Impact of α-Ketoglutarate Treatment on Enhancing Vase Life of Chrysanthemum by Modulating the Isoprenoid Pathway and Increasing Antioxidant Content

Impact of α-Ketoglutarate Treatment on Enhancing Vase Life of Chrysanthemum by Modulating the Isoprenoid Pathway and Increasing Antioxidant Content | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Impact of α-Ketoglutarate Treatment on Enhancing Vase Life of Chrysanthemum by Modulating the Isoprenoid Pathway and Increasing Antioxidant Content Parviz Malekzadeh, Soheila Samadi, Elham Ghasemifar This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8748436/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 12 You are reading this latest preprint version Abstract Chrysanthemum is a globally valued cut flower with substantial commercial importance; however, its postharvest longevity remains limited. This study investigates the application of α-ketoglutarate (AKG), a cost-effective and environmentally friendly compound, for extending the vase life of cut chrysanthemum flowers. The potential of AKG to enhance vase life was systematically evaluated in this research. The effects of different AKG concentrations (0–5 mM) on vase performance, physiological traits, biochemical composition, and gene expression were examined. AKG improved water balance and water uptake, thereby enhancing flower hydration. It increased the contents of glutathione, ascorbic acid, total phenolics, and flavonoids, and enhanced the activities of catalase (CAT) and superoxide dismutase (SOD). In addition, AKG effectively inhibited the accumulation of reactive oxygen species (ROS) and reduced malondialdehyde (MDA) levels, electrolyte leakage (EL), and lipoxygenase (LOX) activity. AKG also suppressed ethylene (ETH) production by downregulating the activities of 1-aminocyclopropane-1-carboxylic acid synthase (ACS) and oxidase (ACO), as well as reducing the expression of the CmACS and CmACO genes. Collectively, these findings demonstrate that AKG effectively prolongs vase life and represents a sustainable and eco-friendly strategy for enhancing the postharvest quality of cut chrysanthemums. Biological sciences/Biochemistry Biological sciences/Plant sciences Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 1. Introduction Chrysanthemum ( Chrysanthemum morifolium Ramat.), belonging to the Asteraceae family, stands as one of the most economically significant floricultural crops worldwide, ranking second only to roses in the global cut flower market 1,2 . Despite its immense aesthetic diversity and high commercial demand, the postharvest longevity of chrysanthemum is frequently compromised by rapid physiological decline, characterized by leaf yellowing and petal senescence. These degradative processes, often triggered by oxidative stress and hormonal imbalances, represent a major bottleneck in the long-distance transportation and marketability of this species. Consequently, developing innovative strategies to prolong vase life and maintain floral quality remains a pivotal objective in postharvest physiological research 3,4 . Nitrogen (N) metabolism represents a vital biochemical process that plays a key role in regulating growth physiology and enhancing the postharvest resilience of cut chrysanthemum flowers ( Chrysanthemum morifolium ) against environmental stresses 5 . Precise regulation of this cycle, in addition to preserving aesthetic characteristics, increases cellular stability through the synthesis of protective osmolytes such as proline—a primary derivative of glutamate. Given that the uncontrolled accumulation of ammonium ions (NH 4 + ) following the detachment of the flower from the mother plant leads to severe cytotoxicity and accelerates tissue senescence, glutamate biosynthesis through effective ammonium uptake and assimilation gains twofold importance 6,7 . In this regard, the glutamine synthetase/glutamate dehydrogenase (GS/GDH) enzymatic system acts as the primary pathway for modulating ammonium concentrations and catalyzing glutamate synthesis, thereby preventing cellular degradation under abiotic stress 8 . Beyond its nutritional role, optimal nitrogen supply directly promotes the plant's antioxidant capacity by reinforcing the reserves of soluble proteins and glycine betaine, while preventing premature wilting by maintaining osmotic potential. Ultimately, the enhancement of nitrogen metabolic status, functioning similarly to synthetic osmo-protectants, ensures the stability of cell membranes and significantly extends the vase life of chrysanthemums 9 . This sequence of reactions underscores the significance of replacing toxic pathways with beneficial compounds to delay physiological senescence; thus, nitrogen acts beyond a mere nutrient, serving as a protective agent against oxidative processes and a key factor in floral longevity in the vase environment 3,10 . Ethylene is synthesized in plants via the methionine pathway, in which two key enzymes, ACC synthase (ACS) and ACC oxidase (ACO), control the rate-determining steps of this process. ACS catalyzes the conversion of S-adenosyl-L-methionine to ACC and functions as the rate-limiting step, whereas ACO converts ACC to ethylene in the presence of oxygen. Regulation of the expression and activity of these two enzymes plays a fundamental role in controlling ethylene production and, consequently, in regulating senescence and postharvest longevity of cut flowers 11-13 . The objective of this study was to investigate the role of α-ketoglutarate (AKG) as a central metabolic regulator in delaying postharvest senescence of cut chrysanthemum flowers. This research specifically focused on evaluating the effects of AKG on maintaining cellular membrane stability, reducing lipid peroxidation, inhibiting phospholipid-degrading enzymes (LOX, PLC, and PLD), enhancing both enzymatic and non-enzymatic antioxidant defense systems, and regulating the expression of key genes involved in ethylene biosynthesis (CmACS1 and CmACO1). The findings of this study, for the first time, provide integrated evidence for the role of AKG in the simultaneous suppression of oxidative stress and molecular regulation of the ethylene pathway, introducing AKG as a novel and effective compound for extending the vase life of cut flowers. 2. Material and Methods 2.1. Plant materials and treatments On October 21, 2025, between 9:00 and 11:00 a.m., flowering shoots of chrysanthemum at the blooming stage were harvested from a commercial greenhouse in Mahallat County, Markazi Province, Iran. Immediately after harvest, the flowers were placed in low-temperature foam boxes and transported to the laboratory as quickly as possible. The cut flowers were then rehydrated in distilled water for 3 h. Subsequently, uniform stems were selected and recut under water at a 45° angle to a length of approximately 35 cm, leaving four compound leaves on each stem. The experimental environmental conditions were maintained as follows: a 12-h daily photoperiod, room temperature of 25 ± 5 °C, and relative humidity of 45–60%. α-Ketoglutarate was obtained from the Postharvest Research Laboratory of Qom University (Merck, Germany). The experimental design included distilled water as the negative control (CK1), while α-ketoglutarate at a concentration of 5 mmol L⁻¹ was added to the basic holding solution as the treatment. Petal sampling and morphological measurements were conducted every 24 h starting from the onset of flowering. Collected samples were immediately frozen in liquid nitrogen and stored at −80 °C for subsequent biochemical analyses. For all biochemical assessments—including non-enzymatic antioxidants (total phenolics, flavonoids, glutathione, and ascorbic acid), antioxidant enzymes (SOD and CAT), lipoxygenase (LOX) activity, ETH-associated enzymes (ACS and ACO), and stress indicators (MDA, EL, H₂O₂, O₂⁻, and ETH)—three independent biological replicates were conducted. Each biological replicate consisted of three technical repeats to ensure both methodological reproducibility and data reliability. 2.2. Determination of MDA, H 2 O 2 and Electrolyte leakage content To evaluate physiological stress markers, electrolyte leakage (EL) was determined according to the procedure of Malekzadeh, et al. 14 . The Malonic dialdehyde (MDA) content was analyzed by homogenizing 1 g of flower sample in 25 mL of 5% (w/v) trichloroacetic acid, with results reported as μmol kg⁻¹ FW according the methods described by Ali, et al. 10 . For hydrogen peroxide (H 2 O 2 ) quantification, the titanium (IV) technique was employed, involving the homogenization of 1 g of frozen tissue in 5 mL of ice-cold acetone 14 . 2.3. LOX activity The activity of Lipoxygenase (LOX) was determined following the procedure established by Malekzadeh, et al. 15 . A reaction substrate was prepared by incorporating 40 µL of linoleic acid and 200 µL of Tween 20 into 40 mL of 0.1 M sodium phosphate buffer at pH 7.0. To initiate the assay, 0.2 mL of the enzyme extract was mixed with 1 mL of this prepared substrate in a cuvette. The absorbance was monitored at 234 nm and 25°C. A single unit of LOX activity was defined as the quantity of enzyme required to induce an absorbance increase of 0.01 per minute 14 . 2.4. Enzymatic Isolation and Preparation To obtain the crude enzyme extract, 0.5 g of petal samples were pulverized into a fine consistency under cryogenic conditions using liquid nitrogen and a mortar. This powder was then disrupted in 2 mL of an 8.0 pH potassium phosphate buffer (50 mM). To ensure enzyme stability, the medium was supplemented with 10% (w/v) polyvinylpyrrolidone (PVP), 0.1 mM EDTA, and 1 mM dithiothreitol (DTT). The resulting mixture was subjected to centrifugation at 10,000 times g for 30 minutes at a constant temperature of 4°C. The clarified supernatant was subsequently harvested for biochemical quantification 7 . 2.4.1. Superoxide Dismutase (SOD) Quantification The capacity of SOD to hinder the photochemical reduction of nitroblue tetrazolium (NBT) was utilized to measure its activity 14 . A reaction medium was prepared in a 50 mM phosphate buffer (pH 7.8), containing 13 mM L-methionine, 25 mM NBT, 0.1 mM EDTA, 50 mM sodium carbonate, and 2 mM riboflavin. To this, 0.1 mL of the supernatant was added. The samples were then exposed to 15 minutes of illumination from two 15 W fluorescent sources. A blank sample (enzyme-free) was used to determine the baseline for maximum color development. The reaction was halted by extinguishing the lights and placing the tubes in total darkness. Absorbance was recorded at 560 nm. One SOD unit represents the enzyme quantity necessary to achieve 50% inhibition of NBT reduction compared to the control. 2.4.2. Catalase (CAT) Assessment The degradation rate of hydrogen peroxide (H 2 O 2 ) was monitored at 240 nm to evaluate CAT activity. The 1 mL assay system consisted of 50 mM potassium phosphate buffer (pH 7.0) and 15 mM H 2 O 2 . The enzymatic process was triggered by introducing 50 µL of the isolated extract. CAT activity was calculated based on the micromoles of H 2 O 2 decomposed per minute per milligram of protein 16 . 2.5. Analysis of Ethylene Biosynthesis and Its Regulatory Components 2.5.1. Measurement of Ethylene Levels and Activities of ACS and ACO Enzymes The quantification of ethylene (ETH) biosynthesis-related parameters was carried out using commercially available ELISA kits, following the manufacturer’s instructions precisely. The analyzed parameters included the activities of 1-aminocyclopropane-1-carboxylic acid synthase (ACS; Kit No. MM-33691O2) and 1-aminocyclopropane-1-carboxylic acid oxidase (ACO; Kit No. MM-2135), as well as ETH concentration (Kit No. MM-0888O1). All measurements were determined based on calibration curves generated for each assay. ACS and ACO enzymatic activities were expressed in μmol s⁻¹ L⁻¹, whereas ETH content was reported as μg kg⁻¹ of fresh tissue. 2.5.2. Primer design Specific primers for ethylene biosynthesis genes ( CmACS1 and CmACO1 ) and the internal control gene (Cm-EF1α) were designed based on the sequences available in the NCBI database. The primer sequences were validated for their specificity and efficiency using melting curve analysis (Table 1). Table1. Primer Sequences Used for Quantitative Real-Time PCR Gene Name Forward Primer (5' → 3') Reverse Primer (5' → 3') CmACS1 TTCAGGGACTTCGTTTCGAG GCTTCTTGAGTTGCTCCGTG CmACO1 TGAAGTTTCCAGTCATCGACC CCGTAGTTTCCGAACTGGTC Cm-EF1α TGGTTGTTGCTGTTAAGCCA CAAGAGCCTCAAGCAAGACC 2.1. RNA Extraction and cDNA Synthesis Total RNA was extracted from chrysanthemum petals (control and 5 mM AKG -treated) at different time points (Day 0, 2, 4, 6, 8 and 10) using the RNX-Plus reagent following the manufacturer’s instructions. To eliminate potential genomic DNA contamination, the extracted RNA was treated with DNase I (RNase-free). The concentration and purity of the RNA samples were determined using a NanoDrop spectrophotometer (ND-1000) at absorbance ratios of A260/A280 and A260/A230. Only RNA samples with an A260/A280 ratio between 1.8 and 2.0 were used for further analysis. Subsequently, first-strand cDNA was synthesized from 1 mug of total RNA using a Reverse Transcription Kit (Thermo Fisher Scientific) with oligo(dT) primers according to the provided protocol. 