HDAC7 is a specific therapeutic target in Acute Erythroid Leukemia | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article HDAC7 is a specific therapeutic target in Acute Erythroid Leukemia Susumu Goyama, Wenyu Zhang, Keita Yamamoto, Yu-Hsuan Chang, Tomohiro Yabushita, and 8 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4080460/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 15 Sep, 2024 Read the published version in Leukemia → Version 1 posted 9 You are reading this latest preprint version Abstract Acute erythroleukemia (AEL) is a rare subtype of acute myeloid leukemia with a poor prognosis. In this study, we established a novel murine AEL model with Trp53 depletion and ERG overexpression. ERG overexpression in Trp53 -deficient mouse bone marrow cells, but not in wild-type bone marrow cells, leads to AEL development within two months after transplantation with 100% penetrance. The established mouse AEL cells expressing Cas9 can be cultured in vitro , induce AEL in vivo even in unirradiated recipient mice, and enable to efficient gene ablation using the CRISPR/Cas9 system. We also confirmed the cooperation between ERG overexpression and TP53 inactivation in promoting the growth of immature erythroid cells in human cord blood cells. Mechanistically, ERG antagonizes KLF1 and inhibits erythroid maturation, meanwhile TP53 deficiency promotes proliferation of erythroid progenitors. Furthermore, we identified HDAC7 as a specific susceptibility in AEL by the DepMap-based two-group comparison analysis. HDAC7 promotes the growth of human and mouse AEL cells both in vitro and in vivo through its non-enzymatic functions. Our study provides experimental evidence that TP53 deficiency and ERG overexpression are necessary and sufficient for the development of AEL and highlights HDAC7 as a promising therapeutic target for this disease. Biological sciences/Cancer/Cancer therapy/Targeted therapies Biological sciences/Cancer/Cancer models Biological sciences/Cancer/Haematological cancer/Leukaemia/Acute myeloid leukaemia Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Key Points TP53 deficiency and ERG overexpression collaboratively induce the development of AEL. HDAC7 is a promising and selective therapeutic target in AEL. Introduction Acute erythroleukemia (AEL) is a rare and aggressive subtype of acute myeloid leukemia (AML) involving uncontrolled proliferation of erythroid precursors leading to the accumulation of immature and abnormal red blood cells in the bone marrow and peripheral blood 1 . AEL has traditionally been recognized as having two subtypes: the more common erythroid/myeloid leukemia (EML), defined by the presence of increased erythroid cells and myeloid blasts; and the very rare pure erythroid leukemia (PEL), characterized by the expansion of immature erythroid cells only. Although EML is no longer considered a distinct entity, PEL is still recognized as a distinct variant of AML in both the 2016 and 2022 World Health Organization (WHO) classification systems. It is now widely recognized that true AEL, characterized primarily by immature erythroid proliferation, is often associated with highly complex cytogenetic alterations and biallelic loss of TP53 function 2 AEL is typically a disease of older adults and has a very poor prognosis with a median survival time of typically less than 6 months. TP53 mutations/deletions are often accompanied by gains and amplifications involving the JAK2/EPOR/MPL genes and ERG/ETS2 in AEL 3 , 4 . JAK2 , EPOR and MPL are the genes related to the JAK/STAT pathway that was shown to promote erythroid cell proliferation. 3 ETS2 and ERG are transcription factors that were shown to promote megakaryopoiesis while inhibiting erythroid maturation 5 , 6 . Thus, genetic analyses suggest that loss of TP53, JAK/STAT overactivation and aberrant expression of megakaryocytic transcription factors collaboratively promote the development of AEL. Previous studies have reported several mouse models for AEL with TP53 mutations or deletion 7 . Classically, loss of Trp53 alleles or expression of mutant TP53 has been shown to promote the Friend virus- and Spi1-induced erythroleukemia 8 , 9 . More recent models recapitulating the genetic alterations found in AEL have shown that Trp53 -deficiency or TP53 mutations cooperate with JAK2-V617F, NTRK1-H498R, NFIA-ETO2 and ERG to induce erythroleukemia in mice 4 , 10 – 13 . Although these mouse models have provided insights into the pathogenesis of AEL, how these genetic alterations cooperate with TP53 inactivation in the process of erythroid transformation is still not fully understood. From a therapeutic point of view, it has been shown that JAK or Trk inhibitors are effective in inhibiting the development of AEL 3 , 14 . However, such kinase inhibitors are often not sufficient to eliminate all the leukemic clones, and therefore other therapeutic targets in AEL need to be identified. In this study, we investigated the effect of TP53 inhibition and ERG overexpression on erythroid leukemogenesis using human cord blood cells, human erythroid leukemia cell lines and a mouse transplantation assay. TP53 inhibition promotes the growth of erythroid progenitors, while ERG inhibits terminal maturation of erythroid cells, and the combination induces the development of AEL. We also identified HDAC7 as a critical and specific regulator in erythroid leukemogenesis, which could be a promising therapeutic target for AEL. Methods Mice C57BL/6 (Ly5.2) mice (Sankyo Labo Service Corporation, Tokyo, Japan) were used for bone marrow transplantation assays. Trp53 −/− mice, in which 5′ part of exon 2 including translation initiation site of Trp53 gene was replaced with Neomycin resistance gene, were provided from the RIKEN BioResource Center (Ibaragi, Japan) 15 . Rosa26-LSL-Cas9 knockin mice were purchased from Jackson Laboratory (#024857) 16 . The Trp53 −/− mice were crossed with the Cas9 knockin mice to obtain Trp53 −/− /Cas9 mice. All animal experiments were approved by the Animal Care Committee of the Institute of Medical Science at the University of Tokyo (PA21-67), and were conducted following the Regulation on Animal Experimentation at University of Tokyo based on International Guiding Principles for Biomedical Research Involving Animals. Cell culture Human cord blood (CB) cells were obtained from the Japanese Red Cross Kanto-Koshinetsu Cord Blood Bank (Tokyo, Japan). Mono nuclear cells (MNCs) were isolated from CB by density gradient centrifugation using LymphoprepTM (density 1.077; Alere Technologies AS, Oslo, Norway). The CD34 + cell fraction was then isolated from the MNCs using the MidiMACS system (CD34 + Microbead Kit; Miltenyi Biotec; Bergisch Gladbach, Germany) according to the manufacturer’s protocols. CB CD34 + cells were incubated in StemSpanTM SFEMII (STEMCELL Technologies) supplemented with 100 ng/ml rhSCF (#255-SC, R&D Systems), 10 ng/ml rhIL-6 (#206-IL, R&D Systems), 1 ng/ml rhIL-3 (#203-IL, R&D Systems) and 1% penicillin–streptomycin (PS, #09367-34, Nacalai). CB cells were then transduced with vector or p53DD and were cultured in StemSpan SFEM II medium (#ST-09655, STEMCELL Technologies) with 2 U/ml erythropoietin (EPO, #3999412G7020, Kyowa Kirin). THP1 and Kasumi-1 cells were cultured in Roswell Park Memorial Institute (RMPI)-1640 medium (#189–02025, FUJIFILM Wako) with 10% fetal bovine serum (FBS; #FB-1365/500, Biosera) and 1% PS. F36P and TF-1 cells were cultured in RPMI-1640 medium supplemented with 10% FBS, 1% PS and 2 ng/ml GM-CSF (#215-GMP, R&D Systems). cSAM cells were cultured in RPMI-1640 medium supplemented with 10% FBS containing 1 ng/ml mouse IL-3 (#203-IL, R&D Systems). CEP53 cells were cultured in RPMI-1640 medium supplemented with 10% FBS containing 1 ng/ml EPO (#959-ME, R&D Systems). Plat-E and 293 T cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) medium (#044–29765, Wako) with 10% FBS and 1% PS. Plasmids p53DD was obtained from Addgene (#25989) 17 , and we cloned it into pMYs-IRES-NGFR vector 18 . MSCV-PIG, MSCV-PIG-ERG was abstained from Addgene (#66984) 19 . We added the AM-tag sequence (5’-TGCCAAGATCCTCAACGCAAAGGCAACGTGATACTCTCTCAGGC TTACGGGTGCCAAGATCCTCAACGCAAAGGCAACGTGATACTCTCTCAGGCTTACTAG-3’) into MSCV-PIG-ERG for the ChIP-Seq assay. pcDNA3-GATA1 (Addgene # 85693) 20 , pSG5-hEKLF (Addgene #67835) 21 and pGL3-GATA-Luc (Addgene #85695) 22 were obtained from Addgene. pGL4.10[Luc2] (#E6651) and pGL4.74[hRluc/TK] (#E692A) were obtained from Promega. For pGL4.1-KLF1-Luc, we amplified the 6x repeat promoter sequence (5’-AGGGTGTGG-3’) of KLF1 23 using PCR and inserted the PCR-amplified fragment into the restriction sites of pGL4.10[Luc2]. Viral transduction Retroviruses for mouse cells were generated by transient transfection of retroviral constructs into Plat-E packaging cells 24 using the calcium phosphate method. Retroviruses for human cells were generated by transient transfection of retroviral constructs along with M57 and RD114 into 293T cells using the calcium phosphate method. Retrovirus transduction to the cells was performed using Retronectin (Takara Bio Inc., Otsu, Shiga, Japan). Lentiviruses were produced by transient transfection of lentiviral plasmids along with pCMV-VSV-G (Addgene, #8454) 25 and psPAX2 (Addgene, #12260) into 293T cells using the calcium-phosphate method. 26 Gene depletion using the CRISPR/Cas9 system To generate short guide RNA (sgRNA) constructs, annealed oligos were inserted into pLentiguide-puro vector (#52963) or pLKO5.sgRNA.EFS.tRFP657 vector (#57824) 27 , which were obtained from Addgene. Cas9 expressing vector was also obtained from addgene (lentiCas9-Blast #52962) 28 . Lentiviruses were produced by transient transfection of 293T cells as described above. Cells were infected with the virus for 24 hours and were selected for stable expression of Cas9 using blasticidin (10 µg/ml). The sgRNA-transduced cells were selected using puromycin (1µg/ml) or FACS-based sorting of tRFP657-positive cells. The sequences of sgRNAs are provided in Supplemental Table 1. Luciferase assay 1x10 5 293T cells were seeded in 12-well culture plates with cells in 500 µL medium. 18 h after seeding, the cells were transfected with pGL4.1-6X-KLF1 or pGL3-GATA-Luc (co-expressing Firefly Luciferase [FLuc]), pSG5-hEKLF (KLF1) or pcDNA3-GATA1, and pGL4.74 vector (co-expressing Renilla Luciferase [RLuc]) with MSCV-PIG-ERG or MSCV-PIG, using polyethylenimine (PEI). The cells were harvested 48 h after transfection and were assayed for the luciferase activity using the luciferase assay system (Promega) and a luminometer (BMG LABTECH, FLUOstar OPTIMA). Promoter activity was calculated as a ratio of Fluc to Rluc. Transplantation assay Mouse bone marrow cells were collected from the Cas9 mice and Trp53 −/− /Cas9 mice. Bone marrow progenitors (c-Kit + cells) were selected using the CD117 MicroBead Kit (Miltenyi Biotec) and were pre-cultured in RPMI-1640 containing 10% FBS, 1% penicillin–streptomycin and 50 ng/ml murine SCF, 10 ng/ml TPO, 10 ng/ml IL-3 and 10 ng/ml IL-6 for 16hr. These cells were then transduced with ERG and transplanted into sublethally (5.25 Gy) irradiated 12 weeks-old C57BL/6 mice. Each mouse received 2x10 5 cells. For transplantation of CEP53 cells, each mouse received 5x10 6 CEP53 cells without irradiation. For the in vivo transplantation assay using sgRNAs targeting Hdac7 , spleen cells collected from the moribund AEL mice were transduced with NT or Hdac7 -sgRNAs, and 5x10 5 cells were transplanted into sublethally (525 cGy) irradiated 12 weeks-old C57BL/6 mice. Flow Cytometry Cells were stained by fluoro-conjugated antibodies for 30min at 4°C. After staining, cells were washed with cold PBS two times, and were resuspended in PBS containing 2% FBS. Cells were analyzed with Canto II (BD Biosciences, San Jose, CA, USA) and FlowJo software (FlowJo) or sorted with FACS Aria III (BD Biosciences, San Jose, CA, USA). The antibodies and their dilution ratios are provided in Supplemental Table 2. Western blotting Cells were washed with PBS several times and lysed with pre-heated Laemmli sample buffer (Bio-rad, USA; #1610737). Total cell lysates were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to a polyvinylidene fluoride membrane (Bio-Rad). Bands were visualized by LAS-4000 Luminescent Image Analyzer (FUJIFILM). The antibodies and their dilution ratios are provided in Supplemental Table 3. RNA-Seq For RNA-seq with mouse AEL cells and erythroid progenitors, bone marrow cells were collected from normal C57BL/6 mice and the mice transplanted with Trp53 −/− ERG-expressing cells. Cells were then stained with biotinylated Ter119 and CD71 antibodies and 2x10 6 Ter119 + CD71 + cells were sorted by AriaIII (BD Biosciences, San Jose, CA, USA). For RNA-seq with F36P cells, F36P cells were transduced with vector/ERG (coexpress GFP) or NT/HDAC7-sgRNAs. GFP + cells were sorted by AriaIII. The sgRNA-transduced cells were selected with 1 µg/ml puromycin. Total RNA was extracted using RNeasy Mini Kit (Qiagen). After RNA fragmentation, cDNA was synthesized by random hexamer-primed reverse transcription, followed by a second-strand cDNA synthesis with dUTP. Following end repair, add A and adaptor ligation, the DNA fragments were amplified by PCR. Libraries were sequenced using Illumina NovaSeq 6000 with paired-end mode (2x100 bp). Pair-end sequencing FASTQ files were aligned to the mouse reference genome (mm10). Raw gene counts were derived from the read alignments by Rsubread 29 (v2.12.3) and further transferred into count per million (CPM) by edgeR 30 (v3.40.2). After filtering out low-expression genes with CPM lower than 1, all CPM values were log2 transformed for generating unsupervised clustering dendrograms and heatmaps. Differential expression was analyzed with the linear model using limma 31 (v3.54.2). Genes with false discovery rate (FDR) < 0.05 adjusted by the Benjamini-Hochberg method were considered significant differentially expressing genes (DEGs). 32 Pathway analyses were performed using GO Enrichment Analysis 33 and Gene Set Enrichment Analysis 34 , 35 ChIP-Seq Chromatin immunoprecipitation was performed using Simple chip kit (Cell signaling technology, #9002) following the manufacturer’s instructions. 1x10 7 F36P cells transduced with vector or ERG were fixed with 1% formaldehyde (Sigma) and then quenched with glycine. After washing and cell lysis, the chromatin was fragmented with 0.75 µl micrococcal nuclease (MNase) at 37 C for 15–20 min and nuclei were completely lysed by sonication. The 10 µg of chromatin in each reaction was incubated with 10 µl of anti-AM (#91111, Active motif), anti-H3K27ac (#8173, CST) or IgG antibody (#2729,CST) overnight at 4 C with rotation. Immunoprecipitation was performed with protein G magnetic beads. Following elution, reverse-crosslinks, and purification, DNA was used for sequencing. ChIP-seq libraries were prepared and sequenced using Illumina Novaseq 6000 with paired-end mode (2x150 bp). Pair-end sequencing FASTQ files were aligned to the human reference genome (hg38) using Bowtie2 36 on Galaxy platform ( https://usegalaxy.org ). Mapped reads were transformed by bamCoverage with the parameter “normalize using RPKM” from the deepTools 37 . Heatmap was generated by plotHeatmap which also from the deepTools. Peak calling was performed with MACS2 callpeak. 38 Gene list of peak calling was established by using R package CHIPseeker. 39 Cell viability assay The cytotoxicity of the class IIA HDAC inhibitor (TMP269) against various cell lines was assessed using the Cell Counting Kit-8 (Dojindo, Kumamoto, Japan) according to the provided instructions. Cells were plated at a density of 1×10 4 cells/well in 0.1 ml of RPMI medium in 96-well plates and then treated with different concentrations of each compound. After 72-hours of incubation with the compounds at 37°C, 8 µl of Cell Counting Kit-8 solution was added to each well. Following 1-hour incubation at 37°C, absorbance at 450 nm was measured using a microplate reader (CLARIOstar Plus, BMG LABTECH, Ortenberg, GER). Relative cell viability was calculated as the ratio of the absorbance in each treatment group to that of the corresponding untreated control group. Data are presented as mean ± standard deviation (SD) of more than three independent experiments. Histone deacetylase enzyme activity measure assay HDAC activity was evaluated using the HDAC-Glo™ I/II Assay and Screening System (Promega #G6420). 