Microbiological Assessment and Evaluation of Yellow Fever Virus Vaccine Strain 17D Yield in Germ-Free Chicken Eggs | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Microbiological Assessment and Evaluation of Yellow Fever Virus Vaccine Strain 17D Yield in Germ-Free Chicken Eggs Toby Carter, Jean-Rémy Sadeyen, Martin Murphy, Leonard Moran, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7353340/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Internal microbial contamination of specific pathogen-free (SPF) eggs results in batches of vaccines being rejected and negatively impacts vaccine yield. Thus, increasing viral yield will have major implications for vaccine manufacturers. In this context, we analysed the microbiological contents of Germ-Free (GF) eggs and evaluated the yield of Yellow Fever virus vaccine strain 17D (YFV-17D) in GF eggs when compared with SPF eggs from 2 different suppliers. Chick Embryo Fibroblast (CEF) cells were generated from GF and SPF eggs and infected with YFV-17D to quantify the interferon beta (IFN-β) antiviral response. The batch viral yield from GF eggs was 18 fold and 1350 fold higher than that from SPF supplier #1 and SPF supplier #2 respectively. The IFN-β antiviral response of GF-derived CEF cells was 1.6–4.7 fold lower than SPF supplier 1-derived and 1.9–5.1 fold lower than SPF supplier 2-derived CEF cells. In conclusion, the contents of the GF eggs were sterile, the yield of YFV-17D was significantly higher in GF eggs than in SPF eggs, and the higher yield was associated with a significant reduction in IFN-β levels. Biological sciences/Biotechnology Biological sciences/Immunology Biological sciences/Microbiology Germ-Free eggs microbiological analysis Yellow Fever virus Strain 17D viral yield interferon beta egg-based vaccines Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Yellow fever is a disease caused by yellow fever virus (YFV), a zoonotic Flavivirus that is spread by infected female mosquitos, mostly Aedes aegypti [ 1 ]. Yellow fever can be prevented by the Yellow Fever 17D vaccine, a vaccine which uses the 17D strain (hereafter YFV-17D) isolated in 1927 and remains one of the oldest live-attenuated vaccines in use today [ 2 ]. The YFV-17D vaccine is produced in embryonated chicken eggs using a seed-lot system that was developed in 1945 [ 3 ] and it is the only vaccine that is included in International Health Regulations [ 4 ]. The embryonated eggs that are used for vaccine production against various human and animal health pathogens (such as influenza [ 5 , 6 , 7 ], yellow fever [ 8 ], measles and mumps [ 9 ], Newcastle disease [ 10 ] and smallpox [ 11 ]) are derived from specific pathogen-free (SPF) hens. SPF eggs are derived from avian flocks free from the pathogens specified in Chap. 5.2.2 of the European Pharmacopoeia [ 12 ]. Although eggs have been used for many years for the manufacture of vaccines, their use in vaccine production is not without significant challenges [ 13 ]. One of the main challenges faced by egg-based vaccine manufacturers is the risk of internal microbial contamination. Microbial contamination can be a major problem, with entire vaccine batches being destroyed, delaying vaccine release and costing millions of dollars per annum [ 13 ]. In addition, yellow fever vaccine supplies have been limited in recent years [ 14 ]. Despite significant efforts to the contrary, the risk of contamination in egg-based vaccines cannot be fully eliminated due to the unavoidable internal contamination of SPF eggs [ 15 , 16 ]. As noted by Adeyemi et al . [ 13 ], internal bacterial contamination of eggs is caused by the unique anatomy of the avian species and the porosity of the eggshell [ 17 , 18 ]. The pores of the eggshell are particularly vulnerable to bacterial ingress during laying and for approximately 5 minutes after the egg is laid, whilst the outer shell cuticle dries [ 19 ]. In addition, the reproductive tract of avian species merges with the digestive tract in the cloaca, with a single point of exit from the hen for eggs and faecal matter. This results in the porous egg coming into contact with the faeces of the chicken before being laid, resulting in contamination of the fertilised egg [ 20 ]. Consequently, bacteria which are present on the surface of all eggs, including SPF eggs, can leach into the interior of the egg [ 21 , 22 ]. A number of strategies have been developed to mitigate contamination risks in egg-based vaccine production, but unless the problem of internal microbial contamination of the egg is solved, the risk cannot be eliminated. In contrast to SPF eggs, Germ-Free (GF) eggs are produced under aseptic conditions and are free from any internal microbial contamination, thereby overcoming the historical contamination challenges facing egg-based vaccine manufacturers. Viruses are known to suppress and evade the host innate immune response as a strategy to enhance their replication; for example, both influenza A virus and YFV suppress interferon signalling via the interactions of non-structural protein 1 and non-structural protein 4B respectively [ 24 ]. Contamination of SPF eggs with non-specified pathogens may result in ‘immune-modulated’ virus yield with resultant effects on vaccine production and therapeutic applications. The importance of the gut flora in the immune response was highlighted by Ichinohe et al . (2011) [ 25 ] who showed that mice with no gut flora had 10-fold higher influenza viral titres than mice with a functional gut flora. Similarly, Abt et al . (2012) [ 26 ] also showed that the depletion of the gut flora resulted in an impaired capacity to limit viral replication due to impaired IFN responses. Similar results were found in chickens, where a reduction in the IFN response during influenza infection resulted in a higher viral yield being produced [ 27 ]. The objectives of the study were to: a) analyse GF eggs for the presence of internal microbial contamination and b) evaluate if an increase in the yield of YFV-17D in GF eggs, when compared with SPF eggs, is associated with a reduced level of IFN-β. Our hypothesis in this study was based on a finding in a previous study conducted by this team, where a significantly higher yield of human influenza virus (H1N1) was associated with significantly reduced IFN-β levels [ 13 ]. Results Microbiological Analysis by Independent Laboratory. Three hundred and eighty-six (386) eggs were sent to Complete Laboratory Solutions (CLS; an independent specialised contract laboratory in Galway, Ireland) to be tested for the presence or absence of bacteria and fungi. No growth was detected in any of the media used for any of the 386 eggs. The results of the analyses are presented in Table 1. Consignment Number Pooled eggs Bacteriology Analysis* Fungal Analysis 1 14 No growth No growth 2 17 No growth No growth 3 6 No growth No growth 4 20 No growth No growth 5 17 No growth No growth 6 26 No growth No growth 7 25 No growth No growth 8 54 No growth No growth 9 21 No growth No growth 10 48 No growth No growth 11 15 No growth No growth 12 15 No growth No growth 13 32 No growth No growth 14 42 No growth No growth 15 16 No growth No growth 16 12 No growth No growth 17 6 No growth No growth *Bacteriological analysis was performed under aerobic, anaerobic, and micro-aerophilic conditions. Table 1. Results of analysis (bacterial and fungal) of the contents of 386 eggs by Complete Laboratory Solution (CLS), Galway, Ireland Sterility Test Methodology. Twenty (20) eggs were tested for sterility using the methodology based on Chap. 2.6.1 of the European Pharmacopeia [ 27 ]. From the 20 tested eggs, one egg presented growth in TSB and FTM media after 72h of incubation. The vessel containing bacterial growth was subcultured to TSA, and the microorganism was gram-stained, with gram-negative rods being detected. Rapid Microbial Method (bioluminescence). Thirty (30) eggs were tested using the Promicol Novilite® assay. In this methodology, the samples were incubated for 72h, and then a bioluminescence assay was performed. All 30 individual egg samples passed the Promicol assay, indicating the absence of microbial ATP. A sample report from the Promicol Novilite® assay is presented in Fig. 1 . Total Volume of Virus Harvested (ml) from Chicken Embryos Infected on Embryonation Day 9 with Yellow Fever Virus Strain 17D. Ovagen GF eggs and eggs from two SPF suppliers were inoculated with YFV-17D on embryonation day 9 and harvested at 24, 48 and 72 hours post-inoculation (hpi). Both the harvest volumes and viral titres were recorded. The highest volume recovered from Ovagen GF embryos harvested at 72 hpi was 17% higher than that from SPF Supplier #1, and 10% higher than that from SPF Supplier #2). A significant difference was observed between Ovagen GF and SPF Supplier #1 at 72 hpi (p = 0.0412; Fig. 2 ). Viral Titre (pfu/ml) Recovered from Germ-Free and Specific Pathogen-Free Embryos Infected with Yellow Fever Virus Strain 17D at Embryonated Day 9. The highest viral titre was observed in Ovagen GF embryos harvested at 72 hpi, which was 15 times higher than that of SPF Supplier #1 and 1250 times higher than that of SPF Supplier #2. There was a significant difference at 72 hpi between Ovagen GF embryos and SPF Supplier #1 (p = 0.0026), as well as Ovagen GF embryos and SPF Supplier #2 (p = 0.0017) (Fig. 3 ). Total Plaque Forming Units (pfu/batch) Recovered from the Combined Harvest of 5 Germ-Free and Specific Pathogen-Free Embryos Infected with Yellow Fever Virus Strain 17D at Embryonated Day 9. The highest total viral yield was observed in Ovagen GF embryos harvested at 72 hpi, which was 18 times higher than that of SPF Supplier #1 and 1350 times higher than that of SPF Supplier #2. There was a significant difference at 72 hpi between Ovagen GF and SPF Supplier #1 (p = 0.0036), as well as between Ovagen GF and SPF Supplier #2 (p = 0.0025) (Fig. 4 ). Interferon Beta Response to Yellow Fever Virus Strain 17D in Chicken Embryo Fibroblast Cells. The following observations were made regarding IFN-β levels in chick embryo fibroblast (CEF) cells derived from Ovagen GF embryos and from embryos supplied by two different SPF suppliers (Fig. 5 ). These results show that at 1 hour post-inoculation (hpi), IFN-β expression in Ovagen GF CEFs was ~ 4.7 fold lower than that in SPF Supplier #1 (p 0.05) and ~ 2.6 fold lower than that in SPF Supplier #2 (p = 0.0057). The data from 8 hpi show that IFN-β expression in Ovagen GFCEFs was ~ 3.7 fold lower than that for SPF Supplier #1 (p = 0.00741) and ~ 4.1 fold lower than that for SPF Supplier #2 (p = 0.0057). At 12 hpi, IFN-β expression in Ovagen GF CEFs was ~ 1.6 fold lower than that in SPF Supplier #1 (p = 0.0352) and ~ 4.1 fold lower than that in SPF Supplier #2 (p = 0.0329) and at 16 hpi, IFN-β expression in Ovagen GF CEFs was ~ 1.7 fold lower than that in SPF Supplier #1 (p = 0.0043) and ~ 1.9 fold lower than that in SPF Supplier #2 (p = 0.0485). In contrast to the other timepoints, at 24 hpi, IFN-β expression in Ovagen GF CEFs was ~ 2.2 fold numerically lower that for SPF Supplier #1 (p > 0.05) and ~ 1.2 fold numerically higher than that for SPF Supplier #2 (p > 0.05). Discussion The contents of 435 Ovagen GF eggs were analysed for microbial presence using three different methods (total viable count, sterility test and bioluminescence) in three different laboratories. The results of these analyses confirmed that the eggs were sterile, with the exception of one egg. This egg, which represented 0.2% of the total number of eggs analysed in this study, showed evidence of bacterial growth. The authors believe that the contamination was most likely a false positive carried from the exterior of the egg or the environment into the internal contents of the egg during processing. The authors acknowledge that a potential limitation of this study is that this contamination was not further investigated in terms of the identification and speciation of the gram-negative rods detected. Prior to conducting this study, the authors consulted a bio-statistician who performed a power calculation. The result of the power calculation confirmed that 160 eggs would be required to disprove the null hypothesis that the proportion is greater than 0.0001% (one in one million). The data presented in this study show that the contents of 434 of the 435 eggs, which were analysed using the methods listed above, were free of microbial growth. This probability of less than one in one million was used in this study because that is the parameter established by the World Health Organization for the pharmaceutical industry to define a container as sterile [ 28 ]. To confirm the germ-free status of Ovagen GF eggs, the data presented above were generated by two independent laboratories (CLS and Promicol) and the Ovagen internal Microbiology Laboratory. Eggs were also supplied to a global vaccine manufacturer for various evaluations. The independent analysis of the contents of the Germ-Free eggs by that global vaccine manufacturer confirmed that the eggs were sterile on arrival and