was analyzed, adapter sequences were removed and the filtered clean reads were obtained for further analysis. Thereafter, reads were mapped to reference banana genome using HISAT2 software. The expression of genes was enumerated using HTSeq-count. The input data for differential gene expression analysis were the read counts estimated by HTSeq (performed using DESeq2 software). Differentially expressed genes were identified based on the cutoff of 1.5-fold expression change and P -value ≤0.05 of three replicate reads per gene. 2.13 Trans activation assay: Utilizing the Xba I and Sac I restriction sites, the MusaDREB1G was substituted in the place of GUS in the pBI121 binary vector, resulting in the creation of pBI121-pCaMV35S::MusaDREB1G-nosT. This was identified as the effector construct. The promoter regions of SPX1, HGS_Nat catalytic domain binding protein, or P450 were PCR amplified from the genome of the banana cultivar Rasthali and subsequently ligated upstream of GUS in the binary vector pCAMBIA1301 using the Hind III and Nco I sites. The recombinant vector, designated as pCAMBIA1301-p SPX1/p-HG_NAT/p-P450::GUS-nosT, served as the reporter construct. Banana embryogenic cells from the Musa cultivar Rasthali were transformed with either the reporter construct alone or co-transformed with both the effector and reporter constructs. GUS activity was assessed in the cells five days post-transformation, following the protocol established by Jefferson (1987). The g ene and promoter sequences are provided in the supplementary file S3. 3. Results 3.1 MusaDREB1G-like protein is a stress-related transcription factor from banana Phylogenetic analysis of the MusaDREB protein was performed with different DREB transcription factors from different plants (e.g. Arabidopsis thaliana , Oryza Sativa and Zea mays etc.) and a neighbor-joining tree was constructed. The transcription factor showed a close evolutionary resemblance with the DREB1G-like transcription factor of Oryza sativa , and was thus named as MusaDREB1G -like protein (Fig. 1). To explore the function of MusaDREB1G-like protein in abiotic stresses, quantitative RT-PCR was performed using cDNAs of leaves from Musa x paradisiaca cv Karibale Monthan plants subjected to various abiotic stress conditions such as drought, salinity, cold and externally applied abscisic acid. Following exposure to ABA, the MusaDREB1G transcript level reached its peak at around 3 hours, showing an approximately four-fold increase compared to the control. Subsequently, the expression reduced and gradually returning to control levels after 24 h of exposure (Fig. 2A). Under drought or salinity, the transcript levels of MusaDREB1G were suppressed, reaching their minimum abundance after 24 h of stress (Fig. 2B and 2C). Conversely, cold stress strongly induced the expression of MusaDREB1G, with a substantial increase in transcript abundance (> six-fold higher expression) observed after 4 h of exposure to cold (Fig. 2D). 3.2 Over expression of MusaDREB1G -like protein in banana plants Transgenic lines overexpressing MusaDREB1G were developed using Agrobacterium -mediated transformation. The integration of T-DNA into the genomic DNA of regenerated banana lines was confirmed through GUS staining of transgenic leaves, followed by the amplification of the hpt II coding sequence from genomic DNA samples. Individual transgenic lines were multiplied and rooted in vitro before being transferred to a greenhouse for acclimatization. All the transgenic lines evaluated displayed a dwarf-growth phenotype in greenhouse, while the similarly aged control banana plants showed normal growth (Fig. 3A-C). All the three randomly selected transgenic lines showed significant up regulation in the expression of MusaDREB1G transcript. (Fig. 3D) 3.4 MusaDREB1G over expression improves drought or cold stress tolerance in banana Leaf disk and in vitro stress recovery assays to assess the stress tolerance of transgenic banana lines were conducted. Under conditions of stress, the chlorophyll content in leaves reduces, but the resistant plants retain more chlorophyll than the susceptible ones. Leaf disk assay revealed the transgenic banana lines to maintain a significantly higher content of chlorophyll than the control plants at the end of the osmotic or cold stress, but not salinity stress (Fig. 4). In in vitro stress recovery assays, the stress-treated transgenic banana lines showed better recovery than control as they regained higher fresh weight and had better root growth during recovery from drought and cold stresses (Fig. 5). 3.5 MusaDREB1G over expression improves antioxidant capacity and lowers the cellular H 2 O 2 content Cellular production of ROS such as H 2 O 2 is kept under strict control as they are detrimental at higher concentration. However, abiotic stresses such as drought, salinity or cold are known to trigger excess ROS and H 2 O 2 production in plants. Overexpression of MusaDREB1G in banana plants led to the reduction in the levels of H 2 O 2 as compared to the control lines (Fig. 6A), indicating the role of ROS homeostasis in MusaDREB1-mediated stress tolerance. To understand the regulation of H 2 O 2 in the MusaDREB1G over expressing lines, the transcript abundance of H 2 O 2 scavenging genes in the transgenic lines was analyzed. Among the different ROS scavengers analyzed, Catalase, Thioredoxin, and Thioredoxin reductase genes were considerably up regulated than that observed in the corresponding control lines (Fig. 6B). 