1×10 4 cells/well were seeded in a 96-well plate with 100 µL HDAC-Glo™ I/II buffer. Then, 100 µL HDAC-Glo™ I/II reagent and 1 µL developer reagent were added to each well. After incubation for 30 minutes at room temperature, luminescence was measured using the FLUOstar OPTIMA. Data are presented as mean ± standard deviation (SD) of more than three independent experiments. Statistical analyses GraphPad Prism 9 was used for statistical analyses. Unpaired Student's t-test (two-tailed) and Ordinary one-way ANOVA were used for pairwise comparisons of significance. The log-rank (Mantel-Cox) was used for the survival curves comparison. Animal experiments were neither blinded nor randomized. The type of replication (biological or technical) is indicated in figure legends. Sample size was decided based on our previous experience in the field, not predetermined by a statistical method. All data are shown as mean ± SD. Results Distinct roles of TP53 and ERG in erythroid proliferation and differentiation We first assessed the effect of TP53 inhibition and ERG overexpression on proliferation and differentiation of human erythroid progenitors. We transduced ERG and/or dominant negative TP53 fragment (p53DD) into human cord blood (CB) CD34 + cells and cultured them in the presence of erythropoietin (EPO) to induce erythroid differentiation (Fig. 1 A). p53DD promoted both proliferation and differentiation of CB cells, as evidenced by the increased cell numbers and CD71 + CD235 + cells in culture (Fig. 1 B, C). In contrast, ERG overexpression resulted in significant increase of CD71 − CD235 − non-erythroid cells with little influence on CB cell proliferation. Notably, coexpression of ERG and p53DD promoted the efficient growth of immature CD71 + CD235 − erythroid progenitors without enhancing erythroid differentiation (Fig. 1 C). Morphological analysis revealed that the p53DD-transduced cells had visible dark nucleoli in the nucleus, indicating the effect of TP53 inactivation to increase erythroblasts (Fig. 1 D). To further assess the role of ERG in erythroid differentiation, we transduced ERG into several human AML cell lines with erythroid properties: F36P, HEL, and TF-1. ERG expression was confirmed by western blotting ( Supplemental Fig. 1A ). The cells were then cultured with human EPO to induce erythroid differentiation for 6 days. Consistent with the earlier results, ERG overexpression inhibited the expression of an erythroid marker CD235a (glycophorin A) and the morphological changes induced by EPO in all these erythroid leukemia cell lines (Fig. 1 E, Supplemental Fig. 1B ). These data suggest a distinct role for TP53 and ERG in erythropoiesis: TP53 restricts proliferation and differentiation of hematopoietic stem and progenitor cells toward the erythroid lineage, whereas ERG inhibits terminal differentiation of erythroid progenitors. Importantly, TP53 inhibition together with ERG overexpression in human CB CD34 + cells induced rapid proliferation of immature erythroblasts. ERG inhibits erythroid differentiation by antagonizing KLF1 activity To understand how ERG inhibits erythroid differentiation, we next performed RNA-Seq and ChIP-seq analyses using F36P cells expressing vector or ERG with a C-terminal AM (Active Motif) tag (Fig. 2 A). High expression of AM-tagged ERG in F36P cells was confirmed by western blotting and RNA-seq (Fig. 2 B, Supplemental Fig. 2B ). RNA-seq revealed significant downregulation of several erythroid genes, including KLF1, EPOR, HBG and LMO2, in ERG-expressing F36P cells. In contrast, ERG overexpression induced upregulation of genes related to megakaryopoiesis, such as ITGB3 , GP1BA and FLI1 (Fig. 2 C, Supplemental Fig. 2A, 2B, Supplemental Dataset ). Gene set enrichment analysis (GSEA) showed that ERG induced downregulation of GATA1-target genes and heme metabolism pathway genes, whereas it induced upregulation of genes related to megakaryopoiesis ( Supplemental Fig. 2C ). Thus, consistent with the earlier report 40 , ERG overexpression promotes expression of megakaryocyte-specific genes while inhibiting erythroid gene expression. ChIP-seq revealed that ERG bound to genomic regions containing the ETS core consensus sequence [5′-GGA(A/T)-3′], including those with FLI1, ETS1 and PU.1-binding sequences (Fig. 2 D). More than 75% of ERG binding sites were located in promoter regions and many of them were enriched for histone 3 lysine 27 acetylation (H3K27ac), a marker of active transcription ( Supplemental Fig. 2D, E, Supplemental Dataset ). Genes associated with platelet activation, megakaryocyte and hemostasis pathways were upregulated by ERG with the increase of H3K27 acetylation at their promoters ( Supplemental Fig. 2F ). In particular, we identified GATA2 and FLI1 as direct ERG target genes in F36P cells (Fig. 2 E). In addition to these ERG-activated genes, combined RNA-seq and ChIP-seq analyses led to the identification of EPOR as a potential repressive target of ERG (Fig. 2 E). Indeed, the promoter region of EPOR contains an unusually large number of the ERG binding motif (GGAAG) (Fig. 2 F). Interestingly, more than 70% of the ERG-bound genes were also bound by KLF1 in erythrocytes ( http://chip-atlas.org/target_genes public KLF1) (Fig. 2 G). Given that KLF1 is a key transcription factor promoting erythropoiesis, these data suggest a possible competition between ERG and KLF1 to regulate erythroid gene expression. To test this possibility, we performed luciferase reporter assays using reporters containing the KLF1 (5’-AGGGTGTGG-3’) binding sequence. As expected, ERG repressed the transcriptional activity of the KLF1 promoter in HEK293T cells (Fig. 2 H). Thus, similar to another ETS family member FLI1 41 , ERG inhibits erythroid maturation mainly by antagonizing KLF1 activity. Trp53 -deficiency and ERG overexpression collaboratively promote the development of AEL We next investigated the functional cooperation between ERG and Trp53 (a murine homologue of TP53) deficiency in the development of AEL using a murine transplantation model. Bone marrow progenitor cells (c-kit + cells) from 12 weeks Trp53 −/− -Cas9 or Cas9 male mice were transduced with ERG, and 2x10 5 cells were transplanted into sublethally (5.25Gy) irradiated 8–12 weeks C57BL/6 male mice (Fig. 3 A). All mice transplanted with Cas9 + Trp53 −/− ERG-expressing cells developed lethal leukemia approximately 60 days after transplantation (Fig. 3 B). The mice bearing the Cas9 + Trp53 −/− ERG-expressing cells showed various hematopoietic abnormalities, including an increase in white blood cells, anemia and thrombocytopenia, while those receiving ERG-expressing cells showed only a trend toward mild anemia at two months post-transplantation (Fig. 3 C). Morphological and immunophenotypic analyses of bone marrow and spleen cells revealed that the Cas9 + Trp53 −/− ERG-expressing cells induced marked increase of CD71 + Ter119 +/− immature erythroblasts with concomitant decrease of B and T cells (Fig. 3 D, Supplemental Fig. 3A, C ). In contrast, ERG alone never caused rapid leukemia, but induced the development of neutrophilia after a long latency period (Fig. 3 E, Supplemental Fig. 3B ). We also transplanted the Cas9 + Trp53 −/− ERG-expressing spleen cells and the Cas9 + spleen cells expressing only ERG into secondary recipient mice. All mice transplanted with the Cas9 + Trp53 −/− ERG-expressing cells developed AEL within 45 days, whereas those receiving Cas9 + ERG-expressing cells with intact Trp53 did not (Fig. 3 F, G). Thus, Trp53 -deficiency and ERG overexpression are necessary and sufficient to fully transform c-kit + adult bone marrow progenitors into AEL cells. Establishment of a mouse AEL cell line CEP53 To establish the Cas9-expressing murine AEL cell lines, we next cultured the AEL cells collected from a spleen of a moribund mouse bearing Cas9 + Trp53 −/− ERG-expressing cells in RMPI-1640 medium with various hematopoietic cytokines. SCF or IL-3 alone did not support the growth of spleen cells. SCF + IL-3 only promoted the growth of non-erythroid cells. In contrast, addition of EPO together with SCF and IL-3 promoted the marked expansion of GFP + AEL cells in vitro ( Supplemental Fig. 3D ). The established AEL cells, we designated it CEP53 ( C as9 and E RG-expressing p53 -deficient cells), grew well with 1 ng/ml EPO, expressed GFP as well as erythroid markers (CD71 and Ter119), and showed typical AEL morphology (dark nucleoli, increased nuclear/cytoplasmic ratio and cytoplasmic blebs) (Fig. 4 A). To assess the repopulating capacity of CEP53, we transplanted 5x10 6 CEP53 cells that had been cultured in vitro for 1 months into recipient mice without irradiation. All the mice developed AEL within 4 weeks, indicating that CEP53 cells retain the strong leukemogenicity even after the long-term in vitro culture (Fig. 4 B, Supplemental Fig. 3E ). Thus, we established a Cas9-expressing murine AEL cell line, CEP53, which can be cultured in vitro with only 1 ng/ml EPO, induces AEL in vivo even in unirradiated recipient mice, and allows efficient depletion of genes of interest using the CRISPR/Cas9 system. HDAC7 inhibits terminal maturation of human erythroid leukemia cells Next, we applied the DepMap ( https://depmap.org/portal/)-base d two group comparison system (Nakahara, 2023, GitHub. Available at: https://github.com/jakushinn/depmap_analysis ) to identify therapeutic vulnerabilities in AEL. We first divided 15 human AML cell lines into those with erythroid characteristics (HEL, F36P, TF-1 and OCIM2) and non-erythroid AML cells (KASUMI1, NB4, THP-1, U937, MV411, MOLM13, AML193, MOLM14, OCIAML2, OCIAML3, and MUTZ8). We compared the Gene Effect Score, which represents the essentiality of a gene in each cancer cell in DepMap, in the erythroid and non-erythroid leukemia cells. This analysis revealed several genes that are specifically important for the growth of erythroid leukemia cells, including BCL2L1, which was recently shown to be essential for the survival of erythroid/megakaryocytic AML 42 (Fig. 5 A). We then integrated the DepMap analysis, RNA-seq data of mouse AEL cells and expression profiles of human AML patients and identified HDAC7 as a potential therapeutic target in AEL. HDAC7 is a class IIa histone deacetylase (HDAC) that is important for the growth of human erythroid leukemia cells, and is highly expressed in both human and mouse AEL (Fig. 5 A, Supplemental Fig. 4A-C, Supplemental Dataset ). To verify the role of HDAC7 in human AEL, we then assessed the effect of HDAC7 depletion in two erythroid (F36P and TF-1) and two non-erythroid (THP-1 and KASUMI-1) leukemia cell lines. We first transduced Cas9 (coexpressing Blasticidin S resistance gene: bsr) together with non-targeting (NT) or single-guide (sg)RNAs targeting HDAC7 (coexpressing tRFP657) into these cells and monitored the frequency of tRFP657 + (HDAC7-depleted) cells in culture starting 96 hours after the transduction. Efficient depletion of HDAC7 in these cells was confirmed by western blotting (Fig. 5 B). Consistent with the data in DepMap, HDAC7 depletion suppressed the growth of erythroid leukemia cells but not that of non-erythroid leukemia cells (Fig. 5 C). HDAC7 depletion promoted erythroid differentiation of TF-1 and F36P cells, as evidenced by the increased expression of CD235a, even in the absence of EPO in culture (Fig. 5 D). We also found that the ERG-mediated block of erythroid differentiation was partially reversed by HDAC7 depletion in F36P cells ( Supplemental Fig. 4D ). RNA-seq analysis revealed that loss of HDAC7 resulted in upregulation of several erythroid genes ( HBBP1 , HBD and HEMGN ) and GATA1-target genes in F36P cells (Fig. 5 E, Supplemental Dataset ), confirming the enhanced erythroid maturation upon HDAC7 depletion. However, unlike ERG overexpression, HDAC7 depletion did not alter megakaryocytic gene expression, suggesting a more specific role of HDAC7 in erythroid differentiation. We also found that HDAC7 absence induced strong upregulation of HDAC5 , another class IIa HDAC, which may play a compensatory role in HDAC7-depleted F36P cells (Fig. 5 D). Thus, HDAC7 promotes the growth of human erythroid leukemia cells by inhibiting their terminal maturation. Hdac7 promotes the development of mouse AEL We next assessed the role of HDAC7 in the mouse AEL cell line, CEP53. We transduced NT or sgRNAs targeting mouse Hdac7 (coexpressing tRFP657) into CEP53 and monitored the frequency of tRFP657 + ( Hdac7 -depleted) cells in culture. Similar to the earlier results obtained by the human erythroid leukemia cells, Hdac7 depletion inhibited the growth of CEP53 cells in vitro by inducing their erythroid differentiation. In contrast, loss of HDAC7 did not inhibit the growth of cSAM cells 43 , the mouse monocytic AML cells transformed by SETBP1 and ASXL1 mutations (Fig. 6 A-C), confirming the selective importance of HDAC7 in erythroid leukemia. To determine the role of HDAC7 in the development of AEL in vivo , we then performed transplantation assay using CEP53 cells transduced with NT or the Hdac7 -targeting sgRNA (sg Hdac7 -a) coexpressing tRFP657. We collected GFP + leukemia cells from bone marrow and spleen 25 days after transplantation, at which time all mice developed AEL. We observed substantial decrease of tRFP657 + ( Hdac7 -depleted) cells in both bone marrow and spleen, indicating the critical role of HDAC7 in promoting the in vivo development of AEL (Fig. 6 D, E, Supplemental Fig. 5 ). Taken together, we concluded that HDAC7 is a critical and selective regulator in human and mouse AEL. Enzymatic function of HDAC7 is dispensable for the growth of AEL Next, we assessed the effect of a selective Class IIa HDAC inhibitor TMP269 on various human AML cell lines including AEL. However, contrary to the expectation, AEL cell lines were not more sensitive to TMP269 than non-AEL cell lines (Fig. 7 A ) . We therefore hypothesized that the HDAC7 may promote the growth of AEL cells through non-enzymatic functions. To test this hypothesis, we first designed sgRNA-resistant cDNA by introducing synonymous mutations in the sgRNA-target sequences to prevent the recognition of HDAC7 -targeting sgRNA (sg HDAC7 -A) (Fig. 7 B). We then introduced a histidine (H) to alanin (A) mutation at H672 in human HDAC7 to generate a catalytically inactive HDAC7 mutant 44 (Fig. 7 C). We transduced vector, wild-type (WT) HDAC7 or HDAC7-H672A into F36P cells and assessed the HDAC activity in them (Fig. 7 D). The HDAC enzyme inhibitor trichostatin A (TSA) showed the expected dose-dependent reduction in HDAC enzyme activity. To our surprise, both wild-type and mutant HDAC7 did not enhance but rather inhibited the HDAC activity in F36P cells (Fig. 7 E), indicating that HDAC7 does not act as a “histone deacetylase” in erythroid leukemia cells. We then transduced NT or HDAC7-targeting sgRNAs into F36P cells expressing vector or sgRNA-resistant HDAC7 constructs. Successful transduction of HDAC7 constructs and sgRNA-mediated depletion of endogenous HDAC7 were confirmed by western blotting (Fig. 7 F). As expected, HDAC7 depletion induced erythroid differentiation and inhibited the growth of F36P cells, which was canceled in the wild-type HDAC7-transduced F36P cells. Importantly, the catalytically inactive HDAC7 mutant also reversed the effect of HDAC7 depletion on the growth and maturation of F36P cells as efficiently as wild-type HDAC7 (Fig. 7 G, H, Supplemental Fig. 5B ). Collectively, these results suggest that the enzymatic activity is dispensable for the oncogenic activity of HDAC7 in AEL. Discussion ERG is a versatile oncogene that has been shown to induce the development of various types of leukemia with additional genetic alterations. Our data together with previous reports clearly showed that TP53 inactivation cooperates with ERG to induce the development of erythroleukemia 5 , 45 – 47 . However, previous studies have used fetal liver-derived erythroblasts, which are more likely to recapitulate pediatric AEL. In this study, we demonstrate that the combination of ERG overexpression and Trp53 -deficiency can transform c-kit + adult bone marrow progenitors into AEL cells, providing the first experimental model for adult AEL. Mechanistically, ERG interferes with erythroid differentiation by antagonizing KLF1 activity, while promoting upregulation of megakaryocytic genes. This function of ERG is similar to that of another ETS transcription factor, FLI1, which has been shown to play a critical role in the megakaryocytic/erythroid bifurcation by counteracting KLF1. 