also after 11 days of incubation (data not presented). These data also show the effectiveness of the egg packaging system developed by Ovagen in maintaining the sterility of the eggs during transport. Bioluminescent reactions, often luciferase-based, are widely used both in vitro and in vivo for food testing [ 29 ], environmental monitoring [ 30 ], diagnostics [ 31 ], drug screening [ 32 – 34 ], and various kinds of biomedical research. The authors of this article submit that the use of bioluminescence to detect adenosine triphosphate (ATP) is a very robust technique to determine if the contents of eggs are sterile as it detects ATP from micro-organisms in the egg content. In that context, the use of bioluminescence in the evaluation of Ovagen GF eggs validates the germ-free status of its eggs. IFNs are a subclass of cytokines which are produced in the body during infection, particularly viral infection, in order to help fight infections [ 35 ]. Their central role in the innate immune system means that many viruses, including yellow fever virus, have evolved to overcome their suppression of viral replication [ 36 ]. As described by Taylor in 2014 [ 37 ], there are many different types of IFNs which differ in their cell type distribution and mode of action. IFN-β in particular is produced by CEF cells in response to viral infection [ 38 ]. One of the key objectives of this study was to determine if an increase in the viral yield of the YFV-17D was associated with reduced levels of IFN-β. The results of this study clearly demonstrated that when YFV-17D was inoculated into eggs, the viral batch yield (pfu/batch) for Ovagen GF embryos harvested at 72 hpi was 18 times higher than SPF Supplier #1 and 1350 times higher than SPF Supplier #2. The significant (p = 0.036-p = 0.025) increase in viral yield was associated with a significant (p = 0.0352-p < 0.0001), almost five-fold reduction in IFN-β levels, which supports our hypothesis. Furthermore, our results corroborate the rodent studies conducted by Ichinohe et al . [ 24 ] and the egg study by Adeyemi et al . [ 13 ] where reduced IFN-β levels were associated with an increase in viral yield. In a previous publication, we observed that the yield of human influenza virus A/H1N1/Victoria/pdm/2019 was higher in GF eggs when compared to SPF eggs, and this higher yield was associated with a significant reduction in IFN-β levels [ 13 ]. To the best of our knowledge, this is the first time that GF eggs have been used for the purpose of assessing the yield of YFV-17D in embryonated eggs, and these data show an important potential application for GF eggs in vaccine manufacturing. We are currently in the process of performing such trials with a number of global vaccine manufacturers. The implications of an increased yield of YFV-17D from eggs for vaccine manufacture will also have significant societal and economic benefits as more vaccines can be produced from eggs at a reduced cost, thereby providing the opportunity for more widescale production of human and animal vaccines from eggs [ 39 ]. Collins and Barrett in 2017 [ 40 ] published a paper on the live attenuated yellow fever 17D vaccine. In that paper they discussed the number of 10 3 pfu/dose in 0.5 ml as being the minimum dose that are required to be present in a dose of Yellow Fever virus vaccine. Based on these data from Collins and Barrett [ 40 ], we calculated the potential number of vaccine doses that can be obtained from a single Ovagen GF egg to be 7,606 doses of yellow fever virus vaccine. In contrast, the calculated number of doses of yellow fever virus vaccine was 422 from SPF Supplier #1 and 6 from SPF Supplier #2. Using the data provided by Collins and Barrett [ 40 ], it is clear that there is a quantifiable benefit in using Ovagen GF eggs for yellow fever vaccine manufacture. Conclusions The results of this study show that the contents of Germ-Free eggs were sterile when determined by a number of different microbiological methods. The yield of YFV-17D was significantly higher in Ovagen GF eggs when compared to SPF eggs, and this higher yield was associated with a significant reduction in IFN-β levels. Materials and Methods Microbiological Assessment of Germ-free eggs Some of the methods in this paper i.e. methods relating to microbiological assessment of germ-free eggs have previously been reported by the authors in Adeyemi et al . [ 13 ]. The relevant sections are indicated below. Minimal Sample Size Determination The methods in this section have previously been reported by the authors in Adeyemi et al . [ 13 ]. A power calculation was performed using a simulation with R software. The calculation was performed to evaluate 80% power to reject the null hypothesis that the proportion of microbiologically contaminated eggs is greater than 0.0001% (one in one million). This calculation was based on an assumed proportion of 1% or higher in the case that the null hypothesis is false, with an exact binomial test and a 5% level of significance. The power calculation predicted that a sample size of 160 eggs would be needed to demonstrate that the proportion of bacterially contaminated eggs is, at most, 0.0001%. Microbiological Analysis by Independent Laboratory The methods in this section have previously been reported by the authors in Adeyemi et al . [ 13 ] and were performed according to the Standard Operating Procedures of CLS. A total of 386 eggs, produced by hens in the Ovagen Germ-Free Egg Production Facility, were sent to CLS to be tested for the presence of bacteria (aerobic, anaerobic, and microaerophilic) and fungi. The eggs were sent in 17 consignments. For this test, the eggs were pooled to be tested according to the number of eggs delivered each time. Each eggshell was disinfected with sterile 70% isopropyl alcohol (IPA). The egg was then broken using a sterile spatula, and the content (white and yolk) was aseptically transferred to a sterile container. The eggs were pooled in batches of different sizes (Table 2 ), and 10 ml of pooled eggs were transferred into Tryptone Soy Broth (TSB) in 90 ml containers which was used for sample enrichment. Each pooled sample was incubated for 24 hours at 30°C to 35°C. After incubation, 1 ml of the pooled sample was aseptically inoculated onto 3 Tryptone Soy Agar (TSA) plates which were used for bacterial analysis (aerobic and anaerobic) and one Sabouraud Dextrose Agar (SDA) plate which was used for fungal analysis. The plates were incubated as follows: Bacterial (Aerobic): One TSA plate incubated for 3 days at 30°C to 35°C. Bacterial (Anaerobic): One TSA plate incubated for 3 days at 30°C to 35°C under anaerobic conditions inside an anaerobic gas jar containing an anaerobic gas generator pack and indicator (BD GasPak™ EZ EZ Anaerobe Pouch System). Bacterial (Microaerophilic): One TSA plate incubated for 3 days at 30°C to 35°C under microaerophilic conditions inside an anaerobic gas jar containing a microaerophilic gas generator (BD GasPak™ EZ CampyPouch System). Fungus analysis: One SDA plate incubated for 5 days at 20°C to 25°C. After incubation was completed, the plates were checked for the presence of microbial growth, and the results were reported as colony forming-units/10 ml of pooled eggs. Table 2 Number of consignment of eggs and number of eggs per consignment shipped to Complete Laboratory Solutions, Galway, Ireland for analysis. The eggs were pooled to be tested according to the consignment size. Consignment number Number of Pooled eggs Consignment number Number of Pooled eggs 1 14 10 48 2 17 11 15 3 6 12 15 4 20 13 32 5 17 14 42 6 26 15 16 7 25 16 12 8 54 17 6 9 21 Sterility Test Methodology The methods in this section have previously been reported by the authors in Adeyemi et al . [ 13 ] and were performed according to the Standard Operating Procedures of Ovagen Group Limited. A total of 20 eggs were collected from separate avian isolators in the Ovagen Germ-Free Egg Production Facility. All eggs were individually tested in a laminar flow cabinet according to the sterility test based on the methodology described in Chap. 2.6.1 of the European Pharmacopeia [ 27 ]. The eggshells were disinfected with 70% sterile IPA and allowed to dry. The egg was then broken using a sterile spatula, and the content (white and yolk) was aseptically transferred to a sterile sample bag. A total of 50 ml of Fluid A (Millipore®: this was used for sample dilution and is the pharmacopoeial solution described in the European Pharmacopoeia Chap. 2.6.1) was added to the bag, and it was mixed in a stomacher® for 3 minutes. About 1 ml of the egg content was aseptically added to 100 ml of TSB (Millipore®: for fungal and aerobic bacterial analysis, according to the European Pharmacopoeia Chap. 2.6.1) and Fluid Thioglycollate Medium (FTM) (Millipore®: for aerobic and anaerobic bacterial analysis, according to the European Pharmacopoeia Chap. 2.6.1 [ 27 ]). TSB was incubated at 20°C to 25°C for 14 days, and FTM was incubated at 30°C to 35°C for 14 days. As the egg renders turbidity to the media, it was not possible to distinguish microbial growth. After 14 days of incubation, 1 ml of each media was transferred to a fresh bottle of the same media and incubated together with the original bottle for 4 additional days under the same conditions described above. After incubation was completed, the bottles were checked for the presence of microbial growth. Rapid Microbial Method (bioluminescence) The methods in this section have previously been reported by the authors in Adeyemi et al . [ 13 ] and were performed according to the Standard Operating Procedures of Promicol. The chosen method was a qualitative bioluminescence method where adenosine triphosphate (ATP) is detected through an assay using luciferin and luciferase, which emit light in proportion to the amount of the ATP present. The sample was cultivated in Promicol Novilite® culture media (one of TSB, Sabouraud Dextrose Broth (SDB) or anaerobic TSB) and the emitted light was measured with a Promicol Novilite® bioluminometer following the manufacturer’s protocol and expressed in relative light units (RLU). All work was performed in a laminar flow cabinet. A total of 30 eggs, produced by hens in the Ovagen Germ-Free Egg Production Facility were individually tested using the Promicol Novilite® assay. For each egg, the eggshell was disinfected with 70% sterile IPA and allowed to dry. Each egg was then broken using a sterile spatula, and the content (white and yolk) was aseptically transferred to a sterile sample bag. A total of 50 ml of Fluid A (Millipore®) was added to the bag then placed in a stomacher® for 3 minutes. One (1) ml of the egg content mix was added to TSB (Promicol®: for aerobic bacterial analysis), SDB (Promicol®: for fungal analysis), and TSBana (Promicol®: for anaerobic bacterial analysis). TSB and TSBana were incubated at 30°C to 35°C for 72 hours. SDB was incubated at 20°C to 25°C for 72 hours. After the incubation period, 100 µl of each vessel was added to a microplate in triplicates, and the plate was read on Promicol Novilite® following the manufacturer’s protocol. Replication of Yellow Fever Virus Strain 17D This methodology was used to compare the virus replication of YFV-17D in White Leghorn Germ-Free eggs with SPF eggs from 2 different suppliers (SPF Supplier #1 and SPF Supplier #2). The breeds of hens used by SPF supplier #1 and #2 are White Leghorns with different genetic strains. One of these suppliers has a genetic line which is not resistant to any of the avian leukosis virus subgroups, which is important for leukosis studies and both suppliers meet the requirements of the European Pharmacopoeia Section 5.2.2 (Chicken Flocks Free from Specified Pathogens for the Production and Quality Control of Vaccines) [ 12 ]. Two (2) batches of 9-day-old embryonated eggs (24 eggs per batch) from each egg supplier were inoculated with 1,000 pfu YFV-17D diluted to 100 µl with phosphate-buffered saline (PBS) per embryo and incubated at 37°C under 45% humidity for a total of 72 hours, with one cycle of turning every 30 minutes (Fig. 6 ). Figure 6 . Yellow fever virus strain 17D inoculation scheme to evaluate virus replication in Germ-Free and SPF eggs. As a control, 3 eggs from each source were inoculated with 100 µl PBSa only. For each infected group, 5 live embryos per timepoint were harvested; embryo survival was determined by candling immediately prior to harvest. At the designated timepoint, embryos were removed from the egg, decapitated, then washed in sterile water. The washed embryos were placed in a blender cup with 5 ml sterile water per embryos, then blended for 2 minutes to ensure total homogenisation. The homogenate was centrifuged at 4,000 rpm at 4°C for 15 minutes, then the resulting supernatant centrifuged at 4,000 rpm at 4°C for 60 minutes. The supernatant from the second spin was decanted and YFV stabiliser (an 8:3 mix of 50% sucrose (Sigma-Aldrich S0389):50% sodium glutamate (Merck 6106-04-3) was added at a ratio of 7:25 stabiliser:supernatant. The stabilised supernatant was kept