3.6 Transgenic banana lines accumulate higher content of ABA and JA LC-MS analysis showed significantly higher levels of ABA, JA and IAA in transgenic banana lines overexpressing MusaDREB1G , whereas the salicylic acid (SA) content did not change appreciably as compared to the control plants of a similar age (Fig. 7 A-D). To further confirm the influence of MusaDREB1G on hormone biosynthetic genes, expression analysis of hormone biosynthetic genes under drought and cold stresses was performed in MusaDREB1G over expressing lines. ABA biosynthetic genes, ZEP (Zeaxanthin epoxidase) and NCED (9-cis-epoxycarotenoid dioxygenase), as well as JA biosynthetic genes, PLA-1 (Phospholipase A-1) and LOX (Lipoxygenase), showed enhanced expression in the MusaDREB1G over expressed lines, indicating their possible regulation by MusaDREB1G (Fig. 7 E, F). Under drought or cold stress, expression of the hormone biosynthetic genes at various time points corroborated with the expression pattern of MusaDREB1G (Fig. 7 G, H). 3.3 Analysis of the 5’-regulatory region of MusaDREB1G The 5′-regulatory region of MusaDREB1G-like protein was ligated upstream of the GUS reporter gene in pCAMBIA-1301 (Fig. 8A). This T-DNA harboring Pro MusaDREB1G -GUS was transformed into tobacco leaf disks and transgenic tobacco lines were regenerated (Fig. 8B). These transgenic lines were utilized for analysis of the tissue specific and stress inducible activity of Pro MusaDREB1G -GUS. Transgenic lines showed highest expression of GUS after 6h of drought, 12h of salinity, and 24h of cold stress (Fig. 8C). The expression of GUS was quantitatively measured at highest expression time points using MUG assay, and it was observed that after 6h of drought, and 12h of salinity stress, L-3 had significantly higher GUS activity than control. While under cold stress, both the lines displayed significantly higher GUS expression over control (Fig. 8D). The Pro MusaDREB1G sequence harbors several stress-responsive cis-elements (Fig. 8E). These cis-elements are boxed and description of individual cis-elements is provided in the table (Table 1). 3.6 MusaDREB1G proteins bind to three different dehydration response elements To assess its DNA-binding ability, the MusaDREB1G protein with 6 additional in frame C-terminal His residues (His-tag) was over-expressed in E. coli and purified by affinity chromatography using the Ni-NTA resin (Fig. 9A). The presence of the purified MusaDREB1G protein was verified on Western blots employing the monoclonal anti-His antibody (Fig. 9B) subsequently, the MusaDREB1G protein was used for electrophoretic mobility shift assays (EMSA). Nine distinct ds-oligonucleotide fragments, each harboring different DRE elements were designed and evaluated for their ability to bind to the recombinant MusaDREB1G protein. Out of the nine DNA tested, three variations of the DRE elements exhibited a notable binding to the MusaDREB1G (Fig. 9C) . The three DNA fragments that showed appreciable binding to the MusaDREB1G were D1G3, D1G6, and D1G7, whereas the same protein failed to bind to the DNA fragments, M1, M2 and M3, which contained the mutated DREB elements (Fig. 9D). Trans-activation assay was performed to verify the ability of the MusaDREB1G to bind to the DRE element and activate transcription in vivo in banana. The promoters containing the DRE that bound to the MusaDREB1G in vitro were chosen for generating the reporter constructs. For the transient transactivation assay, the effector construct (T-DNA containing pCaMV35S:: MusaDREB1G-nosT) and GUS reporter constructs containing the promoter of the selected genes i.e. SPX (Ma07_g09970), P450 (Ma03_g32460) and HG_NAT cat domain ( Ma07_g09970) (T-DNA encoding PSPX/P450/PHG_NAT::GUS-nosT) were co-introduced into banana embryogenic cells (Fig. 9E, F)). Under these conditions, enhanced reporter activity would be observed only when the over-expressed MusaDREB1G would bind to the respective promoters and activate transcription. Indeed, a markedly increased GUS activity was observed in the case of all the three promoters, indicating that MusaDREB1G did indeed activate transcription of these selected genes in vivo in banana (Fig. 9G). 3.8 Identification of cold or drought responsive genes influenced by MusaDREB1G over expression To identify the MusaDREB1G regulated cold and drought responsive genes, we did comparative analysis of MusaDREB1G-OX banana transcriptome with drought and cold treated wild type (WT) banana transcriptome. The purpose of the transcriptomic experiment was to initially identify the differentially expressed genes in the MusaDREB1G overexpression line (please refer supplementary file S4). Subsequently, once identified, these DEGs were compared with the earlier-obtained dataset of differentially expressed genes observed in the wild-type banana plants exposed to different abiotic stresses (Xu et al., 2023) . This analysis was done to not only identify genes that are differentially expressed in the MusaDREB1G-OX per se, but also to determine DEGs that are common between the overexpression line and the stress-treated wild-type banana. The selection of genes in the comparative analysis was done using a cut off of minimum 1.5-fold up or down regulation with a P value≤0.05. The comparative analysis showed that around 572 differentially expressed genes are common between MusaDREB1G and wild type banana transcriptomes treated with cold and drought (Fig. 10A). The list of DEGs, their description and their transcript abundance data