48 Another interesting finding is the unexpected ERG-mediated suppression of EPOR, given that EPOR amplification frequently coexists in patients with AEL harboring TP53 mutations and ERG amplification 49 50 . This seemingly contradictory finding suggests that the elevated expression of EPOR and the consequent activation of the JAK pathway need to be attenuated by ERG for leukemic transformation. Like ERG, a recent study showed that NFIA-ETO2 fusion blocks erythroid maturation and induces AEL in cooperation with mutant TP53 51 . Thus, suppression of erythroid gene expression programs by transcription factors appears to be necessary to generate fully transformed AEL in cooperation with TP53 inactivation. Given its multiple roles, including its essential role in hematopoietic stem cell maintenance, ERG may not be the ideal therapeutic target in AEL. Instead, we identified HDAC7 as a selective regulator in erythroleukemia. HDAC7 is a member of the class IIa family of HDACs (HDAC4/5/6/7), which intrinsically possess low enzymatic activity but harbor a unique adapter domain in the N-terminus that mediates binding to several transcription factors 52 . Importantly, we have shown that HDAC7 promotes the growth of AEL cells through non-enzymatic functions. Therefore, it is necessary to develop HDAC7 degraders rather than the deacetylase inhibitor to treat AEL. The mechanisms by which HDAC7 promotes AEL development also need to be elucidated in future studies. In addition to HDAC7, a previous study showed that another class IIa HDAC, HDAC5, forms a complex with GATA1 and KLF1 to regulate normal erythroid maturation 53 . Although HDAC5 is dispensable for the growth of human erythroleukemia cells, the substantial increase of HDAC5 in the Hdac7-depleted mouse AEL cells indicates its potential compensatory function for the loss of HDAC7. Targeting these class IIa HDACs with protein degraders could be an effective therapeutic strategy with fewer side effects for AEL. In summary, we showed the distinct and cooperative functions of TP53 loss and ERG overexpression during erythroid transformation. We also established a novel mouse model of adult AEL that will be useful to evaluate the role of specific genes or to test the effect of drug candidates in a physiological microenvironment with a functional immune system. In addition, our study highlights HDAC7 as a promising therapeutic target in AEL that is resistant to current standard therapies. Declarations Authorship Contributions W.Z. designed and performed experiments, analyzed the data, and wrote the paper. K.Y. provided resources and advised on data interpretation. Y.-H.C. performed experiments, analyzed the data and advised on data interpretation. T.Y. designed and performed experiments and advised on data interpretation. Y.H., R.S., J.N., S.S. assisted in experiments. K.I. analyzed the data. Q.C., X.Z. assisted in experiments. T.K. advised on data interpretation. S.G. conceived the project, designed experiments, analyzed the data and wrote the paper. Disclosure of Conflicts of Interest All authors declare no competing financial interests with the contents of this article. Acknowledgements We thank Akiho Tsuchiya for her expert technical assistance. We thank Dr. Xiaoxiao Liu, Dr Taishi Yonezawa, Dr. Shuhei Asada, Dr. Reina Takeda for helpful discussions and advice. We also thank the FACS Core Laboratory and the Mouse Core at The Institute of Medical Science, The University of Tokyo. This work was supported by Grant-in-Aid for Scientific Research (B) (22H03100, SG), Grant-in-Aid for Scientific Research on Innovative Areas (Research in a proposed research area) (21H00274, SG), Fostering Joint International Research (B) (22KK0127, SG), AMED under Grant Number (22ck0106644s0202 and 23ama221514h0002, SG), Research Grants from the Princess Takamatsu Cancer Research Fund (SG), Research grant from the Daiichi Sankyo Foundation of Life Science (SG), Research grant from The Japanese Society of Hematology (SG, TK), JSPS KAKENHI Grant Number JP22K16319 (KY), AMED under Grant Number JP23ama221223 (KY), Research grant from Kobayashi Foundation for Cancer Research (KY), Grant-in-Aid for Scientific Research (A) (No. 20H00537, TK), Grant-in-Aid for Scientific Research on Innovative Areas (No. 19H04756, TK) and JST SPRING (JPMJSP2108, WZ). Data availability The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request. References Genomic and Epigenomic Landscapes of Adult De Novo Acute Myeloid Leukemia. New England Journal of Medicine. 2013;368(22):2059–2074. Alexander C. A History and Current Understanding of Acute Erythroid Leukemia. Clin Lymphoma Myeloma Leuk. 2023;23(8):583–588. Takeda J, Yoshida K, Nakagawa MM, et al. Amplified EPOR/JAK2 Genes Define a Unique Subtype of Acute Erythroid Leukemia. Blood Cancer Discov. 2022;3(5):410–427. Fagnan A, Bagger FO, Piqué-Borràs M-R, et al. Human erythroleukemia genetics and transcriptomes identify master transcription factors as functional disease drivers. Blood. 2020;136(6):698–714. Salek-Ardakani S, Smooha G, de Boer J, et al. ERG Is a Megakaryocytic Oncogene. Cancer Res. 2009;69(11):4665–4673. Stankiewicz MJ, Crispino JD. ETS2 and ERG promote megakaryopoiesis and synergize with alterations in GATA-1 to immortalize hematopoietic progenitor cells. Blood. 2009;113(14):3337–3347. Fagnan A, Piqué-Borràs M-R, Tauchmann S, Mercher T, Schwaller J. Molecular Landscapes and Models of Acute Erythroleukemia. Hemasphere. 2021;5(5):e558. Munroe DG, Peacock JW, Benchimol S. Inactivation of the Cellular p53 Gene Is a Common Feature of Friend Virus-Induced Erythroleukemia: Relationship of Inactivation to Dominant Transforming Alleles. Mol Cell Biol. 1990;10(7):3307–3313. Lavigueur A, Bernstein A. p53 transgenic mice: accelerated erythroleukemia induction by Friend virus. Oncogene. 1991;6(12):2197–2201. Iacobucci I, Wen J, Meggendorfer M, et al. Genomic subtyping and therapeutic targeting of acute erythroleukemia. Nat Genet. 2019;51(4):694–704. Rampal R, Ahn J, Abdel-Wahab O, et al. Genomic and functional analysis of leukemic transformation of myeloproliferative neoplasms. Proceedings of the National Academy of Sciences. 2014;111(50):E5401-5410. Tsuruta-Kishino T, Koya J, Kataoka K, et al. Loss of p53 induces leukemic transformation in a murine model of Jak2 V617F-driven polycythemia vera. Oncogene. 2017;36(23):3300–3311. Piqué-Borràs M-R, Bagger FO, Bezerra MF, et al. Transformation Mechanisms of the Nfia-ETO2 Fusion Gene Associated with Pediatric Pure Acute Erythroleukemia. Blood. 2019;134(Supplement_1):532–532. Iacobucci I, Wen J, Meggendorfer M, et al. Genomic subtyping and therapeutic targeting of acute erythroleukemia. Nat Genet. 2019;51(4):694–704. Tsukada T, Tomooka Y, Takai S, et al. Enhanced proliferative potential in culture of cells from p53-deficient mice. Oncogene. 1993;8(12):3313–3322. Platt RJ, Chen S, Zhou Y, et al. CRISPR-Cas9 knockin mice for genome editing and cancer modeling. Cell. 2014;159(2):440–55. Irwin M, Marin MC, Phillips AC, et al. Role for the p53 homologue p73 in E2F-1-induced apoptosis. Nature. 2000;407(6804):645–648. Tamura M, Yonezawa T, Liu X, et al. Opposing effects of acute versus chronic inhibition of p53 on decitabine’s efficacy in myeloid neoplasms. Sci Rep. 2019;9(1):8171. Roe J-S, Mercan F, Rivera K, Pappin DJ, Vakoc CR. BET Bromodomain Inhibition Suppresses the Function of Hematopoietic Transcription Factors in Acute Myeloid Leukemia. Mol Cell. 2015;58(6):1028–1039. Collavin L, Gostissa M, Avolio F, et al. Modification of the erythroid transcription factor GATA-1 by SUMO-1. Proceedings of the National Academy of Sciences. 2004;101(24):8870–8875. Mas C, Lussier-Price M, Soni S, et al. Structural and functional characterization of an atypical activation domain in erythroid Krüppel-like factor (EKLF). Proceedings of the National Academy of Sciences. 2011;108(26):10484–10489. Collavin L, Gostissa M, Avolio F, et al. Modification of the erythroid transcription factor GATA-1 by SUMO-1. Proceedings of the National Academy of Sciences. 2004;101(24):8870–8875. Kulczynska K, Bieker JJ, Siatecka M. A Krüppel-like factor 1 (KLF1) Mutation Associated with Severe Congenital Dyserythropoietic Anemia Alters Its DNA-Binding Specificity. Mol Cell Biol. 2020;40(5):e00444-19. Morita S, Kojima T, Kitamura T. Plat-E: an efficient and stable system for transient packaging of retroviruses. Gene Ther. 2000;7(12):1063–1066. STEWART SA, DYKXHOORN DM, PALLISER D, et al. Lentivirus-delivered stable gene silencing by RNAi in primary cells. RNA. 2003;9(4):493–501. Goyama S, Schibler J, Gasilina A, et al. UBASH3B/Sts-1-CBL axis regulates myeloid proliferation in human preleukemia induced by AML1-ETO. Leukemia. 2016;30(3):728–739. Heckl D, Kowalczyk MS, Yudovich D, et al. Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 2014;32(9):941–946. Sanjana NE, Shalem O, Zhang F. Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods. 2014;11(8):783–784. Liao Y, Smyth GK, Shi W. The R package Rsubread is easier, faster, cheaper and better for alignment and quantification of RNA sequencing reads. Nucleic Acids Res. 2019;47(8):e47–e47. Chen Y, Lun ATL, Smyth GK. From reads to genes to pathways: differential expression analysis of RNA-Seq experiments using Rsubread and the edgeR quasi-likelihood pipeline. F1000Res. 2016;5:1438. Ritchie ME, Phipson B, Wu D, et al. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015;43(7):e47–e47. Wang T-W, Johmura Y, Suzuki N, et al. Blocking PD-L1–PD-1 improves senescence surveillance and ageing phenotypes. Nature. 2022;611(7935):358–364. Mi H, Muruganujan A, Ebert D, Huang X, Thomas PD. PANTHER version 14: more genomes, a new PANTHER GO-slim and improvements in enrichment analysis tools. Nucleic Acids Res. 2019;47(D1):D419–D426. Mootha VK, Lindgren CM, Eriksson K-F, et al. PGC-1α-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes. Nat Genet. 2003;34(3):267–273. Subramanian A, Tamayo P, Mootha VK, et al. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proceedings of the National Academy of Sciences. 2005;102(43):15545–15550. Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012;9(4):357–359. Ramírez F, Ryan DP, Grüning B, et al. deepTools2: a next generation web server for deep-sequencing data analysis. Nucleic Acids Res. 2016;44(W1):W160–W165. Zhang Y, Liu T, Meyer CA, et al. Model-based Analysis of ChIP-Seq (MACS). Genome Biol. 2008;9(9):R137. Wang Q, Li M, Wu T, et al. Exploring Epigenomic Datasets by ChIPseeker. Curr Protoc. 2022;2(10):. Stankiewicz MJ, Crispino JD. ETS2 and ERG promote megakaryopoiesis and synergize with alterations in GATA-1 to immortalize hematopoietic progenitor cells. Blood. 2009;113(14):3337–3347. Doré LC, Crispino JD. Transcription factor networks in erythroid cell and megakaryocyte development. Blood. 2011;118(2):231–239. Kuusanmäki H, Dufva O, Vähä-Koskela M, et al. Erythroid/megakaryocytic differentiation confers BCL-XL dependency and venetoclax resistance in acute myeloid leukemia. Blood. 2023;141(13):1610–1625. Inoue D, Kitaura J, Matsui H, et al. SETBP1 mutations drive leukemic transformation in ASXL1-mutated MDS. Leukemia. 2015;29(4):847–857. Wang Y, Abrol R, Mak JYW, et al. Histone deacetylase 7: a signalling hub controlling development, inflammation, metabolism and disease. FEBS J. 2023;290(11):2805–2832. Carmichael CL, Metcalf D, Henley KJ, et al. Hematopoietic overexpression of the transcription factor Erg induces lymphoid and erythro-megakaryocytic leukemia. Proceedings of the National Academy of Sciences. 2012;109(38):15437–15442. Thoms JAI, Birger Y, Foster S, et al. ERG promotes T-acute lymphoblastic leukemia and is transcriptionally regulated in leukemic cells by a stem cell enhancer. Blood. 2011;117(26):7079–7089. Tsuzuki S, Taguchi O, Seto M. Promotion and maintenance of leukemia by ERG. Blood. 2011;117(14):3858–3868. Starck J, Cohet N, Gonnet C, et al. Functional Cross-Antagonism between Transcription Factors FLI-1 and EKLF. Mol Cell Biol. 2003;23(4):1390–1402. Takeda J, Yoshida K, Nakagawa MM, et al. Amplified EPOR/JAK2 Genes Define a Unique Subtype of Acute Erythroid Leukemia. Blood Cancer Discov. 2022;3(5):410–427. Adélaïde J, Cervera N, Guille A, et al. Gains of EPOR and ERG genes in adult erythroleukaemia. Br J Haematol. 2020;189(4):e174-e177. Piqué-Borràs M-R, Jevtic Z, Otzen Bagger F, et al. The NFIA-ETO2 fusion blocks erythroid maturation and induces pure erythroid leukemia in cooperation with mutant TP53. Blood. 2023;141(18):2245–2260. Martin M, Kettmann R, Dequiedt F. Class IIa histone deacetylases: regulating the regulators. Oncogene. 2007;26(37):5450–5467. Varricchio L, Dell’Aversana C, Nebbioso A, et al. Identification of NuRSERY, a new functional HDAC complex composed by HDAC5, GATA1, EKLF and pERK present in human erythroid cells. Int J Biochem Cell Biol. 2014;50(1):112–122. Additional Declarations There is NO conflict of interest to disclose. Supplementary Files SupplementalInformation.pdf SupplementalTable.docx Supplementaldataset.xlsx Supplemental Dataset Cite Share Download PDF Status: Published Journal Publication published 15 Sep, 2024 Read the published version in Leukemia → Version 1 posted Editorial decision: revise 12 Apr, 2024 Review # 2 received at journal 10 Apr, 2024 Reviewer # 2 agreed at journal 03 Apr, 2024 Review # 1 received at journal 26 Mar, 2024 Reviewer # 1 agreed at journal 24 Mar, 2024 Reviewers invited by journal 24 Mar, 2024 Editor assigned by journal 12 Mar, 2024 Submission checks completed at journal 12 Mar, 2024 First submitted to journal 12 Mar, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4080460","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":283152014,"identity":"43f8af0b-8aad-466d-bcfe-7ca48227710b","order_by":0,"name":"Susumu Goyama","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABFElEQVRIie3RsUrDQBjA8e8IVIejWS8Eeq/wHYEsSlZfI+XA6ToJnYoWCnGJnVP0IRRf4KAQl9iuhSzxDYpDF6F60OggOXEUvP/08cGPu0sAXK6/2ymABu8w03ZHpj+S8y/CfkuWHcQWP8vF62ayHvQ3qYckg0ufVqKBSQLebfcxoqqiUJV1FBiSGsKCmzxCKCWQO91NCoWh6tXDe0M0yd4ZrmnMoKeBFKmNRG9qv7pqCbRkbyecqTgcZTrFz4vhcx4zktkJ0nJ8MppLsaheZpiuIFjk5QUO55La3sKvZ4+12iW8/ySXbDsG36fyodnukoGwfDHUx9iO5tcdbmI2ZqCi6BTAp0fN91274aybuFwu17/rA6wNW3n3f0HtAAAAAElFTkSuQmCC","orcid":"","institution":"Graduate School of Frontier Sciences, University of Tokyo","correspondingAuthor":true,"prefix":"","firstName":"Susumu","middleName":"","lastName":"Goyama","suffix":""},{"id":283152015,"identity":"3dcd4bcc-0128-40ca-ba06-4c1d9564e819","order_by":1,"name":"Wenyu Zhang","email":"","orcid":"","institution":"Graduate School of Frontier Sciences, University of Tokyo","correspondingAuthor":false,"prefix":"","firstName":"Wenyu","middleName":"","lastName":"Zhang","suffix":""},{"id":283152016,"identity":"86c9463c-8ae0-495d-8ae3-3acc70116a04","order_by":2,"name":"Keita Yamamoto","email":"","orcid":"","institution":"Graduate School of Frontier Sciences, University of Tokyo","correspondingAuthor":false,"prefix":"","firstName":"Keita","middleName":"","lastName":"Yamamoto","suffix":""},{"id":283152017,"identity":"1cf64029-be1a-4e91-8cac-bf65d0fb93b3","order_by":3,"name":"Yu-Hsuan Chang","email":"","orcid":"","institution":"Graduate School of Frontier Sciences, University of Tokyo","correspondingAuthor":false,"prefix":"","firstName":"Yu-Hsuan","middleName":"","lastName":"Chang","suffix":""},{"id":283152018,"identity":"d2375ac1-0820-45b1-ba9d-0e0669fdce5d","order_by":4,"name":"Tomohiro Yabushita","email":"","orcid":"","institution":"Graduate School of Frontier Sciences, University of Tokyo","correspondingAuthor":false,"prefix":"","firstName":"Tomohiro","middleName":"","lastName":"Yabushita","suffix":""},{"id":283152019,"identity":"26fd61c2-a34e-40a1-92c4-2ece3ad0aef4","order_by":5,"name":"Yangying Hao","email":"","orcid":"","institution":"Graduate School of