at -80°C before being defrosted and titrated by plaque assay (described below). Quantification of Interferon-β Gene Expression To investigate if the differences in viral replication could be due to an altered IFN-β antiviral response, the levels of IFN-β gene expression in chicken embryo fibroblasts (CEF cells) infected with YFV-17D were quantified by reverse transcriptase quantitative PCR (RT-qPCR). The CEF cells, which were derived from Ovagen GF eggs and SPF eggs from both SPF suppliers, were obtained according to Hernandez and Brown (2010) [ 41 ]. Two (2) embryos from each source were culled at embryonated day 9 and the pooled CEF cells were seeded into 6-well cell culture plates containing CEF growth media (Medium E199 (Sigma-Aldrich M4530), 10% foetal calf serum (FCS; LSP S-001A-BR), 1% Penicillin-Streptomycin (Pen/Strep; Gibco 15140-122), 10% Tryptose Phosphate Broth (TPB; Sigma-Aldrich T8159), 0.25% Trypsin-EDTA (Sigma-Aldrich T4049)). The cells were incubated at 37°C under 5% CO2 for 24 hours. CEF cells were washed with PBS and infected with YFV-17D diluted in CEF infection media (Medium E199 supplemented with 10% TPB and 1% Pen/Strep) at 0.01 multiplication of infection for 1 hour and excess virus was removed by aspiration. The cells were washed with PBS and fresh CEF growth media was added. Control wells were inoculated with infection media only. At 1, 4, 8, 12, 16 and 24 hpi the total cell RNA was harvested with a QIAGEN RNA extraction kit (QIAGEN Cat No. 74106) following the kit protocol. IFN-β gene expression was then quantified by RT-qPCR using primers and probes specific to IFN-β and the housekeeping gene RDLP0 (Table 3 ). Gene expression was quantified as absolute 2 −ΔΔCt as per Livak and Schmittgen (2001) [ 42 ]. Table 3 List of primers used to determine relative gene expressions of IFN-β Target Gene Primer name Primer sequence IFN-β IFNβ FP IFNβ RP IFNβ probe CCTCCAACACCTCTTCAACATG TGGCGTGTGCGGTCAAT FAM-TTAGCAGCCCACACACTCCAAAACACTG-TAMRA RPLP0 RPLP0 FP RPLP0 RP RPLP0 probe TTGGGCATCACCACAAAGATT CCCACTTGTCTCCGGTCTTAA FAM-CATCACTCAGAATTTCAATGGTCCCTCGGG-TAMRA Yellow Fever Virus Plaque Assay The YFV strain 17D was obtained from culture collections at the UK Health Security Agency (Porton Down, Salisbury, UK). Plaque assays were used to quantify YFV-17D replication in embryonated hen eggs. In brief, Vero cells (ECACC Cat. No. 84113001) were seeded in 12-well cell culture plates at a density of 2 x 10 5 cells per well in 1 ml Vero growth medium (DMEM (Sigma-Aldrich D6429) supplemented with 10% FCS and 1% Pen/Strep). The next day, the growth media was aspirated, the cells washed once with PBS and infected with YFV-17D diluted in infection medium (DMEM supplemented with 2% FCS and 1% Pen/Strep) for 2 hours at 37°C. The inoculum was aspirated, the cells washed once with PSB, then incubated under 1 ml 0.8% Avicel overlay (a 1:3 ratio of 3.2% Avicel (3.2 g Avicel (FMC Biopolymer CL-611)) and 0.425 g NaCl (SLS CHE3326) in 100 ml sterile water: Infection media) per well for 5 days at 37°C without movement. After incubation, the overlay was removed, cells washed with PBS then stained with 0.1% Crystal Violet (80 ml 1% Crystal Violet (Sigma-Aldrich V5265), 160 ml methanol (Sigma-Aldrich 32213) and 620 ml sterile water) for 1 hour. The stained monolayer was washed gently then air-dried, and the viral titre calculated by counting the number of plaques at the lowest dilution (with at least 10 per well) and multiplying by the inoculum volume (333 µl) and dilution factor to yield the pfu per ml. Statistical Analysis Data are presented as ± S.E.M. (Standard Error of Mean) and statistical analysis was performed using two-way ANOVA with Tukey’s multiple comparisons (GraphPad Prism version 10.0.0 for Windows, GraphPad Software, Boston, Massachusetts, US). Declarations Animal welfare. All work involving embryonated eggs was carried out in strict accordance with European and United Kingdom Home Office legislation. The in ovo work undertaken in this study was reviewed and approved by the Pirbright Institute Animal Welfare and Ethical Review Body to comply with the relevant UK legislation, in accord with the UK Home Project License PP6471846. All experiments involving infection of embryonated hen eggs or cultured cells with yellow fever virus strain 17D were undertaken in a licensed biosafety level 2 conditions. Ethical statement. The authors declare that the study is reported in accordance with ARRIVE guidelines. The handling and care of the fertilised eggs were carried out under approved project licences PP6471846, issued by the UK Home Office in compliance with the Animals (Scientific Procedures) Act 1986 and European Union Legislation (Directive 2010/63/EU). The protocol was reviewed and approved by the Animal Welfare and Ethical Review Board at The Pirbright Institute., Data availability statement The datasets supporting the conclusions of this article are included within the article text. References Elvidge, S. Developing the 17D yellow fever vaccine. Nature Milestones Vaccines S11 , (2020). Beck, A. S. & Barett, A. D. Current status and future prospects of yellow fever vaccines. Expert Rev. Vaccines . 14 , 1479–1492 (2015). Hansen, C. A. & Barrett, A. D. T. The Present and Future of Yellow Fever Vaccines. Pharmaceuticals 14 , 891–917 (2021). International Health Regulations. ; World Health Organisation: Geneva, Switzerland (2016). (2005). Gupta, D. & Mohan, S. Influenza vaccine: A review on current scenario and future prospects. J. Genet. Eng. Biotechnol. 21 , 154–164 (2023). Trombetta, C. M., Marchi, S., Manini, I., Lazzeri, G. & Montomoli, E. Challenges in the development of egg-independent vaccines for influenza. Expert Rev. Vaccines . 18 , 737–750 (2019). Subbarao, K. & Barr, I. A tale of two mutations: Beginning to understand the problems with egg-based influenza vaccines? Cell. Host Microbe . 25 , 773–775 (2019). Gerhardt, C. M. B. et al. Safety of yellow fever vaccine administration in confirmed egg-allergic patients. Vaccine 38 , 6539–6544 (2020). Cerecedo Carballo, I., Pastor, D., Bartolomé, M. C., Zavala, B. & de la Sánchez Cano, M. Hoz Caballer, B. Safety of measles-mumps-rubella vaccine (MMR) in patients allergic to eggs. Allergol. et Immunopathol. 35 , 105–109 (2007). Ghadimipour, R. et al. Monitoring of Newcastle Disease Virus Vaccine Strain Replication in Embryonated Chicken Eggs by Reverse Transcription-Polymerase Chain Reaction. Arch. Razi Inst. 78 , 767–773 (2023). European Directorate for the Quality of Medicines & HealthCare. Guideline for vaccine containing vaccinia virus produced in cell culture (Smallpox Vaccine) (Document No. 65_Smallpox_150620). (2020). Chicken flocks free. from specified pathogens for the production and quality control of vaccines. Eur. Pharm. 11.5 , 50202 (2023). Adeyemi, O. et al. Microbiological Assessment and Evaluation of Virus Yield in Germ-free Chicken Eggs. Open. Microbiol. J. 18 , 1–12 (2024). Gianchecchi, E., Cianchi, V., Torelli, A. & Montomoli, E. Yellow Fever: Origin, Epidemiology, Preventative Strategies and Future Prospects. Vaccines (Basel) . 10 , 372–388 (2022). Cader, S., Goburdhun, D. & Neetoo, H. Assessment of the microbial safety and quality of eggs from small and large-scale hen breeders. J. World’s Poult. Res. 4 , 75–81 (2014). Mayes, F. J. & Takeballi, M. A. Microbial contamination of the hen’s egg: A review. J. Food Prot. 46 , 1092–1098 (1983). De Reu, K. et al. Eggshell factors influencing eggshell penetration and whole egg contamination by different bacteria, including Salmonella enteritidis. Int. J. Food Microbiol. 112 , 253–260 (2006). Padron, M. Salmonella typhimurium penetration through the eggshell of hatching eggs. Avian Dis. 34 , 463–465 (1990). Berrang, M. E., Frank, J. F., Buhr, R. J. & Bailey, J. S. Cox, N.A. Eggshell membrane structure and penetration by Salmonella typhimurium. J. Food Prot. 62 , 73–76 (1999). Lock, J. L., Dolman, J. & Board, R. G. Observations on the mode of bacterial infection of hens’ eggs. FEMS Microbiol. Lett. 100 , 71–73 (1992). Vadehra, D. V., Baker, R. C. & Naylor, H. B. Infection routes of bacteria into chicken eggs. J. Food Sci. 35 , 61–62 (1970). Burley, R. W. & Vadehra, D. V. The avian egg: chemistry and biology (John Wiley and Sons, Inc., 1989). Muñoz-Jordán, J. L. et al. Inhibition of alpha/beta interferon signaling by the NS4B protein of flaviviruses. J. Virol. 79 , 8004–8013 (2005). Ichinohe, T. et al. Microbiota regulates immune defense against respiratory tract influenza A virus infection. Proc. Natl. Acad. Sci. USA 108, 5354–5359 (2011). Abt, M. C. et al. Commensal bacteria calibrate the activation threshold of innate antiviral immunity. Immunity 37 , 158–170 (2012). Richt, J. A. & García-Sastre, A. Attenuated influenza virus vaccines with modified NS1 proteins. Curr. Top. Microbiol. Immunol. 333 , 177–195 (2009). European Directorate for the Quality of Medicines & HealthCare. European Pharmacopoeia Chap. 2.6.1: Test for Sterility. (2020). Sterility testing. World Health Organisation (2024). https://www.who.int/teams/health-product-policy-and-standards/standards-and-specifications/norms-and-standards/sterilitytesting Shama, G. & Malik, D. J. The uses and abuses of rapid bioluminescence-based ATP assays. Int. J. Hyg. Environ. Health . 216 , 115–125 (2013). Girotti, S., Ferri, E. N., Fumo, M. G. & Maiolini, E. Monitoring of environmental pollutants by bioluminescent bacteria. Anal. Chim. Acta . 608 , 2–29 (2008). Frank, L. A. & Krasitskaya, V. V. Application of enzyme bioluminescence for medical diagnostics. Adv. Biochem. Eng. Biotechnol. 144 , 175–197 (2014). Hasson, S. A. et al. Chemogenomic profiling of endogenous PARK2 expression using a genome-edited coincidence reporter. ACS Chem. Biol. 10 , 1188–1197 (2015). Kobayashi, M. et al. Establishment and characterization of transplantable, luminescence labeled rat renal cell carcinoma cell lines. J. Urol. 183 , 2029–2035 (2010). Lampinen, J., Virta, M. & Karp, M. Use of controlled luciferase expression to monitor chemicals affecting protein synthesis. Appl. Environ. Microbiol. 61 , 2981–2989 (1995). Haller, O., Kochs, G. & Weber, F. The interferon response circuit: induction and suppression by pathogenic viruses. Virology 344 , 119–130 (2006). Laurent-Rolle, M. et al. The interferon signaling antagonist function of yellow fever virus NS5 protein is activated by type I interferon. Cell. Host Microbe . 16 , 314–327 (2014). Taylor, M. W. Interferons. In: Viruses and Man: A History of Interactions (ed. Taylor, M.W.) 22, 101–119Springer, Berlin, (2014). Kang, Y. et al. Newcastle disease virus infection in chicken embryonic fibroblasts but not duck embryonic fibroblasts is associated with elevated host innate immune response. Virol. J. 13 , 41–51 (2016). Becker, T., Elbahesh, H., Reperant, L. A., Rimmelzwaan, G. F. & Osterhaus A.D.M.E. Influenza vaccines: Successes and continuing challenges. J. Infect. Dis. 224 , S405–S419 (2021). Collins, N. D. & Barrett, A. D. Live Attenuated Yellow Fever 17D Vaccine: A Legacy Vaccine Still Controlling Outbreaks In Modern Day. Curr. Infect. Dis. Rep. 19 , 14–23 (2017). Hernandez, R. & Brown, D. T. Growth and maintenance of chick embryo fibroblasts (CEF). Curr. Protoc. Microbiol. 17, A.4I.1-A.4I.8 (2010). Livak, K. J. & Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25 , 402–408 (2001). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7353340","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":522613233,"identity":"4ab5a08a-7081-4101-a57d-c79594005ae6","order_by":0,"name":"Toby Carter","email":"","orcid":"","institution":"The Pirbright Institute","correspondingAuthor":false,"prefix":"","firstName":"Toby","middleName":"","lastName":"Carter","suffix":""},{"id":522613238,"identity":"bc26203d-80bd-4ff7-87f0-380847497e7c","order_by":1,"name":"Jean-Rémy Sadeyen","email":"","orcid":"","institution":"The Pirbright Institute","correspondingAuthor":false,"prefix":"","firstName":"Jean-Rémy","middleName":"","lastName":"Sadeyen","suffix":""},{"id":522613239,"identity":"b0a348da-ac2f-42d1-84f6-d18eb01285c8","order_by":2,"name":"Martin Murphy","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA80lEQVRIiWNgGAWjYLCCBAjFxsBQQZwGxgaEljPEamGAaWFsI0K9bvvZ5w8e7mCINrh99thj3nk2if39i489YKixicalxexMumFD4hmG3A3n8tKNebelJc648SzdgOFYWm4DLi0H0hgbEtuAWs7wmEnzbjtszHDjjJkEY8Nh3FrOP0PWMuewsfyN89/wa7mBYkvDYTmD8z1sBLQ8Y5yR2CaRO/MMX5rknGNpcoY32MwkEvD55Xwaw8efbTa5fWd4j0m8qbHhkTt/+JnEhxobnFqgQAKIeRiYeMDsBHh6IAR4GBh/gGj+A8SpHwWjYBSMghEDAB0uXLdSZfaBAAAAAElFTkSuQmCC","orcid":"","institution":"Ovagen Group Ltd","correspondingAuthor":true,"prefix":"","firstName":"Martin","middleName":"","lastName":"Murphy","suffix":""},{"id":522613240,"identity":"22bd70a9-e60a-4a87-bf25-5ef5af070e15","order_by":3,"name":"Leonard Moran","email":"","orcid":"","institution":"Ovagen Group Ltd","correspondingAuthor":false,"prefix":"","firstName":"Leonard","middleName":"","lastName":"Moran","suffix":""},{"id":522613243,"identity":"dd0df3a1-e21b-4f92-b3aa-98be8168c99c","order_by":4,"name":"Catherine Caulfield","email":"","orcid":"","institution":"Ovagen Group Ltd","correspondingAuthor":false,"prefix":"","firstName":"Catherine","middleName":"","lastName":"Caulfield","suffix":""},{"id":522613245,"identity":"c9aa64b6-afaf-4140-93c3-0f676ec7efe1","order_by":5,"name":"Munir Iqbal","email":"","orcid":"","institution":"The Pirbright Institute","correspondingAuthor":false,"prefix":"","firstName":"Munir","middleName":"","lastName":"Iqbal","suffix":""}],"badges":[],"createdAt":"2025-08-12 08:38:20","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7353340/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7353340/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":92592421,"identity":"8dd853ce-8e5c-466c-814c-2eaf93634bbd","added_by":"auto","created_at":"2025-10-01 12:12:49","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":619439,"visible":true,"origin":"","legend":"","description":"","filename":"YellowFeverPaperforScientificReportsForSubmissionamended15SEP2025.docx","url":"https://assets-eu.researchsquare.com/files/rs-7353340/v1/0c7b18d5fc4ea93f8dbc9674.docx"},{"id":92592414,"identity":"f1a0b3b9-994e-45d8-9b20-74606c7056ae","added_by":"auto","created_at":"2025-10-01 12:12:49","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7868,"visible":true,"origin":"","legend":"","description":"","filename":"f7380f02ecb54f42b29328718a37cd3a.json","url":"https://assets-eu.researchsquare.com/files/rs-7353340/v1/2f8b6b68a5d8394d2de28072.json"},{"id":92592666,"identity":"503d7485-e9b8-4432-898d-6aee876a6f13","added_by":"auto","created_at":"2025-10-01 12:20:49","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":111427,"visible":true,"origin":"","legend":"","description":"","filename":"f7380f02ecb54f42b29328718a37cd3a1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7353340/v1/0a0c6091f8df7d9543bfc66e.xml"},{"id":92592418,"identity":"2d57f548-7b9c-4270-a9a5-9e998ee37e58","added_by":"auto","created_at":"2025-10-01 12:12:49","extension":"png","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":118903,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7353340/v1/c45ee538f47539dc57c7db57.png"},{"id":92592423,"identity":"047bb4e7-3b06-46b4-8264-6a41b2409149","added_by":"auto","created_at":"2025-10-01 12:12:49","extension":"jpeg","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":227768,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7353340/v1/54476a16c05d7278f6432b81.jpeg"},{"id":92592434,"identity":"e860a6fd-2ac7-4a6c-ab99-a88c3c8b9362","added_by":"auto","created_at":"2025-10-01 12:12:49","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":243776,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7353340/v1/df45f12343d5d2e18f695f4d.jpeg"},{"id":92592427,"identity":"6de03b5a-db00-4277-a0e1-65b90f5211d3","added_by":"auto","created_at":"2025-10-01 12:12:49","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":224163,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7353340/v1/5bec3613e50dfed4964e3c00.jpeg"},{"id":92592433,"identity":"562c4877-6eac-4559-bc1c-4677ce5aa230","added_by":"auto","created_at":"2025-10-01 12:12:49","extension":"emf","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":178628,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.emf","url":"https://assets-eu.researchsquare.com/files/rs-7353340/v1/2d18df026ed95ea57342c5f8.emf"},{"id":92592424,"identity":"bb6272c9-2e21-4c72-b2bd-6265a92dfd13","added_by":"auto","created_at":"2025-10-01 12:12:49","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":77010,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7353340/v1/91b93aed31067c7d544b4c2b.png"},{"id":92592426,"identity":"dae04e58-9295-4008-9b83-5940b6a69066","added_by":"auto","created_at":"2025-10-01 12:12:49","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":19113,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7353340/v1/2c18a608fd91348bac2c94ad.png"},{"id":92593374,"identity":"dec74b54-adf5-480c-9dc0-640ec0e046ad","added_by":"auto","created_at":"2025-10-01 12:28:49","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":49433,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7353340/v1/b74f9d457a7f568a1282cb9b.png"},{"id":92592425,"identity":"4a170e1f-ce26-44d1-a3e1-267ef233f1f6","added_by":"auto","created_at":"2025-10-01 12:12:49","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":50393,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7353340/v1/327d27dc46dae7fd8ccbb7c2.png"},{"id":92592431,"identity":"b72dbe32-1cce-4cf6-890b-f571a8e1ad1d","added_by":"auto","created_at":"2025-10-01 12:12:49","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":51438,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7353340/v1/4f5ef1c2d60a3729de25f72b.png"},{"id":92593564,"identity":"5d6a88ab-5bd2-438c-99b5-fc7545317f9b","added_by":"auto","created_at":"2025-10-01 12:36:49","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":15180,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7353340/v1/32b02bbe7a3c792a63a8e886.png"},{"id":92592673,"identity":"5a8eaac7-0aea-4d5c-848d-022366033421","added_by":"auto","created_at":"2025-10-01 12:20:49","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":50491,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7353340/v1/7cd2331227220195b846bddb.png"},{"id":92592436,"identity":"56e92587-8cf0-46b7-8533-656e72dda245","added_by":"auto","created_at":"2025-10-01 12:12:49","extension":"xml","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":110378,"visible":true,"origin":"","legend":"","description":"","filename":"f7380f02ecb54f42b29328718a37cd3a1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7353340/v1/0ab771636d37b1274de3b378.xml"},{"id":92592676,"identity":"5ed2d5c5-79cc-404d-ba5d-33a463a22d5f","added_by":"auto","created_at":"2025-10-01 12:20:49","extension":"html","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":120837,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7353340/v1/f08eec4bcdfddc21ebd3dcf6.html"},{"id":92593372,"identity":"96517550-84e2-4b81-af00-53bbbd31f649","added_by":"auto","created_at":"2025-10-01 12:28:49","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":163392,"visible":true,"origin":"","legend":"\u003cp\u003eSample report of Promicol Novilite® assay. Pass = no contamination detected. Fail = contamination detected.\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-7353340/v1/a1d2cd53e0a261c285f2846f.png"},{"id":92592413,"identity":"2b91d10b-7d76-4c3a-b6e7-fa449ebb20e7","added_by":"auto","created_at":"2025-10-01 12:12:49","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":80740,"visible":true,"origin":"","legend":"\u003cp\u003eComparative harvested volume (ml/batch) of virus recovered from Ovagen Germ Free (OVA-GF) and specific pathogen-free (SPF) eggs. The data are presented as n=2 ±S.E.M. (standard error of mean) and were analysed by two-way ANOVA with Tukey’s multiple comparisons (n refers to the number of batches, with n= 5 embryos in each batch). *Significant difference (p=0.0412) at 72 hpi between Ovagen GF and SPF Supplier #1.\u003c/p\u003e","description":"","filename":"image2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7353340/v1/dcb26d2dd94a736dc283bc36.jpeg"},{"id":92592656,"identity":"c0d631ac-bec0-4fed-ba39-7f2ea781ac90","added_by":"auto","created_at":"2025-10-01 12:20:49","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":101285,"visible":true,"origin":"","legend":"\u003cp\u003eComparative viral titre (pfu/ml) recovered from Ovagen Germ Free (OVA-GF) and specific pathogen-free (SPF) eggs. The data are presented as n=2±S.E.M. (standard error of mean) and were analysed by two-way ANOVA with Tukey’s multiple comparisons (n refers to the number of batches, with each individual batch containing 5 embryos). **Significant difference in viral titre between harvest from Ovagen GF and \u0026nbsp;SPF Supplier #1 embryos (p=0.0026), and Ovagen GF and SPF Supplier #2 embryos (p=0.0017).\u003c/p\u003e","description":"","filename":"image3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7353340/v1/373c0609806c6f0548848a7e.jpeg"},{"id":92592663,"identity":"5d7f26c9-93a4-44f9-ba66-938217359895","added_by":"auto","created_at":"2025-10-01 12:20:49","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":81733,"visible":true,"origin":"","legend":"\u003cp\u003eTotal plaque forming units (pfu) recovered from the total harvest of Ovagen Germ Free (OVA-GF) and specific pathogen-free (SPF) eggs (pfu/batch). Data are presented as mean ± S.E.M. (standard error of the mean) for n = 2 batches, with each batch consisting of 5 embryos. Statistical analysis was performed using two-way ANOVA with Tukey’s multiple comparisons test. \u0026nbsp;**Significant difference were observed at 72 hpi between Ovagen GF and SPF Supplier #1 (p=0.0036), and between Ovagen GF \u0026nbsp;and SPF Supplier #2 (p=0.0025).\u003c/p\u003e","description":"","filename":"image4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7353340/v1/ca5a73852f94f398e95b91f9.jpeg"},{"id":92592417,"identity":"a1e519ac-2d8c-44f7-9719-e9c68c991aa2","added_by":"auto","created_at":"2025-10-01 12:12:49","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":44632,"visible":true,"origin":"","legend":"\u003cp\u003eInterferon beta\u003cem\u003e \u003c/em\u003e(IFN-β) comparison. Levels of IFN-β expression were measured at 1h, 4h, 8h, 12h, 16h, and 24h in chick embryo fibroblast cultures derived at embryonic day 9 from Ovagen Germ Free (OVA-GF) eggs and SPF eggs from two different suppliers. Data are presented as absolute 2\u003csup\u003e-ΔΔCt\u003c/sup\u003e values, n=6±S.E.M. and were analysed by two-way ANOVA with Tukey’s multiple comparisons. Significant differences were observed at different time points include: 1 hpi *p=0.0118, ****p\u0026lt;0.0001; 4 hpi **p=0.0057; 8 hpi **(Ovagen-GF vs SPF #1 p=0.0074), **(Ovagen-GF vs SPF #2 p=0.0057); 12 hpi *(Ovagen-GF vs SPF #1 p=0.0352), *(Ovagen-GF vs SPF #2 p=0.0329); 16 hpi *p=0.0485, **p=0.0043.\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-7353340/v1/117c509273ef525b7cab3ca8.png"},{"id":92592420,"identity":"63b07a11-5af2-4166-89eb-db44cf6189fa","added_by":"auto","created_at":"2025-10-01 12:12:49","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":131262,"visible":true,"origin":"","legend":"\u003cp\u003eYellow fever virus strain 17D inoculation scheme to evaluate virus replication in Germ-Free and SPF eggs.\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-7353340/v1/bd5514bd94230d576b6e7224.png"},{"id":95266725,"identity":"629ea726-b11e-4be1-830e-006862fde635","added_by":"auto","created_at":"2025-11-06 06:08:58","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1616392,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7353340/v1/c91c8014-4dad-42fb-9cfa-3d2fd5e2ae5b.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Microbiological Assessment and Evaluation of Yellow Fever Virus Vaccine Strain 17D Yield in Germ-Free Chicken Eggs","fulltext":[{"header":"Introduction","content":"\u003cp\u003eYellow fever is a disease caused by yellow fever virus (YFV), a zoonotic \u003cem\u003eFlavivirus\u003c/em\u003e that is spread by infected female mosquitos, mostly \u003cem\u003eAedes aegypti\u003c/em\u003e [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Yellow fever can be prevented by the Yellow Fever 17D vaccine, a vaccine which uses the 17D strain (hereafter YFV-17D) isolated in 1927 and remains one of the oldest live-attenuated vaccines in use today [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The YFV-17D vaccine is produced in embryonated chicken eggs using a seed-lot system that was developed in 1945 [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e] and it is the only vaccine that is included in International Health Regulations [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. The embryonated eggs that are used for vaccine production against various human and animal health pathogens (such as influenza [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], yellow fever [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], measles and mumps [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], Newcastle disease [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e] and smallpox [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]) are derived from specific pathogen-free (SPF) hens. SPF eggs are derived from avian flocks free from the pathogens specified in Chap.