is listed in supplementary Table S4. Further Gene ontology enrichment analysis with these 572 commonly expressed genes showed that they regulate six major biological processes, namely abiotic stress response, responses to heat stimulus, protein folding etc. The detailed GO::Term and their abundance are provided in Fig. 10B. 4. Discussion: In this study, a detailed functional analysis of MusaDREB1G, a transcription factor in banana, and how this factor enhanced tolerance against drought or cold stress was elucidated. Banana crop varieties with greater B genome numbers have higher stress tolerance (Thingnam et al., 2023), therefore MusaDREB1G from Musa x paradisiaca cv. Karibale Monthan (ABB group and stress tolerant) was selected for overexpression in a stress-susceptible crop cultivar Musa x paradisiaca cv. Rasthali (AAB group). 5’-regulatory region is usually responsible for tissue-specific as well as hormone/regulator-specific expression of a gene. In Arabidopsis, the 5’ regulatory region of date palm DREB1G is activated in presence of osmotic and ABA stress (Kodackattumannil et al., 2023). In the present study, a significant increase in the transcript abundance was observed during the early stages of cold stress (specifically, at 1 to 4 h post-stress) or within 3 h of ABA application. This notable peak suggests the involvement of DREB1G in alleviating early stress-induced symptoms. Similarly, Pro MusaDREB1G -GUS showed highest activation, post 6h drought, 12h salinity exposure or after 24h cold stress in tobacco plants. Under control condition, Pro MusaDREB1G -GUS activation was weak and limited to leaf vessels and stomatal guard cells. Sequence analysis in PLACE database showed presence of multiple stress activated cis-acting elements in the Pro MusaDREB1G which corroborated with its activation under abiotic stress conditions. Presence of weak activation under control, and moderate activation under stress suggest potential applications of Pro MusaDREB1G in genetic engineering of crops for stress tolerance. Notably, post drought or cold stress the MusaDREB1G overexpressing banana lines gained more weight and showed greater root abundance, indicating better recovery than that showed by the control lines. Recovery of the salinity treated plants was not significantly different from control and many plants could not survive the stress period. These data suggests that MusaDREB1G over expression improves drought or cold stress tolerance, but not salt tolerance, in transgenic banana lines. Similarly, engineering of DREB1-type genes in Arabidopsis and rice also enhanced tolerance to abiotic stresses such as drought or cold in these plants (Muthurajan et al., 2021; H. Wang et al., 2022). Interestingly, the MusaDREB1G over-expressing transgenic banana lines exhibited a dwarf phenotype. Likewise, over expression of AtDREB1A in soybean resulted in plant dwarfing (Suo et al., 2012). To the best of our knowledge, this appears to be the first report where overexpression of a DREB transcription factor has led to dwarfism in banana. The development of a dwarf phenotype is a desirable trait in bananas as the short plants would be less prone to lodging induced by the weight of the fruit bunches. In many places, the problem of bunching is addressed with wooden props. However, in coastal regions where heavy winds prevail, these props often prove ineffective, leading to lodging and decreased yield. Therefore, transgenic bananas over expressing MusaDREB1G have the potential to enhance agronomic traits. ROS is a major player of multiple developmental and stress regulatory pathways in plants. On encountering stresses, plants generates extensive amount of ROS, which, if not detoxified, may lead to tissue damage/death and impact yield in crop plants (Tripathy & Oelmüller, 2012). Stress-induced expression of ROS scavenging genes is a popular strategy to manage abiotic stresses in crop plants. The MusaDREB1G-overexpressing banana lines showed considerably lower H 2 O 2 content than control lines. Expression analysis of ROS scavenging enzymes showed significant upregulation of Catalase, Thioredoxin and Thioredoxin reductase, which correlated very well with reduced ROS observed in MusaDREB1G overexpression lines. ABA and JA are the major hormones that play key roles in adaptation to abiotic stresses in plants. ABA induces the expression of stress related transcription factors that eventually regulates stomatal closure, osmolyte accumulation and scavenging of ROS (Muhammad Aslam et al., 2022). The JA hormone induces antioxidant enzymes and activates transcription factors that are helpful in mitigating various stress and impart tolerance (J. Wang, Song, Gong, Xu, & Li, 2020). Recent reports suggest that IAA too induces root growth and scavenges ROS to increase tolerance to drought or osmotic stressors (Ma et al., 2022). The MusaDREB1G over expressing banana lines showed significantly higher content of ABA, JA and IAA than control. These transgenic banana lines also exhibited higher transcript abundance of ABA and JA biosynthetic genes. Together these results signify that MusaDREB1G imparts abiotic stress resistance by regulating the hormone biosynthetic genes. The correlation between the expression pattern of MusaDREB1G and the expression pattern of the hormone-synthesizing genes at different time points on application of stress further underscores this point. Conserved domain analysis in the amino acid sequences of MusaDREB1G showed the presence of a single