Frontier Sciences, University of Tokyo","correspondingAuthor":false,"prefix":"","firstName":"Yangying","middleName":"","lastName":"Hao","suffix":""},{"id":283152020,"identity":"35528901-76a2-44a6-a993-88774f30e5b0","order_by":6,"name":"Ruka Shimura","email":"","orcid":"","institution":"Graduate School of Frontier Sciences, University of Tokyo","correspondingAuthor":false,"prefix":"","firstName":"Ruka","middleName":"","lastName":"Shimura","suffix":""},{"id":283152021,"identity":"c222f1b2-f4b6-4a03-9ea4-88817ccf5baf","order_by":7,"name":"Jakushin Nakahara","email":"","orcid":"","institution":"Graduate School of Frontier Sciences, University of Tokyo","correspondingAuthor":false,"prefix":"","firstName":"Jakushin","middleName":"","lastName":"Nakahara","suffix":""},{"id":283152022,"identity":"4addb72f-22db-4c4c-b559-1b9318ea6726","order_by":8,"name":"Shiori Shikata","email":"","orcid":"","institution":"Graduate School of Frontier Sciences, University of Tokyo","correspondingAuthor":false,"prefix":"","firstName":"Shiori","middleName":"","lastName":"Shikata","suffix":""},{"id":283152023,"identity":"a744ee52-af29-458c-89eb-e15de969f582","order_by":9,"name":"Kohei Iida","email":"","orcid":"","institution":"University of Tokyo","correspondingAuthor":false,"prefix":"","firstName":"Kohei","middleName":"","lastName":"Iida","suffix":""},{"id":283152024,"identity":"6f65de52-b7d4-4a51-8766-b625d0b97057","order_by":10,"name":"Qianyi Chen","email":"","orcid":"","institution":"Graduate School of Frontier Sciences, University of Tokyo","correspondingAuthor":false,"prefix":"","firstName":"Qianyi","middleName":"","lastName":"Chen","suffix":""},{"id":283152025,"identity":"8a30ad3d-23c0-404d-b72f-098d47d1650c","order_by":11,"name":"Xichen Zhang","email":"","orcid":"","institution":"Graduate School of Frontier Sciences, University of Tokyo","correspondingAuthor":false,"prefix":"","firstName":"Xichen","middleName":"","lastName":"Zhang","suffix":""},{"id":283152026,"identity":"195d4fee-6f5c-4f91-99f2-3ee15b0224c3","order_by":12,"name":"Toshio Kitamura","email":"","orcid":"https://orcid.org/0000-0001-7855-1767","institution":"University of Tokyo","correspondingAuthor":false,"prefix":"","firstName":"Toshio","middleName":"","lastName":"Kitamura","suffix":""}],"badges":[],"createdAt":"2024-03-12 05:30:48","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4080460/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4080460/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41375-024-02394-5","type":"published","date":"2024-09-15T04:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":53532196,"identity":"43841969-3873-470a-ae02-f9b329fcc430","added_by":"auto","created_at":"2024-03-27 06:38:31","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1410402,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTP53 inactivation and ERG overexpression promote the growth of immature erythroid progenitors.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA. \u003c/strong\u003eExperimental scheme used in\u003cstrong\u003e B-D. \u003c/strong\u003eHuman cord blood (CB) CD34\u003csup\u003e+\u003c/sup\u003e cells were transduced with p53DD (coexpressing NGFR) and ERG (coexpressing GFP) and cultured in the presence of EPO. \u003cstrong\u003eB. \u003c/strong\u003eProliferation curves of CB cells transduced with vector, p53DD, ERG or p53DD+ERG for 4 days. Results are expressed as mean ± s.e.m. of three independent experiments. \u003csup\u003e****\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.0001 \u003cstrong\u003eC, D. \u003c/strong\u003eCD71 and CD235a\u003csup\u003e \u003c/sup\u003eexpression (\u003cstrong\u003eC\u003c/strong\u003e) and Wright-Giemsa-staining (\u003cstrong\u003eD\u003c/strong\u003e)\u003cstrong\u003e, \u003c/strong\u003eoriginal magnification x400) of CB cells transduced with vector, p53DD, ERG or p53DD+ERG. \u003cstrong\u003eE\u003c/strong\u003e. CD235a expression of F36P, HEL and TF-1 cells transduced with vector or ERG.\u003c/p\u003e","description":"","filename":"Figures1.png","url":"https://assets-eu.researchsquare.com/files/rs-4080460/v1/701b2cf50fb751cad3bbf765.png"},{"id":53532498,"identity":"a9b8875f-a34f-45c9-9d3f-e50493a75de0","added_by":"auto","created_at":"2024-03-27 06:46:31","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":682605,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eERG represses erythroid gene expression and counteracts KLF1 activity.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA. \u003c/strong\u003eExperimental scheme used in \u003cstrong\u003eB-E\u003c/strong\u003e. \u003cstrong\u003eB. \u003c/strong\u003eWestern blotting of F36P cells transduced with vector or AM-tagged ERG. Cell lysates were stained with anti-AM, anti-ERG or anti-α-Tubulin antibodies. \u003cstrong\u003eC. \u003c/strong\u003eExpression levels of megakaryocyte- and erythrocyte-related genes in vector- or ERG-transduced F36P cells from RNA-seq data. \u003cstrong\u003eD. \u003c/strong\u003eTop motifs of ERG binding sites from ChIP-seq data. \u003cstrong\u003eE. \u003c/strong\u003eIntegrative Genomic Viewer (IGV) screenshots of ChIP-seq (ERG: \u003cstrong\u003eblue\u003c/strong\u003e and H3K27ac: \u003cstrong\u003egreen\u003c/strong\u003e) and RNA-seq (\u003cstrong\u003ered\u003c/strong\u003e) signals at \u003cem\u003eGATA2\u003c/em\u003e, \u003cem\u003eFLI1\u003c/em\u003e and \u003cem\u003eEPOR\u003c/em\u003e genes in vector- or ERG-transduced F36P cells.\u003cstrong\u003e F. \u003c/strong\u003eNumerous ERG-binding sequences (GGAAG) are present in the promoter region of EPOR. \u003cstrong\u003eG. \u003c/strong\u003eVenn diagram showing the overlap of ERG- and KLF1-bound genes in erythroid cells. \u003cstrong\u003eH. \u003c/strong\u003eReporter assay with the 6x KLF1 promoter in 293T cells. Results are expressed as mean ± s.e.m. of triplicates. \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"Figures2.png","url":"https://assets-eu.researchsquare.com/files/rs-4080460/v1/3a45a982a320de6a4c82b947.png"},{"id":53532203,"identity":"d08ecfe4-5f2b-4f93-b6df-b5e201159d83","added_by":"auto","created_at":"2024-03-27 06:38:32","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":563696,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eTrp53\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e deficiency and ERG overexpression induce murine AEL.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e. Experimental scheme used in \u003cstrong\u003eB-E\u003c/strong\u003e. \u003cstrong\u003eB. \u003c/strong\u003eKaplan-Meier survival curves of mice transplanted with ERG-expressing cells (n = 7) or \u003cem\u003eTrp53\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003eERG-expressing cells (n = 8) are shown. \u003cstrong\u003eC. \u003c/strong\u003eWhite blood cell (WBC), red blood cell (RBC), hemoglobin (Hb) and platelet (PLT) count in the negative control (NC: normal C57BL/6 mice, n=3) mice and in the mice transplanted with ERG-expressing cells (ERG, n=4) or \u003cem\u003eTrp53\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003eERG-expressing cells (\u003cem\u003eTrp53\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003eERG, n=4) 8 weeks after transplantation. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, \u003csup\u003e***\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001. \u003cstrong\u003eD\u003c/strong\u003e. Flow cytometric analysis of bone marrow (BM) and spleen (SPL) cells in the NC mice and mice transplanted with \u003cem\u003eTrp53\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003eERG-expressing cells 8 weeks after transplantation. Quantified data are shown in Supplemental Figure 3C. \u003cstrong\u003eE. \u003c/strong\u003eFlow cytometric analysis of BM and SPL cells from mice transplanted with ERG-expressing cells 50 weeks after transplantation. \u003cstrong\u003eF. \u003c/strong\u003eKaplan–Meier survival curves of secondary recipient mice transplanted with ERG-expressing or \u003cem\u003eTrp53\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003eERG-expressing spleen cells. \u003cstrong\u003eG\u003c/strong\u003e. Flow cytometric analysis of BM and SPL cells in the secondary recipient mice transplanted with \u003cem\u003eTrp53\u003c/em\u003e\u003csup\u003e-/-\u003c/sup\u003eERG-expressing spleen cells 4 weeks after transplantation.\u003c/p\u003e","description":"","filename":"Figures3.png","url":"https://assets-eu.researchsquare.com/files/rs-4080460/v1/8d9bca137513b5b92814e103.png"},{"id":53532206,"identity":"2f6b3571-09cd-471d-a6c4-e622afecbb78","added_by":"auto","created_at":"2024-03-27 06:38:32","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1139067,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEstablishment of a murine AEL cell line: CEP53\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA. \u003c/strong\u003eCEP53 cells in suspension (far left), Wright-Giemsa staining of a cytospin slide of CEP53 cells (left) and flow cytometric analysis of CEP53 cells for GFP (right) and Ter119 and CD71 (far right). \u003cstrong\u003eB.\u003c/strong\u003e CEP53 cells were transplanted into non-irradiated recipient mice. Bone marrow (BM) and spleen (SPL) cells were collected from two moribund mice. Expression of GFP, Ter119, CD71 in BM and SPL cells were shown. Note that almost all GFP\u003csup\u003e+\u003c/sup\u003e CEP53 cells were CD71\u003csup\u003e+\u003c/sup\u003eTer119\u003csup\u003e+/-\u003c/sup\u003e erythroblasts.\u003c/p\u003e","description":"","filename":"Figures4.png","url":"https://assets-eu.researchsquare.com/files/rs-4080460/v1/a8fa3975a1ea0e4ac7e1f307.png"},{"id":53532205,"identity":"ff4c0228-404f-423d-8387-44439a94e0cf","added_by":"auto","created_at":"2024-03-27 06:38:32","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":648395,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eHDAC7\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e depletion induces erythroid maturation in human AEL cells.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA. \u003c/strong\u003eDepMap Gene Effect Score analysis between erythroid (n=4) and non-erythroid human AML (n=11). GATA1, KLF1, BCL2L1 and HDAC7 were selectively important for the growth of erythroid cells.\u003cstrong\u003e B. \u003c/strong\u003eErythroid (F36P and TF-1) and non-erythroid (THP-1 and Kasumi-1) cells were transduced with non-targeting (NT) or \u003cem\u003eHDAC7\u003c/em\u003e-targeting (sg\u003cem\u003eHDAC7\u003c/em\u003e-A/B/C) sgRNAs. The expression of HDAC7 and Tubulin in these cell lines was evaluated by Western blotting. \u003cstrong\u003eC.\u003c/strong\u003e THP-1, KASUMI-1, F36P and TF-1 cells were transduced with the sg\u003cem\u003eHDAC7\u003c/em\u003e-A/B/C or NT sgRNA co-expressing tRFP657 followed by \u003cem\u003ein vitro\u003c/em\u003e cell culture. Results are normalized to the frequency of tRFP657\u003csup\u003e+\u003c/sup\u003e cells at day 4, set to 1. Data are expressed as mean ± s.e.m. of three independent experiments. \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01, \u003csup\u003e****\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.0001. \u003cstrong\u003eD. \u003c/strong\u003eFlow cytometric analysis of CD235a expression in F36P and TF-1 cells transduced with sgNT or sg\u003cem\u003eHDAC7\u003c/em\u003e-A transduction. \u003cstrong\u003eE.\u003c/strong\u003e GSEA showing the enrichment of GATA-1 targets genes and erythrocyte membrane genes among the upregulated genes in \u003cem\u003eHDAC7\u003c/em\u003e-depleted F36P cells (left). A volcano plot showing differentially expressed genes between control and \u003cem\u003eHDAC7\u003c/em\u003e-depleted F36P cells. Down- (blue) and up- (red) regulated genes are defined by -log (FDR) greater than 1.3 (right).\u003c/p\u003e","description":"","filename":"Figures5.png","url":"https://assets-eu.researchsquare.com/files/rs-4080460/v1/a94c672e970bca88731bc7d3.png"},{"id":53532201,"identity":"a4425175-a24a-4d66-91e6-b2af7548e2bc","added_by":"auto","created_at":"2024-03-27 06:38:32","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":422464,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eHdac7\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e deletion inhibits mouse AEL development.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA. \u003c/strong\u003eCEP53 and cSAM cells were transduced with non-targeting (NT) or two independent \u003cem\u003eHdac7\u003c/em\u003e-targeting sgRNAs (sg\u003cem\u003eHdac7\u003c/em\u003e-a/b). The expression of Hdac7 and Tubulin in these cell lines was evaluated by Western blotting. \u003cstrong\u003eB.\u003c/strong\u003e CEP53 and cSAM cells were transduced with NT or sg\u003cem\u003eHdac7\u003c/em\u003e-a/b co-expressing tRFP657 followed by \u003cem\u003ein vitro\u003c/em\u003e cell culture. Results are normalized to the frequency of tRFP657\u003csup\u003e+\u003c/sup\u003e cells at day 4, set to 1. Data are expressed as mean ± s.e.m. of three independent experiments. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01. \u003cstrong\u003eC.\u003c/strong\u003e Flow cytometric analysis of Ter119 in control or \u003cem\u003eHdac7\u003c/em\u003e-depleted CEP53 cells.\u003cstrong\u003e D\u003c/strong\u003e. Experimental scheme used in \u003cstrong\u003eE\u003c/strong\u003e. CEP53 cells were transduced with sgNT or sg\u003cem\u003eHdac7\u003c/em\u003e-\u003cem\u003ea\u003c/em\u003e co-expressing tRFP657, following transplantation into non-irradiated recipient mice. Representative FACS plots are shown in Supplemental Figure 5A. \u003cstrong\u003eE\u003c/strong\u003e. Relative ratios of the tRFP657\u003csup\u003e+\u003c/sup\u003e (sgRNA-transduced) fraction in GFP\u003csup\u003e+\u003c/sup\u003e CEP53 cells after transplantation compared to that before transplantation are shown as mean ± s.e.m. \u003csup\u003e***\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.001, \u003csup\u003e****\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e\u0026lt;0.0001. sgNT n=4, sgHdac7 n=6 for each group.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e","description":"","filename":"Figures6.png","url":"https://assets-eu.researchsquare.com/files/rs-4080460/v1/589b3e6e2f97a18ec0e01fc9.png"},{"id":53532499,"identity":"c646ba24-040f-4982-8411-f17717dc2458","added_by":"auto","created_at":"2024-03-27 06:46:31","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":538745,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHDAC7 promotes AEL cell growth through non-enzymatic function.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e. Erythroid (HEL, F36P, TF-1) and non-erythroid (MOLM13, MV4;11, NOMO1, MONO-MAC6, SKM1, SKNO1, HL60) human AML cell lines were treated with TMP269 (1 – 100 mM) for 72 hours in three technical replicates. \u003cstrong\u003eB\u003c/strong\u003e. Construction of sgRNA-resistant HDAC7 cDNA. \u003cstrong\u003eC\u003c/strong\u003e. Schematic representation of HDAC7. The H672A mutation was shown to abolish its enzymatic activity. \u003cstrong\u003eD\u003c/strong\u003e. F36P cells were transduced with vector, FLAG-tagged wild-type (WT) HDAC7 or HDAC7-H672A, and their expression was confirmed by Western blotting. \u003cstrong\u003eE\u003c/strong\u003e. The dose-dependent reduction of HDAC activity in F36P cells by TSA treatment was confirmed using the same assay (left). HDAC activity was evaluated in vector, HDAC7-WT or HDAC7-H672A-transduced F36P cells using the HDAC-Glo\u003csup\u003eTM\u003c/sup\u003e I/II assay (right). \u003cstrong\u003eF\u003c/strong\u003e. The vector, HDAC7-WT or HDAC7-H672A transduced F36P cells were then transduced with non-targeting (NT) or \u003cem\u003eHDAC7\u003c/em\u003e-targeting (sg\u003cem\u003eHDAC7\u003c/em\u003e-A) sgRNA. HDAC7 and Tubulin expression was evaluated by Western blotting. \u003cstrong\u003eG\u003c/strong\u003e. The vector, HDAC7-WT or HDAC7-H672A transduced F36P cells were transduced with NT or sg\u003cem\u003eHdac7\u003c/em\u003e-A co-expressing tRFP657 followed by \u003cem\u003ein vitro\u003c/em\u003e cell culture. Results are normalized to the frequency of tRFP657\u003csup\u003e+\u003c/sup\u003e cells at day 4, set to 1. \u003cstrong\u003eH\u003c/strong\u003e. Flow cytometric histograms of CD235a expression in F36P cells transduced with vector-, HDAC7-WT or HDAC7-H672A together with NT or sg\u003cem\u003eHdac7\u003c/em\u003e-A.