2.2. Quantitative Real-Time PCR (RT-qPCR) Analysis The expression profiles of ethylene biosynthesis genes, including CmACS1 and CmACO1 , were analyzed via quantitative real-time PCR (RT-qPCR). The reactions were performed on a Real-Time PCR System (Bio-Rad CFX96) using SYBR Green Master Mix. The total reaction volume was 20 muL, containing 10 muL of SYBR Green Mix, 1 muL of cDNA template, 0.5 muL of each forward and reverse primer (10 muM), and 8 muL of nuclease-free water. The thermal cycling conditions were as follows: initial denaturation at 95°C for 3 min, followed by 40 cycles of 95°C for 15 s, and 60°C for 30 s. A melting curve analysis (65°C to 95°C) was conducted at the end of each run to verify the specificity of the primers and the absence of primer dimers. The relative expression levels of the target genes were calculated using the 2-DeltaDelta Ct method, with Cm-EF1alpha as the internal reference gene for normalization. 2.8. Data Analysis and Statistics Data processing and statistical evaluations were carried out utilizing GraphPad Prism 8.0 software. The findings are reported as the mean values accompanied by their respective standard deviations (SD). To determine the influence of experimental treatments and duration of storage on the measured parameters, a two-way analysis of variance (ANOVA) was employed. Post-hoc comparisons were executed using Tukey’s multiple range test to identify specific differences between groups. In all analyses, a p-value of less than 0.05 was adopted as the threshold for defining statistical significance. 3. Results 3.1. Morphological Evaluation: Flower Fresh Weight and Diameter Fig. 1 shows the effect of postharvest treatment with alpha-ketoglutarate (AKG) at different concentrations (0 and 5 mM) on the external appearance of Chrysanthemum flowers over a 10-day vast life. In the control group (without AKG treatment), the flowers exhibited significant changes in their appearance over time and gradually wilted from day 6 onwards. In contrast, in the group treated with 5 mM AKG, the flowers maintained their appearance until day 10 and showed fewer changes. The results regarding the physical parameters of cut Chrysanthemums under the influence of alpha-Ketoglutarate (AKG) are presented in Fig. 2. As illustrated in Fig. 2A, the fresh weight of Chrysanthemum cut flowers in both groups exhibited an initial increase, reflecting the absorption of the vase solution during the first few days. In the control group, the fresh weight peaked on day 6 and subsequently underwent a sharp decline, reaching its minimum value of approximately 11 g by the end of the vase life (day 10). Conversely, flowers treated with 5 mM AKG maintained significantly higher fresh weight throughout the entire experimental period. The AKG-treated flowers reached a significantly superior peak of approximately 42 g on day 6. Even at the final stage (day 10), the fresh weight in the AKG group was roughly double that of the control group, indicating that AKG effectively preserves biomass and delays tissue dehydration. The flower diameter, showed a distinct contrast between treatments (Fig. 2B). The diameter of control flowers increased slowly and reached a plateau of approximately 116 mm by day 10. However, the exogenous application of AKG substantially promoted floral expansion from the very beginning of the treatment. The flower diameter in the AKG group reached its maximum value of 171 mm on day 8, which was significantly higher than the control at the same time point (approx. 104 mm). Although a slight decrease was observed in the treated group toward day 10, the flowers maintained a significantly larger and more aesthetically pleasing size compared to the untreated control. 3.2. Stem Bending and Vase Solution pH The mechanical stability and chemical environment of the vase solution are critical determinants of postharvest quality. As shown in Fig. 3A, control flowers exhibited a rapid increase in the bending percentage of the flower scape, reaching nearly 100% by day 10. In contrast, the exogenous application of AKG remarkably suppressed this disorder, maintaining the bending rate below 20% throughout the experiment. The significant difference between groups (p < 0.01) suggests that AKG strengthens the mechanical integrity of the vascular tissues and prevents early wilting. The pH of the vase solution in the control group showed a sharp alkaline shift, rising from 6.4 to over 8.5 by day 10 (Fig. 3B). However, AKG treatment effectively stabilized the solution pH at a more neutral level (approx. 7.4). Maintaining a lower pH is often associated with inhibited microbial proliferation and enhanced water conductance in the xylem. 3.3. Solution Uptake and Lipid Peroxidation (MDA Content) The rate of solution uptake gradually declined in all groups as senescence progressed (Fig. 4A). However, AKG -treated flowers maintained a significantly higher uptake rate compared to the control group from day 4 onwards (p < 0.05). By day 10, the water absorption in the AKG group remained notably superior, supporting the higher fresh weight and diameter observed in previous sections. As illustrated in Fig. 4B, MDA content, a key marker of lipid peroxidation, significantly increased in control flowers over the 10-d vase period. However, the exogenous application of 5 mM alpha-ketoglutarate effectively suppressed this increase. Specifically, at the late stages of senescence (6-10 d), alpha-ketoglutarate-treated flowers exhibited substantially lower MDA levels compared to the control, suggesting enhanced membrane integrity and reduced oxidative damage during postharvest life. 3.4. Enzymatic Antioxidant Defense and ROS Scavenging Activity The influence of exogenous 5 mM alpha-Ketoglutarate on the antioxidant machinery and reactive oxygen species (ROS) accumulation in cut flowers is illustrated in Figure 5. As shown in Fig. 5A, the activity of Catalase (CAT) in control flowers reached its maximum on day 2 and subsequently declined. In contrast, AKG treatment significantly upregulated CAT activity, which peaked on day 4 (approximately 158 U g⁻¹ protein) and remained significantly higher than the control throughout the remainder of the vase life (p < 0.01). This sustained high enzymatic activity suggests a robust defense against hydrogen peroxide-induced stress. The impact of enhanced CAT activity was directly reflected in the Hydrogen Peroxide (H 2 O 2 ) levels (Fig. 5B). While the control flowers exhibited a steady increase in H 2 O 2 accumulation, peaking on day 6 (~68µ mmol kg⁻¹), AKG -treated petals showed significantly lower concentrations from day 4 onwards. By day 8, the H 2 O 2 content in the AKG group was significantly reduced compared to the control group (p < 0.01), indicating efficient peroxide scavenging. Superoxide Dismutase (SOD) activity followed a similar trend as CAT (Fig. 5C). The exogenous application of AKG triggered a significant increase in SOD activity early in the vase period (day 2, ~118 Ug⁻¹ protein). Throughout the experimental timeframe, the AKG group maintained a significantly higher capacity for superoxide dismutation compared to the untreated control, which showed a continuous decline in enzyme activity after day 0. The accumulation of Superoxide anions (O 2 •- ) increased over time in both groups as a hallmark of senescence (Fig. 5D). However, AKG treatment remarkably inhibited this accumulation. While the control group reached its highest levels on day 10 (~815 µmol kg⁻¹), the AKG -treated flowers maintained significantly lower concentrations (~600 µmol kg⁻¹) during the same period. The significant difference between treatments (p < 0.05 and p < 0.01) highlights the role of AKG in mitigating oxidative damage at the cellular level. 3.5. Non-Enzymatic Antioxidant Defense System The influence of exogenous 5 mM AKG on the non-enzymatic antioxidant pool, specifically Glutathione (GSH) and Ascorbic acid (AsA), is presented in Figure 6. The maintenance of these metabolites is essential for regulating the cellular redox state and supporting the ascorbate-glutathione cycle. As illustrated in Fig. 6A, both groups showed an initial increase in GSH content during the first 6 days of the vase life. However, the magnitude of this increase was significantly greater in the AKG -treated flowers. As shown in Fig. 6A; Both groups started at a baseline of approximately 170 mg kg -1 . By day 4, AKG treatment induced a sharp rise to nearly 480 mg kg -1 , significantly outperforming the control group (270 mg kg -1 ). The GSH content in AKG -treated petals reached its maximum value of approximately 510 mg kg -1 on day 6. During this peak, the GSH levels in treated flowers were nearly double those of the control group (p < 0.01). While a decline was observed in both groups toward the end of the experiment, the AKG -treated flowers maintained significantly higher levels (370 mg kg -1 at day 10) compared to the control group, which dropped to its initial baseline levels (175 mg kg -1 ). The changes in Ascorbic acid content followed a similar trend to GSH, highlighting the synergistic effect of AKG on the antioxidant system (Fig. 6B). There was no significant difference between treatments in the first 48 hours, with both groups maintaining levels around 47-51 mg kg -1 . From day 4, the AKG-treated flowers exhibited a significant divergence from the control. The AsA content in the AKG group reached its highest concentration of approximately 62 mg kg -1 on day 6, whereas the control group showed a much smaller increase, peaking at only 53 mg kg -1 (p < 0.01). As senescence progressed, AsA levels in control flowers declined steadily. However, AKG treatment effectively preserved a higher concentration of this vital antioxidant, ending the vase period (day 10) with significantly superior levels (55 mg kg -1 ) compared to the control (50 mg kg -1 , p < 0.05). 3.6. Total phenols and Total flavonoids Content The impact of AKG on the accumulation of secondary metabolites, specifically total phenols and total flavonoids, was visualized using heatmap analysis throughout the 10-day vase life (Figure 7). As illustrated in Fig. 7A, both the control and AKG -treated flowers exhibited a baseline total phenol content of 3.76 g kg -1 on day 0. In the control group, phenol levels showed a steady decline over time, reaching a minimum of 3.10 g kg -1 by day 8. Conversely, the exogenous application of AKG significantly stimulated the accumulation of phenolic compounds. In the AKG -treated petals, phenol content rose sharply to 4.90 g kg -1 on day 2 and reached its maximum concentration of 5.27 g kg -1 (represented by the magenta zone) on day 4. Although a gradual decrease occurred in the following days, the AKG group maintained substantially higher phenol levels (3.60 g kg -1 at day 10) compared to the untreated control (3.21 g kg -1 ), suggesting that AKG enhances the metabolic defense system against senescence. A similar trend was observed for total flavonoid content as shown in Fig. 7B. Starting from a common initial value of 0.4600 g kg -1 , the flavonoid levels in the control group remained relatively low and stable, fluctuating between 0.35 and 0.52 g kg -1 throughout the period. In contrast, AKG treatment induced a consistent and significant increase in flavonoid accumulation. The flavonoid content in AKG -treated flowers increased steadily to 0.6700 g kg -1 by day 4 and reached a remarkable peak of 0.9200 g kg -1 (magenta zone) on day 8. Even at the end of the vase life (day 10), the flavonoid concentration in the AKG group (0.7500 g kg -1 ) was more than double that of the control group (0.3575 g kg -1 ). These results indicate that the application of alpha-Ketoglutarate effectively bolsters the non-enzymatic antioxidant pool by promoting the biosynthesis of secondary metabolites, which likely contributes to the extended vase life and improved ornamental quality of the flowers. The physiological impact of exogenous AKG on the preservation of cellular membrane integrity was further evaluated through Electrolyte Leakage (EL) and Lipoxygenase (LOX) activity, as visualized in the heatmap analysis (Figure 8). As shown in Fig. 8A, a progressive increase in membrane permeability was observed in both groups throughout the 10-day vase life; however, the rate of leakage was significantly mitigated by the AKG treatment. While both groups started with a baseline EL of 36%, the control group exhibited a rapid surge to 116% by day 4, whereas AKG -treated flowers maintained a much lower leakage rate of 74%. This divergence became more pronounced during the middle and late stages of senescence; specifically, on day 8, the control reached a peak of 171%, while the AKG treatment effectively kept the EL at 104%. By the end of the experiment (day 10), the AKG group showed an EL of 116%, which was remarkably lower than the 159% recorded for the control, indicating that AKG significantly delays the loss of membrane semi-permeability. The activity of the LOX enzyme, which facilitates the degradation of polyunsaturated fatty acids in cell membranes, was closely correlated with the EL results (Fig. 8B). From a common initial baseline of 6.40 µmol min -1 mg -1 , the control group showed an immediate and sharp rise in LOX activity, reaching its maximum value of 11.60 on day 6. In contrast, the exogenous application of AKG remarkably suppressed enzyme activity, maintaining it at a relatively stable and lower level (approx. 