AP2 domain. According to the presence of number of AP2 domains and their position with respect to other domains, the AP2 super family is subdivided into four different families namely AP2, DREB, RAV, and ERF. These members show variation in their ability to bind to (and transactivate) the different DRE elements present in promoters (Wu et al., 2022). Members of the AP2 sub family have been reported to bind to GCAC(A/G)N(A/T) TCCC(A/G)ANG(C/T) element (Gong et al., 2008; Nole-Wilson & Krizek, 2000), the ERF family members binds to AGCCGCC domain (Ohme-Takagi & Shinshi, 1995;Wu et al 2022) while the RAV family members bind to CAACA and CACCTG sequences (Cheng et al.,2023). EMSA showed the MusaDREB1G protein bound to the D1G3 sequence (GCCGTCGATGTTG CCGTCGATGTTGCCGTCGATGTT), the D1G6 (AACATCGACG GCAACA TCGACGCAACATCGACGGC) and the D1G7 oligo sequence (ATCCATA AGAGCCGCCA CTAAAATAAGACCGATCAA). These oligos contain sequences that belong to either AP2 family (GCACAT), RAV family i.e. GCCGCC or ERF family i.e. AGCCGCC. The trans activation assays with specific promoters that contain the above-mentioned elements further validated MusaDREB1G as a member of the AP2 super family of TFs. MusaDREB1G binds to another DRE element, TGTTG, which is present in its own promoter Pro MusaDREB1G, signifying the possible presence of a feedback loop between MusaDREB1G and its expression. After ABA treatment, increased expression of MusaDREB1G was indeed observed at the end of 3h in banana plants, suggesting the presence of the above-mentioned feedback loop between ABA and MusaDREB1G. To pinpoint the drought or cold responsive genes influenced by MusaDREB1G, we identified the differentially expressed genes (DEGs) in MusaDREB1G overexpressing lines and compared them with DEGs observed in response to cold or drought in banana plants. Gene ontology analysis showed the 572 common genes to be involved in 6 major biological processes that included abiotic stress regulation, response to abiotic stimuli, photosynthesis, heat response, and temperature response (GO:0015979, GO:0009628, GO:0009708, GO:0009266, respectively) (Fig. 10B). Further examination revealed common genes to be mainly comprising of transcription factors, chaperone proteins, and hormone biosynthesis genes (listed in supplementary Table S4). Analysis of MusaDREB1G over expressing plants transcriptomes indicated induction of COR genes, LEA and its isoforms, along with multiple aquaporins, which may help in countering drought or cold stress. The transcriptome data clearly shows that the MusaDREB1G plays crucial role in regulating cold as well as drought tolerance by modulating multiple biological processes. 5. Conclusion Collectively, these findings suggest MusaDREB1G-like protein functions as a stress regulatory transcription factor, responsible for tolerance to drought or cold stress through multifaceted mechanisms involving induction of genes whose products are involved in biosynthesis of stress hormones or scavenging of ROS or in overcoming abiotic stresses (detailed in Fig. 11). Although, the overexpression of MusaDREB1G in banana plants led to dwarfism, the transgenic plants showed enhanced ability to withstand drought or cold stress as compared to the control plants. Harnessing the stress-induced expression of this transcription factor in banana plants holds promise for bolstering their resilience to environmental challenges and enhance productivity. Author contributions SB, HT, SS, YSR, TG & AB planned and designed the experiments. SB, SN, PB and HT performed the experiments and analyzed the data. SB, HT, SS, YSR, TG and AB wrote the manuscript. All the authors have read and approved the manuscript. Acknowledgement The work was supported from the funding of Department of Atomic Energy, Government of India. SN thanks “Department of Science and Technology” (DST), New Delhi for DST INSPIRE Faculty award. Figure Legends: Fig. (1) Evolutionary relationship of MusaDREB1G transcription factor. (A) Phylogenetic analysis of MusaDREB1G with multiple DREB transcription factors from Zea mays , Arabidopsis thaliana and Oryza sativa . (Accession No of the genes are provided in the figure). (B) Multiple sequence alignment displaying presence of AP2/ERF domain in MusaDREB1G. Fig. (2) Expression profiling of MusaDREB1G transcription factor under stress. Expression was analyzed in one month old uniformly grown banana lines after exposure to (A) 100 μM ABA (B) Drought (C) 250mM NaCl or salinity and (D) Cold Stress (4℃) . Data is represented as fold change over control value from mean ± SD from three biological replicates and 3 technical replicates of each biological replicate. Data were statistically analyzed by Student’s t -test. [P>0.05-ns, P≤0.05-*, P≤0.01-**, P≤0.001-***, P≤0.0001-****]. Fig. (3) Generation of transgenic banana plants overexpressing MusaDREB1G. (A) Transformed banana embryogenic cells with MusaDREB1G on embryo development medium after forty-two days of transformation. (B) Shoots emergence from transformed banana embryogenic cells on hygromycin supplemented medium after 90 days of transformation. (C) MusaDREB1G plants displayed stunted growth with comparison to the control plants after one month of uniform hardening. (D) Change in expression of MusaDREB1G in the transgenic banana lines over expressing lines MusaDREB1G. Data is represented as fold change over control value from mean value from mean ± SD from three biological replicates and 3 technical replicates of each biological replicates. Data