\u003c/p\u003e","description":"","filename":"Figures7.png","url":"https://assets-eu.researchsquare.com/files/rs-4080460/v1/27d59acba0f194ea2f7f2b33.png"},{"id":64544532,"identity":"3be9723d-8bc4-4d46-b6c7-fab835ed1001","added_by":"auto","created_at":"2024-09-15 07:05:22","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":7129668,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4080460/v1/34693500-ed49-45a1-ae67-c5051773f68a.pdf"},{"id":53532204,"identity":"a4e12427-bb52-4266-85b0-ee8685e8606d","added_by":"auto","created_at":"2024-03-27 06:38:32","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":9850854,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementalInformation.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4080460/v1/a323b2fc82bb96fcabcd83d9.pdf"},{"id":53532198,"identity":"b9a58cc1-2708-41a7-b0e7-fc62e607884e","added_by":"auto","created_at":"2024-03-27 06:38:31","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":71415,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementalTable.docx","url":"https://assets-eu.researchsquare.com/files/rs-4080460/v1/af23b2277ddf61b800b9dd8e.docx"},{"id":53532500,"identity":"62982048-5188-4603-8a46-07a4714237b9","added_by":"auto","created_at":"2024-03-27 06:46:32","extension":"xlsx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":11218482,"visible":true,"origin":"","legend":"\u003cp\u003eSupplemental Dataset\u003c/p\u003e","description":"","filename":"Supplementaldataset.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4080460/v1/e736f0a4ec415db1b95f9cf6.xlsx"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e conflict of interest to disclose.","formattedTitle":"HDAC7 is a specific therapeutic target in Acute Erythroid Leukemia","fulltext":[{"header":"Key Points","content":"\u003cul\u003e\n \u003cli\u003e\u003cem\u003eTP53\u003c/em\u003e deficiency and ERG overexpression collaboratively induce the development of AEL.\u003c/li\u003e\n \u003cli\u003eHDAC7 is a promising and selective therapeutic target in AEL.\u0026nbsp;\u003c/li\u003e\n\u003c/ul\u003e"},{"header":"Introduction","content":"\u003cp\u003eAcute erythroleukemia (AEL) is a rare and aggressive subtype of acute myeloid leukemia (AML) involving uncontrolled proliferation of erythroid precursors leading to the accumulation of immature and abnormal red blood cells in the bone marrow and peripheral blood\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. AEL has traditionally been recognized as having two subtypes: the more common erythroid/myeloid leukemia (EML), defined by the presence of increased erythroid cells and myeloid blasts; and the very rare pure erythroid leukemia (PEL), characterized by the expansion of immature erythroid cells only. Although EML is no longer considered a distinct entity, PEL is still recognized as a distinct variant of AML in both the 2016 and 2022 World Health Organization (WHO) classification systems. It is now widely recognized that true AEL, characterized primarily by immature erythroid proliferation, is often associated with highly complex cytogenetic alterations and biallelic loss of TP53 function\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e \u003cp\u003eAEL is typically a disease of older adults and has a very poor prognosis with a median survival time of typically less than 6 months. \u003cem\u003eTP53\u003c/em\u003e mutations/deletions are often accompanied by gains and amplifications involving the \u003cem\u003eJAK2/EPOR/MPL\u003c/em\u003e genes and \u003cem\u003eERG/ETS2\u003c/em\u003e in AEL\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. \u003cem\u003eJAK2\u003c/em\u003e, \u003cem\u003eEPOR\u003c/em\u003e and \u003cem\u003eMPL\u003c/em\u003e are the genes related to the JAK/STAT pathway that was shown to promote erythroid cell proliferation.\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e ETS2 and ERG are transcription factors that were shown to promote megakaryopoiesis while inhibiting erythroid maturation\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e,\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Thus, genetic analyses suggest that loss of TP53, JAK/STAT overactivation and aberrant expression of megakaryocytic transcription factors collaboratively promote the development of AEL.\u003c/p\u003e \u003cp\u003ePrevious studies have reported several mouse models for AEL with \u003cem\u003eTP53\u003c/em\u003e mutations or deletion\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. Classically, loss of \u003cem\u003eTrp53\u003c/em\u003e alleles or expression of mutant TP53 has been shown to promote the Friend virus- and Spi1-induced erythroleukemia\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e,\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. More recent models recapitulating the genetic alterations found in AEL have shown that \u003cem\u003eTrp53\u003c/em\u003e-deficiency or \u003cem\u003eTP53\u003c/em\u003e mutations cooperate with \u003cem\u003eJAK2-V617F, NTRK1-H498R, NFIA-ETO2\u003c/em\u003e and \u003cem\u003eERG\u003c/em\u003e to induce erythroleukemia in mice\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e,\u003cspan additionalcitationids=\"CR11 CR12\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. Although these mouse models have provided insights into the pathogenesis of AEL, how these genetic alterations cooperate with TP53 inactivation in the process of erythroid transformation is still not fully understood. From a therapeutic point of view, it has been shown that JAK or Trk inhibitors are effective in inhibiting the development of AEL \u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e,\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. However, such kinase inhibitors are often not sufficient to eliminate all the leukemic clones, and therefore other therapeutic targets in AEL need to be identified.\u003c/p\u003e \u003cp\u003eIn this study, we investigated the effect of TP53 inhibition and ERG overexpression on erythroid leukemogenesis using human cord blood cells, human erythroid leukemia cell lines and a mouse transplantation assay. TP53 inhibition promotes the growth of erythroid progenitors, while ERG inhibits terminal maturation of erythroid cells, and the combination induces the development of AEL. We also identified HDAC7 as a critical and specific regulator in erythroid leukemogenesis, which could be a promising therapeutic target for AEL.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eMice\u003c/h2\u003e \u003cp\u003eC57BL/6 (Ly5.2) mice (Sankyo Labo Service Corporation, Tokyo, Japan) were used for bone marrow transplantation assays. \u003cem\u003eTrp53\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice, in which 5\u0026prime; part of exon 2 including translation initiation site of \u003cem\u003eTrp53\u003c/em\u003e gene was replaced with Neomycin resistance gene, were provided from the RIKEN BioResource Center (Ibaragi, Japan)\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. Rosa26-LSL-Cas9 knockin mice were purchased from Jackson Laboratory (#024857)\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. The \u003cem\u003eTrp53\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice were crossed with the Cas9 knockin mice to obtain \u003cem\u003eTrp53\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e/Cas9 mice. All animal experiments were approved by the Animal Care Committee of the Institute of Medical Science at the University of Tokyo (PA21-67), and were conducted following the Regulation on Animal Experimentation at University of Tokyo based on International Guiding Principles for Biomedical Research Involving Animals.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eCell culture\u003c/h2\u003e \u003cp\u003eHuman cord blood (CB) cells were obtained from the Japanese Red Cross Kanto-Koshinetsu Cord Blood Bank (Tokyo, Japan). Mono nuclear cells (MNCs) were isolated from CB by density gradient centrifugation using LymphoprepTM (density 1.077; Alere Technologies AS, Oslo, Norway). The CD34\u003csup\u003e+\u003c/sup\u003e cell fraction was then isolated from the MNCs using the MidiMACS system (CD34\u003csup\u003e+\u003c/sup\u003e Microbead Kit; Miltenyi Biotec; Bergisch Gladbach, Germany) according to the manufacturer\u0026rsquo;s protocols. CB CD34\u003csup\u003e+\u003c/sup\u003e cells were incubated in StemSpanTM SFEMII (STEMCELL Technologies) supplemented with 100 ng/ml rhSCF (#255-SC, R\u0026amp;D Systems), 10 ng/ml rhIL-6 (#206-IL, R\u0026amp;D Systems), 1 ng/ml rhIL-3 (#203-IL, R\u0026amp;D Systems) and 1% penicillin\u0026ndash;streptomycin (PS, #09367-34, Nacalai). CB cells were then transduced with vector or p53DD and were cultured in StemSpan SFEM II medium (#ST-09655, STEMCELL Technologies) with 2 U/ml erythropoietin (EPO, #3999412G7020, Kyowa Kirin). THP1 and Kasumi-1 cells were cultured in Roswell Park Memorial Institute (RMPI)-1640 medium (#189\u0026ndash;02025, FUJIFILM Wako) with 10% fetal bovine serum (FBS; #FB-1365/500, Biosera) and 1% PS. F36P and TF-1 cells were cultured in RPMI-1640 medium supplemented with 10% FBS, 1% PS and 2 ng/ml GM-CSF (#215-GMP, R\u0026amp;D Systems). cSAM cells were cultured in RPMI-1640 medium supplemented with 10% FBS containing 1 ng/ml mouse IL-3 (#203-IL, R\u0026amp;D Systems). CEP53 cells were cultured in RPMI-1640 medium supplemented with 10% FBS containing 1 ng/ml EPO (#959-ME, R\u0026amp;D Systems). Plat-E and 293 T cells were cultured in Dulbecco\u0026rsquo;s Modified Eagle Medium (DMEM) medium (#044\u0026ndash;29765, Wako) with 10% FBS and 1% PS.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003ePlasmids\u003c/h2\u003e \u003cp\u003ep53DD was obtained from Addgene (#25989)\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e, and we cloned it into pMYs-IRES-NGFR vector\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. MSCV-PIG, MSCV-PIG-ERG was abstained from Addgene (#66984)\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. We added the AM-tag sequence (5\u0026rsquo;-TGCCAAGATCCTCAACGCAAAGGCAACGTGATACTCTCTCAGGC\u003c/p\u003e \u003cp\u003eTTACGGGTGCCAAGATCCTCAACGCAAAGGCAACGTGATACTCTCTCAGGCTTACTAG-3\u0026rsquo;) into MSCV-PIG-ERG for the ChIP-Seq assay. pcDNA3-GATA1 (Addgene # 85693)\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e, pSG5-hEKLF (Addgene #67835)\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e and pGL3-GATA-Luc (Addgene #85695)\u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e were obtained from Addgene. pGL4.10[Luc2] (#E6651) and pGL4.74[hRluc/TK] (#E692A) were obtained from Promega. For pGL4.1-KLF1-Luc, we amplified the 6x repeat promoter sequence (5\u0026rsquo;-AGGGTGTGG-3\u0026rsquo;) of KLF1 \u003csup\u003e23\u003c/sup\u003e using PCR and inserted the PCR-amplified fragment into the restriction sites of pGL4.10[Luc2].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eViral transduction\u003c/h2\u003e \u003cp\u003eRetroviruses for mouse cells were generated by transient transfection of retroviral constructs into Plat-E packaging cells\u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e using the calcium phosphate method. Retroviruses for human cells were generated by transient transfection of retroviral constructs along with M57 and RD114 into 293T cells using the calcium phosphate method. Retrovirus transduction to the cells was performed using Retronectin (Takara Bio Inc., Otsu, Shiga, Japan). Lentiviruses were produced by transient transfection of lentiviral plasmids along with pCMV-VSV-G (Addgene, #8454)\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e and psPAX2 (Addgene, #12260) into 293T cells using the calcium-phosphate method.\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eGene depletion using the CRISPR/Cas9 system\u003c/h2\u003e \u003cp\u003eTo generate short guide RNA (sgRNA) constructs, annealed oligos were inserted into pLentiguide-puro vector (#52963) or pLKO5.sgRNA.EFS.tRFP657 vector (#57824)\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e, which were obtained from Addgene. Cas9 expressing vector was also obtained from addgene (lentiCas9-Blast #52962)\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. Lentiviruses were produced by transient transfection of 293T cells as described above. Cells were infected with the virus for 24 hours and were selected for stable expression of Cas9 using blasticidin (10 \u0026micro;g/ml). The sgRNA-transduced cells were selected using puromycin (1\u0026micro;g/ml) or FACS-based sorting of tRFP657-positive cells. The sequences of sgRNAs are provided in Supplemental Table\u0026nbsp;1.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eLuciferase assay\u003c/h2\u003e \u003cp\u003e1x10\u003csup\u003e5\u003c/sup\u003e 293T cells were seeded in 12-well culture plates with cells in 500 \u0026micro;L medium. 18 h after seeding, the cells were transfected with pGL4.1-6X-KLF1 or pGL3-GATA-Luc (co-expressing Firefly Luciferase [FLuc]), pSG5-hEKLF (KLF1) or pcDNA3-GATA1, and pGL4.74 vector (co-expressing Renilla Luciferase [RLuc]) with MSCV-PIG-ERG or MSCV-PIG, using polyethylenimine (PEI). The cells were harvested 48 h after transfection and were assayed for the luciferase activity using the luciferase assay system (Promega) and a luminometer (BMG LABTECH, FLUOstar OPTIMA). Promoter activity was calculated as a ratio of Fluc to Rluc.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eTransplantation assay\u003c/h2\u003e \u003cp\u003eMouse bone marrow cells were collected from the Cas9 mice and \u003cem\u003eTrp53\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e/Cas9 mice. Bone marrow progenitors (c-Kit\u003csup\u003e+\u003c/sup\u003e cells) were selected using the CD117 MicroBead Kit (Miltenyi Biotec) and were pre-cultured in RPMI-1640 containing 10% FBS, 1% penicillin\u0026ndash;streptomycin and 50 ng/ml murine SCF, 10 ng/ml TPO, 10 ng/ml IL-3 and 10 ng/ml IL-6 for 16hr. These cells were then transduced with ERG and transplanted into sublethally (5.25 Gy) irradiated 12 weeks-old C57BL/6 mice. Each mouse received 2x10\u003csup\u003e5\u003c/sup\u003e cells. For transplantation of CEP53 cells, each mouse received 5x10\u003csup\u003e6\u003c/sup\u003e CEP53 cells without irradiation. For the \u003cem\u003ein vivo\u003c/em\u003e transplantation assay using sgRNAs targeting \u003cem\u003eHdac7\u003c/em\u003e, spleen cells collected from the moribund AEL mice were transduced with NT or \u003cem\u003eHdac7\u003c/em\u003e-sgRNAs, and 5x10\u003csup\u003e5\u003c/sup\u003e cells were transplanted into sublethally (525 cGy) irradiated 12 weeks-old C57BL/6 mice.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eFlow Cytometry\u003c/h2\u003e \u003cp\u003eCells were stained by fluoro-conjugated antibodies for 30min at 4\u0026deg;C. After staining, cells were washed with cold PBS two times, and were resuspended in PBS containing 2% FBS. Cells were analyzed with Canto II (BD Biosciences, San Jose, CA, USA) and FlowJo software (FlowJo) or sorted with FACS Aria III (BD Biosciences, San Jose, CA, USA). The antibodies and their dilution ratios are provided in Supplemental Table\u0026nbsp;2.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eWestern blotting\u003c/h2\u003e \u003cp\u003eCells were washed with PBS several times and lysed with pre-heated Laemmli sample buffer (Bio-rad, USA; #1610737). Total cell lysates were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to a polyvinylidene fluoride membrane (Bio-Rad). Bands were visualized by LAS-4000 Luminescent Image Analyzer (FUJIFILM). The antibodies and their dilution ratios are provided in Supplemental Table\u0026nbsp;3.