7.35) during the same period. Throughout the late phase of the vase life (days 8–10), while the control group continued to exhibit high LOX levels (above 10.30), the AKG -treated flowers showed stabilized activity between 7.10 and 7.20. These findings suggest that the primary mechanism by which AKG extends the vase life of Chrysanthemums is through the effective inhibition of LOX-mediated membrane degradation, thereby preserving the structural and functional integrity of the petal tissues. 3.7. Expression Analysis of Ethylene Biosynthesis Genes and Enzyme Activities To further elucidate the molecular mechanisms underlying the delay in senescence, the expression levels of two key ethylene-related genes, CmACS1 and CmACO1 , along with their corresponding enzyme activities, were monitored over the 10-day vase period (Fig. 10 A-B). At the beginning of the experiment (Day 0), no significant differences were observed between the control and 5 mM AKG treatments regarding gene expression or enzymatic activities. However, as senescence progressed, a distinct divergence emerged between the two groups. In control flowers, the transcript levels of CmACS and CmACO exhibited a sharp and continuous increase, reaching 4.50-fold and 5.20-fold higher than the baseline by Day 4, respectively. In stark contrast, AKG treatment effectively suppressed this upregulation, maintaining the expression of both genes at significantly lower levels (approx. 1.80 and 2.10-fold) during the same period (p < 0.01). By the middle and late stages of the vase life (Days 6 to 10), the inhibitory effect of AKG became even more pronounced. While the control group reached its peak expression for CmACO1 on Day 10 (9.10-fold), the AKG -treated petals showed a remarkably attenuated profile, ending the period with a transcript level of only 3.80-fold. Consistent with the gene expression data, the enzymatic activities of ACS and ACO followed a similar upward trend in the control group, peaking at 13.1 and 11.2 U mg⁻¹ protein on Day 10, respectively. The application of AKG significantly mitigated these enzymatic surges. Specifically, on Day 8, ACS activity in AKG -treated flowers was nearly 45% lower than that of the control group. These results indicate that AKG extends the longevity of chrysanthemum flowers by transcriptionally and enzymatically repressing the ethylene biosynthetic pathway, thereby delaying the autocatalytic ethylene burst associated with floral wilting. 4. Discussion The present study provides compelling evidence that exogenous application of alpha-ketoglutarate (AKG) significantly delays senescence and extends the vase life of cut chrysanthemum flowers through a multifaceted regulatory mechanism involving water relations, redox homeostasis, membrane stability, secondary metabolism, and ethylene biosynthesis. One of the primary contributors to the prolonged vase life observed in AKG-treated flowers (Fig. 2) was the maintenance of superior water balance and mechanical stability. Enhanced solution uptake and reduced stem bending (Fig. 3A; Fig. 4A) indicate that AKG effectively alleviated vascular occlusion, a major postharvest limitation in cut flowers. The stabilization of vase solution pH (Fig. 3B) likely restricted microbial proliferation, thereby preserving xylem conductivity. Sustained fresh weight and larger flower diameter further suggest that AKG-treated petals maintained higher turgor pressure, which is essential for cell expansion, structural integrity, and delayed physical wilting 17-19 . Beyond its effects on water relations, AKG markedly strengthened the antioxidant defense system, which plays a central role in regulating flower senescence 20,21 . The significant enhancement of enzymatic antioxidants, particularly superoxide dismutase (SOD) and catalase (CAT) (Fig. 5A, C), together with elevated levels of non-enzymatic antioxidants such as glutathione (GSH) and ascorbic acid (AsA) (Fig. 6), indicates that AKG promoted a highly efficient reactive oxygen species (ROS)-scavenging network. This coordinated activation of the ascorbate–glutathione cycle effectively limited the accumulation of H₂O₂ and O₂•⁻ (Fig. 5B, D), thereby preventing the oxidative burst that typically acts as an early trigger of petal senescence 3,22,23 . Given that AKG is a key intermediate of the tricarboxylic acid (TCA) cycle, its application may enhance ATP production and provide carbon skeletons required for antioxidant biosynthesis, thus sustaining cellular redox balance 24 . Maintenance of membrane integrity emerged as another decisive factor underlying the anti-senescence effect of AKG 3,25 . Heatmap analysis revealed a strong negative correlation between electrolyte leakage and lipoxygenase (LOX) activity in AKG-treated flowers (Fig. 8). LOX is a critical enzyme involved in the oxygenation of polyunsaturated fatty acids, initiating lipid peroxidation cascades that compromise membrane structure. The pronounced suppression of LOX activity (Fig. 8B), along with significantly lower malondialdehyde (MDA) content (Fig. 4B), demonstrates that AKG effectively mitigated membrane lipid peroxidation. By preserving membrane semi-permeability, AKG prevented irreversible cellular damage, which is widely regarded as the point of no return in petal senescence 26,27 . In parallel, AKG stimulated the accumulation of secondary metabolites, particularly total phenols and flavonoids (Fig. 7), which provided an additional layer of chemical defense against oxidative stress. Phenolic compounds are well known for their capacity to directly scavenge free radicals and to reinforce cell wall structure, while flavonoids contribute to both ROS detoxification and membrane stabilization 9,26 . The temporal pattern observed—higher phenol levels during the mid-stage of vase life (Day 4) and sustained flavonoid accumulation toward the later stages (Day 8)—suggests that AKG confers prolonged protection throughout the senescence process. The significant association between elevated flavonoid content and reduced ROS accumulation (Fig. 5) further highlights the importance of non-enzymatic antioxidants in maintaining petal integrity and visual quality 1,28 . A pivotal finding of this study is the regulatory effect of AKG on ethylene biosynthesis at both transcriptional and enzymatic levels. In control flowers, the sharp and continuous upregulation of CmACS1 and CmACO1 during vase life (Fig. 9B, D), together with increased ACS and ACO activities (Fig. 9A, C), reflects the typical autocatalytic ethylene production associated with petal senescence. This pattern is consistent with previous reports in chrysanthemum and other ethylene-sensitive ornamental species. In contrast, AKG-treated flowers exhibited a pronounced suppression of both gene expression and enzyme activity throughout the vase period, particularly during the critical mid-to-late stages (Days 4–8), when ethylene production usually accelerates 11,29,30 . The attenuation of ACS activity—widely regarded as the rate-limiting step in ethylene biosynthesis—provides a mechanistic explanation for the delayed senescence symptoms observed in AKG-treated flowers 13,30 . Importantly, the reduced activities of ACS and ACO translated into significantly lower ethylene content (Fig. 10), confirming that AKG effectively delayed the ethylene burst that drives downstream senescence-related processes such as membrane degradation, protein hydrolysis, and loss of petal turgidity. Moreover, the suppression of ethylene production is closely linked to the reduced LOX activity and electrolyte leakage observed in this study, as ethylene is known to stimulate LOX-mediated lipid peroxidation 11,31 . The inhibitory effect of AKG on ethylene biosynthesis may be attributed to its central metabolic role 32,33 . As a key intermediate of the TCA cycle, AKG is intimately connected to cellular energy status and carbon–nitrogen balance. The exogenous supply of AKG likely redirected cellular metabolism toward energy production and stress defense rather than toward the energy-demanding process of ethylene-mediated programmed cell death 33 . Additionally, improved redox homeostasis resulting from enhanced antioxidant capacity may have indirectly downregulated senescence-associated genes involved in ethylene biosynthesis 32-34 . In conclusion, the extension of vase life in chrysanthemum by AKG is the result of an integrated, multi-level regulatory mechanism. AKG improves water relations, enhances antioxidant defenses, preserves membrane integrity, stimulates secondary metabolite accumulation, and suppresses ethylene biosynthesis at both transcriptional and enzymatic levels. These coordinated effects collectively delay the physiological and molecular events leading to petal senescence. The findings of this study highlight AKG as a promising, metabolically based preservative for extending the postharvest longevity and commercial value of ethylene-sensitive ornamental crops. 5. Conclusion In conclusion, the present study demonstrates that α-ketoglutarate (AKG) is an effective and eco-friendly treatment for extending the vase life of cut chrysanthemum flowers. AKG application improved water relations and delayed senescence by enhancing antioxidant capacity, as evidenced by increased levels of glutathione, ascorbic acid, phenolics, and flavonoids, along with elevated activities of key antioxidant enzymes such as CAT and SOD. Concurrently, AKG reduced oxidative damage by limiting ROS accumulation, lipid peroxidation, electrolyte leakage, and LOX activity. Importantly, AKG also modulated ethylene biosynthesis by suppressing ACS and ACO enzyme activities and downregulating the expression of CmACS and CmACO genes, highlighting the involvement of the isoprenoid pathway in AKG-mediated senescence regulation. The combined enhancement of antioxidant defense systems and inhibition of ethylene production played a crucial role in delaying flower senescence and maintaining postharvest quality Declarations Data availability The data that support the findings of this study are available from the corresponding author upon reasonable request. There are no restrictions on data availability. Funding: No Funding References Budiarto, K., Zamzami, L. & Endarto, O. Effect of salicylic and ascorbic acids on post-harvest vase life of Chrysanthemum cut flowers. Horticultural Science 49 (2022). Eisa, E. A., Tilly-Mándy, A., Honfi, P., Shala, A. Y. & Gururani, M. A. Chrysanthemum: A comprehensive review on recent developments on in vitro regeneration. Biology 11 , 1774 (2022). Mohit & Bala, M. Response of Chrysanthemum (Chrysanthemum morifolium Ramat.) Varieties to Different Covering Materials for Off Season Flower Production. National Academy Science Letters 47 , 457-461 (2024). Pradhan, A. Standardization of planting time of Chrysanthemum (Chrysanthemum morifolium Ramat.) cv. White Star and Yellow Star for cut flower production in naturally ventilated polyhouse in Gangetic plains of West Bengal , Department of Floriculture and Landscaping, Bidhan Chandra …, (2024). Singh, M., Bala, M. & Singh, S. Optimization of nitrogen application and planting geometry for production of cut chrysanthemums (Chrysanthemum morifolium Ramat.). Journal of Horticultural Sciences 17 , 363-370 (2022). Liu, X.-f., Teng, R., Xiang, L., Li, F. & Chen, K. Sucrose-delaying flower color fading associated with delaying anthocyanin accumulation decrease in cut chrysanthemum. PeerJ 11 , e16520 (2023). Malekzadeh, P. The effect of melatonin treatment in improving the antioxidant system and increasing the shelf life of post-harvesting of bell peppers (Capsicum annuum L.). Journal of Environmental Science Studies 8 , 7218-7232 (2024). Li, C., Tao, J. & Wu, Z. Gaseous ozone regulates reactive oxygen species metabolism and ascorbate–glutathione cycle to delay the senescence of fresh-cut red pitaya (Selenicereus undatus) fruit. Scientia Horticulturae 312 , 111839 (2023). Arjuna, I. G. M. & Andriani, A. P. R. Utilization of Chrysanthemum Leaf Extract and Molasses in the Cultivation of Chrysanthemum Cut Flowers. AJARCDE (Asian Journal of Applied Research for Community Development and Empowerment) 6 , 61-65 (2022). Ali, A. F., Hatamnia, A. A., Malekzadeh, P., Sayyari, M. & Aghdam, M. S. Exogenous dopamine ameliorates chilling injury in banana fruits by enhancing endogenous dopamine and glycine betaine accumulation and promoting ROS scavenging system activity. Postharvest Biology and Technology 205 , 112521 (2023). Khan, S., Alvi, A. F., Saify, S., Iqbal, N. & Khan, N. A. The ethylene biosynthetic enzymes, 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS) and ACC oxidase (ACO): the less explored players in abiotic stress tolerance. Biomolecules 14 , 90 (2024). Xia, J. et al. Genome-Wide In Silico Analysis of 1-Aminocyclopropane-1-carboxylate oxidase (ACO) Gene Family in Rice (Oryza sativa L.). Plants 13 , 3490 (2024). Mun, G. J., Kim, J. S., Lee, C. H. & Lee, H. Y. Strigolactone decreases ethylene biosynthesis in etiolated rice seedlings by reducing expression of OsACO genes. Applied Biological Chemistry 68 , 14 (2025). Malekzadeh, P., Kamrani, A., Abbasi, Z. & Sadeghi, M. Glycine betaine treatment extends the shelf life and retards cap browning of button mushrooms. Scientific Reports 15 , 20796 (2025). Malekzadeh, Khosravi-Nejad, F., Hatamnia, A. A. & Sheikhakbari Mehr, R. Impact of postharvest exogenous γ-aminobutyric acid treatment on cucumber fruit in response to chilling tolerance. Physiology and Molecular Biology of Plants 23 , 827-836, doi:10.1007/s12298-017-0475-2 (2017). Shahbazi, S., Hatamnia, A. A. & Malekzadeh, P. Effect of Melatonin Treatment on Post-Harvest Life of Broccoli during Storage. Journal of Vegetables Sciences 6 (2023). Aftab, M., Lone, H. Y., Wani, A. A., Zargar, M. A. & Tahir, I. GABA-Mediated Defense Mechanisms Against Oxidative Stress: A Case Study in Lilium tigrinum Cut Flowers. Journal of Plant Growth Regulation , 1-14 (2025). Darras, A. Trends in postharvest technology, marketing and distribution of the native Australian and South African ornamental plants, cut flowers and cut foliage. Frontiers in Horticulture 4 , 1584484 (2025). Liu, Y. et al. Phenylalanine application enhances resistance metabolite accumulation and antioxidant capacity to alleviate chilling injury in postharvest nectarines. Postharvest Biology and Technology 231 , 113912 (2026). Chen, S. Review of Recent Advances in Chemical Preservatives for Cut Flowers. Br. J. Biol. Stud 4 , 1-8 (2024). Ehsanimehr, N., Hosseinifarahi, M., Abdipour, M., Eshghi, S. & Jamali, B. Improving postharvest quality and vase life of cut rose flowers by pre-harvest foliar co-applications of γ-aminobutyric acid and calcium chloride. Scientific Reports 14 , 14520 (2024). Kumar, B. S., Aruna, M. & Chanakya, M. Chapter-5 Post-Harvest Handling Techniques of Cut Flowers. Research and Review 89 , 73 (2024). Liu, Z., Luo, Y. & Liao, W. in Oxygen, Nitrogen and Sulfur Species in Post-Harvest Physiology of Horticultural Crops 23-42 (Elsevier, 2024). Mohammadi, M., Ranjbar, M.