Morphological and molecular characterization of Ixodid ticks infesting cattle in western India

Morphological and molecular characterization of Ixodid ticks infesting cattle in western India | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Morphological and molecular characterization of Ixodid ticks infesting cattle in western India Jeemi Arbindbhai Patel, Binod Kumar, Bhupendrakumar Jamsubhai Thakre, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4010374/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Ticks are well known for its potential as vectors second only to mosquitoes. They are considered to be the important vectors of many disease-causing pathogens in domesticated animals as well as in humans. For any strategic control of pest or pathogens, their identification and epidemiological knowledge is very much essential. Accordingly, a total of 860 cattle were examined from more than 100 farms, Gausalas and Panjrapoles in four districts of western India where 46.05% (n=396) cattle were found to be infested with ticks. The collected tick samples were examined under stereo-zoom microscope and ticks were identified morphologically as either Hyalomma anatolicum or Rhipicephalus microplus . Which was further confirmed by PCR assay targeting cytochrome c oxidase subunit I (cox1) gene followed by sequence analysis. The interspecific divergence between current isolates of Hy. anatolicum and R. microplus was 20.9%. The wider range of intraspecific divergence was recorded in R. microplus (0 - 11.7%) compared to Hy. anatolicum (0 -1.6%), globally. In phylogenetic analysis Indian isolates of R. microplus clustered with R. microplus clade C. Additionally, a more applicable test, In-silico followed by PCR-RFLP restriction enzyme analysis, was employed to differentiate between the two tick species. Among the total 396 tick infested cattle, significantly higher (p<0.001) number of cattle were found to be infested with H. anatolicum (70.96%, n=281) as compared to R. microplus (51.77%, n=205) whereas, 22.73% (n=90) cattle were found to be infested with mixed tick infestation of both. The study indicate that Hy. anatolicum and R. microplus ticks of western region of India is same as other parts of country. Hyalomma anatolicum Rhipicephalus microplus cattle COX1 PCR-RFLP western India. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Ticks are obligatory haematophagus arthropods which pose a significant medical and veterinary health risk on a global scale owing to the direct harm they impose on their hosts and just because they serve as vectors for a wide range of human and animal pathogens. Dairy industry in particular suffers huge economic losses because of ticks and tick-borne diseases (TTBDs) in tropical and sub-tropical countries including India. Therefore it is crucial to monitor and maintain surveillance of the key vector species in order to understand their epidemiology, distribution or abundance in a particular geographical area. This is not only provides knowledge about the vector but also help in the assessment of the vector-borne diseases. This is crucial when discussing how climate change affects vector populations and the dynamics of the transmission of vector-borne diseases (Medlock et al., 2013; Semenza & Paz, 2021 ). The direct and indirect impacts of TTBDs are well documented (Ghosh and Nagar, 2014 ; Hurtado and Giraldo-Ríos, 2018 ). At least 106 species have been reported from India (Ghosh et al., 2007 ) out of the 904 valid tick species identified globally (Ajith Kumar et al., 2018 ). Of the reported tick species, Rhipicephalus microplus and Hyalomma anatolicum are the most widely distributed economically important tick species infesting Indian cattle, sheep, goat, buffaloes. These are also known to transmit Babesia bigemina, Anaplasma marginale, Theileria annulata, T. buffeli, T. lestoquardi (Ghosh et al., 2007 , Ghosh and Nagar, 2014 ). Moreover, Hyalomma ticks are also known for maintenance and transmission of Crimean Congo Hemorrhagic fever (CCHF) virus to humans which is frequently reported in India (Ghosh and Nagar, 2014 ; Mourya et al., 2019 ) and from other parts of the world (Boulanger et al., 2019 ; Shahhosseini et al., 2021 ). However, till now, the distribution of these tick species in this region is poorly known and not well characterized. Although, the body of ticks is not distinctly divided as other arthropods like insects, but they can be divided into three regions: anterior head and mouth region called Gnathosoma, middle leg region called Podosoma and posterior region that includes anus, festoon and other structures called Opisthosoma. Various anatomical features are available on both dorsal and ventral sides of the tick. The variations in these structures are used for identification purposes. They also have different life stages like eggs, larvae, nymphs and adults of different size and morphological features (Taylor et al., 2015 ). Traditional taxonomical identification of ticks was based on the morphological features of adult ticks observed under a microscope. Despite the significance of morphological characterization as a fundamental component of tick identification, its application is restricted to the presence of entomological expertise, the availability of dichotomous keys or comparative illustrations, morphologically similar taxa, tick specimen integrity, or engorgement status, especially for immature stages (Senbill et al., 2022 ; Well and Stevens, 2008 ). Additionally, this demands for extensive morphological and taxonomic expertise and experience. In such a case, complementary tools for precise tick identification are provided by molecular methods based on the amplification and sequencing of mitochondrial and/or ribosomal DNA fragments (Brahma et al., 2014 ; Ernieenor et al., 2017 ). Cytochrome c oxidase-1 (COX1) gene is most frequently used marker and reported first choice for tick species identification (Lv et al., 2014 ; Ernieenor et al., 2017 ). The molecular methods like PCR amplification of suitable fragment of genome followed by sequence analysis are the usual and