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eRNA-Seq\u003c/h2\u003e \u003cp\u003eFor RNA-seq with mouse AEL cells and erythroid progenitors, bone marrow cells were collected from normal C57BL/6 mice and the mice transplanted with \u003cem\u003eTrp53\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003eERG-expressing cells. Cells were then stained with biotinylated Ter119 and CD71 antibodies and 2x10\u003csup\u003e6\u003c/sup\u003e Ter119\u003csup\u003e+\u003c/sup\u003eCD71\u003csup\u003e+\u003c/sup\u003e cells were sorted by AriaIII (BD Biosciences, San Jose, CA, USA). For RNA-seq with F36P cells, F36P cells were transduced with vector/ERG (coexpress GFP) or NT/HDAC7-sgRNAs. GFP\u003csup\u003e+\u003c/sup\u003e cells were sorted by AriaIII. The sgRNA-transduced cells were selected with 1 \u0026micro;g/ml puromycin. Total RNA was extracted using RNeasy Mini Kit (Qiagen). After RNA fragmentation, cDNA was synthesized by random hexamer-primed reverse transcription, followed by a second-strand cDNA synthesis with dUTP. Following end repair, add A and adaptor ligation, the DNA fragments were amplified by PCR. Libraries were sequenced using Illumina NovaSeq 6000 with paired-end mode (2x100 bp). Pair-end sequencing FASTQ files were aligned to the mouse reference genome (mm10). Raw gene counts were derived from the read alignments by Rsubread\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e (v2.12.3) and further transferred into count per million (CPM) by edgeR\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e (v3.40.2). After filtering out low-expression genes with CPM lower than 1, all CPM values were log2 transformed for generating unsupervised clustering dendrograms and heatmaps. Differential expression was analyzed with the linear model using limma\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e (v3.54.2). Genes with false discovery rate (FDR)\u0026thinsp;\u0026lt;\u0026thinsp;0.05 adjusted by the Benjamini-Hochberg method were considered significant differentially expressing genes (DEGs). \u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e Pathway analyses were performed using GO Enrichment Analysis\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e and Gene Set Enrichment Analysis\u003csup\u003e\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e,\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eChIP-Seq\u003c/h2\u003e \u003cp\u003eChromatin immunoprecipitation was performed using Simple chip kit (Cell signaling technology, #9002) following the manufacturer\u0026rsquo;s instructions. 1x10\u003csup\u003e7\u003c/sup\u003e F36P cells transduced with vector or ERG were fixed with 1% formaldehyde (Sigma) and then quenched with glycine. After washing and cell lysis, the chromatin was fragmented with 0.75 \u0026micro;l micrococcal nuclease (MNase) at 37 C for 15\u0026ndash;20 min and nuclei were completely lysed by sonication. The 10 \u0026micro;g of chromatin in each reaction was incubated with 10 \u0026micro;l of anti-AM (#91111, Active motif), anti-H3K27ac (#8173, CST) or IgG antibody (#2729,CST) overnight at 4 C with rotation. Immunoprecipitation was performed with protein G magnetic beads. Following elution, reverse-crosslinks, and purification, DNA was used for sequencing. ChIP-seq libraries were prepared and sequenced using Illumina Novaseq 6000 with paired-end mode (2x150 bp). Pair-end sequencing FASTQ files were aligned to the human reference genome (hg38) using Bowtie2\u003csup\u003e36\u003c/sup\u003e on Galaxy platform (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://usegalaxy.org\u003c/span\u003e\u003cspan address=\"https://usegalaxy.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Mapped reads were transformed by bamCoverage with the parameter \u0026ldquo;normalize using RPKM\u0026rdquo; from the deepTools\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. Heatmap was generated by plotHeatmap which also from the deepTools. Peak calling was performed with MACS2 callpeak.\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e Gene list of peak calling was established by using R package CHIPseeker.\u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eCell viability assay\u003c/h2\u003e \u003cp\u003eThe cytotoxicity of the class IIA HDAC inhibitor (TMP269) against various cell lines was assessed using the Cell Counting Kit-8 (Dojindo, Kumamoto, Japan) according to the provided instructions. Cells were plated at a density of 1\u0026times;10\u003csup\u003e4\u003c/sup\u003e cells/well in 0.1 ml of RPMI medium in 96-well plates and then treated with different concentrations of each compound. After 72-hours of incubation with the compounds at 37\u0026deg;C, 8 \u0026micro;l of Cell Counting Kit-8 solution was added to each well. Following 1-hour incubation at 37\u0026deg;C, absorbance at 450 nm was measured using a microplate reader (CLARIOstar Plus, BMG LABTECH, Ortenberg, GER). Relative cell viability was calculated as the ratio of the absorbance in each treatment group to that of the corresponding untreated control group. Data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD) of more than three independent experiments.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eHistone deacetylase enzyme activity measure assay\u003c/h2\u003e \u003cp\u003eHDAC activity was evaluated using the HDAC-Glo\u0026trade; I/II Assay and Screening System (Promega #G6420). 1\u0026times;10\u003csup\u003e4\u003c/sup\u003e cells/well were seeded in a 96-well plate with 100 \u0026micro;L HDAC-Glo\u0026trade; I/II buffer. Then, 100 \u0026micro;L HDAC-Glo\u0026trade; I/II reagent and 1 \u0026micro;L developer reagent were added to each well. After incubation for 30 minutes at room temperature, luminescence was measured using the FLUOstar OPTIMA. Data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD) of more than three independent experiments.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analyses\u003c/h2\u003e \u003cp\u003eGraphPad Prism 9 was used for statistical analyses. Unpaired Student's t-test (two-tailed) and Ordinary one-way ANOVA were used for pairwise comparisons of significance. The log-rank (Mantel-Cox) was used for the survival curves comparison. Animal experiments were neither blinded nor randomized. The type of replication (biological or technical) is indicated in figure legends. Sample size was decided based on our previous experience in the field, not predetermined by a statistical method. All data are shown as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eDistinct roles of TP53 and ERG in erythroid proliferation and differentiation\u003c/h2\u003e \u003cp\u003eWe first assessed the effect of TP53 inhibition and ERG overexpression on proliferation and differentiation of human erythroid progenitors. We transduced ERG and/or dominant negative TP53 fragment (p53DD) into human cord blood (CB) CD34\u003csup\u003e+\u003c/sup\u003e cells and cultured them in the presence of erythropoietin (EPO) to induce erythroid differentiation (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). p53DD promoted both proliferation and differentiation of CB cells, as evidenced by the increased cell numbers and CD71\u003csup\u003e+\u003c/sup\u003eCD235\u003csup\u003e+\u003c/sup\u003e cells in culture (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, C). In contrast, ERG overexpression resulted in significant increase of CD71\u003csup\u003e\u0026minus;\u003c/sup\u003eCD235\u003csup\u003e\u0026minus;\u003c/sup\u003e non-erythroid cells with little influence on CB cell proliferation. Notably, coexpression of ERG and p53DD promoted the efficient growth of immature CD71\u003csup\u003e+\u003c/sup\u003eCD235\u003csup\u003e\u0026minus;\u003c/sup\u003e erythroid progenitors without enhancing erythroid differentiation (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Morphological analysis revealed that the p53DD-transduced cells had visible dark nucleoli in the nucleus, indicating the effect of TP53 inactivation to increase erythroblasts (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). To further assess the role of ERG in erythroid differentiation, we transduced ERG into several human AML cell lines with erythroid properties: F36P, HEL, and TF-1. ERG expression was confirmed by western blotting (\u003cb\u003eSupplemental Fig.\u0026nbsp;1A\u003c/b\u003e). The cells were then cultured with human EPO to induce erythroid differentiation for 6 days. Consistent with the earlier results, ERG overexpression inhibited the expression of an erythroid marker CD235a (glycophorin A) and the morphological changes induced by EPO in all these erythroid leukemia cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE, \u003cb\u003eSupplemental Fig.\u0026nbsp;1B\u003c/b\u003e). These data suggest a distinct role for TP53 and ERG in erythropoiesis: TP53 restricts proliferation and differentiation of hematopoietic stem and progenitor cells toward the erythroid lineage, whereas ERG inhibits terminal differentiation of erythroid progenitors. Importantly, TP53 inhibition together with ERG overexpression in human CB CD34\u003csup\u003e+\u003c/sup\u003e cells induced rapid proliferation of immature erythroblasts.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eERG inhibits erythroid differentiation by antagonizing KLF1 activity\u003c/h2\u003e \u003cp\u003eTo understand how ERG inhibits erythroid differentiation, we next performed RNA-Seq and ChIP-seq analyses using F36P cells expressing vector or ERG with a C-terminal AM (Active Motif) tag (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). High expression of AM-tagged ERG in F36P cells was confirmed by western blotting and RNA-seq (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB, \u003cb\u003eSupplemental Fig.\u0026nbsp;2B\u003c/b\u003e). RNA-seq revealed significant downregulation of several erythroid genes, including KLF1, EPOR, HBG and LMO2, in ERG-expressing F36P cells. In contrast, ERG overexpression induced upregulation of genes related to megakaryopoiesis, such as \u003cem\u003eITGB3\u003c/em\u003e, \u003cem\u003eGP1BA\u003c/em\u003e and \u003cem\u003eFLI1\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC, \u003cb\u003eSupplemental Fig.\u0026nbsp;2A, 2B, Supplemental Dataset\u003c/b\u003e). Gene set enrichment analysis (GSEA) showed that ERG induced downregulation of GATA1-target genes and heme metabolism pathway genes, whereas it induced upregulation of genes related to megakaryopoiesis (\u003cb\u003eSupplemental Fig.\u0026nbsp;2C\u003c/b\u003e). Thus, consistent with the earlier report\u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e, ERG overexpression promotes expression of megakaryocyte-specific genes while inhibiting erythroid gene expression.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eChIP-seq revealed that ERG bound to genomic regions containing the ETS core consensus sequence [5\u0026prime;-GGA(A/T)-3\u0026prime;], including those with FLI1, ETS1 and PU.1-binding sequences (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). More than 75% of ERG binding sites were located in promoter regions and many of them were enriched for histone 3 lysine 27 acetylation (H3K27ac), a marker of active transcription (\u003cb\u003eSupplemental Fig.\u0026nbsp;2D, E, Supplemental Dataset\u003c/b\u003e). Genes associated with platelet activation, megakaryocyte and hemostasis pathways were upregulated by ERG with the increase of H3K27 acetylation at their promoters (\u003cb\u003eSupplemental Fig.\u0026nbsp;2F\u003c/b\u003e). In particular, we identified GATA2 and FLI1 as direct ERG target genes in F36P cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). In addition to these ERG-activated genes, combined RNA-seq and ChIP-seq analyses led to the identification of EPOR as a potential repressive target of ERG (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). Indeed, the promoter region of EPOR contains an unusually large number of the ERG binding motif (GGAAG) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF).\u003c/p\u003e \u003cp\u003eInterestingly, more than 70% of the ERG-bound genes were also bound by KLF1 in erythrocytes (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://chip-atlas.org/target_genes\u003c/span\u003e\u003cspan address=\"http://chip-atlas.org/target_genes\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e public KLF1) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG). Given that KLF1 is a key transcription factor promoting erythropoiesis, these data suggest a possible competition between ERG and KLF1 to regulate erythroid gene expression. To test this possibility, we performed luciferase reporter assays using reporters containing the KLF1 (5\u0026rsquo;-AGGGTGTGG-3\u0026rsquo;) binding sequence. As expected, ERG repressed the transcriptional activity of the KLF1 promoter in HEK293T cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH). Thus, similar to another ETS family member FLI1\u003csup\u003e41\u003c/sup\u003e, ERG inhibits erythroid maturation mainly by antagonizing KLF1 activity.\u003c/p\u003e \u003cp\u003e \u003cb\u003eTrp53\u003c/b\u003e \u003cb\u003e-deficiency and ERG overexpression collaboratively promote the development of AEL\u003c/b\u003e \u003c/p\u003e \u003cp\u003eWe next investigated the functional cooperation between ERG and \u003cem\u003eTrp53\u003c/em\u003e (a murine homologue of TP53) deficiency in the development of AEL using a murine transplantation model. Bone marrow progenitor cells (c-kit\u003csup\u003e+\u003c/sup\u003e cells) from 12 weeks \u003cem\u003eTrp53\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e-Cas9 or Cas9 male mice were transduced with ERG, and 2x10\u003csup\u003e5\u003c/sup\u003e cells were transplanted into sublethally (5.25Gy) irradiated 8\u0026ndash;12 weeks C57BL/6 male mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). All mice transplanted with Cas9\u003csup\u003e+\u003c/sup\u003e\u003cem\u003eTrp53\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003eERG-expressing cells developed lethal leukemia approximately 60 days after transplantation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). The mice bearing the Cas9\u003csup\u003e+\u003c/sup\u003e\u003cem\u003eTrp53\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003eERG-expressing cells showed various hematopoietic abnormalities, including an increase in white blood cells, anemia and thrombocytopenia, while those receiving ERG-expressing cells showed only a trend toward mild anemia at two months post-transplantation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). Morphological and immunophenotypic analyses of bone marrow and spleen cells revealed that the Cas9\u003csup\u003e+\u003c/sup\u003e\u003cem\u003eTrp53\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003eERG-expressing cells induced marked increase of CD71\u003csup\u003e+\u003c/sup\u003eTer119\u003csup\u003e+/\u0026minus;\u003c/sup\u003e immature erythroblasts with concomitant decrease of B and T cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD, \u003cb\u003eSupplemental Fig.\u0026nbsp;3A, C\u003c/b\u003e). In contrast, ERG alone never caused rapid leukemia, but induced the development of neutrophilia after a long latency period (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE, \u003cb\u003eSupplemental Fig.\u0026nbsp;3B\u003c/b\u003e). We also transplanted the Cas9\u003csup\u003e+\u003c/sup\u003e\u003cem\u003eTrp53\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003eERG-expressing spleen cells and the Cas9\u003csup\u003e+\u003c/sup\u003e spleen cells expressing only ERG into secondary recipient mice. All mice transplanted with the Cas9\u003csup\u003e+\u003c/sup\u003e\u003cem\u003eTrp53\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003eERG-expressing cells developed AEL within 45 days, whereas those receiving Cas9\u003csup\u003e+\u003c/sup\u003eERG-expressing cells with intact \u003cem\u003eTrp53\u003c/em\u003e did not (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF, G). Thus, \u003cem\u003eTrp53\u003c/em\u003e-deficiency and ERG overexpression are necessary and sufficient to fully transform c-kit\u003csup\u003e+\u003c/sup\u003e adult bone marrow progenitors into AEL cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eEstablishment of a mouse AEL cell line CEP53\u003c/h2\u003e \u003cp\u003eTo establish the Cas9-expressing murine AEL cell lines, we next cultured the AEL cells collected from a spleen of a moribund mouse bearing Cas9\u003csup\u003e+\u003c/sup\u003e\u003cem\u003eTrp53\u003c/em\u003e\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003eERG-expressing cells in RMPI-1640 medium with various hematopoietic cytokines. SCF or IL-3 alone did not support the growth of spleen cells. SCF\u0026thinsp;+\u0026thinsp;IL-3 only promoted the growth of non-erythroid cells. In contrast, addition of EPO together with SCF and IL-3 promoted the marked expansion of GFP\u003csup\u003e+\u003c/sup\u003e AEL cells \u003cem\u003ein vitro\u003c/em\u003e (\u003cb\u003eSupplemental Fig.