\u0026nbsp;5.2.2 of the European Pharmacopoeia [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eAlthough eggs have been used for many years for the manufacture of vaccines, their use in vaccine production is not without significant challenges [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. One of the main challenges faced by egg-based vaccine manufacturers is the risk of internal microbial contamination. Microbial contamination can be a major problem, with entire vaccine batches being destroyed, delaying vaccine release and costing millions of dollars per annum [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. In addition, yellow fever vaccine supplies have been limited in recent years [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eDespite significant efforts to the contrary, the risk of contamination in egg-based vaccines cannot be fully eliminated due to the unavoidable internal contamination of SPF eggs [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. As noted by Adeyemi \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], internal bacterial contamination of eggs is caused by the unique anatomy of the avian species and the porosity of the eggshell [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. The pores of the eggshell are particularly vulnerable to bacterial ingress during laying and for approximately 5 minutes after the egg is laid, whilst the outer shell cuticle dries [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. In addition, the reproductive tract of avian species merges with the digestive tract in the cloaca, with a single point of exit from the hen for eggs and faecal matter. This results in the porous egg coming into contact with the faeces of the chicken before being laid, resulting in contamination of the fertilised egg [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Consequently, bacteria which are present on the surface of all eggs, including SPF eggs, can leach into the interior of the egg [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eA number of strategies have been developed to mitigate contamination risks in egg-based vaccine production, but unless the problem of internal microbial contamination of the egg is solved, the risk cannot be eliminated. In contrast to SPF eggs, Germ-Free (GF) eggs are produced under aseptic conditions and are free from any internal microbial contamination, thereby overcoming the historical contamination challenges facing egg-based vaccine manufacturers.\u003c/p\u003e\u003cp\u003eViruses are known to suppress and evade the host innate immune response as a strategy to enhance their replication; for example, both influenza A virus and YFV suppress interferon signalling via the interactions of non-structural protein 1 and non-structural protein 4B respectively [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Contamination of SPF eggs with non-specified pathogens may result in \u0026lsquo;immune-modulated\u0026rsquo; virus yield with resultant effects on vaccine production and therapeutic applications.\u003c/p\u003e\u003cp\u003eThe importance of the gut flora in the immune response was highlighted by Ichinohe \u003cem\u003eet al\u003c/em\u003e. (2011) [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e] who showed that mice with no gut flora had 10-fold higher influenza viral titres than mice with a functional gut flora. Similarly, Abt \u003cem\u003eet al\u003c/em\u003e. (2012) [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e] also showed that the depletion of the gut flora resulted in an impaired capacity to limit viral replication due to impaired IFN responses. Similar results were found in chickens, where a reduction in the IFN response during influenza infection resulted in a higher viral yield being produced [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe objectives of the study were to: a) analyse GF eggs for the presence of internal microbial contamination and b) evaluate if an increase in the yield of YFV-17D in GF eggs, when compared with SPF eggs, is associated with a reduced level of IFN-β. Our hypothesis in this study was based on a finding in a previous study conducted by this team, where a significantly higher yield of human influenza virus (H1N1) was associated with significantly reduced IFN-β levels [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cb\u003eMicrobiological Analysis by Independent Laboratory.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThree hundred and eighty-six (386) eggs were sent to Complete Laboratory Solutions (CLS; an independent specialised contract laboratory in Galway, Ireland) to be tested for the presence or absence of bacteria and fungi. No growth was detected in any of the media used for any of the 386 eggs. The results of the analyses are presented in Table\u0026nbsp;1.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eConsignment Number\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePooled eggs\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eBacteriology Analysis*\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eFungal Analysis\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e14\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e2\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e17\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e3\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e4\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e20\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e5\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e17\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e6\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e26\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e7\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e25\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e8\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e54\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e9\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e21\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e10\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e48\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e11\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e15\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e12\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e15\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e13\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e32\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e14\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e42\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e15\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e16\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e16\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e12\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e17\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNo growth\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e*Bacteriological analysis was performed under aerobic, anaerobic, and micro-aerophilic conditions.\u003c/p\u003e\u003cp\u003e\u003cb\u003eTable\u0026nbsp;1.\u003c/b\u003e Results of analysis (bacterial and fungal) of the contents of 386 eggs by Complete Laboratory Solution (CLS), Galway, Ireland\u003c/p\u003e\u003cp\u003e\u003cb\u003eSterility Test Methodology.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTwenty (20) eggs were tested for sterility using the methodology based on Chap.\u0026nbsp;2.6.1 of the European Pharmacopeia [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. From the 20 tested eggs, one egg presented growth in TSB and FTM media after 72h of incubation.\u003c/p\u003e\u003cp\u003eThe vessel containing bacterial growth was subcultured to TSA, and the microorganism was gram-stained, with gram-negative rods being detected.\u003c/p\u003e\u003cp\u003e\u003cb\u003eRapid Microbial Method (bioluminescence).\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThirty (30) eggs were tested using the Promicol Novilite\u0026reg; assay. In this methodology, the samples were incubated for 72h, and then a bioluminescence assay was performed.\u003c/p\u003e\u003cp\u003eAll 30 individual egg samples passed the Promicol assay, indicating the absence of microbial ATP. A sample report from the Promicol Novilite\u0026reg; assay is presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eTotal Volume of Virus Harvested (ml) from Chicken Embryos Infected on Embryonation Day 9 with Yellow Fever Virus Strain 17D.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eOvagen GF eggs and eggs from two SPF suppliers were inoculated with YFV-17D on \u003cb\u003eembryonation\u003c/b\u003e day 9 and harvested at 24, 48 and 72 hours post-inoculation (hpi). Both the harvest volumes and viral titres were recorded. The highest volume recovered from Ovagen GF embryos harvested at 72 hpi was 17% higher than that from SPF Supplier #1, and 10% higher than that from SPF Supplier #2). A significant difference was observed between Ovagen GF and SPF Supplier #1 at 72 hpi (p\u0026thinsp;=\u0026thinsp;0.0412; Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eViral Titre (pfu/ml) Recovered from Germ-Free and Specific Pathogen-Free Embryos Infected with Yellow Fever Virus Strain 17D at Embryonated Day 9.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe highest viral titre was observed in Ovagen GF embryos harvested at 72 hpi, which was 15 times higher than that of SPF Supplier #1 and 1250 times higher than that of SPF Supplier #2. There was a significant difference at 72 hpi between Ovagen GF embryos and SPF Supplier #1 (p\u0026thinsp;=\u0026thinsp;0.0026), as well as Ovagen GF embryos and SPF Supplier #2 (p\u0026thinsp;=\u0026thinsp;0.0017) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eTotal Plaque Forming Units (pfu/batch) Recovered from the Combined Harvest of 5 Germ-Free and Specific Pathogen-Free Embryos Infected with Yellow Fever Virus Strain 17D at Embryonated Day 9.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe highest total viral yield was observed in Ovagen GF embryos harvested at 72 hpi, which was 18 times higher than that of SPF Supplier #1 and 1350 times higher than that of SPF Supplier #2. There was a significant difference at 72 hpi between Ovagen GF and SPF Supplier #1 (p\u0026thinsp;=\u0026thinsp;0.0036), as well as between Ovagen GF and SPF Supplier #2 (p\u0026thinsp;=\u0026thinsp;0.0025) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eInterferon Beta Response to Yellow Fever Virus Strain 17D in Chicken Embryo Fibroblast Cells.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe following observations were made regarding IFN-β levels in chick embryo fibroblast (CEF) cells derived from Ovagen GF embryos and from embryos supplied by two different SPF suppliers (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). These results show that at 1 hour post-inoculation (hpi), IFN-β expression in Ovagen GF CEFs was ~\u0026thinsp;4.7 fold lower than that in SPF Supplier #1 (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) and ~\u0026thinsp;5.1 fold lower than that in SPF Supplier #2 (p\u0026thinsp;=\u0026thinsp;0.0118). At 4 hpi, IFN-β expression in Ovagen GF CEFs was ~\u0026thinsp;1.8 fold lower than that in SPF Supplier #1 (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05) and ~\u0026thinsp;2.6 fold lower than that in SPF Supplier #2 (p\u0026thinsp;=\u0026thinsp;0.0057). The data from 8 hpi show that IFN-β expression in Ovagen GFCEFs was ~\u0026thinsp;3.7 fold lower than that for SPF Supplier #1 (p\u0026thinsp;=\u0026thinsp;0.00741) and ~\u0026thinsp;4.1 fold lower than that for SPF Supplier #2 (p\u0026thinsp;=\u0026thinsp;0.0057). At 12 hpi, IFN-β expression in Ovagen GF CEFs was ~\u0026thinsp;1.6 fold lower than that in SPF Supplier #1 (p\u0026thinsp;=\u0026thinsp;0.0352) and ~\u0026thinsp;4.1 fold lower than that in SPF Supplier #2 (p\u0026thinsp;=\u0026thinsp;0.0329) and at 16 hpi, IFN-β expression in Ovagen GF CEFs was ~\u0026thinsp;1.7 fold lower than that in SPF Supplier #1 (p\u0026thinsp;=\u0026thinsp;0.0043) and ~\u0026thinsp;1.9 fold lower than that in SPF Supplier #2 (p\u0026thinsp;=\u0026thinsp;0.0485). In contrast to the other timepoints, at 24 hpi, IFN-β expression in Ovagen GF CEFs was ~\u0026thinsp;2.2 fold numerically lower that for SPF Supplier #1 (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05) and ~\u0026thinsp;1.2 fold numerically higher than that for SPF Supplier #2 (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe contents of 435 Ovagen GF eggs were analysed for microbial presence using three different methods (total viable count, sterility test and bioluminescence) in three different laboratories. The results of these analyses confirmed that the eggs were sterile, with the exception of one egg. This egg, which represented 0.2% of the total number of eggs analysed in this study, showed evidence of bacterial growth. The authors believe that the contamination was most likely a false positive carried from the exterior of the egg or the environment into the internal contents of the egg during processing. The authors acknowledge that a potential limitation of this study is that this contamination was not further investigated in terms of the identification and speciation of the gram-negative rods detected.