-E. & Eghlima, G. Impact of gibberellic acid and calcium chloride treatments on neck bending prevention and vase life extension of gerbera cut flowers. Journal of Plant Growth Regulation 43 , 1093-1102 (2024). Zulfiqar, F. et al. Ascorbic acid increases cut flower longevity of sword Lily by regulating oxidative stress and reducing microbial load. Journal of Plant Growth Regulation 43 , 4279-4289 (2024). Al-Fatlawi, K. A. E., Hasan, A. E. & Al-Dulaymi, H. I. Effect of amino acid on the growth and flowering of the Gladiolus plant (priscilla cultivar). International Journal of Agricultural & Statistical Sciences 18 (2022). Al-Taie, E. K. S. & Al-Jubouri, A. A. H. Role of Pinching and Spraying Amino Acid on the Vegetative and Flowering Growth Attributes of Okra Varieties. Journal of Agriculture, Aquaculture, and Animal Science 2 , 186-194 (2025). Zhang, W., Li, J., Zhang, W., Njie, A. & Pan, X. The changes in C/N, carbohydrate, and amino acid content in leaves during female flower bud differentiation of Juglans sigillata. Acta Physiologiae Plantarum 44 , 19 (2022). Farooq, S., Lone, M. L., Altaf, F., Parveen, S. & Tahir, I. Boric acid as a potential substitute for conventional ethylene antagonists in mitigating postharvest flower senescence of Digitalis purpurea. Ornamental Horticulture 27 , 516-525 (2021). Haq, A. u. et al. Flower senescence coordinated by ethylene: an update and future scope on postharvest biology in the “buttercup” family. Journal of Plant Growth Regulation 43 , 402-422 (2024). Hammann, S. & Vetter, W. Method Development for the Determination of Free and Esterified Sterols in Button Mushrooms (Agaricus bisporus). Journal of Agricultural and Food Chemistry 64 , 3437-3444, doi:10.1021/acs.jafc.6b00383 (2016). Jin, Y. et al. The function of GABA in plant cell growth, development and stress response. Phyton 92 , 2211 (2023). Lei, S. & Huang, B. Metabolic regulation of α-Ketoglutarate associated with heat tolerance in perennial ryegrass. Plant Physiology and Biochemistry 190 , 164-173 (2022). Wu, X. et al. Melatonin: Biosynthesis, content, and function in horticultural plants and potential application. Scientia Horticulturae 288 , 110392 (2021). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 04 Mar, 2026 Reviews received at journal 03 Mar, 2026 Reviewers agreed at journal 03 Mar, 2026 Reviews received at journal 23 Feb, 2026 Reviews received at journal 21 Feb, 2026 Reviewers agreed at journal 19 Feb, 2026 Reviewers agreed at journal 18 Feb, 2026 Reviewers agreed at journal 18 Feb, 2026 Reviewers invited by journal 18 Feb, 2026 Editor assigned by journal 12 Feb, 2026 Submission checks completed at journal 11 Feb, 2026 First submitted to journal 11 Feb, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8748436","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":593941677,"identity":"7f10cea0-5ae0-4758-810e-349e9bab5581","order_by":0,"name":"Parviz Malekzadeh","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA70lEQVRIiWNgGAWjYLCCBwwJQDKBjeEDTCSBkJYEqBbGGSRrYeYhxk3mDNyJHxIq0uz525OPPbYps4lmYD/8gOHhHtxaLBt4N0sknMlhljjzLN0451xabgNPmgFDwjPcWgwO8G6QSGyrYGO4kWMmndt2OLeBIQfoyAN4tWz+kfivgkf+Rv43aUuQFv43BLVsk0hsyJEwuJHDJs0I0iJBwBbLZt5tFgnH0gwMzzwzk+wB+qVN4pnBAXxazNl7N9/4UJNsL3c8+ZnEjzKb3H7+5IcPf+BzGDMKlw2MGPBoAGpB5bLhUzsKRsEoGAUjFQAAT0JRg3eJmOgAAAAASUVORK5CYII=","orcid":"","institution":"University of Qom","correspondingAuthor":true,"prefix":"","firstName":"Parviz","middleName":"","lastName":"Malekzadeh","suffix":""},{"id":593941678,"identity":"f890d72d-3820-48b8-836d-9ff3558cf5e4","order_by":1,"name":"Soheila Samadi","email":"","orcid":"","institution":"Payame Noor University (PNU)","correspondingAuthor":false,"prefix":"","firstName":"Soheila","middleName":"","lastName":"Samadi","suffix":""},{"id":593941679,"identity":"0150f3fe-245d-412c-841d-38b6ff010f16","order_by":2,"name":"Elham Ghasemifar","email":"","orcid":"","institution":"Payame Noor University (PNU)","correspondingAuthor":false,"prefix":"","firstName":"Elham","middleName":"","lastName":"Ghasemifar","suffix":""}],"badges":[],"createdAt":"2026-01-31 09:24:53","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8748436/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8748436/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":103504151,"identity":"bf7fa70c-4eba-4d02-b589-7071f167523b","added_by":"auto","created_at":"2026-02-26 13:17:58","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1149114,"visible":true,"origin":"","legend":"\u003cp\u003eImpact of postharvest treatment with α-ketoglutarate (AKG) at various concentrations (0 and 5 mM) on the external appearance of Chrysanthemum flowers during a 10-day vase life.\u003c/p\u003e","description":"","filename":"Fig1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8748436/v1/1e8f9bf7a16063d30cf4bf0d.jpg"},{"id":103093900,"identity":"ff3fd060-7d14-47ea-bb5b-2fb43ed09a6f","added_by":"auto","created_at":"2026-02-20 17:29:57","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1135553,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of postharvest treatment with 5 mM alpha-ketoglutarate (AKG) on the flower weight (A) and flower diameter (B) of Chrysanthemum during vase life.\u003c/p\u003e","description":"","filename":"Fig2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8748436/v1/8eb2a45cc8c5880bc213f1af.jpg"},{"id":103093899,"identity":"783c1a89-cf33-4cf9-a444-a5f8641c6c1e","added_by":"auto","created_at":"2026-02-20 17:29:57","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":968178,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of postharvest treatment with 5 mM alpha-ketoglutarate (AKG) on the bending (A) and pH (B) of Chrysanthemum flowers during vase life.\u003c/p\u003e","description":"","filename":"Fig3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8748436/v1/ccfdebec471a3fc035a4f946.jpg"},{"id":103504156,"identity":"f91ad211-e55b-4fb6-8b4f-a4b94d41e94f","added_by":"auto","created_at":"2026-02-26 13:18:02","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1324502,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of postharvest treatment with 5 mM alpha-ketoglutarate (AKG) on solution uptake and MDA content in Chrysanthemum flowers during vase life.\u003c/p\u003e","description":"","filename":"Fig4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8748436/v1/9b33d1df4d075d5f0792560a.jpg"},{"id":103093903,"identity":"d1976814-9964-4fc9-bab1-c10a86951452","added_by":"auto","created_at":"2026-02-20 17:29:57","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2083198,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of 5 mM alpha-ketoglutarate (AKG) treatment on antioxidant enzyme activities; CAT (A) and SOD (C) hydrogen peroxide content (B), and superoxide anion levels (D) in cut Chrysanthemum flowers during vase life.\u003c/p\u003e","description":"","filename":"Fig5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8748436/v1/745f789ab4a8ceda40a3f063.jpg"},{"id":103093905,"identity":"cd79d79f-5d84-405a-ac4c-9560903b7027","added_by":"auto","created_at":"2026-02-20 17:29:57","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1149374,"visible":true,"origin":"","legend":"\u003cp\u003eTreatment on Effect of 5 mM alpha-ketoglutarate (AKG) treatment on glutathione content (A) and ascorbic acid content (B) in cut Chrysanthemum flowers during vase life.\u003c/p\u003e","description":"","filename":"Fig6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8748436/v1/ab288069aaf950a9870d0de2.jpg"},{"id":103093902,"identity":"d1c741b2-9d1c-48df-9ac1-3ada9ba59134","added_by":"auto","created_at":"2026-02-20 17:29:57","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":756348,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of 5 mM alpha-ketoglutarate (AKG) treatment on total phenol content (A) and total flavonoid content (B) in cut Chrysanthemum flowers during vase life.\u003c/p\u003e","description":"","filename":"Fig7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8748436/v1/7bbfa3e76d44e79e2652f109.jpg"},{"id":103503972,"identity":"c90f02be-10a3-4c3b-ae4c-6567e84e0a5d","added_by":"auto","created_at":"2026-02-26 13:06:14","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":694866,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of 5 mM alpha-ketoglutarate (AKG) treatment on electrolyte leakage (A) and lipoxygenase (LOX) activity (B) in cut Chrysanthemum flowers during vase life.\u003c/p\u003e","description":"","filename":"Fig8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8748436/v1/d5a13242e0df746fd32f4ef4.jpg"},{"id":103504608,"identity":"dd9a661c-e37f-468c-b2bc-8526c67a15a4","added_by":"auto","created_at":"2026-02-26 13:20:44","extension":"jpg","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":3719283,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of 5 mM alpha-ketoglutarate (AKG) treatment on ACO activity (A), CmACO gene expression (B), ACS activity (C), and\u003cem\u003eCmACS\u003c/em\u003e gene expression (D) in cut Chrysanthemum flowers during vase life.\u003c/p\u003e","description":"","filename":"Fig9.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8748436/v1/fb577d0c05ad5d6214f81daf.jpg"},{"id":103093907,"identity":"7fcb44d6-9ab7-49dc-a226-78cf59ec0ef3","added_by":"auto","created_at":"2026-02-20 17:29:57","extension":"jpg","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":942842,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of 5 mM alpha-ketoglutarate (AKG) treatment on ETH content in cut Chrysanthemum flowers during vase life.\u003c/p\u003e","description":"","filename":"Fig10.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8748436/v1/278291c4aeb38a13857cdf7d.jpg"},{"id":103509364,"identity":"44c4994a-bf22-4b73-b9d5-359c67dfdef9","added_by":"auto","created_at":"2026-02-26 13:58:24","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":14806037,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8748436/v1/6bec2879-81b8-4437-8ef8-23aecf37e3d8.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Impact of α-Ketoglutarate Treatment on Enhancing Vase Life of Chrysanthemum by Modulating the Isoprenoid Pathway and Increasing Antioxidant Content","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eChrysanthemum (\u003cem\u003eChrysanthemum morifolium\u003c/em\u003e Ramat.), belonging to the Asteraceae family, stands as one of the most economically significant floricultural crops worldwide, ranking second only to roses in the global cut flower market \u003csup\u003e1,2\u003c/sup\u003e. Despite its immense aesthetic diversity and high commercial demand, the postharvest longevity of chrysanthemum is frequently compromised by rapid physiological decline, characterized by leaf yellowing and petal senescence. These degradative processes, often triggered by oxidative stress and hormonal imbalances, represent a major bottleneck in the long-distance transportation and marketability of this species. Consequently, developing innovative strategies to prolong vase life and maintain floral quality remains a pivotal objective in postharvest physiological research \u003csup\u003e3,4\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eNitrogen (N) metabolism represents a vital biochemical process that plays a key role in regulating growth physiology and enhancing the postharvest resilience of cut chrysanthemum flowers (\u003cem\u003eChrysanthemum morifolium\u003c/em\u003e) against environmental stresses \u003csup\u003e5\u003c/sup\u003e. Precise regulation of this cycle, in addition to preserving aesthetic characteristics, increases cellular stability through the synthesis of protective osmolytes such as proline—a primary derivative of glutamate. Given that the uncontrolled accumulation of ammonium ions (NH\u003csub\u003e4\u003c/sub\u003e\u003csup\u003e+\u003c/sup\u003e) following the detachment of the flower from the mother plant leads to severe cytotoxicity and accelerates tissue senescence, glutamate biosynthesis through effective ammonium uptake and assimilation gains twofold importance \u003csup\u003e6,7\u003c/sup\u003e. In this