\u0026nbsp;3D\u003c/b\u003e). The established AEL cells, we designated it CEP53 (\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eC\u003c/span\u003eas9 and \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eE\u003c/span\u003eRG-expressing \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003ep53\u003c/span\u003e-deficient cells), grew well with 1 ng/ml EPO, expressed GFP as well as erythroid markers (CD71 and Ter119), and showed typical AEL morphology (dark nucleoli, increased nuclear/cytoplasmic ratio and cytoplasmic blebs) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). To assess the repopulating capacity of CEP53, we transplanted 5x10\u003csup\u003e6\u003c/sup\u003e CEP53 cells that had been cultured \u003cem\u003ein vitro\u003c/em\u003e for 1 months into recipient mice without irradiation. All the mice developed AEL within 4 weeks, indicating that CEP53 cells retain the strong leukemogenicity even after the long-term \u003cem\u003ein vitro\u003c/em\u003e culture (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB, \u003cb\u003eSupplemental Fig.\u0026nbsp;3E\u003c/b\u003e). Thus, we established a Cas9-expressing murine AEL cell line, CEP53, which can be cultured \u003cem\u003ein vitro\u003c/em\u003e with only 1 ng/ml EPO, induces AEL \u003cem\u003ein vivo\u003c/em\u003e even in unirradiated recipient mice, and allows efficient depletion of genes of interest using the CRISPR/Cas9 system.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eHDAC7 inhibits terminal maturation of human erythroid leukemia cells\u003c/h2\u003e \u003cp\u003eNext, we applied the DepMap (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://depmap.org/portal/)-base\u003c/span\u003e\u003cspan address=\"https://depmap.org/portal/)-base\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003ed two group comparison system (Nakahara, 2023, \u003cem\u003eGitHub.\u003c/em\u003e Available at: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://github.com/jakushinn/depmap_analysis\u003c/span\u003e\u003cspan address=\"https://github.com/jakushinn/depmap_analysis\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) to identify therapeutic vulnerabilities in AEL. We first divided 15 human AML cell lines into those with erythroid characteristics (HEL, F36P, TF-1 and OCIM2) and non-erythroid AML cells (KASUMI1, NB4, THP-1, U937, MV411, MOLM13, AML193, MOLM14, OCIAML2, OCIAML3, and MUTZ8). We compared the Gene Effect Score, which represents the essentiality of a gene in each cancer cell in DepMap, in the erythroid and non-erythroid leukemia cells. This analysis revealed several genes that are specifically important for the growth of erythroid leukemia cells, including BCL2L1, which was recently shown to be essential for the survival of erythroid/megakaryocytic AML\u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). We then integrated the DepMap analysis, RNA-seq data of mouse AEL cells and expression profiles of human AML patients and identified HDAC7 as a potential therapeutic target in AEL. HDAC7 is a class IIa histone deacetylase (HDAC) that is important for the growth of human erythroid leukemia cells, and is highly expressed in both human and mouse AEL (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, \u003cb\u003eSupplemental Fig.\u0026nbsp;4A-C, Supplemental Dataset\u003c/b\u003e). To verify the role of HDAC7 in human AEL, we then assessed the effect of HDAC7 depletion in two erythroid (F36P and TF-1) and two non-erythroid (THP-1 and KASUMI-1) leukemia cell lines. We first transduced Cas9 (coexpressing Blasticidin S resistance gene: bsr) together with non-targeting (NT) or single-guide (sg)RNAs targeting \u003cem\u003eHDAC7\u003c/em\u003e (coexpressing tRFP657) into these cells and monitored the frequency of tRFP657\u003csup\u003e+\u003c/sup\u003e (HDAC7-depleted) cells in culture starting 96 hours after the transduction. Efficient depletion of HDAC7 in these cells was confirmed by western blotting (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Consistent with the data in DepMap, HDAC7 depletion suppressed the growth of erythroid leukemia cells but not that of non-erythroid leukemia cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). HDAC7 depletion promoted erythroid differentiation of TF-1 and F36P cells, as evidenced by the increased expression of CD235a, even in the absence of EPO in culture (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). We also found that the ERG-mediated block of erythroid differentiation was partially reversed by HDAC7 depletion in F36P cells (\u003cb\u003eSupplemental Fig.\u0026nbsp;4D\u003c/b\u003e). RNA-seq analysis revealed that loss of HDAC7 resulted in upregulation of several erythroid genes (\u003cem\u003eHBBP1\u003c/em\u003e, \u003cem\u003eHBD\u003c/em\u003e and \u003cem\u003eHEMGN\u003c/em\u003e) and GATA1-target genes in F36P cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE, \u003cb\u003eSupplemental Dataset\u003c/b\u003e), confirming the enhanced erythroid maturation upon HDAC7 depletion. However, unlike ERG overexpression, HDAC7 depletion did not alter megakaryocytic gene expression, suggesting a more specific role of HDAC7 in erythroid differentiation. We also found that HDAC7 absence induced strong upregulation of \u003cem\u003eHDAC5\u003c/em\u003e, another class IIa HDAC, which may play a compensatory role in HDAC7-depleted F36P cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). Thus, HDAC7 promotes the growth of human erythroid leukemia cells by inhibiting their terminal maturation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eHdac7 promotes the development of mouse AEL\u003c/h2\u003e \u003cp\u003eWe next assessed the role of HDAC7 in the mouse AEL cell line, CEP53. We transduced NT or sgRNAs targeting mouse \u003cem\u003eHdac7\u003c/em\u003e (coexpressing tRFP657) into CEP53 and monitored the frequency of tRFP657\u003csup\u003e+\u003c/sup\u003e (\u003cem\u003eHdac7\u003c/em\u003e-depleted) cells in culture. Similar to the earlier results obtained by the human erythroid leukemia cells, \u003cem\u003eHdac7\u003c/em\u003e depletion inhibited the growth of CEP53 cells \u003cem\u003ein vitro\u003c/em\u003e by inducing their erythroid differentiation. In contrast, loss of HDAC7 did not inhibit the growth of cSAM cells\u003csup\u003e\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e, the mouse monocytic AML cells transformed by SETBP1 and ASXL1 mutations (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA-C), confirming the selective importance of HDAC7 in erythroid leukemia. To determine the role of HDAC7 in the development of AEL \u003cem\u003ein vivo\u003c/em\u003e, we then performed transplantation assay using CEP53 cells transduced with NT or the \u003cem\u003eHdac7\u003c/em\u003e-targeting sgRNA (sg\u003cem\u003eHdac7\u003c/em\u003e-a) coexpressing tRFP657. We collected GFP\u003csup\u003e+\u003c/sup\u003e leukemia cells from bone marrow and spleen 25 days after transplantation, at which time all mice developed AEL. We observed substantial decrease of tRFP657\u003csup\u003e+\u003c/sup\u003e (\u003cem\u003eHdac7\u003c/em\u003e-depleted) cells in both bone marrow and spleen, indicating the critical role of HDAC7 in promoting the \u003cem\u003ein vivo\u003c/em\u003e development of AEL (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD, E, \u003cb\u003eSupplemental Fig.\u0026nbsp;5\u003c/b\u003e). Taken together, we concluded that HDAC7 is a critical and selective regulator in human and mouse AEL.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eEnzymatic function of HDAC7 is dispensable for the growth of AEL\u003c/h2\u003e \u003cp\u003eNext, we assessed the effect of a selective Class IIa HDAC inhibitor TMP269 on various human AML cell lines including AEL. However, contrary to the expectation, AEL cell lines were not more sensitive to TMP269 than non-AEL cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e. We therefore hypothesized that the HDAC7 may promote the growth of AEL cells through non-enzymatic functions. To test this hypothesis, we first designed sgRNA-resistant cDNA by introducing synonymous mutations in the sgRNA-target sequences to prevent the recognition of \u003cem\u003eHDAC7\u003c/em\u003e-targeting sgRNA (sg\u003cem\u003eHDAC7\u003c/em\u003e-A) (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB). We then introduced a histidine (H) to alanin (A) mutation at H672 in human HDAC7 to generate a catalytically inactive HDAC7 mutant \u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC). We transduced vector, wild-type (WT) HDAC7 or HDAC7-H672A into F36P cells and assessed the HDAC activity in them (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD). The HDAC enzyme inhibitor trichostatin A (TSA) showed the expected dose-dependent reduction in HDAC enzyme activity. To our surprise, both wild-type and mutant HDAC7 did not enhance but rather inhibited the HDAC activity in F36P cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eE), indicating that HDAC7 does not act as a \u0026ldquo;histone deacetylase\u0026rdquo; in erythroid leukemia cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe then transduced NT or HDAC7-targeting sgRNAs into F36P cells expressing vector or sgRNA-resistant HDAC7 constructs. Successful transduction of HDAC7 constructs and sgRNA-mediated depletion of endogenous HDAC7 were confirmed by western blotting (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eF). As expected, HDAC7 depletion induced erythroid differentiation and inhibited the growth of F36P cells, which was canceled in the wild-type HDAC7-transduced F36P cells. Importantly, the catalytically inactive HDAC7 mutant also reversed the effect of HDAC7 depletion on the growth and maturation of F36P cells as efficiently as wild-type HDAC7 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eG, H, \u003cb\u003eSupplemental Fig.\u0026nbsp;5B\u003c/b\u003e). Collectively, these results suggest that the enzymatic activity is dispensable for the oncogenic activity of HDAC7 in AEL.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eERG is a versatile oncogene that has been shown to induce the development of various types of leukemia with additional genetic alterations. Our data together with previous reports clearly showed that TP53 inactivation cooperates with ERG to induce the development of erythroleukemia\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e,\u003cspan additionalcitationids=\"CR46\" citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e. However, previous studies have used fetal liver-derived erythroblasts, which are more likely to recapitulate pediatric AEL. In this study, we demonstrate that the combination of ERG overexpression and \u003cem\u003eTrp53\u003c/em\u003e-deficiency can transform c-kit\u003csup\u003e+\u003c/sup\u003e adult bone marrow progenitors into AEL cells, providing the first experimental model for adult AEL.\u003c/p\u003e \u003cp\u003eMechanistically, ERG interferes with erythroid differentiation by antagonizing KLF1 activity, while promoting upregulation of megakaryocytic genes. This function of ERG is similar to that of another ETS transcription factor, FLI1, which has been shown to play a critical role in the megakaryocytic/erythroid bifurcation by counteracting KLF1.\u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e Another interesting finding is the unexpected ERG-mediated suppression of EPOR, given that EPOR amplification frequently coexists in patients with AEL harboring \u003cem\u003eTP53\u003c/em\u003e mutations and ERG amplification\u003csup\u003e49 50\u003c/sup\u003e. This seemingly contradictory finding suggests that the elevated expression of EPOR and the consequent activation of the JAK pathway need to be attenuated by ERG for leukemic transformation. Like ERG, a recent study showed that NFIA-ETO2 fusion blocks erythroid maturation and induces AEL in cooperation with mutant TP53\u003csup\u003e51\u003c/sup\u003e. Thus, suppression of erythroid gene expression programs by transcription factors appears to be necessary to generate fully transformed AEL in cooperation with TP53 inactivation.\u003c/p\u003e \u003cp\u003eGiven its multiple roles, including its essential role in hematopoietic stem cell maintenance, ERG may not be the ideal therapeutic target in AEL. Instead, we identified HDAC7 as a selective regulator in erythroleukemia. HDAC7 is a member of the class IIa family of HDACs (HDAC4/5/6/7), which intrinsically possess low enzymatic activity but harbor a unique adapter domain in the N-terminus that mediates binding to several transcription factors\u003csup\u003e\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u003c/sup\u003e. Importantly, we have shown that HDAC7 promotes the growth of AEL cells through non-enzymatic functions. Therefore, it is necessary to develop HDAC7 degraders rather than the deacetylase inhibitor to treat AEL. The mechanisms by which HDAC7 promotes AEL development also need to be elucidated in future studies. In addition to HDAC7, a previous study showed that another class IIa HDAC, HDAC5, forms a complex with GATA1 and KLF1 to regulate normal erythroid maturation\u003csup\u003e\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u003c/sup\u003e. Although HDAC5 is dispensable for the growth of human erythroleukemia cells, the substantial increase of HDAC5 in the Hdac7-depleted mouse AEL cells indicates its potential compensatory function for the loss of HDAC7. Targeting these class IIa HDACs with protein degraders could be an effective therapeutic strategy with fewer side effects for AEL.\u003c/p\u003e \u003cp\u003eIn summary, we showed the distinct and cooperative functions of TP53 loss and ERG overexpression during erythroid transformation. We also established a novel mouse model of adult AEL that will be useful to evaluate the role of specific genes or to test the effect of drug candidates in a physiological microenvironment with a functional immune system. In addition, our study highlights HDAC7 as a promising therapeutic target in AEL that is resistant to current standard therapies.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eAuthorship Contributions\u003c/h2\u003e \u003cp\u003eW.Z. designed and performed experiments, analyzed the data, and wrote the paper. K.Y. provided resources and advised on data interpretation. Y.-H.C. performed experiments, analyzed the data and advised on data interpretation. T.Y. designed and performed experiments and advised on data interpretation. Y.H., R.S., J.N., S.S. assisted in experiments. K.I. analyzed the data. Q.C., X.Z. assisted in experiments. T.K. advised on data interpretation. S.G. conceived the project, designed experiments, analyzed the data and wrote the paper.\u003c/p\u003e \u003ch2\u003eDisclosure of Conflicts of Interest\u003c/h2\u003e \u003cp\u003eAll authors declare no competing financial interests with the contents of this article.\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e \u003cp\u003eWe thank Akiho Tsuchiya for her expert technical assistance. We thank Dr. Xiaoxiao Liu, Dr Taishi Yonezawa, Dr. Shuhei Asada, Dr. Reina Takeda for helpful discussions and advice. We also thank the FACS Core Laboratory and the Mouse Core at The Institute of Medical Science, The University of Tokyo. This work was supported by Grant-in-Aid for Scientific Research (B) (22H03100, SG), Grant-in-Aid for Scientific Research on Innovative Areas (Research in a proposed research area) (21H00274, SG), Fostering Joint International Research (B) (22KK0127, SG), AMED under Grant Number (22ck0106644s0202 and 23ama221514h0002, SG), Research Grants from the Princess Takamatsu Cancer Research Fund (SG), Research grant from the Daiichi Sankyo Foundation of Life Science (SG), Research grant from The Japanese Society of Hematology (SG, TK), JSPS KAKENHI Grant Number JP22K16319 (KY), AMED under Grant Number JP23ama221223 (KY), Research grant from Kobayashi Foundation for Cancer Research (KY), Grant-in-Aid for Scientific Research (A) (No. 20H00537, TK), Grant-in-Aid for Scientific Research on Innovative Areas (No. 19H04756, TK) and JST SPRING (JPMJSP2108, WZ).