\u003c/p\u003e\u003cp\u003ePrior to conducting this study, the authors consulted a bio-statistician who performed a power calculation. The result of the power calculation confirmed that 160 eggs would be required to disprove the null hypothesis that the proportion is greater than 0.0001% (one in one million). The data presented in this study show that the contents of 434 of the 435 eggs, which were analysed using the methods listed above, were free of microbial growth. This probability of less than one in one million was used in this study because that is the parameter established by the World Health Organization for the pharmaceutical industry to define a container as sterile [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eTo confirm the germ-free status of Ovagen GF eggs, the data presented above were generated by two independent laboratories (CLS and Promicol) and the Ovagen internal Microbiology Laboratory. Eggs were also supplied to a global vaccine manufacturer for various evaluations. The independent analysis of the contents of the Germ-Free eggs by that global vaccine manufacturer confirmed that the eggs were sterile on arrival and also after 11 days of incubation (data not presented). These data also show the effectiveness of the egg packaging system developed by Ovagen in maintaining the sterility of the eggs during transport.\u003c/p\u003e\u003cp\u003eBioluminescent reactions, often luciferase-based, are widely used both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e for food testing [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], environmental monitoring [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e], diagnostics [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], drug screening [\u003cspan additionalcitationids=\"CR33\" citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e], and various kinds of biomedical research. The authors of this article submit that the use of bioluminescence to detect adenosine triphosphate (ATP) is a very robust technique to determine if the contents of eggs are sterile as it detects ATP from micro-organisms in the egg content. In that context, the use of bioluminescence in the evaluation of Ovagen GF eggs validates the germ-free status of its eggs.\u003c/p\u003e\u003cp\u003eIFNs are a subclass of cytokines which are produced in the body during infection, particularly viral infection, in order to help fight infections [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Their central role in the innate immune system means that many viruses, including yellow fever virus, have evolved to overcome their suppression of viral replication [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. As described by Taylor in 2014 [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e], there are many different types of IFNs which differ in their cell type distribution and mode of action. IFN-β in particular is produced by CEF cells in response to viral infection [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. One of the key objectives of this study was to determine if an increase in the viral yield of the YFV-17D was associated with reduced levels of IFN-β.\u003c/p\u003e\u003cp\u003eThe results of this study clearly demonstrated that when YFV-17D was inoculated into eggs, the viral batch yield (pfu/batch) for Ovagen GF embryos harvested at 72 hpi was 18 times higher than SPF Supplier #1 and 1350 times higher than SPF Supplier #2. The significant (p\u0026thinsp;=\u0026thinsp;0.036-p\u0026thinsp;=\u0026thinsp;0.025) increase in viral yield was associated with a significant (p\u0026thinsp;=\u0026thinsp;0.0352-p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), almost five-fold reduction in IFN-β levels, which supports our hypothesis. Furthermore, our results corroborate the rodent studies conducted by Ichinohe \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e] and the egg study by Adeyemi \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e] where reduced IFN-β levels were associated with an increase in viral yield.\u003c/p\u003e\u003cp\u003eIn a previous publication, we observed that the yield of human influenza virus A/H1N1/Victoria/pdm/2019 was higher in GF eggs when compared to SPF eggs, and this higher yield was associated with a significant reduction in IFN-β levels [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. To the best of our knowledge, this is the first time that GF eggs have been used for the purpose of assessing the yield of YFV-17D in embryonated eggs, and these data show an important potential application for GF eggs in vaccine manufacturing. We are currently in the process of performing such trials with a number of global vaccine manufacturers.\u003c/p\u003e\u003cp\u003eThe implications of an increased yield of YFV-17D from eggs for vaccine manufacture will also have significant societal and economic benefits as more vaccines can be produced from eggs at a reduced cost, thereby providing the opportunity for more widescale production of human and animal vaccines from eggs [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Collins and Barrett in 2017 [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e] published a paper on the live attenuated yellow fever 17D vaccine. In that paper they discussed the number of 10\u003csup\u003e3\u003c/sup\u003e pfu/dose in 0.5 ml as being the minimum dose that are required to be present in a dose of Yellow Fever virus vaccine. Based on these data from Collins and Barrett [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e], we calculated the potential number of vaccine doses that can be obtained from a single Ovagen GF egg to be 7,606 doses of yellow fever virus vaccine. In contrast, the calculated number of doses of yellow fever virus vaccine was 422 from SPF Supplier #1 and 6 from SPF Supplier #2. Using the data provided by Collins and Barrett [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e], it is clear that there is a quantifiable benefit in using Ovagen GF eggs for yellow fever vaccine manufacture.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eThe results of this study show that the contents of Germ-Free eggs were sterile when determined by a number of different microbiological methods. The yield of YFV-17D was significantly higher in Ovagen GF eggs when compared to SPF eggs, and this higher yield was associated with a significant reduction in IFN-β levels.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003eMicrobiological Assessment of Germ-free eggs\u003c/h2\u003e\u003cp\u003eSome of the methods in this paper i.e. methods relating to microbiological assessment of germ-free eggs have previously been reported by the authors in Adeyemi \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. The relevant sections are indicated below.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eMinimal Sample Size Determination\u003c/h3\u003e\n\u003cp\u003eThe methods in this section have previously been reported by the authors in Adeyemi \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. A power calculation was performed using a simulation with R software. The calculation was performed to evaluate 80% power to reject the null hypothesis that the proportion of microbiologically contaminated eggs is greater than 0.0001% (one in one million). This calculation was based on an assumed proportion of 1% or higher in the case that the null hypothesis is false, with an exact binomial test and a 5% level of significance. The power calculation predicted that a sample size of 160 eggs would be needed to demonstrate that the proportion of bacterially contaminated eggs is, at most, 0.0001%.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eMicrobiological Analysis by Independent Laboratory\u003c/h2\u003e\u003cp\u003eThe methods in this section have previously been reported by the authors in Adeyemi \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e] and were performed according to the Standard Operating Procedures of CLS. A total of 386 eggs, produced by hens in the Ovagen Germ-Free Egg Production Facility, were sent to CLS to be tested for the presence of bacteria (aerobic, anaerobic, and microaerophilic) and fungi. The eggs were sent in 17 consignments. For this test, the eggs were pooled to be tested according to the number of eggs delivered each time.\u003c/p\u003e\u003cp\u003eEach eggshell was disinfected with sterile 70% isopropyl alcohol (IPA). The egg was then broken using a sterile spatula, and the content (white and yolk) was aseptically transferred to a sterile container. The eggs were pooled in batches of different sizes (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e2\u003c/span\u003e), and 10 ml of pooled eggs were transferred into Tryptone Soy Broth (TSB) in 90 ml containers which was used for sample enrichment. Each pooled sample was incubated for 24 hours at 30\u0026deg;C to 35\u0026deg;C. After incubation, 1 ml of the pooled sample was aseptically inoculated onto 3 Tryptone Soy Agar (TSA) plates which were used for bacterial analysis (aerobic and anaerobic) and one Sabouraud Dextrose Agar (SDA) plate which was used for fungal analysis. The plates were incubated as follows:\u003c/p\u003e\u003cp\u003e\u003col\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eBacterial (Aerobic): One TSA plate incubated for 3 days at 30\u0026deg;C to 35\u0026deg;C.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eBacterial (Anaerobic): One TSA plate incubated for 3 days at 30\u0026deg;C to 35\u0026deg;C under anaerobic conditions inside an anaerobic gas jar containing an anaerobic gas generator pack and indicator (BD GasPak\u0026trade; EZ EZ Anaerobe Pouch System).\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eBacterial (Microaerophilic): One TSA plate incubated for 3 days at 30\u0026deg;C to 35\u0026deg;C under microaerophilic conditions inside an anaerobic gas jar containing a microaerophilic gas generator (BD GasPak\u0026trade; EZ CampyPouch System).\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003cspan\u003e\u003cli\u003e\u003cp\u003eFungus analysis: One SDA plate incubated for 5 days at 20\u0026deg;C to 25\u0026deg;C. After incubation was completed, the plates were checked for the presence of microbial growth, and the results were reported as colony forming-units/10 ml of pooled eggs.\u003c/p\u003e\u003c/li\u003e\u003c/span\u003e\u003c/ol\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eNumber of consignment of eggs and number of eggs per consignment shipped to Complete Laboratory Solutions, Galway, Ireland for analysis. The eggs were pooled to be tested according to the consignment size.\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eConsignment number\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eNumber of\u003c/p\u003e\u003cp\u003ePooled eggs\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eConsignment number\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNumber of\u003c/p\u003e\u003cp\u003ePooled eggs\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e1\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e14\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003e10\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e48\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e2\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e17\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003e11\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e15\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e3\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003e12\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e15\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e4\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e20\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003e13\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e32\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e5\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e17\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003e14\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e42\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e6\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e26\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003e15\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e16\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e7\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e25\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003e16\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e12\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e8\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e54\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e\u003cb\u003e17\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e6\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cb\u003e9\u003c/b\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e21\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eSterility Test Methodology\u003c/h3\u003e\n\u003cp\u003eThe methods in this section have previously been reported by the authors in Adeyemi \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e] and were performed according to the Standard Operating Procedures of Ovagen Group Limited. A total of 20 eggs were collected from separate avian isolators in the Ovagen Germ-Free Egg Production Facility. All eggs were individually tested in a laminar flow cabinet according to the sterility test based on the methodology described in Chap.