regard, the glutamine synthetase/glutamate dehydrogenase (GS/GDH) enzymatic system acts as the primary pathway for modulating ammonium concentrations and catalyzing glutamate synthesis, thereby preventing cellular degradation under abiotic stress \u003csup\u003e8\u003c/sup\u003e. Beyond its nutritional role, optimal nitrogen supply directly promotes the plant's antioxidant capacity by reinforcing the reserves of soluble proteins and glycine betaine, while preventing premature wilting by maintaining osmotic potential. Ultimately, the enhancement of nitrogen metabolic status, functioning similarly to synthetic osmo-protectants, ensures the stability of cell membranes and significantly extends the vase life of chrysanthemums \u003csup\u003e9\u003c/sup\u003e. This sequence of reactions underscores the significance of replacing toxic pathways with beneficial compounds to delay physiological senescence; thus, nitrogen acts beyond a mere nutrient, serving as a protective agent against oxidative processes and a key factor in floral longevity in the vase environment \u003csup\u003e3,10\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eEthylene is synthesized in plants via the methionine pathway, in which two key enzymes, ACC synthase (ACS) and ACC oxidase (ACO), control the rate-determining steps of this process. ACS catalyzes the conversion of S-adenosyl-L-methionine to ACC and functions as the rate-limiting step, whereas ACO converts ACC to ethylene in the presence of oxygen. Regulation of the expression and activity of these two enzymes plays a fundamental role in controlling ethylene production and, consequently, in regulating senescence and postharvest longevity of cut flowers \u003csup\u003e11-13\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eThe objective of this study was to investigate the role of α-ketoglutarate (AKG) as a central metabolic regulator in delaying postharvest senescence of cut chrysanthemum flowers. This research specifically focused on evaluating the effects of AKG on maintaining cellular membrane stability, reducing lipid peroxidation, inhibiting phospholipid-degrading enzymes (LOX, PLC, and PLD), enhancing both enzymatic and non-enzymatic antioxidant defense systems, and regulating the expression of key genes involved in ethylene biosynthesis (CmACS1 and CmACO1). The findings of this study, for the first time, provide integrated evidence for the role of AKG in the simultaneous suppression of oxidative stress and molecular regulation of the ethylene pathway, introducing AKG as a novel and effective compound for extending the vase life of cut flowers.\u003c/p\u003e"},{"header":"2. Material and Methods","content":"\u003cp\u003e\u003cstrong\u003e2.1. Plant materials and treatments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOn October 21, 2025, between 9:00 and 11:00 a.m., flowering shoots of chrysanthemum at the blooming stage were harvested from a commercial greenhouse in Mahallat County, Markazi Province, Iran. Immediately after harvest, the flowers were placed in low-temperature foam boxes and transported to the laboratory as quickly as possible. The cut flowers were then rehydrated in distilled water for 3 h. Subsequently, uniform stems were selected and recut under water at a 45\u0026deg; angle to a length of approximately 35 cm, leaving four compound leaves on each stem. The experimental environmental conditions were maintained as follows: a 12-h daily photoperiod, room temperature of 25 \u0026plusmn; 5 \u0026deg;C, and relative humidity of 45\u0026ndash;60%. \u0026alpha;-Ketoglutarate was obtained from the Postharvest Research Laboratory of Qom University (Merck, Germany). The experimental design included distilled water as the negative control (CK1), while \u0026alpha;-ketoglutarate at a concentration of 5 mmol L⁻\u0026sup1; was added to the basic holding solution as the treatment. Petal sampling and morphological measurements were conducted every 24 h starting from the onset of flowering. Collected samples were immediately frozen in liquid nitrogen and stored at \u0026minus;80 \u0026deg;C for subsequent biochemical analyses.\u003c/p\u003e\n\u003cp\u003eFor all biochemical assessments\u0026mdash;including non-enzymatic antioxidants (total phenolics, flavonoids, glutathione, and ascorbic acid), antioxidant enzymes (SOD and CAT), lipoxygenase (LOX) activity, ETH-associated enzymes (ACS and ACO), and stress indicators (MDA, EL, H₂O₂, O₂⁻, and ETH)\u0026mdash;three independent biological replicates were conducted. Each biological replicate consisted of three technical repeats to ensure both methodological reproducibility and data reliability.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2. Determination of MDA, H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e and Electrolyte leakage content\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo evaluate physiological stress markers, electrolyte leakage (EL) was determined according to the procedure of Malekzadeh, et al. \u003csup\u003e14\u003c/sup\u003e. The Malonic dialdehyde (MDA) content was analyzed by homogenizing 1 g of flower sample in 25 mL of 5% (w/v) trichloroacetic acid, with results reported as \u0026mu;mol kg⁻\u0026sup1; FW according the methods described by Ali, et al. \u003csup\u003e10\u003c/sup\u003e . For hydrogen peroxide (H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e) quantification, the titanium (IV) technique was employed, involving the homogenization of 1 g of frozen tissue in 5 mL of ice-cold acetone \u003csup\u003e14\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.3. LOX activity\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe activity of Lipoxygenase (LOX) was determined following the procedure established by Malekzadeh, et al. \u003csup\u003e15\u003c/sup\u003e. A reaction substrate was prepared by incorporating 40 \u0026micro;L of linoleic acid and 200 \u0026micro;L of Tween 20 into 40 mL of 0.1 M sodium phosphate buffer at pH 7.0. To initiate the assay, 0.2 mL of the enzyme extract was mixed with 1 mL of this prepared substrate in a cuvette. The absorbance was monitored at 234 nm and 25\u0026deg;C. A single unit of LOX activity was defined as the quantity of enzyme required to induce an absorbance increase of 0.01 per minute \u003csup\u003e14\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4. \u0026nbsp;Enzymatic Isolation and Preparation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo obtain the crude enzyme extract, 0.5 g of petal samples were pulverized into a fine consistency under cryogenic conditions using liquid nitrogen and a mortar. This powder was then disrupted in 2 mL of an 8.0 pH potassium phosphate buffer (50 mM). To ensure enzyme stability, the medium was supplemented with 10% (w/v) polyvinylpyrrolidone (PVP), 0.1 mM EDTA, and 1 mM dithiothreitol (DTT). The resulting mixture was subjected to centrifugation at 10,000 times g for 30 minutes at a constant temperature of 4\u0026deg;C. The clarified supernatant was subsequently harvested for biochemical quantification \u003csup\u003e7\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4.1. Superoxide Dismutase (SOD) Quantification\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe capacity of SOD to hinder the photochemical reduction of nitroblue tetrazolium (NBT) was utilized to measure its activity \u003csup\u003e14\u003c/sup\u003e. A reaction medium was prepared in a 50 mM phosphate buffer (pH 7.8), containing 13 mM L-methionine, 25 mM NBT, 0.1 mM EDTA, 50 mM sodium carbonate, and 2 mM riboflavin. To this, 0.1 mL of the supernatant was added. The samples were then exposed to 15 minutes of illumination from two 15 W fluorescent sources. A blank sample (enzyme-free) was used to determine the baseline for maximum color development. The reaction was halted by extinguishing the lights and placing the tubes in total darkness. Absorbance was recorded at 560 nm. One SOD unit represents the enzyme quantity necessary to achieve 50% inhibition of NBT reduction compared to the control.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.4.2. Catalase (CAT) Assessment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe degradation rate of hydrogen peroxide (H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e) was monitored at 240 nm to evaluate CAT activity. The 1 mL assay system consisted of 50 mM potassium phosphate buffer (pH 7.0) and 15 mM\u0026nbsp;H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e. The enzymatic process was triggered by introducing 50 \u0026micro;L of the isolated extract. CAT activity was calculated based on the micromoles of\u0026nbsp;H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e decomposed per minute per milligram of protein \u003csup\u003e16\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.5. Analysis of Ethylene Biosynthesis and Its Regulatory Components\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.5.1. Measurement of Ethylene Levels and Activities of ACS and ACO Enzymes \u0026nbsp;\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe quantification of ethylene (ETH) biosynthesis-related parameters was carried out using commercially available ELISA kits, following the manufacturer\u0026rsquo;s instructions precisely. The analyzed parameters included the activities of 1-aminocyclopropane-1-carboxylic acid synthase (ACS; Kit No. MM-33691O2) and 1-aminocyclopropane-1-carboxylic acid oxidase (ACO; Kit No. MM-2135), as well as ETH concentration (Kit No. MM-0888O1). All measurements were determined based on calibration curves generated for each assay. ACS and ACO enzymatic activities were expressed in \u0026mu;mol s⁻\u0026sup1; L⁻\u0026sup1;, whereas ETH content was reported as \u0026mu;g kg⁻\u0026sup1; of fresh tissue.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.5.2. Primer design\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSpecific primers for ethylene biosynthesis genes (\u003cem\u003eCmACS1\u003c/em\u003e and \u003cem\u003eCmACO1\u003c/em\u003e) and the internal control gene (Cm-EF1\u0026alpha;) were designed based on the sequences available in the NCBI database. The primer sequences were validated for their specificity and efficiency using melting curve analysis (Table 1).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable1.\u003c/strong\u003e Primer Sequences Used for Quantitative Real-Time PCR\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" class=\"fr-table-selection-hover\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGene Name\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eForward Primer (5\u0026apos; \u003cstrong\u003e\u0026rarr;\u003c/strong\u003e3\u0026apos;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eReverse Primer (5\u0026apos; \u003cstrong\u003e\u0026rarr;\u003c/strong\u003e3\u0026apos;)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCmACS1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTTCAGGGACTTCGTTTCGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eGCTTCTTGAGTTGCTCCGTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCmACO1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTGAAGTTTCCAGTCATCGACC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCCGTAGTTTCCGAACTGGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCm-EF1\u0026alpha;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eTGGTTGTTGCTGTTAAGCCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\"\u003e\n \u003cp\u003eCAAGAGCCTCAAGCAAGACC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e2.1. RNA Extraction and cDNA Synthesis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from chrysanthemum petals (control and 5 mM AKG -treated) at different time points (Day 0, 2, 4, 6, 8 and 10) using the RNX-Plus reagent following the manufacturer\u0026rsquo;s instructions. To eliminate potential genomic DNA contamination, the extracted RNA was treated with DNase I (RNase-free). The concentration and purity of the RNA samples were determined using a NanoDrop spectrophotometer (ND-1000) at absorbance ratios of A260/A280 and A260/A230. Only RNA samples with an A260/A280 ratio between 1.8 and 2.0 were used for further analysis. Subsequently, first-strand cDNA was synthesized from 1\u0026nbsp;mug of total RNA using a Reverse Transcription Kit (Thermo Fisher Scientific) with oligo(dT) primers according to the provided protocol.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.2. Quantitative Real-Time PCR (RT-qPCR) Analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe expression profiles of ethylene biosynthesis genes, including \u003cem\u003eCmACS1\u003c/em\u003e and \u003cem\u003eCmACO1\u003c/em\u003e, were analyzed via quantitative real-time PCR (RT-qPCR). The reactions were performed on a Real-Time PCR System (Bio-Rad CFX96) using SYBR Green Master Mix. The total reaction volume was 20\u0026nbsp;muL, containing 10\u0026nbsp;muL of SYBR Green Mix, 1\u0026nbsp;muL of cDNA template, 0.5\u0026nbsp;muL of each forward and reverse primer (10\u0026nbsp;muM), and 8\u0026nbsp;muL of nuclease-free water. The thermal cycling conditions were as follows: initial denaturation at 95\u0026deg;C for 3 min, followed by 40 cycles of 95\u0026deg;C for 15 s, and 60\u0026deg;C for 30 s. A melting curve analysis (65\u0026deg;C to 95\u0026deg;C) was conducted at the end of each run to verify the specificity of the primers and the absence of primer dimers. The relative expression levels of the target genes were calculated using the\u0026nbsp;2-DeltaDelta Ct\u0026nbsp;method, with \u003cem\u003eCm-EF1alpha\u003c/em\u003e as the internal reference gene for normalization.