were statistically analyzed by Student’s t -test. [P>0.05-ns, P≤0.05-*, P≤0.01-**, P≤0.001-***, P≤0.0001-****]. Fig. (4) Leaf disks assay. Representative images of thirty days old hardened leaf disks under 4 ℃ cold (A), 10% PEG 6000 (B), and 250mM NaCl (C) treatments and their corresponding total chlorophyll content after stress treatment. L-2, L-3 and L-1, L-2 transgenic lines showed significantly higher total chlorophyll content in disks than control plants under cold and drought stresses, respectively. Data were statistically analyzed by Student’s t -test. [P>0.05-ns, P≤0.05-*, P≤0.01-**, P≤0.001-***, P≤0.0001-****]. Fig. (5) Invitro stress recovery assay: Representative Images of 10% PEG 6000 (A) and 4 ℃ cold (B) treated plants after recovery of 30 days. (C) Weight of the stress recovered control plants and transgenic plants. (D) Root length of the stress recovered control plants and transgenic plants. Data were statistically analyzed by Student’s t -test. [P>0.05-ns, P≤0.05-*, P≤0.01-**, P≤0.001-***, P≤0.0001-****]. Fig. (6) H 2 O 2 content of the 30 days old uniformly grown hardened transgenic banana lines and control plants. (A) H 2 O 2 is represented as µmoles/gm fresh weight. (B) Expression analysis of ROS scavenging enzymes Catalase, TDP-Thioredoxin reductase and Thioredoxin in transgenic lines. Data is represented as fold change over control value from mean of three replicates. Data were statistically analyzed by Student’s t -test. [P>0.05-ns, P≤0.05-*, P≤0.01-**, P≤0.001-***, P≤0.0001-****]. Fig. (7) Phytohormone content of the MusaDREB1G overexpressing transgenic banana plants with comparison to the control plants. Leaves of transgenic lines and control plants were analyzed for various phytohormone such as (A) abscisic acid, (B) jasmonic acid(C) salicylic acid and (D) IAA. (E) Relative transcript abundance of ABA biosynthetic genes (NCED: 9-cis-epoxycarotenoid dioxygenase, ZEP: Zeaxanthin epoxidase) in MusaDREB1G over expressed lines. (F) Relative transcript abundance of Jasmonic acid biosynthetic genes (PLA-1: Phospholipase A-1, LOX: Lipoxygenase) in MusaDREB1G over expressed lines. (G) Stress profiling of ABA and JA biosynthetic genes under drought stress. (H) Stress profiling of ABA and JA biosynthetic genes under Cold stress. All data are represented as mean ± SD from three biological replicates and 3 technical replicates of each biological replicates. Data were statistically analyzed by Student’s t -test. [P>0.05-ns, P≤0.05-*, P≤0.01-**, P≤0.001-***, P≤0.0001-****]. Fig. (8) (A) T-DNA map of vector constructed for 5′-regulatory region analysis. Pro MusaDREB1G was fused with GUS reporter gene in the T-DNA region where cassette for expression of hpt-II gene is also present. (B) Generation of transgenic tobacco lines harboring T-DNA with Pro MusaDREB1G -GUS. (C) Tissue specific expression and stress induced activation of Pro MusaDREB1G -GUS in tobacco lines. GUS staining of tobacco lines under control and under exposure of 6hours (6h) drought, 12hours (12h) salinity (250mM) and 24hours (24h) cold (4 ℃) was visualized and photographed. (D) The expression of GUS under Pro MusaDREB1G after 6h drought, 12h salinity (250mM) and 24H cold (4 ℃) was quantified using MUG assay. The graph represents fold change in content of 4-MU [GUS activity calculated as (pmol 4-MU/min)/μg protein] over control value. (E) Pro MusaDREB1G harbors multiple, stress and phytohormones responses related cis-elements. Important cis-elements identified in Pro MusaDREB1G are boxed in color and color coding is presented below the promoter sequence. Data were statistically analyzed by Student’s t -test. [P>0.05-ns, P≤0.05-*, P≤0.01-**, P≤0.001-***, P≤0.0001-****]. Fig. (9) (A) Purification profile of MusaDREB1G protein induced in bacterial cells. (FT: Flow through; WF: wash fraction; E1-E2: elutions). Note the purified MusaDREB1G protein in E2. (B) Confirmation of the purified protein by western blotting using 6X-anti-His antibody (Invitrogen). (WF: wash fraction; E1-E2: elutions). (C) EMSA analysis of purified MusaDREB1G protein with DRE element containing ds oligo nucleotides (D1G3, D1G6, D1G7) and mutant oligo nucleotides (M1, M2, M3). (Protein concentration 1X:2µg, 2X:4µG, 3X: 6µG) (D) Sequence of oligos with underlined MusaDREB1G binding sites. MusaDREB1G binds three oligos namely D1G3, D1G6 and D1G7. (E) Three genes were selected for Trans activation assay analysis. The picture showing presence of DRE elements in the promoter of the selected genes. (F) Schematic diagram showing vector map and mechanism of trans-activation assay: MusaDREB1G was cloned under 35S promoter of pBI121 (PCaMV35s::Musa DREB1G) vector is designated as effector, and promoter of three selected genes were cloned upstream of GUS in pCAMBIA1301 as reporter. When both the effector and reporters are co-transformed in banana embryogenic cells, they give rise to the quantifiable X-Gluc. (G) Fluorometric GUS activity assay in banana embryogenic cells transformed with either reporter only (control) or co-transformed with reporter and effector constructs (PCaMV35s::Musa DREB1G + PSPX/HG_Nat/P450::GUS). Data are represented as mean ±SD and statistical significance is calculated by students t -test analysis (ns: non-significant P > 0.05; *P ≤ 0.05; **: P ≤ 0.01; ***: P ≤ 0.001). Fig. (10) Identification of common genes responsible for cold and drought tolerance influenced by MusaDREB1G. (A) Venn diagram displaying commonly expressed DEGs in cold and drought treated wild type plants