\u0026nbsp;2.6.1 of the European Pharmacopeia [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe eggshells were disinfected with 70% sterile IPA and allowed to dry. The egg was then broken using a sterile spatula, and the content (white and yolk) was aseptically transferred to a sterile sample bag. A total of 50 ml of Fluid A (Millipore\u0026reg;: this was used for sample dilution and is the pharmacopoeial solution described in the European Pharmacopoeia Chap.\u0026nbsp;2.6.1) was added to the bag, and it was mixed in a stomacher\u0026reg; for 3 minutes. About 1 ml of the egg content was aseptically added to 100 ml of TSB (Millipore\u0026reg;: for fungal and aerobic bacterial analysis, according to the European Pharmacopoeia Chap.\u0026nbsp;2.6.1) and Fluid Thioglycollate Medium (FTM) (Millipore\u0026reg;: for aerobic and anaerobic bacterial analysis, according to the European Pharmacopoeia Chap.\u0026nbsp;2.6.1 [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]).\u003c/p\u003e\u003cp\u003eTSB was incubated at 20\u0026deg;C to 25\u0026deg;C for 14 days, and FTM was incubated at 30\u0026deg;C to 35\u0026deg;C for 14 days. As the egg renders turbidity to the media, it was not possible to distinguish microbial growth. After 14 days of incubation, 1 ml of each media was transferred to a fresh bottle of the same media and incubated together with the original bottle for 4 additional days under the same conditions described above. After incubation was completed, the bottles were checked for the presence of microbial growth.\u003c/p\u003e\n\u003ch3\u003eRapid Microbial Method (bioluminescence)\u003c/h3\u003e\n\u003cp\u003eThe methods in this section have previously been reported by the authors in Adeyemi \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e] and were performed according to the Standard Operating Procedures of Promicol. The chosen method was a qualitative bioluminescence method where adenosine triphosphate (ATP) is detected through an assay using luciferin and luciferase, which emit light in proportion to the amount of the ATP present. The sample was cultivated in Promicol Novilite\u0026reg; culture media (one of TSB, \u003cem\u003eSabouraud\u003c/em\u003e Dextrose Broth (SDB) or anaerobic TSB) and the emitted light was measured with a Promicol Novilite\u0026reg; bioluminometer following the manufacturer\u0026rsquo;s protocol and expressed in relative light units (RLU). All work was performed in a laminar flow cabinet. A total of 30 eggs, produced by hens in the Ovagen Germ-Free Egg Production Facility were individually tested using the Promicol Novilite\u0026reg; assay. For each egg, the eggshell was disinfected with 70% sterile IPA and allowed to dry. Each egg was then broken using a sterile spatula, and the content (white and yolk) was aseptically transferred to a sterile sample bag. A total of 50 ml of Fluid A (Millipore\u0026reg;) was added to the bag then placed in a stomacher\u0026reg; for 3 minutes. One (1) ml of the egg content mix was added to TSB (Promicol\u0026reg;: for aerobic bacterial analysis), SDB (Promicol\u0026reg;: for fungal analysis), and TSBana (Promicol\u0026reg;: for anaerobic bacterial analysis).\u003c/p\u003e\u003cp\u003eTSB and TSBana were incubated at 30\u0026deg;C to 35\u0026deg;C for 72 hours. SDB was incubated at 20\u0026deg;C to 25\u0026deg;C for 72 hours. After the incubation period, 100 \u0026micro;l of each vessel was added to a microplate in triplicates, and the plate was read on Promicol Novilite\u0026reg; following the manufacturer\u0026rsquo;s protocol.\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eReplication of Yellow Fever Virus Strain 17D\u003c/h2\u003e\u003cp\u003eThis methodology was used to compare the virus replication of YFV-17D in White Leghorn Germ-Free eggs with SPF eggs from 2 different suppliers (SPF Supplier #1 and SPF Supplier #2). The breeds of hens used by SPF supplier #1 and #2 are White Leghorns with different genetic strains. One of these suppliers has a genetic line which is not resistant to any of the avian leukosis virus subgroups, which is important for leukosis studies and both suppliers meet the requirements of the European Pharmacopoeia Section 5.2.2 (Chicken Flocks Free from Specified Pathogens for the Production and Quality Control of Vaccines) [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTwo (2) batches of 9-day-old embryonated eggs (24 eggs per batch) from each egg supplier were inoculated with 1,000 pfu YFV-17D diluted to 100 \u0026micro;l with phosphate-buffered saline (PBS) per embryo and incubated at 37\u0026deg;C under 45% humidity for a total of 72 hours, with one cycle of turning every 30 minutes (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eFigure \u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e. Yellow fever virus strain 17D inoculation scheme to evaluate virus replication in Germ-Free and SPF eggs.\u003c/p\u003e\u003cp\u003eAs a control, 3 eggs from each source were inoculated with 100 \u0026micro;l PBSa only. For each infected group, 5 live embryos per timepoint were harvested; embryo survival was determined by candling immediately prior to harvest.\u003c/p\u003e\u003cp\u003eAt the designated timepoint, embryos were removed from the egg, decapitated, then washed in sterile water. The washed embryos were placed in a blender cup with 5 ml sterile water per embryos, then blended for 2 minutes to ensure total homogenisation. The homogenate was centrifuged at 4,000 rpm at 4\u0026deg;C for 15 minutes, then the resulting supernatant centrifuged at 4,000 rpm at 4\u0026deg;C for 60 minutes. The supernatant from the second spin was decanted and YFV stabiliser (an 8:3 mix of 50% sucrose (Sigma-Aldrich S0389):50% sodium glutamate (Merck 6106-04-3) was added at a ratio of 7:25 stabiliser:supernatant. The stabilised supernatant was kept at -80\u0026deg;C before being defrosted and titrated by plaque assay (described below).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eQuantification of Interferon-β Gene Expression\u003c/h2\u003e\u003cp\u003eTo investigate if the differences in viral replication could be due to an altered IFN-β antiviral response, the levels of IFN-β gene expression in chicken embryo fibroblasts (CEF cells) infected with YFV-17D were quantified by reverse transcriptase quantitative PCR (RT-qPCR). The CEF cells, which were derived from Ovagen GF eggs and SPF eggs from both SPF suppliers, were obtained according to Hernandez and Brown (2010) [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Two (2) embryos from each source were culled at embryonated day 9 and the pooled CEF cells were seeded into 6-well cell culture plates containing CEF growth media (Medium E199 (Sigma-Aldrich M4530), 10% foetal calf serum (FCS; LSP S-001A-BR), 1% Penicillin-Streptomycin (Pen/Strep; Gibco 15140-122), 10% Tryptose Phosphate Broth (TPB; Sigma-Aldrich T8159), 0.25% Trypsin-EDTA (Sigma-Aldrich T4049)). The cells were incubated at 37\u0026deg;C under 5% CO2 for 24 hours.\u003c/p\u003e\u003cp\u003eCEF cells were washed with PBS and infected with YFV-17D diluted in CEF infection media (Medium E199 supplemented with 10% TPB and 1% Pen/Strep) at 0.01 multiplication of infection for 1 hour and excess virus was removed by aspiration. The cells were washed with PBS and fresh CEF growth media was added. Control wells were inoculated with infection media only.\u003c/p\u003e\u003cp\u003eAt 1, 4, 8, 12, 16 and 24 hpi the total cell RNA was harvested with a QIAGEN RNA extraction kit (QIAGEN Cat No. 74106) following the kit protocol. IFN-β gene expression was then quantified by RT-qPCR using primers and probes specific to IFN-β and the housekeeping gene RDLP0 (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Gene expression was quantified as absolute 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e as per Livak and Schmittgen (2001) [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e].\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eList of primers used to determine relative gene expressions of IFN-β\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTarget Gene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003ePrimer name\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003ePrimer sequence\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIFN-β\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eIFNβ FP\u003c/p\u003e\u003cp\u003eIFNβ RP\u003c/p\u003e\u003cp\u003eIFNβ probe\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCCTCCAACACCTCTTCAACATG\u003c/p\u003e\u003cp\u003eTGGCGTGTGCGGTCAAT\u003c/p\u003e\u003cp\u003eFAM-TTAGCAGCCCACACACTCCAAAACACTG-TAMRA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRPLP0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eRPLP0 FP\u003c/p\u003e\u003cp\u003eRPLP0 RP\u003c/p\u003e\u003cp\u003eRPLP0\u003c/p\u003e\u003cp\u003eprobe\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTTGGGCATCACCACAAAGATT\u003c/p\u003e\u003cp\u003eCCCACTTGTCTCCGGTCTTAA\u003c/p\u003e\u003cp\u003eFAM-CATCACTCAGAATTTCAATGGTCCCTCGGG-TAMRA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eYellow Fever Virus Plaque Assay\u003c/h2\u003e\u003cp\u003eThe YFV strain 17D was obtained from culture collections at the UK Health Security Agency (Porton Down, Salisbury, UK). Plaque assays were used to quantify YFV-17D replication in embryonated hen eggs. In brief, Vero cells (ECACC Cat. No. 84113001) were seeded in 12-well cell culture plates at a density of 2 x 10\u003csup\u003e5\u003c/sup\u003e cells per well in 1 ml Vero growth medium (DMEM (Sigma-Aldrich D6429) supplemented with 10% FCS and 1% Pen/Strep). The next day, the growth media was aspirated, the cells washed once with PBS and infected with YFV-17D diluted in infection medium (DMEM supplemented with 2% FCS and 1% Pen/Strep) for 2 hours at 37\u0026deg;C. The inoculum was aspirated, the cells washed once with PSB, then incubated under 1 ml 0.8% Avicel overlay (a 1:3 ratio of 3.2% Avicel (3.2 g Avicel (FMC Biopolymer CL-611)) and 0.425 g NaCl (SLS CHE3326) in 100 ml sterile water: Infection media) per well for 5 days at 37\u0026deg;C without movement. After incubation, the overlay was removed, cells washed with PBS then stained with 0.1% Crystal Violet (80 ml 1% Crystal Violet (Sigma-Aldrich V5265), 160 ml methanol (Sigma-Aldrich 32213) and 620 ml sterile water) for 1 hour. The stained monolayer was washed gently then air-dried, and the viral titre calculated by counting the number of plaques at the lowest dilution (with at least 10 per well) and multiplying by the inoculum volume (333 \u0026micro;l) and dilution factor to yield the pfu per ml.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eStatistical Analysis\u003c/h2\u003e\u003cp\u003eData are presented as \u0026plusmn;\u0026thinsp;S.E.M. (Standard Error of Mean) and statistical analysis was performed using two-way ANOVA with Tukey\u0026rsquo;s multiple comparisons (GraphPad Prism version 10.0.0 for Windows, GraphPad Software, Boston, Massachusetts, US).\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAnimal welfare.\u003c/strong\u003e\u0026nbsp; All work involving embryonated eggs was carried out in strict accordance with European and United Kingdom Home Office legislation. The in ovo work undertaken in this study was reviewed and approved by the Pirbright Institute Animal Welfare and Ethical Review Body to comply with the relevant UK legislation, in accord with the UK Home Project License PP6471846. All experiments involving infection of embryonated hen eggs or cultured cells with yellow fever virus strain 17D were undertaken in a licensed biosafety level 2 conditions.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical statement.\u0026nbsp;\u003c/strong\u003eThe authors declare that the study is reported in accordance with ARRIVE guidelines. The handling and care of the fertilised eggs were carried out under approved project licences PP6471846, issued by the UK Home Office in compliance with the Animals (Scientific Procedures) Act 1986 and European Union Legislation (Directive 2010/63/EU). \u0026nbsp;The protocol was reviewed and approved by the Animal Welfare and Ethical Review Board at The Pirbright Institute.,\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets supporting the conclusions of this article are included within the article text.\u0026nbsp;\u003c/p\u003e\n"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eElvidge, S. Developing the 17D yellow fever vaccine. \u003cem\u003eNature Milestones Vaccines\u003c/em\u003e \u003cb\u003eS11\u003c/b\u003e, (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBeck, A. S. \u0026amp; Barett, A. D. Current status and future prospects of yellow fever vaccines. \u003cem\u003eExpert Rev. Vaccines\u003c/em\u003e. \u003cb\u003e14\u003c/b\u003e, 1479\u0026ndash;1492 (2015).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHansen, C. A. \u0026amp; Barrett, A. D. T. The Present and Future of Yellow Fever Vaccines. \u003cem\u003ePharmaceuticals\u003c/em\u003e \u003cb\u003e14\u003c/b\u003e, 891\u0026ndash;917 (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eInternational Health Regulations. ; World Health Organisation: Geneva, Switzerland (2016). (2005).