\u003c/p\u003e\u003ch2\u003eData availability\u003c/h2\u003e \u003cp\u003eThe datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eGenomic and Epigenomic Landscapes of Adult De Novo Acute Myeloid Leukemia. New England Journal of Medicine. 2013;368(22):2059\u0026ndash;2074.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlexander C. A History and Current Understanding of Acute Erythroid Leukemia. Clin Lymphoma Myeloma Leuk. 2023;23(8):583\u0026ndash;588.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTakeda J, Yoshida K, Nakagawa MM, et al. Amplified EPOR/JAK2 Genes Define a Unique Subtype of Acute Erythroid Leukemia. Blood Cancer Discov. 2022;3(5):410\u0026ndash;427.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFagnan A, Bagger FO, Piqu\u0026eacute;-Borr\u0026agrave;s M-R, et al. Human erythroleukemia genetics and transcriptomes identify master transcription factors as functional disease drivers. Blood. 2020;136(6):698\u0026ndash;714.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSalek-Ardakani S, Smooha G, de Boer J, et al. ERG Is a Megakaryocytic Oncogene. Cancer Res. 2009;69(11):4665\u0026ndash;4673.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStankiewicz MJ, Crispino JD. ETS2 and ERG promote megakaryopoiesis and synergize with alterations in GATA-1 to immortalize hematopoietic progenitor cells. Blood. 2009;113(14):3337\u0026ndash;3347.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFagnan A, Piqu\u0026eacute;-Borr\u0026agrave;s M-R, Tauchmann S, Mercher T, Schwaller J. Molecular Landscapes and Models of Acute Erythroleukemia. Hemasphere. 2021;5(5):e558.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMunroe DG, Peacock JW, Benchimol S. Inactivation of the Cellular p53 Gene Is a Common Feature of Friend Virus-Induced Erythroleukemia: Relationship of Inactivation to Dominant Transforming Alleles. Mol Cell Biol. 1990;10(7):3307\u0026ndash;3313.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLavigueur A, Bernstein A. p53 transgenic mice: accelerated erythroleukemia induction by Friend virus. Oncogene. 1991;6(12):2197\u0026ndash;2201.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIacobucci I, Wen J, Meggendorfer M, et al. Genomic subtyping and therapeutic targeting of acute erythroleukemia. Nat Genet. 2019;51(4):694\u0026ndash;704.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRampal R, Ahn J, Abdel-Wahab O, et al. Genomic and functional analysis of leukemic transformation of myeloproliferative neoplasms. Proceedings of the National Academy of Sciences. 2014;111(50):E5401-5410.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTsuruta-Kishino T, Koya J, Kataoka K, et al. Loss of p53 induces leukemic transformation in a murine model of Jak2 V617F-driven polycythemia vera. Oncogene. 2017;36(23):3300\u0026ndash;3311.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePiqu\u0026eacute;-Borr\u0026agrave;s M-R, Bagger FO, Bezerra MF, et al. Transformation Mechanisms of the Nfia-ETO2 Fusion Gene Associated with Pediatric Pure Acute Erythroleukemia. Blood. 2019;134(Supplement_1):532\u0026ndash;532.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIacobucci I, Wen J, Meggendorfer M, et al. Genomic subtyping and therapeutic targeting of acute erythroleukemia. Nat Genet. 2019;51(4):694\u0026ndash;704.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTsukada T, Tomooka Y, Takai S, et al. Enhanced proliferative potential in culture of cells from p53-deficient mice. Oncogene. 1993;8(12):3313\u0026ndash;3322.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePlatt RJ, Chen S, Zhou Y, et al. CRISPR-Cas9 knockin mice for genome editing and cancer modeling. Cell. 2014;159(2):440\u0026ndash;55.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIrwin M, Marin MC, Phillips AC, et al. Role for the p53 homologue p73 in E2F-1-induced apoptosis. Nature. 2000;407(6804):645\u0026ndash;648.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTamura M, Yonezawa T, Liu X, et al. Opposing effects of acute versus chronic inhibition of p53 on decitabine\u0026rsquo;s efficacy in myeloid neoplasms. Sci Rep. 2019;9(1):8171.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoe J-S, Mercan F, Rivera K, Pappin DJ, Vakoc CR. BET Bromodomain Inhibition Suppresses the Function of Hematopoietic Transcription Factors in Acute Myeloid Leukemia. Mol Cell. 2015;58(6):1028\u0026ndash;1039.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCollavin L, Gostissa M, Avolio F, et al. Modification of the erythroid transcription factor GATA-1 by SUMO-1. Proceedings of the National Academy of Sciences. 2004;101(24):8870\u0026ndash;8875.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMas C, Lussier-Price M, Soni S, et al. Structural and functional characterization of an atypical activation domain in erythroid Kr\u0026uuml;ppel-like factor (EKLF). Proceedings of the National Academy of Sciences. 2011;108(26):10484\u0026ndash;10489.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCollavin L, Gostissa M, Avolio F, et al. Modification of the erythroid transcription factor GATA-1 by SUMO-1. Proceedings of the National Academy of Sciences. 2004;101(24):8870\u0026ndash;8875.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKulczynska K, Bieker JJ, Siatecka M. A Kr\u0026uuml;ppel-like factor 1 (KLF1) Mutation Associated with Severe Congenital Dyserythropoietic Anemia Alters Its DNA-Binding Specificity. Mol Cell Biol. 2020;40(5):e00444-19.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMorita S, Kojima T, Kitamura T. Plat-E: an efficient and stable system for transient packaging of retroviruses. Gene Ther. 2000;7(12):1063\u0026ndash;1066.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSTEWART SA, DYKXHOORN DM, PALLISER D, et al. Lentivirus-delivered stable gene silencing by RNAi in primary cells. RNA. 2003;9(4):493\u0026ndash;501.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoyama S, Schibler J, Gasilina A, et al. UBASH3B/Sts-1-CBL axis regulates myeloid proliferation in human preleukemia induced by AML1-ETO. Leukemia. 2016;30(3):728\u0026ndash;739.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHeckl D, Kowalczyk MS, Yudovich D, et al. Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 2014;32(9):941\u0026ndash;946.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSanjana NE, Shalem O, Zhang F. Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods. 2014;11(8):783\u0026ndash;784.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiao Y, Smyth GK, Shi W. The R package Rsubread is easier, faster, cheaper and better for alignment and quantification of RNA sequencing reads. Nucleic Acids Res. 2019;47(8):e47\u0026ndash;e47.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen Y, Lun ATL, Smyth GK. From reads to genes to pathways: differential expression analysis of RNA-Seq experiments using Rsubread and the edgeR quasi-likelihood pipeline. F1000Res. 2016;5:1438.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRitchie ME, Phipson B, Wu D, et al. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015;43(7):e47\u0026ndash;e47.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang T-W, Johmura Y, Suzuki N, et al. Blocking PD-L1\u0026ndash;PD-1 improves senescence surveillance and ageing phenotypes. Nature. 2022;611(7935):358\u0026ndash;364.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMi H, Muruganujan A, Ebert D, Huang X, Thomas PD. PANTHER version 14: more genomes, a new PANTHER GO-slim and improvements in enrichment analysis tools. Nucleic Acids Res. 2019;47(D1):D419\u0026ndash;D426.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMootha VK, Lindgren CM, Eriksson K-F, et al. PGC-1α-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes. Nat Genet. 2003;34(3):267\u0026ndash;273.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSubramanian A, Tamayo P, Mootha VK, et al. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proceedings of the National Academy of Sciences. 2005;102(43):15545\u0026ndash;15550.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLangmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat Methods. 2012;9(4):357\u0026ndash;359.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRam\u0026iacute;rez F, Ryan DP, Gr\u0026uuml;ning B, et al. deepTools2: a next generation web server for deep-sequencing data analysis. Nucleic Acids Res. 2016;44(W1):W160\u0026ndash;W165.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Liu T, Meyer CA, et al. Model-based Analysis of ChIP-Seq (MACS). Genome Biol. 2008;9(9):R137.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Q, Li M, Wu T, et al. Exploring Epigenomic Datasets by ChIPseeker. Curr Protoc. 2022;2(10):.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStankiewicz MJ, Crispino JD. ETS2 and ERG promote megakaryopoiesis and synergize with alterations in GATA-1 to immortalize hematopoietic progenitor cells. Blood. 2009;113(14):3337\u0026ndash;3347.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDor\u0026eacute; LC, Crispino JD. Transcription factor networks in erythroid cell and megakaryocyte development. Blood. 2011;118(2):231\u0026ndash;239.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKuusanm\u0026auml;ki H, Dufva O, V\u0026auml;h\u0026auml;-Koskela M, et al. Erythroid/megakaryocytic differentiation confers BCL-XL dependency and venetoclax resistance in acute myeloid leukemia. Blood. 2023;141(13):1610\u0026ndash;1625.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eInoue D, Kitaura J, Matsui H, et al. SETBP1 mutations drive leukemic transformation in ASXL1-mutated MDS. Leukemia. 2015;29(4):847\u0026ndash;857.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y, Abrol R, Mak JYW, et al. Histone deacetylase 7: a signalling hub controlling development, inflammation, metabolism and disease. FEBS J. 2023;290(11):2805\u0026ndash;2832.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCarmichael CL, Metcalf D, Henley KJ, et al. Hematopoietic overexpression of the transcription factor Erg induces lymphoid and erythro-megakaryocytic leukemia. Proceedings of the National Academy of Sciences. 2012;109(38):15437\u0026ndash;15442.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThoms JAI, Birger Y, Foster S, et al. ERG promotes T-acute lymphoblastic leukemia and is transcriptionally regulated in leukemic cells by a stem cell enhancer. Blood. 2011;117(26):7079\u0026ndash;7089.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTsuzuki S, Taguchi O, Seto M. Promotion and maintenance of leukemia by ERG. Blood. 2011;117(14):3858\u0026ndash;3868.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStarck J, Cohet N, Gonnet C, et al. Functional Cross-Antagonism between Transcription Factors FLI-1 and EKLF. Mol Cell Biol. 2003;23(4):1390\u0026ndash;1402.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTakeda J, Yoshida K, Nakagawa MM, et al. Amplified EPOR/JAK2 Genes Define a Unique Subtype of Acute Erythroid Leukemia. Blood Cancer Discov. 2022;3(5):410\u0026ndash;427.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAd\u0026eacute;la\u0026iuml;de J, Cervera N, Guille A, et al. Gains of EPOR and ERG genes in adult erythroleukaemia. Br J Haematol. 2020;189(4):e174-e177.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePiqu\u0026eacute;-Borr\u0026agrave;s M-R, Jevtic Z, Otzen Bagger F, et al. The NFIA-ETO2 fusion blocks erythroid maturation and induces pure erythroid leukemia in cooperation with mutant TP53. Blood. 2023;141(18):2245\u0026ndash;2260.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartin M, Kettmann R, Dequiedt F. Class IIa histone deacetylases: regulating the regulators. Oncogene. 2007;26(37):5450\u0026ndash;5467.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVarricchio L, Dell\u0026rsquo;Aversana C, Nebbioso A, et al. Identification of NuRSERY, a new functional HDAC complex composed by HDAC5, GATA1, EKLF and pERK present in human erythroid cells. Int J Biochem Cell Biol. 2014;50(1):112\u0026ndash;122.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"leukemia","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"leu","sideBox":"Learn more about [Leukemia](http://www.nature.com/leu/)","snPcode":"41375","submissionUrl":"https://mts-leu.nature.com/cgi-bin/main.plex","title":"Leukemia","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-4080460/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4080460/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eAcute erythroleukemia (AEL) is a rare subtype of acute myeloid leukemia with a poor prognosis. In this study, we established a novel murine AEL model with \u003cem\u003eTrp53\u003c/em\u003e depletion and ERG overexpression. ERG overexpression in \u003cem\u003eTrp53\u003c/em\u003e-deficient mouse bone marrow cells, but not in wild-type bone marrow cells, leads to AEL development within two months after transplantation with 100% penetrance. The established mouse AEL cells expressing Cas9 can be cultured \u003cem\u003ein vitro\u003c/em\u003e, induce AEL \u003cem\u003ein vivo\u003c/em\u003e even in unirradiated recipient mice, and enable to efficient gene ablation using the CRISPR/Cas9 system. We also confirmed the cooperation between ERG overexpression and TP53 inactivation in promoting the growth of immature erythroid cells in human cord blood cells. Mechanistically, ERG antagonizes KLF1 and inhibits erythroid maturation, meanwhile TP53 deficiency promotes proliferation of erythroid progenitors. Furthermore, we identified HDAC7 as a specific susceptibility in AEL by the DepMap-based two-group comparison analysis. HDAC7 promotes the growth of human and mouse AEL cells both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e through its non-enzymatic functions. Our study provides experimental evidence that TP53 deficiency and ERG overexpression are necessary and sufficient for the development of AEL and highlights HDAC7 as a promising therapeutic target for this disease.\u003c/p\u003e","manuscriptTitle":"HDAC7 is a specific therapeutic target in Acute Erythroid Leukemia","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-27 06:38:26","doi":"10.21203/rs.3.rs-4080460/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2024-04-12T11:35:07+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2024-04-10T21:00:55+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2024-04-03T22:11:19+00:00","index":2,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2024-03-26T15:28:38+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2024-03-24T09:51:25+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2024-03-24T06:25:40+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-03-12T11:17:38+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-03-12T11:17:09+00:00","index":"","fulltext":""},{"type":"submitted","content":"Leukemia","date":"2024-03-12T05:27:38+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"leukemia","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"leu","sideBox":"Learn more about [Leukemia](http://www.nature.com/leu/)","snPcode":"41375","submissionUrl":"https://mts-leu.nature.com/cgi-bin/main.plex","title":"Leukemia","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"a4110f3c-6c10-40b3-ad24-e7f477a8079f","owner":[],"postedDate":"March 27th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":29811321,"name":"Biological sciences/Cancer/Cancer therapy/Targeted therapies"},{"id":29811322,"name":"Biological sciences/Cancer/Cancer models"},{"id":29811323,"name":"Biological sciences/Cancer/Haematological cancer/Leukaemia/Acute myeloid leukaemia"}],"tags":[],"updatedAt":"2024-09-15T07:05:09+00:00","versionOfRecord":{"articleIdentity":"rs-4080460","link":"https://doi.org/10.1038/s41375-024-02394-5","journal":{"identity":"leukemia","isVorOnly":false,"title":"Leukemia"},"publishedOn":"2024-09-15 04:00:00","publishedOnDateReadable":"September 15th, 2024"},"versionCreatedAt":"2024-03-27 06:38:26","video":"","vorDoi":"10.1038/s41375-024-02394-5","vorDoiUrl":"https://doi.org/10.1038/s41375-024-02394-5","workflowStages":[]},"version":"v1","identity":"rs-4080460","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4080460","identity":"rs-4080460","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.