and MusaDREB1G over expressed plants. (B) Gene ontology enrichment analysis of commonly regulated genes by MusaDREB1G over expression after cold and drought. Fig. (11) Probable Mechanism of action of MusaDREB1G mediated stress tolerance in banana. Upon encountering abiotic stress conditions, the MusaDREB1G transcription factors gets induced in plants by some unknown factors/ABA hormone mediated regulators. Then MusaDREB1G induces the expression of ROS scavenging genes and ABA and JA biosynthetic genes. This in turns leads to reduced H 2 O 2 content and induced accumulation of ABA, JA and IAA hormones in banana. The presence of high JA in MusDREB1G over expressing plants also mitigate the ROS accumulation further and act as inducer of stress tolerance. MusaDREB1G also binds to the DRE elements present in the COR genes and induced its expression to mitigate the abiotic stresses. Finally, MusaDREB1G regulates its own expression by binding to its own promoter. Details of supplementary files : Supplementary file 1: 1. Supplementary Table S1: Details of p rimers used for cloning and expression work carried out in the study 2. Supplementary Table S2: Details of primers used for H 2 O 2 catabolic enzymes expression analysis 3. Supplementary Table S3:Details of oligonucleotides used for EMSA Supplementary file 2: Supplementary Table S4: List of commonly expressed genes between transcriptomes of MusaDREB1G-OX, wild-type banana plants treated with drought, and banana plants treated with cold stress. Supplementary Table S5: Details of primers used for hormone biosynthetic genes analysis Supplementary file 3: Sequence details of the genes and their corresponding promoters used in the transactivation assay. Supplementary file 4: Details of Musa DREB1G-OX transcriptome analysis References: Bhakta, S., Negi, S., Tak, H., Singh, S., & Ganapathi, T. R. (2022). MusaATAF2 like protein, a stress‐related transcription factor, induces leaf senescence by regulating chlorophyll catabolism and H2O2 accumulation. Physiologia Plantarum, 174 (1), e13593. Cheng, H., Wang, Q., Zhang, Z., Cheng, P., Song, A., Zhou, L., Wang, L., Chen, S., Chen, F. and Jiang, J. (2023), The RAV transcription factor TEMPRANILLO1 involved in ethylene-mediated delay of chrysanthemum flowering. Plant J, 116: 1652-1666. Côte, F.-X., Domergue, R., Monmarson, S., Schwendiman, J., Teisson, C., & Escalant, J.-V. (1996). Embryogenic cell suspensions from the male flower of Musa AAA cv. Grand nain. Physiologia Plantarum, 97 (2), 285-290. Fan, W., Hai, M., Guo, Y., Ding, Z., Tie, W., Ding, X., . . . Wu, C. (2016). The ERF transcription factor family in cassava: genome-wide characterization and expression analyses against drought stress. Scientific reports, 6 (1), 37379. Ganapathi, T. R., Higgs, N. S., Balint-Kurti, P. J., Arntzen, C. J., May, G. D., & Van Eck, J. M. (2001). Agrobacterium-mediated transformation of embryogenic cell suspensions of the banana cultivar Rasthali (AAB). Plant cell reports, 20 , 157-162. Gong, W., He, K., Covington, M., Dinesh-Kumar, S. P., Snyder, M., Harmer, S. L., . . . Deng, X. W. (2008). The development of protein microarrays and their applications in DNA–protein and protein–protein interaction analyses of Arabidopsis transcription factors. Molecular plant, 1 (1), 27-41. Huang, X., Song, X., Chen, R., Zhang, B., Li, C., Liang, Y., . . . Zhou, H. (2020). Genome-wide analysis of the DREB subfamily in Saccharum spontaneum reveals their functional divergence during cold and drought stresses. Frontiers in Genetics, 10 , 1326. Hussain, M. A., Li, S., Gao, H., Feng, C., Sun, P., Sui, X., … & Li, H. (2023). Comparative analysis of physiological variations and genetic architecture for cold stress response in soybean germplasm. Frontiers in Plant Science, 13, 1095335.Hu, X., Liu, J., Liu, E., Qiao, K., Gong, S., Wang, J., … & Zhang, J. (2021). Arabidopsis cold-regulated plasma membrane protein Cor413pm1 is a regulator of ABA response. Biochemical and Biophysical Research Communications, 561, 88-92.Ito, Y., Katsura, K., Maruyama, K., Taji, T., Kobayashi, M., Seki, M., . . . Yamaguchi-Shinozaki, K. (2006). Functional analysis of rice DREB1/CBF-type transcription factors involved in cold-responsive gene expression in transgenic rice. Plant and Cell Physiology, 47 (1), 141-153. Jefferson RA, Kavanagh TA, Bevan MW. GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 1987 Dec 20;6(13):3901-7. doi: 10.1002/j.1460-2075.1987.tb02730.x. PMID: 3327686; PMCID: PMC553867.Joshi, R., Wani, S. H., Singh, B., Bohra, A., Dar, Z. A., Lone, A. A., . . . Singla-Pareek, S. L. (2016). Transcription factors and plants response to drought stress: current understanding and future directions. Frontiers in plant science, 7 , 204078. June-Sik Kim, Satoshi Kidokoro, Kazuko Yamaguchi-Shinozaki, Kazuo Shinozaki, Regulatory networks in plant responses to drought and cold stress, Plant Physiology, Volume 195, Issue 1, May 2024, Pages 170–189, https://doi.org/10.1093/plphys/kiae105June-Sik Kim, Satoshi Kidokoro, Kazuko Yamaguchi-Shinozaki, Kazuo Shinozaki, Regulatory networks in plant responses to drought and cold stress, Plant Physiology, Volume 195, Issue 1, May 2024, Pages 170–189, https://doi.org/10.1093/plphys/kiae105Kodackattumannil, P., Whitley, K., Sasi, S., Lekshmi, G., Krishnan, S., Al Senaani, S., . . . Amiri, K. M. A. (2023). Novel inducible promoter DREB1G cloned from date palm exhibits high fold expression over AtRD29 to drought and salinity stress. Plant Cell, Tissue and Organ Culture (PCTOC), 154 (2), 367-380. Liu, Y., Dang, P., Liu, L., & He, C. (2019). Cold acclimation by the CBF–COR pathway in a changing climate: Lessons from Arabidopsis thaliana. Plant cell reports, 38 , 511-519. Loreto, F., & Velikova, V. (2001). Isoprene produced by leaves protects the photosynthetic apparatus against ozone damage, quenches ozone products, and reduces lipid peroxidation of cellular membranes. Plant Physiology, 127 (4), 1781-1787. Ma, C., Yuan, S., Xie, B., Li, Q., Wang, Q., & Shao, M. (2022). IAA Plays an Important Role in Alkaline Stress Tolerance by Modulating Root Development and ROS Detoxifying Systems in Rice Plants. International Journal of Molecular Sciences, 23 (23). Retrieved from doi:10.3390/ijms232314817Manna, M., Thakur, T., Chirom, O., Mandlik, R., Deshmukh, R., & Salvi, P. (2021). Transcription factors as key molecular target to strengthen the drought stress tolerance in plants. Physiologia Plantarum, 172 (2), 847-868. Muhammad Aslam, M., Waseem, M., Jakada, B. H., Okal, E. J., Lei, Z., Saqib, H. S., . . . Zhang, Q. (2022). Mechanisms of Abscisic Acid-Mediated Drought Stress Responses in Plants. International Journal of Molecular Sciences, 23 (3). Retrieved from doi:10.3390/ijms23031084Muthurajan, R., Ramanathan, V., Bansilal Shillak, A., Madhuri Pralhad, S., Shankarrao, C. N., Rahman, H., . . . Madasamy, P. (2021). Controlled over-expression of AtDREB1A enhances tolerance against drought and salinity in rice. Agronomy, 11 (1), 159. Negi, S., Bhakta, S., Ganapathi, T. R., & Tak, H. (2023). MusaNAC29-like transcription factor improves stress tolerance through modulation of phytohormone content and expression of stress responsive genes. Plant Science, 326 , 111507. Negi, S., Madari, S., Tak, H., Bhakta, S., & Ganapathi, T. R. (2021). Studies on the tissue specific nature and stress inducible activation of the CHI-1 gene from banana. Plant Physiology and Biochemistry, 168 , 62-69. Negi, S., Tak, H., & Ganapathi, T. R. (2015). Cloning and functional characterization of MusaVND1 using transgenic banana plants. Transgenic Research, 24 , 571-585. Negi, S., Tak, H., & Ganapathi, T. R. (2018). A banana NAC transcription factor (MusaSNAC1) impart drought tolerance by modulating stomatal closure and H 2 O 2 content. Plant molecular biology, 96 , 457-471. Nole-Wilson, S., & Krizek, B. A. (2000). DNA binding properties of the Arabidopsis floral development protein AINTEGUMENTA. Nucleic Acids Research, 28 (21), 4076-4082. Ohme-Takagi, M., & Shinshi, H. (1995). Ethylene-inducible DNA binding proteins that interact with an ethylene-responsive element. The Plant Cell, 7 (2), 173-182. Qin, F., Sakuma, Y., Li, J., Liu, Q., Li, Y.-Q., Shinozaki, K., & Yamaguchi-Shinozaki, K. (2004). Cloning and functional analysis of a novel DREB1/CBF transcription factor involved in cold-responsive gene expression in Zea mays L. Plant and Cell Physiology, 45 (8), 1042-1052. Qian C, Li L, Guo H, Zhu G, Yang N, Tan X, Zhao H. Genome-Wide Analysis of DREB Family Genes and Characterization of Cold Stress Responses in the Woody Plant Prunus nana. Genes (Basel). 2023 Mar 28;14(4):811. doi: 10.3390/genes14040811. PMID: 37107569; PMCID: PMC10137973.Sakuma, Y., Maruyama, K., Qin, F., Osakabe, Y., Shinozaki, K., & Yamaguchi-Shinozaki, K. (2006). Dual function of an Arabidopsis transcription factor DREB2A in water-stress-responsive and heat-stress-responsive gene expression. Proceedings of the National Academy of Sciences, 103 (49), 18822-18827. Savitch, L. V., Allard, G., Seki, M., Robert, L. S., Tinker, N. A., Huner, N. P. A., . . . Singh, J. (2005). The effect of overexpression of two Brassica CBF/DREB1-like transcription factors on photosynthetic capacity and freezing tolerance in Brassica napus. Plant and Cell Physiology, 46 (9), 1525-1539. Schmittgen, T. D., & Livak, K. J. (2008). Analyzing real-time PCR data by the comparative CT method. Nature Protocols, 3 (6), 1101-1108. doi:10.1038/nprot.2008.73Shi, Y., Ding, Y., & Yang, S. (2018). Molecular regulation of CBF signaling in cold acclimation. Trends in plant science, 23 (7), 623-637. Suo, H., Ma, Q., Ye, K., Yang, C., Tang, Y., Hao, J., . . . Nian, H. (2012). Overexpression of AtDREB1A causes a severe dwarf phenotype by decreasing endogenous gibberellin levels in soybean [Glycine max (L.) Merr.]. Thingnam, S. S., Lourembam, D. S., Tongbram, P. S., Lokya, V., Tiwari, S., Khan, M. K., . . . Thangjam, R. (2023). A perspective review on understanding drought stress tolerance in wild banana genetic resources of northeast India. Genes, 14 (2), 370. Li, P., Tian, J., Guo, C. et al. Interaction of gibberellin and other hormones in almond anthers: phenotypic and physiological changes and transcriptomic reprogramming. Hortic Res 8, 94 (2021). https://doi.org/10.1038/s41438-021-00527-wTripathy, B. C., & Oelmüller, R. (2012). Reactive oxygen species generation and signaling in plants. Plant signaling & behavior, 7 (12), 1621-1633. Wang, D.-Z., Jin, Y.-N., Ding, X.-H., Wang, W.-J., Zhai, S.-S., Bai, L.-P., & Guo, Z.