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGupta, D. \u0026amp; Mohan, S. Influenza vaccine: A review on current scenario and future prospects. \u003cem\u003eJ. Genet. Eng. Biotechnol.\u003c/em\u003e \u003cb\u003e21\u003c/b\u003e, 154\u0026ndash;164 (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTrombetta, C. M., Marchi, S., Manini, I., Lazzeri, G. \u0026amp; Montomoli, E. Challenges in the development of egg-independent vaccines for influenza. \u003cem\u003eExpert Rev. Vaccines\u003c/em\u003e. \u003cb\u003e18\u003c/b\u003e, 737\u0026ndash;750 (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSubbarao, K. \u0026amp; Barr, I. A tale of two mutations: Beginning to understand the problems with egg-based influenza vaccines? \u003cem\u003eCell. Host Microbe\u003c/em\u003e. \u003cb\u003e25\u003c/b\u003e, 773\u0026ndash;775 (2019).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGerhardt, C. M. B. et al. Safety of yellow fever vaccine administration in confirmed egg-allergic patients. \u003cem\u003eVaccine\u003c/em\u003e \u003cb\u003e38\u003c/b\u003e, 6539\u0026ndash;6544 (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCerecedo Carballo, I., Pastor, D., Bartolom\u0026eacute;, M. C., Zavala, B. \u0026amp; de la S\u0026aacute;nchez Cano, M. Hoz Caballer, B. Safety of measles-mumps-rubella vaccine (MMR) in patients allergic to eggs. \u003cem\u003eAllergol. et Immunopathol.\u003c/em\u003e \u003cb\u003e35\u003c/b\u003e, 105\u0026ndash;109 (2007).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGhadimipour, R. et al. Monitoring of Newcastle Disease Virus Vaccine Strain Replication in Embryonated Chicken Eggs by Reverse Transcription-Polymerase Chain Reaction. \u003cem\u003eArch. Razi Inst.\u003c/em\u003e \u003cb\u003e78\u003c/b\u003e, 767\u0026ndash;773 (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEuropean Directorate for the Quality of Medicines \u0026amp; HealthCare. Guideline for vaccine containing vaccinia virus produced in cell culture (Smallpox Vaccine) (Document No. 65_Smallpox_150620). (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChicken flocks free. from specified pathogens for the production and quality control of vaccines. \u003cem\u003eEur. Pharm.\u003c/em\u003e \u003cb\u003e11.5\u003c/b\u003e, 50202 (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAdeyemi, O. et al. Microbiological Assessment and Evaluation of Virus Yield in Germ-free Chicken Eggs. \u003cem\u003eOpen. Microbiol. J.\u003c/em\u003e \u003cb\u003e18\u003c/b\u003e, 1\u0026ndash;12 (2024).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGianchecchi, E., Cianchi, V., Torelli, A. \u0026amp; Montomoli, E. Yellow Fever: Origin, Epidemiology, Preventative Strategies and Future Prospects. \u003cem\u003eVaccines (Basel)\u003c/em\u003e. \u003cb\u003e10\u003c/b\u003e, 372\u0026ndash;388 (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCader, S., Goburdhun, D. \u0026amp; Neetoo, H. Assessment of the microbial safety and quality of eggs from small and large-scale hen breeders. \u003cem\u003eJ. World\u0026rsquo;s Poult. Res.\u003c/em\u003e \u003cb\u003e4\u003c/b\u003e, 75\u0026ndash;81 (2014).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMayes, F. J. \u0026amp; Takeballi, M. A. Microbial contamination of the hen\u0026rsquo;s egg: A review. \u003cem\u003eJ. Food Prot.\u003c/em\u003e \u003cb\u003e46\u003c/b\u003e, 1092\u0026ndash;1098 (1983).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDe Reu, K. et al. Eggshell factors influencing eggshell penetration and whole egg contamination by different bacteria, including Salmonella enteritidis. \u003cem\u003eInt. J. Food Microbiol.\u003c/em\u003e \u003cb\u003e112\u003c/b\u003e, 253\u0026ndash;260 (2006).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePadron, M. Salmonella typhimurium penetration through the eggshell of hatching eggs. \u003cem\u003eAvian Dis.\u003c/em\u003e \u003cb\u003e34\u003c/b\u003e, 463\u0026ndash;465 (1990).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBerrang, M. E., Frank, J. F., Buhr, R. J. \u0026amp; Bailey, J. S. Cox, N.A. Eggshell membrane structure and penetration by \u003cem\u003eSalmonella\u003c/em\u003e typhimurium. \u003cem\u003eJ. Food Prot.\u003c/em\u003e \u003cb\u003e62\u003c/b\u003e, 73\u0026ndash;76 (1999).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLock, J. L., Dolman, J. \u0026amp; Board, R. G. Observations on the mode of bacterial infection of hens\u0026rsquo; eggs. \u003cem\u003eFEMS Microbiol. Lett.\u003c/em\u003e \u003cb\u003e100\u003c/b\u003e, 71\u0026ndash;73 (1992).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVadehra, D. V., Baker, R. C. \u0026amp; Naylor, H. B. Infection routes of bacteria into chicken eggs. \u003cem\u003eJ. Food Sci.\u003c/em\u003e \u003cb\u003e35\u003c/b\u003e, 61\u0026ndash;62 (1970).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBurley, R. W. \u0026amp; Vadehra, D. V. \u003cem\u003eThe avian egg: chemistry and biology\u003c/em\u003e (John Wiley and Sons, Inc., 1989).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMu\u0026ntilde;oz-Jord\u0026aacute;n, J. L. et al. Inhibition of alpha/beta interferon signaling by the NS4B protein of flaviviruses. \u003cem\u003eJ. Virol.\u003c/em\u003e \u003cb\u003e79\u003c/b\u003e, 8004\u0026ndash;8013 (2005).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eIchinohe, T. et al. Microbiota regulates immune defense against respiratory tract influenza A virus infection. \u003cem\u003eProc. Natl. Acad. Sci. USA\u003c/em\u003e 108, 5354\u0026ndash;5359 (2011).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAbt, M. C. et al. Commensal bacteria calibrate the activation threshold of innate antiviral immunity. \u003cem\u003eImmunity\u003c/em\u003e \u003cb\u003e37\u003c/b\u003e, 158\u0026ndash;170 (2012).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRicht, J. A. \u0026amp; Garc\u0026iacute;a-Sastre, A. Attenuated influenza virus vaccines with modified NS1 proteins. \u003cem\u003eCurr. Top. Microbiol. Immunol.\u003c/em\u003e \u003cb\u003e333\u003c/b\u003e, 177\u0026ndash;195 (2009).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEuropean Directorate for the Quality of Medicines \u0026amp; HealthCare. European Pharmacopoeia Chap. 2.6.1: Test for Sterility. (2020).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSterility testing. \u003cem\u003eWorld Health Organisation\u003c/em\u003e (2024). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.who.int/teams/health-product-policy-and-standards/standards-and-specifications/norms-and-standards/sterilitytesting\u003c/span\u003e\u003cspan address=\"https://www.who.int/teams/health-product-policy-and-standards/standards-and-specifications/norms-and-standards/sterilitytesting\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eShama, G. \u0026amp; Malik, D. J. The uses and abuses of rapid bioluminescence-based ATP assays. \u003cem\u003eInt. J. Hyg. Environ. Health\u003c/em\u003e. \u003cb\u003e216\u003c/b\u003e, 115\u0026ndash;125 (2013).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGirotti, S., Ferri, E. N., Fumo, M. G. \u0026amp; Maiolini, E. Monitoring of environmental pollutants by bioluminescent bacteria. \u003cem\u003eAnal. Chim. Acta\u003c/em\u003e. \u003cb\u003e608\u003c/b\u003e, 2\u0026ndash;29 (2008).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFrank, L. A. \u0026amp; Krasitskaya, V. V. Application of enzyme bioluminescence for medical diagnostics. \u003cem\u003eAdv. Biochem. Eng. Biotechnol.\u003c/em\u003e \u003cb\u003e144\u003c/b\u003e, 175\u0026ndash;197 (2014).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHasson, S. A. et al. Chemogenomic profiling of endogenous PARK2 expression using a genome-edited coincidence reporter. \u003cem\u003eACS Chem. Biol.\u003c/em\u003e \u003cb\u003e10\u003c/b\u003e, 1188\u0026ndash;1197 (2015).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKobayashi, M. et al. Establishment and characterization of transplantable, luminescence labeled rat renal cell carcinoma cell lines. \u003cem\u003eJ. Urol.\u003c/em\u003e \u003cb\u003e183\u003c/b\u003e, 2029\u0026ndash;2035 (2010).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLampinen, J., Virta, M. \u0026amp; Karp, M. Use of controlled luciferase expression to monitor chemicals affecting protein synthesis. \u003cem\u003eAppl. Environ. Microbiol.\u003c/em\u003e \u003cb\u003e61\u003c/b\u003e, 2981\u0026ndash;2989 (1995).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHaller, O., Kochs, G. \u0026amp; Weber, F. The interferon response circuit: induction and suppression by pathogenic viruses. \u003cem\u003eVirology\u003c/em\u003e \u003cb\u003e344\u003c/b\u003e, 119\u0026ndash;130 (2006).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLaurent-Rolle, M. et al. The interferon signaling antagonist function of yellow fever virus NS5 protein is activated by type I interferon. \u003cem\u003eCell. Host Microbe\u003c/em\u003e. \u003cb\u003e16\u003c/b\u003e, 314\u0026ndash;327 (2014).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTaylor, M. W. Interferons. In: Viruses and Man: A History of Interactions (ed. Taylor, M.W.) 22, 101\u0026ndash;119Springer, Berlin, (2014).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKang, Y. et al. Newcastle disease virus infection in chicken embryonic fibroblasts but not duck embryonic fibroblasts is associated with elevated host innate immune response. \u003cem\u003eVirol. J.\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e, 41\u0026ndash;51 (2016).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBecker, T., Elbahesh, H., Reperant, L. A., Rimmelzwaan, G. F. \u0026amp; Osterhaus A.D.M.E. Influenza vaccines: Successes and continuing challenges. \u003cem\u003eJ. Infect. Dis.\u003c/em\u003e \u003cb\u003e224\u003c/b\u003e, S405\u0026ndash;S419 (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCollins, N. D. \u0026amp; Barrett, A. D. Live Attenuated Yellow Fever 17D Vaccine: A Legacy Vaccine Still Controlling Outbreaks In Modern Day. \u003cem\u003eCurr. Infect. Dis. Rep.\u003c/em\u003e \u003cb\u003e19\u003c/b\u003e, 14\u0026ndash;23 (2017).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHernandez, R. \u0026amp; Brown, D. T. Growth and maintenance of chick embryo fibroblasts (CEF). \u003cem\u003eCurr. Protoc. Microbiol.\u003c/em\u003e 17, A.4I.1-A.4I.8 (2010).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLivak, K. J. \u0026amp; Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. \u003cem\u003eMethods\u003c/em\u003e \u003cb\u003e25\u003c/b\u003e, 402\u0026ndash;408 (2001).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Germ-Free eggs; microbiological analysis, Yellow Fever virus Strain 17D, viral yield, interferon beta, egg-based vaccines","lastPublishedDoi":"10.21203/rs.3.rs-7353340/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7353340/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eInternal microbial contamination of specific pathogen-free (SPF) eggs results in batches of vaccines being rejected and negatively impacts vaccine yield. Thus, increasing viral yield will have major implications for vaccine manufacturers. In this context, we analysed the microbiological contents of Germ-Free (GF) eggs and evaluated the yield of Yellow Fever virus vaccine strain 17D (YFV-17D) in GF eggs when compared with SPF eggs from 2 different suppliers. Chick Embryo Fibroblast (CEF) cells were generated from GF and SPF eggs and infected with YFV-17D to quantify the interferon beta (IFN-β) antiviral response.\u003c/p\u003e\u003cp\u003eThe batch viral yield from GF eggs was 18 fold and 1350 fold higher than that from SPF supplier #1 and SPF supplier #2 respectively. The IFN-β antiviral response of GF-derived CEF cells was 1.6\u0026ndash;4.7 fold lower than SPF supplier 1-derived and 1.9\u0026ndash;5.1 fold lower than SPF supplier 2-derived CEF cells.\u003c/p\u003e\u003cp\u003eIn conclusion, the contents of the GF eggs were sterile, the yield of YFV-17D was significantly higher in GF eggs than in SPF eggs, and the higher yield was associated with a significant reduction in IFN-β levels.\u003c/p\u003e","manuscriptTitle":"Microbiological Assessment and Evaluation of Yellow Fever Virus Vaccine Strain 17D Yield in Germ-Free Chicken Eggs","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-01 12:12:44","doi":"10.21203/rs.3.rs-7353340/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"8f181e28-c82a-4216-abf2-7f0a3641ba5a","owner":[],"postedDate":"October 1st, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":55546884,"name":"Biological sciences/Biotechnology"},{"id":55546885,"name":"Biological sciences/Immunology"},{"id":55546886,"name":"Biological sciences/Microbiology"}],"tags":[],"updatedAt":"2025-11-06T06:08:45+00:00","versionOfRecord":[],"versionCreatedAt":"2025-10-01 12:12:44","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7353340","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7353340","identity":"rs-7353340","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.