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.8. Data Analysis and Statistics\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData processing and statistical evaluations were carried out utilizing GraphPad Prism 8.0 software. The findings are reported as the mean values accompanied by their respective standard deviations (SD). To determine the influence of experimental treatments and duration of storage on the measured parameters, a two-way analysis of variance (ANOVA) was employed. Post-hoc comparisons were executed using Tukey\u0026rsquo;s multiple range test to identify specific differences between groups. In all analyses, a p-value of less than 0.05 was adopted as the threshold for defining statistical significance.\u003c/p\u003e"},{"header":"3. Results","content":"\u003cp\u003e\u003cstrong\u003e3.1. Morphological Evaluation: Flower Fresh Weight and Diameter\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFig. 1 shows the effect of postharvest treatment with alpha-ketoglutarate (AKG) at different concentrations (0 and 5 mM) on the external appearance of Chrysanthemum flowers over a 10-day vast life. In the control group (without AKG treatment), the flowers exhibited significant changes in their appearance over time and gradually wilted from day 6 onwards. In contrast, in the group treated with 5 mM AKG, the flowers maintained their appearance until day 10 and showed fewer changes.\u003c/p\u003e\n\u003cp\u003eThe results regarding the physical parameters of cut Chrysanthemums under the influence of\u0026nbsp;alpha-Ketoglutarate (AKG) are presented in Fig. 2. As illustrated in Fig. 2A, the fresh weight of Chrysanthemum cut flowers in both groups exhibited an initial increase, reflecting the absorption of the vase solution during the first few days. In the control group, the fresh weight peaked on day 6 and subsequently underwent a sharp decline, reaching its minimum value of approximately 11 g by the end of the vase life (day 10). Conversely, flowers treated with 5 mM AKG maintained significantly higher fresh weight throughout the entire experimental period. The AKG-treated flowers reached a significantly superior peak of approximately 42 g on day 6. Even at the final stage (day 10), the fresh weight in the AKG group was roughly double that of the control group, indicating that AKG effectively preserves biomass and delays tissue dehydration.\u003c/p\u003e\n\u003cp\u003eThe flower diameter, showed a distinct contrast between treatments (Fig. 2B). The diameter of control flowers increased slowly and reached a plateau of approximately 116 mm by day 10. However, the exogenous application of AKG substantially promoted floral expansion from the very beginning of the treatment. The flower diameter in the AKG group reached its maximum value of 171 mm on day 8, which was significantly higher than the control at the same time point (approx. 104 mm). Although a slight decrease was observed in the treated group toward day 10, the flowers maintained a significantly larger and more aesthetically pleasing size compared to the untreated control.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.2. Stem Bending and Vase Solution pH\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe mechanical stability and chemical environment of the vase solution are critical determinants of postharvest quality. As shown in Fig. 3A, control flowers exhibited a rapid increase in the bending percentage of the flower scape, reaching nearly 100% by day 10. In contrast, the exogenous application of AKG remarkably suppressed this disorder, maintaining the bending rate below 20% throughout the experiment. The significant difference between groups (p \u0026lt; 0.01) suggests that AKG strengthens the mechanical integrity of the vascular tissues and prevents early wilting. The pH of the vase solution in the control group showed a sharp alkaline shift, rising from 6.4 to over 8.5 by day 10 (Fig. 3B). However, AKG treatment effectively stabilized the solution pH at a more neutral level (approx. 7.4). Maintaining a lower pH is often associated with inhibited microbial proliferation and enhanced water conductance in the xylem.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.3. Solution Uptake and Lipid Peroxidation (MDA Content)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe rate of solution uptake gradually declined in all groups as senescence progressed (Fig. 4A). However, AKG -treated flowers maintained a significantly higher uptake rate compared to the control group from day 4 onwards (p \u0026lt; 0.05). By day 10, the water absorption in the AKG group remained notably superior, supporting the higher fresh weight and diameter observed in previous sections.\u003c/p\u003e\n\u003cp\u003eAs illustrated in Fig. 4B, MDA content, a key marker of lipid peroxidation, significantly increased in control flowers over the 10-d vase period. However, the exogenous application of 5 mM alpha-ketoglutarate effectively suppressed this increase. Specifically, at the late stages of senescence (6-10 d), alpha-ketoglutarate-treated flowers exhibited substantially lower MDA levels compared to the control, suggesting enhanced membrane integrity and reduced oxidative damage during postharvest life.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.4. Enzymatic Antioxidant Defense and ROS Scavenging Activity\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe influence of exogenous 5 mM alpha-Ketoglutarate on the antioxidant machinery and reactive oxygen species (ROS) accumulation in cut flowers is illustrated in Figure 5.\u003c/p\u003e\n\u003cp\u003eAs shown in Fig. 5A, the activity of Catalase (CAT) in control flowers reached its maximum on day 2 and subsequently declined. In contrast, AKG treatment significantly upregulated CAT activity, which peaked on day 4 (approximately 158 U g⁻\u0026sup1; protein) and remained significantly higher than the control throughout the remainder of the vase life (p \u0026lt; 0.01). This sustained high enzymatic activity suggests a robust defense against hydrogen peroxide-induced stress.\u003c/p\u003e\n\u003cp\u003eThe impact of enhanced CAT activity was directly reflected in the Hydrogen Peroxide (H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e) levels (Fig. 5B). While the control flowers exhibited a steady increase in H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e accumulation, peaking on day 6 (~68\u0026micro; mmol kg⁻\u0026sup1;), AKG -treated petals showed significantly lower concentrations from day 4 onwards. By day 8, the H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e content in the AKG group was significantly reduced compared to the control group (p \u0026lt; 0.01), indicating efficient peroxide scavenging. Superoxide Dismutase (SOD) activity followed a similar trend as CAT (Fig. 5C). The exogenous application of AKG triggered a significant increase in SOD activity early in the vase period (day 2, ~118 Ug⁻\u0026sup1; protein). Throughout the experimental timeframe, the AKG group maintained a significantly higher capacity for superoxide dismutation compared to the untreated control, which showed a continuous decline in enzyme activity after day 0. The accumulation of Superoxide anions (O\u003csub\u003e2\u003c/sub\u003e\u003csup\u003e\u0026bull;-\u003c/sup\u003e) increased over time in both groups as a hallmark of senescence (Fig. 5D). However, AKG treatment remarkably inhibited this accumulation. While the control group reached its highest levels on day 10 (~815 \u0026micro;mol kg⁻\u0026sup1;), the AKG -treated flowers maintained significantly lower concentrations (~600 \u0026micro;mol kg⁻\u0026sup1;) during the same period. The significant difference between treatments (p \u0026lt; 0.05 and p \u0026lt; 0.01) highlights the role of AKG in mitigating oxidative damage at the cellular level.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.5. Non-Enzymatic Antioxidant Defense System\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe influence of exogenous 5 mM AKG on the non-enzymatic antioxidant pool, specifically Glutathione (GSH) and Ascorbic acid (AsA), is presented in Figure 6. The maintenance of these metabolites is essential for regulating the cellular redox state and supporting the ascorbate-glutathione cycle.\u003c/p\u003e\n\u003cp\u003eAs illustrated in Fig. 6A, both groups showed an initial increase in GSH content during the first 6 days of the vase life. However, the magnitude of this increase was significantly greater in the AKG -treated flowers. As shown in Fig. 6A; Both groups started at a baseline of approximately\u0026nbsp;170 mg kg\u003csup\u003e-1\u003c/sup\u003e. By day 4, AKG treatment induced a sharp rise to nearly\u0026nbsp;480 mg kg\u003csup\u003e-1\u003c/sup\u003e, significantly outperforming the control group (270 mg kg\u003csup\u003e-1\u003c/sup\u003e). The GSH content in AKG -treated petals reached its maximum value of approximately\u0026nbsp;510 mg kg\u003csup\u003e-1\u003c/sup\u003e on day 6. During this peak, the GSH levels in treated flowers were nearly double those of the control group (p \u0026lt; 0.01). While a decline was observed in both groups toward the end of the experiment, the AKG -treated flowers maintained significantly higher levels (370 mg kg\u003csup\u003e-1\u003c/sup\u003e at day 10) compared to the control group, which dropped to its initial baseline levels (175 mg kg\u003csup\u003e-1\u003c/sup\u003e).\u003c/p\u003e\n\u003cp\u003eThe changes in Ascorbic acid content followed a similar trend to GSH, highlighting the synergistic effect of AKG on the antioxidant system (Fig. 6B). There was no significant difference between treatments in the first 48 hours, with both groups maintaining levels around\u0026nbsp;47-51 mg kg\u003csup\u003e-1\u003c/sup\u003e. From day 4, the AKG-treated flowers exhibited a significant divergence from the control. The AsA content in the AKG group reached its highest concentration of approximately\u0026nbsp;62 mg kg\u003csup\u003e-1\u003c/sup\u003e on day 6, whereas the control group showed a much smaller increase, peaking at only\u0026nbsp;53 mg kg\u003csup\u003e-1\u003c/sup\u003e (p \u0026lt; 0.01). As senescence progressed, AsA levels in control flowers declined steadily. However, AKG treatment effectively preserved a higher concentration of this vital antioxidant, ending the vase period (day 10) with significantly superior levels (55 mg kg\u003csup\u003e-1\u003c/sup\u003e) compared to the control (50 mg kg\u003csup\u003e-1\u003c/sup\u003e,\u0026nbsp;p \u0026lt; 0.05).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e3.6. Total phenols\u003c/strong\u003e and \u003cstrong\u003eTotal flavonoids Content\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe impact of AKG on the accumulation of secondary metabolites, specifically total phenols and total flavonoids, was visualized using heatmap analysis throughout the 10-day vase life (Figure 7). As illustrated in Fig. 7A, both the control and AKG -treated flowers exhibited a baseline total phenol content of 3.76 g kg\u003csup\u003e-1\u003c/sup\u003e on day 0. In the control group, phenol levels showed a steady decline over time, reaching a minimum of 3.10 g kg\u003csup\u003e-1\u003c/sup\u003e by day 8. Conversely, the exogenous application of AKG significantly stimulated the accumulation of phenolic compounds. In the AKG -treated petals, phenol content rose sharply to 4.90 g kg\u003csup\u003e-1\u003c/sup\u003e on day 2 and reached its maximum concentration of 5.27 g kg\u003csup\u003e-1\u003c/sup\u003e (represented by the magenta zone) on day 4. Although a gradual decrease occurred in the following days, the AKG group maintained substantially higher phenol levels (3.60 g kg\u003csup\u003e-1\u003c/sup\u003e at day 10) compared to the untreated control (3.21 g kg\u003csup\u003e-1\u003c/sup\u003e), suggesting that AKG enhances the metabolic defense system against senescence.\u003c/p\u003e\n\u003cp\u003eA similar trend was observed for total flavonoid content as shown in Fig. 7B. Starting from a common initial value of 0.4600 g kg\u003csup\u003e-1\u003c/sup\u003e, the flavonoid levels in the control group remained relatively low and stable, fluctuating between 0.35 and 0.52 g kg\u003csup\u003e-1\u003c/sup\u003e throughout the period. In contrast, AKG treatment induced a consistent and significant increase in flavonoid accumulation. The flavonoid content in AKG -treated flowers increased steadily to 0.6700 g kg\u003csup\u003e-1\u003c/sup\u003e by day 4 and reached a remarkable peak of 0.9200 g kg\u003csup\u003e-1\u003c/sup\u003e (magenta zone) on day 8. Even at the end of the vase life (day 10), the flavonoid concentration in the AKG group (0.7500 g kg\u003csup\u003e-1\u003c/sup\u003e) was more than double that of the control group (0.3575 g kg\u003csup\u003e-1\u003c/sup\u003e). These results indicate that the application of alpha-Ketoglutarate effectively bolsters the non-enzymatic antioxidant pool by promoting the biosynthesis of secondary metabolites, which likely contributes to the extended vase life and improved ornamental quality of the flowers.