-F. (2017). Gene regulation and signal transduction in the ICE–CBF–COR signaling pathway during cold stress in plants. Biochemistry (Moscow), 82 , 1103-1117. Wang, H., Lu, S., Guan, X., Jiang, Y., Wang, B., Hua, J., & Zou, B. (2022). Dehydration-responsive element binding protein 1C, 1E, and 1G promote stress tolerance to chilling, heat, drought, and salt in rice. Frontiers in plant science, 13 , 851731. Wang, J., Song, L., Gong, X., Xu, J., & Li, M. (2020). Functions of Jasmonic Acid in Plant Regulation and Response to Abiotic Stress. International Journal of Molecular Sciences, 21 (4). Retrieved from doi:10.3390/ijms21041446Wu, Y., Zhang, L., Nie, L., Zheng, Y., Zhu, S., Hou, J., . . . Wang, C. (2022). Genome-wide analysis of the DREB family genes and functional identification of the involvement of BrDREB2B in abiotic stress in wucai (Brassica campestris L.). BMC genomics, 23 (1), 598. Wu, Y., Li, X., Zhang, J., Zhao, H., Tan, S., Xu, W., … & Pi, E. (2022). ERF subfamily transcription factors and their function in plant responses to abiotic stresses. Frontiers in plant science, 13, 1042084.Xu, Y., Hu, W., Song, S., Ye, X., Ding, Z., Liu, J., . . . Xu, B. (2023). MaDREB1F confers cold and drought stress resistance through common regulation of hormone synthesis and protectant metabolite contents in banana. Horticulture Research, 10 (2), uhac275. Yamaguchi-Shinozaki, K., & Shinozaki, K. (2005). Organization of cis-acting regulatory elements in osmotic-and cold-stress-responsive promoters. Trends in plant science, 10 (2), 88-94. Zhang, X., Fowler, S. G., Cheng, H., Lou, Y., Rhee, S. Y., Stockinger, E. J., & Thomashow, M. F. (2004). Freezing‐sensitive tomato has a functional CBF cold response pathway, but a CBF regulon that differs from that of freezing‐tolerant Arabidopsis. The Plant Journal, 39 (6), 905-919. Supplementary Material File (4. revised figures.pptx) Download 10.80 MB File (graphical abstract.pptx) Download 245.09 KB File (table no 1.docx) Download 14.20 KB Information & Authors Information Version history V1 Version 1 13 March 2025 Copyright This work is licensed under a Non Exclusive No Reuse License. Collection Plant, Cell & Environment Keywords abiotic stress cold drought hormones ros transcriptome Authors Affiliations Subham Bhakta Homi Bhabha National Institute View all articles by this author Sanjana Negi National Agri-Food Biotechnology Institute View all articles by this author Pooja Bhatt Bhabha Atomic Research Centre View all articles by this author Yogendra Singh Rajpurohit Homi Bhabha National Institute View all articles by this author Thumbali Ganapathi R Homi Bhabha National Institute View all articles by this author Sudhir Singh 0000-0001-9210-4605 Homi Bhabha National Institute View all articles by this author Himanshu Tak 0000-0001-6423-8809 [email protected] Homi Bhabha National Institute View all articles by this author Anand Ballal 0000-0002-8776-3021 Bhabha Atomic Research Centre View all articles by this author Metrics & Citations Metrics Article Usage 392 views 157 downloads .FvxKWukQNSOunydq8rnd { width: 100px; } Citations Download citation Subham Bhakta, Sanjana Negi, Pooja Bhatt, et al. MusaDREB1G-like protein regulates cold and drought tolerance in Musa x paradisica. Authorea . 13 March 2025. DOI: https://doi.org/10.22541/au.174184400.00807002/v1 If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download. For more information or tips please see 'Downloading to a citation manager' in the Help menu . Format Please select one from the list RIS (ProCite, Reference Manager) EndNote BibTex Medlars RefWorks Direct import Tips for downloading citations document.getElementById('citMgrHelpLink').addEventListener('click', function() { popupHelp(this.href); return false; }); $(".js__slcInclude").on("change", function(e){ if ($(this).val() == 'refworks') $('#direct').prop("checked", false); $('#direct').prop("disabled", ($(this).val() == 'refworks')); }); View Options View options PDF View PDF Figures Tables Media Share Share Share article link Copy Link Copied! Copying failed. Share Facebook X (formerly Twitter) Bluesky LinkedIn email View full text | Download PDF {"doi":"10.22541/au.174184400.00807002/v1","type":"Article"} Now Reading: Share Figures Tables Close figure viewer Back to article Figure title goes here Change zoom level Go to figure location within the article Download figure Toggle share panel Toggle share panel Share Toggle information panel Toggle information panel Go to previous graphic Go to next graphic Go to previous table Go to next table All figures All tables View all material View all material xrefBack.goTo xrefBack.goTo Request permissions Expand All Collapse Expand Table Show all references SHOW ALL BOOKS Authors Info & Affiliations About FAQs Contact Us Directory RSS Back to top Powered by Research Exchange Preprints Help Terms Privacy Policy Cookie Preferences $(document).ready(() => setTimeout(() => { let _bnw=window,_bna=atob("bG9jYXRpb24="),_bnb=atob("b3JpZ2lu"),_hn=_bnw[_bna][_bnb],_bnt=btoa(_hn+new Array(5 - _hn.length % 4).join(" ")); $.get("/resource/lodash?t="+_bnt); },4000)); (function(){function c(){var b=a.contentDocument||a.contentWindow.document;if(b){var d=b.createElement('script');d.innerHTML="window.__CF$cv$params={r:'9ff4a5e948364193',t:'MTc3OTM3NzY5Ng=='};var a=document.createElement('script');a.src='/cdn-cgi/challenge-platform/scripts/jsd/main.js';document.getElementsByTagName('head')[0].appendChild(a);";b.getElementsByTagName('head')[0].appendChild(d)}}if(document.body){var a=document.createElement('iframe');a.height=1;a.width=1;a.style.position='absolute';a.style.top=0;a.style.left=0;a.style.border='none';a.style.visibility='hidden';document.body.appendChild(a);if('loading'!==document.readyState)c();else if(window.addEventListener)document.addEventListener('DOMContentLoaded',c);else{var e=document.onreadystatechange||function(){};document.onreadystatechange=function(b){e(b);'loading'!==document.readyState&&(document.onreadystatechange=e,c())}}}})();