\u003c/p\u003e\n\u003cp\u003eThe physiological impact of exogenous AKG on the preservation of cellular membrane integrity was further evaluated through Electrolyte Leakage (EL) and Lipoxygenase (LOX) activity, as visualized in the heatmap analysis (Figure 8). As shown in Fig. 8A, a progressive increase in membrane permeability was observed in both groups throughout the 10-day vase life; however, the rate of leakage was significantly mitigated by the AKG treatment. While both groups started with a baseline EL of 36%, the control group exhibited a rapid surge to 116% by day 4, whereas AKG -treated flowers maintained a much lower leakage rate of 74%. This divergence became more pronounced during the middle and late stages of senescence; specifically, on day 8, the control reached a peak of 171%, while the AKG treatment effectively kept the EL at 104%. By the end of the experiment (day 10), the AKG group showed an EL of 116%, which was remarkably lower than the 159% recorded for the control, indicating that AKG significantly delays the loss of membrane semi-permeability.\u003c/p\u003e\n\u003cp\u003eThe activity of the LOX enzyme, which facilitates the degradation of polyunsaturated fatty acids in cell membranes, was closely correlated with the EL results (Fig. 8B). From a common initial baseline of 6.40 \u0026micro;mol min\u003csup\u003e-1\u003c/sup\u003e mg\u003csup\u003e-1\u003c/sup\u003e, the control group showed an immediate and sharp rise in LOX activity, reaching its maximum value of 11.60 on day 6. In contrast, the exogenous application of AKG remarkably suppressed enzyme activity, maintaining it at a relatively stable and lower level (approx. 7.35) during the same period. Throughout the late phase of the vase life (days 8\u0026ndash;10), while the control group continued to exhibit high LOX levels (above 10.30), the AKG -treated flowers showed stabilized activity between 7.10 and 7.20. These findings suggest that the primary mechanism by which AKG extends the vase life of Chrysanthemums is through the effective inhibition of LOX-mediated membrane degradation, thereby preserving the structural and functional integrity of the petal tissues.\u003c/p\u003e\n\u003ch3\u003e3.7. Expression Analysis of Ethylene Biosynthesis Genes and Enzyme Activities\u003c/h3\u003e\n\u003cp\u003eTo further elucidate the molecular mechanisms underlying the delay in senescence, the expression levels of two key ethylene-related genes, \u003cem\u003eCmACS1\u003c/em\u003e and \u003cem\u003eCmACO1\u003c/em\u003e, along with their corresponding enzyme activities, were monitored over the 10-day vase period (Fig. 10 A-B).\u003c/p\u003e\n\u003cp\u003eAt the beginning of the experiment (Day 0), no significant differences were observed between the control and\u0026nbsp;5 mM AKG treatments regarding gene expression or enzymatic activities. However, as senescence progressed, a distinct divergence emerged between the two groups. In control flowers, the transcript levels of \u003cem\u003eCmACS\u003c/em\u003e and \u003cem\u003eCmACO\u003c/em\u003e exhibited a sharp and continuous increase, reaching 4.50-fold and 5.20-fold higher than the baseline by Day 4, respectively. In stark contrast, AKG treatment effectively suppressed this upregulation, maintaining the expression of both genes at significantly lower levels (approx. 1.80 and 2.10-fold) during the same period (p \u0026lt; 0.01).\u003c/p\u003e\n\u003cp\u003eBy the middle and late stages of the vase life (Days 6 to 10), the inhibitory effect of AKG became even more pronounced. While the control group reached its peak expression for \u003cem\u003eCmACO1\u003c/em\u003e on Day 10 (9.10-fold), the AKG -treated petals showed a remarkably attenuated profile, ending the period with a transcript level of only 3.80-fold.\u003c/p\u003e\n\u003cp\u003eConsistent with the gene expression data, the enzymatic activities of ACS and ACO followed a similar upward trend in the control group, peaking at 13.1 and 11.2 U mg⁻\u0026sup1; protein on Day 10, respectively. The application of AKG significantly mitigated these enzymatic surges. Specifically, on Day 8, ACS activity in AKG -treated flowers was nearly 45% lower than that of the control group. These results indicate that AKG extends the longevity of chrysanthemum flowers by transcriptionally and enzymatically repressing the ethylene biosynthetic pathway, thereby delaying the autocatalytic ethylene burst associated with floral wilting.\u003c/p\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eThe present study provides compelling evidence that exogenous application of alpha-ketoglutarate (AKG) significantly delays senescence and extends the vase life of cut chrysanthemum flowers through a multifaceted regulatory mechanism involving water relations, redox homeostasis, membrane stability, secondary metabolism, and ethylene biosynthesis. One of the primary contributors to the prolonged vase life observed in AKG-treated flowers (Fig. 2) was the maintenance of superior water balance and mechanical stability. Enhanced solution uptake and reduced stem bending (Fig. 3A; Fig. 4A) indicate that AKG effectively alleviated vascular occlusion, a major postharvest limitation in cut flowers. The stabilization of vase solution pH (Fig. 3B) likely restricted microbial proliferation, thereby preserving xylem conductivity. Sustained fresh weight and larger flower diameter further suggest that AKG-treated petals maintained higher turgor pressure, which is essential for cell expansion, structural integrity, and delayed physical wilting \u003csup\u003e17-19\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eBeyond its effects on water relations, AKG markedly strengthened the antioxidant defense system, which plays a central role in regulating flower senescence \u003csup\u003e20,21\u003c/sup\u003e. The significant enhancement of enzymatic antioxidants, particularly superoxide dismutase (SOD) and catalase (CAT) (Fig. 5A, C), together with elevated levels of non-enzymatic antioxidants such as glutathione (GSH) and ascorbic acid (AsA) (Fig. 6), indicates that AKG promoted a highly efficient reactive oxygen species (ROS)-scavenging network. This coordinated activation of the ascorbate–glutathione cycle effectively limited the accumulation of H₂O₂ and O₂•⁻ (Fig. 5B, D), thereby preventing the oxidative burst that typically acts as an early trigger of petal senescence \u003csup\u003e3,22,23\u003c/sup\u003e. Given that AKG is a key intermediate of the tricarboxylic acid (TCA) cycle, its application may enhance ATP production and provide carbon skeletons required for antioxidant biosynthesis, thus sustaining cellular redox balance \u003csup\u003e24\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eMaintenance of membrane integrity emerged as another decisive factor underlying the anti-senescence effect of AKG \u003csup\u003e3,25\u003c/sup\u003e. Heatmap analysis revealed a strong negative correlation between electrolyte leakage and lipoxygenase (LOX) activity in AKG-treated flowers (Fig. 8). LOX is a critical enzyme involved in the oxygenation of polyunsaturated fatty acids, initiating lipid peroxidation cascades that compromise membrane structure. The pronounced suppression of LOX activity (Fig. 8B), along with significantly lower malondialdehyde (MDA) content (Fig. 4B), demonstrates that AKG effectively mitigated membrane lipid peroxidation. By preserving membrane semi-permeability, AKG prevented irreversible cellular damage, which is widely regarded as the point of no return in petal senescence \u003csup\u003e26,27\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eIn parallel, AKG stimulated the accumulation of secondary metabolites, particularly total phenols and flavonoids (Fig. 7), which provided an additional layer of chemical defense against oxidative stress. Phenolic compounds are well known for their capacity to directly scavenge free radicals and to reinforce cell wall structure, while flavonoids contribute to both ROS detoxification and membrane stabilization \u003csup\u003e9,26\u003c/sup\u003e. The temporal pattern observed—higher phenol levels during the mid-stage of vase life (Day 4) and sustained flavonoid accumulation toward the later stages (Day 8)—suggests that AKG confers prolonged protection throughout the senescence process. The significant association between elevated flavonoid content and reduced ROS accumulation (Fig. 5) further highlights the importance of non-enzymatic antioxidants in maintaining petal integrity and visual quality \u003csup\u003e1,28\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eA pivotal finding of this study is the regulatory effect of AKG on ethylene biosynthesis at both transcriptional and enzymatic levels. In control flowers, the sharp and continuous upregulation of CmACS1 and CmACO1 during vase life (Fig. 9B, D), together with increased ACS and ACO activities (Fig. 9A, C), reflects the typical autocatalytic ethylene production associated with petal senescence. This pattern is consistent with previous reports in chrysanthemum and other ethylene-sensitive ornamental species. In contrast, AKG-treated flowers exhibited a pronounced suppression of both gene expression and enzyme activity throughout the vase period, particularly during the critical mid-to-late stages (Days 4–8), when ethylene production usually accelerates \u003csup\u003e11,29,30\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eThe attenuation of ACS activity—widely regarded as the rate-limiting step in ethylene biosynthesis—provides a mechanistic explanation for the delayed senescence symptoms observed in AKG-treated flowers \u003csup\u003e13,30\u003c/sup\u003e. Importantly, the reduced activities of ACS and ACO translated into significantly lower ethylene content (Fig. 10), confirming that AKG effectively delayed the ethylene burst that drives downstream senescence-related processes such as membrane degradation, protein hydrolysis, and loss of petal turgidity. Moreover, the suppression of ethylene production is closely linked to the reduced LOX activity and electrolyte leakage observed in this study, as ethylene is known to stimulate LOX-mediated lipid peroxidation \u003csup\u003e11,31\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eThe inhibitory effect of AKG on ethylene biosynthesis may be attributed to its central metabolic role \u003csup\u003e32,33\u003c/sup\u003e. As a key intermediate of the TCA cycle, AKG is intimately connected to cellular energy status and carbon–nitrogen balance. The exogenous supply of AKG likely redirected cellular metabolism toward energy production and stress defense rather than toward the energy-demanding process of ethylene-mediated programmed cell death \u003csup\u003e33\u003c/sup\u003e. Additionally, improved redox homeostasis resulting from enhanced antioxidant capacity may have indirectly downregulated senescence-associated genes involved in ethylene biosynthesis \u003csup\u003e32-34\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eIn conclusion, the extension of vase life in chrysanthemum by AKG is the result of an integrated, multi-level regulatory mechanism. AKG improves water relations, enhances antioxidant defenses, preserves membrane integrity, stimulates secondary metabolite accumulation, and suppresses ethylene biosynthesis at both transcriptional and enzymatic levels. These coordinated effects collectively delay the physiological and molecular events leading to petal senescence. The findings of this study highlight AKG as a promising, metabolically based preservative for extending the postharvest longevity and commercial value of ethylene-sensitive ornamental crops.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003e\u0026nbsp;In conclusion, the present study demonstrates that α-ketoglutarate (AKG) is an effective and eco-friendly treatment for extending the vase life of cut chrysanthemum flowers. AKG application improved water relations and delayed senescence by enhancing antioxidant capacity, as evidenced by increased levels of glutathione, ascorbic acid, phenolics, and flavonoids, along with elevated activities of key antioxidant enzymes such as CAT and SOD. Concurrently, AKG reduced oxidative damage by limiting ROS accumulation, lipid peroxidation, electrolyte leakage, and LOX activity. Importantly, AKG also modulated ethylene biosynthesis by suppressing ACS and ACO enzyme activities and downregulating the expression of CmACS and CmACO genes, highlighting the involvement of the isoprenoid pathway in AKG-mediated senescence regulation. The combined enhancement of antioxidant defense systems and inhibition of ethylene production played a crucial role in delaying flower senescence and maintaining postharvest quality\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are available from the corresponding author upon reasonable\u0026nbsp;request. There are no restrictions on data availability.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e No Funding\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBudiarto, K., Zamzami, L. \u0026amp; Endarto, O. Effect of salicylic and ascorbic acids on post-harvest vase life of Chrysanthemum cut flowers. \u003cem\u003eHorticultural Science\u003c/em\u003e \u003cstrong\u003e49\u003c/strong\u003e (2022).\u003c/li\u003e\n\u003cli\u003eEisa, E. A., Tilly-M\u0026aacute;ndy, A., Honfi, P., Shala, A. Y. \u0026amp; Gururani, M. A. Chrysanthemum: A comprehensive review on recent developments on in vitro regeneration. \u003cem\u003eBiology\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 1774 (2022).\u003c/li\u003e\n\u003cli\u003eMohit \u0026amp; Bala, M. Response of Chrysanthemum (Chrysanthemum morifolium Ramat.) Varieties to Different Covering Materials for Off Season Flower Production. \u003cem\u003eNational Academy Science Letters\u003c/em\u003e \u003cstrong\u003e47\u003c/strong\u003e, 457-461 (2024).\u003c/li\u003e\n\u003cli\u003ePradhan, A. \u003cem\u003eStandardization of planting time of Chrysanthemum (Chrysanthemum morifolium Ramat.) cv. White Star and Yellow Star for cut flower production in naturally ventilated polyhouse in Gangetic plains of West Bengal\u003c/em\u003e, Department of Floriculture and Landscaping, Bidhan Chandra \u0026hellip;, (2024).\u003c/li\u003e\n\u003cli\u003eSingh, M., Bala, M. \u0026amp; Singh, S. Optimization of nitrogen application and planting geometry for production of cut chrysanthemums (Chrysanthemum morifolium Ramat.). \u003cem\u003eJournal of Horticultural Sciences\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 363-370 (2022).\u003c/li\u003e\n\u003cli\u003eLiu, X.-f., Teng, R., Xiang, L., Li, F. \u0026amp; Chen, K. Sucrose-delaying flower color fading associated with delaying anthocyanin accumulation decrease in cut chrysanthemum. \u003cem\u003ePeerJ\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, e16520 (2023).\u003c/li\u003e\n\u003cli\u003eMalekzadeh, P. The effect of melatonin treatment in improving the antioxidant system and increasing the shelf life of post-harvesting of bell peppers (Capsicum annuum L.). \u003cem\u003eJournal of Environmental Science Studies\u003c/em\u003e \u003cstrong\u003e8\u003c/strong\u003e, 7218-7232 (2024).\u003c/li\u003e\n\u003cli\u003eLi, C., Tao, J. \u0026amp; Wu, Z. Gaseous ozone regulates reactive oxygen species metabolism and ascorbate\u0026ndash;glutathione cycle to delay the senescence of fresh-cut red pitaya (Selenicereus undatus) fruit. \u003cem\u003eScientia Horticulturae\u003c/em\u003e \u003cstrong\u003e312\u003c/strong\u003e, 111839 (2023).\u003c/li\u003e\n\u003cli\u003eArjuna, I. G. M. \u0026amp; Andriani, A. P. R. Utilization of Chrysanthemum Leaf Extract and Molasses in the Cultivation of Chrysanthemum Cut Flowers. \u003cem\u003eAJARCDE (Asian Journal of Applied Research for Community Development and Empowerment)\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 61-65 (2022).\u003c/li\u003e\n\u003cli\u003eAli, A. F., Hatamnia, A. A., Malekzadeh, P., Sayyari, M. \u0026amp; Aghdam, M. S. Exogenous dopamine ameliorates chilling injury in banana fruits by enhancing endogenous dopamine and glycine betaine accumulation and promoting ROS scavenging system activity. \u003cem\u003ePostharvest Biology and Technology\u003c/em\u003e \u003cstrong\u003e205\u003c/strong\u003e, 112521 (2023).\u003c/li\u003e\n\u003cli\u003eKhan, S., Alvi, A. F., Saify, S., Iqbal, N. \u0026amp; Khan, N. A. The ethylene biosynthetic enzymes, 1-aminocyclopropane-1-carboxylate (ACC) synthase (ACS) and ACC oxidase (ACO): the less explored players in abiotic stress tolerance. \u003cem\u003eBiomolecules\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 90 (2024).\u003c/li\u003e\n\u003cli\u003eXia, J.\u003cem\u003e et al.\u003c/em\u003e Genome-Wide In Silico Analysis of 1-Aminocyclopropane-1-carboxylate oxidase (ACO) Gene Family in Rice (Oryza sativa L.). \u003cem\u003ePlants\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 3490 (2024).\u003c/li\u003e\n\u003cli\u003eMun, G. J., Kim, J. S., Lee, C. H. \u0026amp; Lee, H. Y. Strigolactone decreases ethylene biosynthesis in etiolated rice seedlings by reducing expression of OsACO genes. \u003cem\u003eApplied Biological Chemistry\u003c/em\u003e \u003cstrong\u003e68\u003c/strong\u003e, 14 (2025).\u003c/li\u003e\n\u003cli\u003eMalekzadeh, P., Kamrani, A., Abbasi, Z. \u0026amp; Sadeghi, M. Glycine betaine treatment extends the shelf life and retards cap browning of button mushrooms. \u003cem\u003eScientific Reports\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 20796 (2025).\u003c/li\u003e\n\u003cli\u003eMalekzadeh, Khosravi-Nejad, F., Hatamnia, A. A. \u0026amp; Sheikhakbari Mehr, R. Impact of postharvest exogenous \u0026gamma;-aminobutyric acid treatment on cucumber fruit in response to chilling tolerance. \u003cem\u003ePhysiology and Molecular Biology of Plants\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 827-836, doi:10.1007/s12298-017-0475-2 (2017).\u003c/li\u003e\n\u003cli\u003eShahbazi, S., Hatamnia, A. A. \u0026amp; Malekzadeh, P. Effect of Melatonin Treatment on Post-Harvest Life of Broccoli during Storage. \u003cem\u003eJournal of Vegetables Sciences\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e (2023).\u003c/li\u003e\n\u003cli\u003eAftab, M., Lone, H. Y., Wani, A. A., Zargar, M. A. \u0026amp; Tahir, I. GABA-Mediated Defense Mechanisms Against Oxidative Stress: A Case Study in Lilium tigrinum Cut Flowers. \u003cem\u003eJournal of Plant Growth Regulation\u003c/em\u003e, 1-14 (2025).\u003c/li\u003e\n\u003cli\u003eDarras, A. Trends in postharvest technology, marketing and distribution of the native Australian and South African ornamental plants, cut flowers and cut foliage. \u003cem\u003eFrontiers in Horticulture\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, 1584484 (2025).\u003c/li\u003e\n\u003cli\u003eLiu, Y.\u003cem\u003e et al.\u003c/em\u003e Phenylalanine application enhances resistance metabolite accumulation and antioxidant capacity to alleviate chilling injury in postharvest nectarines. \u003cem\u003ePostharvest Biology and Technology\u003c/em\u003e \u003cstrong\u003e231\u003c/strong\u003e, 113912 (2026).\u003c/li\u003e\n\u003cli\u003eChen, S. Review of Recent Advances in Chemical Preservatives for Cut Flowers. \u003cem\u003eBr. J. Biol. Stud\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, 1-8 (2024).\u003c/li\u003e\n\u003cli\u003eEhsanimehr, N., Hosseinifarahi, M., Abdipour, M., Eshghi, S. \u0026amp; Jamali, B. Improving postharvest quality and vase life of cut rose flowers by pre-harvest foliar co-applications of \u0026gamma;-aminobutyric acid and calcium chloride. \u003cem\u003eScientific Reports\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 14520 (2024).\u003c/li\u003e\n\u003cli\u003eKumar, B. S., Aruna, M. \u0026amp; Chanakya, M. Chapter-5 Post-Harvest Handling Techniques of Cut Flowers. \u003cem\u003eResearch and Review\u003c/em\u003e \u003cstrong\u003e89\u003c/strong\u003e, 73 (2024).\u003c/li\u003e\n\u003cli\u003eLiu, Z., Luo, Y. \u0026amp; Liao, W. in \u003cem\u003eOxygen, Nitrogen and Sulfur Species in Post-Harvest Physiology of Horticultural Crops\u003c/em\u003e 23-42 (Elsevier, 2024).\u003c/li\u003e\n\u003cli\u003eMohammadi, M., Ranjbar, M.-E. \u0026amp; Eghlima, G. Impact of gibberellic acid and calcium chloride treatments on neck bending prevention and vase life extension of gerbera cut flowers. \u003cem\u003eJournal of Plant Growth Regulation\u003c/em\u003e \u003cstrong\u003e43\u003c/strong\u003e, 1093-1102 (2024).\u003c/li\u003e\n\u003cli\u003eZulfiqar, F.\u003cem\u003e et al.\u003c/em\u003e Ascorbic acid increases cut flower longevity of sword Lily by regulating oxidative stress and reducing microbial load. \u003cem\u003eJournal of Plant Growth Regulation\u003c/em\u003e \u003cstrong\u003e43\u003c/strong\u003e, 4279-4289 (2024).\u003c/li\u003e\n\u003cli\u003eAl-Fatlawi, K. A. E., Hasan, A. E. \u0026amp; Al-Dulaymi, H. I. Effect of amino acid on the growth and flowering of the Gladiolus plant (priscilla cultivar). \u003cem\u003eInternational Journal of Agricultural \u0026amp; Statistical Sciences\u003c/em\u003e \u003cstrong\u003e18\u003c/strong\u003e (2022).\u003c/li\u003e\n\u003cli\u003eAl-Taie, E. K. S. \u0026amp; Al-Jubouri, A. A. H. Role of Pinching and Spraying Amino Acid on the Vegetative and Flowering Growth Attributes of Okra Varieties. \u003cem\u003eJournal of Agriculture, Aquaculture, and Animal Science\u003c/em\u003e \u003cstrong\u003e2\u003c/strong\u003e, 186-194 (2025).\u003c/li\u003e\n\u003cli\u003eZhang, W., Li, J., Zhang, W., Njie, A. \u0026amp; Pan, X. The changes in C/N, carbohydrate, and amino acid content in leaves during female flower bud differentiation of Juglans sigillata. \u003cem\u003eActa Physiologiae Plantarum\u003c/em\u003e \u003cstrong\u003e44\u003c/strong\u003e, 19 (2022).\u003c/li\u003e\n\u003cli\u003eFarooq, S., Lone, M. L., Altaf, F., Parveen, S. \u0026amp; Tahir, I. Boric acid as a potential substitute for conventional ethylene antagonists in mitigating postharvest flower senescence of Digitalis purpurea. \u003cem\u003eOrnamental Horticulture\u003c/em\u003e \u003cstrong\u003e27\u003c/strong\u003e, 516-525 (2021).\u003c/li\u003e\n\u003cli\u003eHaq, A. u.\u003cem\u003e et al.\u003c/em\u003e Flower senescence coordinated by ethylene: an update and future scope on postharvest biology in the \u0026ldquo;buttercup\u0026rdquo; family. \u003cem\u003eJournal of Plant Growth Regulation\u003c/em\u003e \u003cstrong\u003e43\u003c/strong\u003e, 402-422 (2024).\u003c/li\u003e\n\u003cli\u003eHammann, S. \u0026amp; Vetter, W. Method Development for the Determination of Free and Esterified Sterols in Button Mushrooms (Agaricus bisporus). \u003cem\u003eJournal of Agricultural and Food Chemistry\u003c/em\u003e \u003cstrong\u003e64\u003c/strong\u003e, 3437-3444, doi:10.1021/acs.jafc.6b00383 (2016).\u003c/li\u003e\n\u003cli\u003eJin, Y.\u003cem\u003e et al.\u003c/em\u003e The function of GABA in plant cell growth, development and stress response. \u003cem\u003ePhyton\u003c/em\u003e \u003cstrong\u003e92\u003c/strong\u003e, 2211 (2023).\u003c/li\u003e\n\u003cli\u003eLei, S. \u0026amp; Huang, B. Metabolic regulation of \u0026alpha;-Ketoglutarate associated with heat tolerance in perennial ryegrass. \u003cem\u003ePlant Physiology and Biochemistry\u003c/em\u003e \u003cstrong\u003e190\u003c/strong\u003e, 164-173 (2022).\u003c/li\u003e\n\u003cli\u003eWu, X.\u003cem\u003e et al.\u003c/em\u003e Melatonin: Biosynthesis, content, and function in horticultural plants and potential application. \u003cem\u003eScientia Horticulturae\u003c/em\u003e\u003cstrong\u003e288\u003c/strong\u003e, 110392 (2021).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-8748436/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8748436/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Chrysanthemum is a globally valued cut flower with substantial commercial importance; however, its postharvest longevity remains limited. This study investigates the application of α-ketoglutarate (AKG), a cost-effective and environmentally friendly compound, for extending the vase life of cut chrysanthemum flowers. The potential of AKG to enhance vase life was systematically evaluated in this research. The effects of different AKG concentrations (0–5 mM) on vase performance, physiological traits, biochemical composition, and gene expression were examined. AKG improved water balance and water uptake, thereby enhancing flower hydration. It increased the contents of glutathione, ascorbic acid, total phenolics, and flavonoids, and enhanced the activities of catalase (CAT) and superoxide dismutase (SOD). In addition, AKG effectively inhibited the accumulation of reactive oxygen species (ROS) and reduced malondialdehyde (MDA) levels, electrolyte leakage (EL), and lipoxygenase (LOX) activity. AKG also suppressed ethylene (ETH) production by downregulating the activities of 1-aminocyclopropane-1-carboxylic acid synthase (ACS) and oxidase (ACO), as well as reducing the expression of the CmACS and CmACO genes. Collectively, these findings demonstrate that AKG effectively prolongs vase life and represents a sustainable and eco-friendly strategy for enhancing the postharvest quality of cut chrysanthemums.","manuscriptTitle":"Impact of α-Ketoglutarate Treatment on Enhancing Vase Life of Chrysanthemum by Modulating the Isoprenoid Pathway and Increasing Antioxidant Content","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-20 17:29:52","doi":"10.21203/rs.3.rs-8748436/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-03-04T19:41:16+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-03-03T22:42:13+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"154947537968713054539291570238214568164","date":"2026-03-03T22:15:30+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-02-23T08:11:09+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-02-21T13:44:33+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"171236629714346865652657194648438461145","date":"2026-02-19T13:44:46+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"323324374983856747912870315947789749595","date":"2026-02-19T01:22:51+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"271322491662103915831441933336386342110","date":"2026-02-18T07:54:49+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-02-18T07:40:31+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-02-12T18:39:33+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-02-11T13:51:01+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2026-02-11T13:31:16+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"1a38e3b2-ef17-48cc-9f43-16bcb648e99e","owner":[],"postedDate":"February 20th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":63204437,"name":"Biological sciences/Biochemistry"},{"id":63204438,"name":"Biological sciences/Plant sciences"}],"tags":[],"updatedAt":"2026-05-19T14:23:03+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-20 17:29:52","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8748436","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8748436","identity":"rs-8748436","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}