recommended methods for the precise identification of an organism (Amendt et al., 2004 ). There are only very few reports on the morphological and molecular characterization of common bovine tick species R. microplus and Hy. anatolicum from India (Low et al., 2015 ; Roy et al., 2018 ; Kandi et al., 2022 ; Amrutha et al., 2023). Particularly, information are lacking regarding the status of the common bovine tick, Hy. anatolicum and R. microplus , from western India in public domain. Accordingly, in the present investigation both traditional and molecular approaches were used for the identification and characterization of ticks infesting the cattle in western region of India. Materials and Methods Area under study The study was conducted in western part of India that included four districts of Gujarat states namely, Junagadh (21° 31´ N and 70° 28´ E), Rajkot (22° 3´ N and 70° 78´ E), Gir-Somnath (21° 01´ N and 70° 72´ E) and Porbandar (21° 68´ N and 69° 81´ E). These areas fall under two agro-climatic zones, i.e., North Saurashtra and South Saurashtra of Gujarat having dry sub-humid climate (Ghosh, 1991 ). The weather is marked by an arid and dry climate, with a moderate rainfall during the monsoons and moist weather owing to the Arabian Sea and the Gulf of Cambay. Among the four districts, only Rajkot is land-locked while Junagadh, Gir-Somanath and Porbander have boundaries with Arabian Sea. The average minimum temperature is around 10°C in winters and reaches a maximum of 42°C during dry hot summers (Patil, 2006 ). Collection of tick Standard procedures and bio-safety measures were followed during collection of tick sample from animals (Walker et al., 2003 ; Rooman et al., 2021 ). Ticks were collected randomly from cattle population of farms, gaushalas and panjrapoles located under the area of the study during the months of April, 2017 to March, 2018 (Table 1 ). Animals were thoroughly examined for any tick infestation and male and female ticks in different stages were collected from the body of animals using forceps without damage. Five to eight ticks collected from an individual animal were pooled and labelled as one sample. The collected tick samples were transferred into a small plastic bag and marked. During the study period, 396 tick samples were collected, brought to laboratory, washed with tap water and preserved in 70% ethanol. Table 1 Details of tick samples collected and species of tick recorded on cattle in four district of western India Agro-Climatic Zones Districts No. of Farms/ Gausalas/ Panjarapols visited No. of cattle examined No. of cattle infested with tick species H. anatolicum R. microplus Mixed infestations Total South Saurastra Region Junagadh 37 298 60 (40.54%) 60 (40.54%)) 28 (18.92%) 148 (49.66%) Porbandar 19 186 39 (50.65%) 18 (23.38%) 20 (25.97%) 77 (41.40%) Gir-somanath 23 155 37 (47.44%) 21 (26.92%) 20 (25.64%) 78 (50.32%) North Saurastra Region Rajkot 28 221 55 * (59.14%) 16 (17.20%) 22 (23.66%) 93 (42.08%) Total: 107 860 191 (48.23%) 115 (29.04%) 90 (22.73%) 396 (46.05%) * p < 0.05 between Junagadh and Rajkot Morphological Identification of tick Collected ticks were identified under stereo-zoom microscope (Olympus SZ61, Japan) based on morphology using standard identification key. Briefly, consistent and unique key features of ticks were used for genus level identification, and standard key characteristics were used for species level identification afterwards (Taylor et al., 2015 ; Walker et al., 2003 ). Identified ticks were stored in 70% ethanol. Molecular identification of tick Thirty adult ticks (15 of each genus) were randomly selected for molecular confirmation and characterization. Individually whole genomic DNA was isolated using conventional method. After ethanol evaporation from preserved ticks, they were mechanically crushed in 1 ml lysis buffer (NaCl 0.1M, Tris-HCl 0.21M, pH8 EDTA 0.05M, SDS 0.5%) using mortar and pestle and incubated in 56°C water bath for 16 hours after mixing with proteinase K (100 µg/ml). Subsequently, extraction protocol was followed as per Phenol-Chloroform methods (Wallace, 1987 ). Finally, the DNA was precipitated with absolute ethanol and resuspended in 200 µl of nuclease free water. The quality of DNA was checked on 1% agarose gel, quantified spectrophotometrically (Nanodrop spectrophotometer) and stored at -20°C. To amplify the fragments of cytochrome c oxidase subunit I (COX1) gene of R. microplus , PCR primers were designed using Primer3web tools ( https://primer3.ut.ee/ ) based on sequences available in GenBank (Accession no. MK889213). However, published primers were used for amplification of COX1 gene of H. anatolicum (Schulz et al., 2020) (Table 2 ). PCR primers were synthesized at Eurofins Genomics India Pvt. Ltd., Bengaluru, India. Table 2 Details of primers used for amplification of partial sequences of COX1 gene of H. anatolicum and R. microplus Primer ID Primers (5´→ 3´) Tick species Expected amplification References RCoIF1 gtaattgtaactgcccacgca R. microplus 214 bp (79–292 bp) Present study RCoIR1 ttcatccagttcctgcacct Hya_COI-237 tggtaatgatcaaatttataatgta Hyalomma spp. 495 bp Schulz et al., 2020 Hya_COI-1267 cgatctgttaataatatagtaat A 25 µl PCR reaction was set up using 12.5 µl of 2X DreamTaq Green PCR master mix (Thermo Scientific, Lithuania), 1 µl each of forward and reverse primers (10 µM each), 1 µl DNA and 9.5 µl of NFW. The reaction mixture was incubated in a gradient thermal cycler (Applied Bio System, USA) at optimized condition viz., initial denaturation for 5 min at 95°C, 32 cycles of denaturation (30 s at 94°C), annealing (30 s at 52°C for R. microplus and 50°C for H. anatolicum ) and extension (30 s at 72°C), and lastly final extension (5 min at 72°C). The amplified product was visualized under UV on 1.2% agarose gel containing ethidium bromide and photographed in gel documentation system (Gel Doc, USA). Randomly, 10 µl of PCR purified product (GeneJET Gel Extraction and DNA Cleanup Micro Kit, Thermo Scientific, Lithuania) from each tick species were submitted to commercial house (Eurofins Genomics India Pvt. Ltd., Bengaluru, India) for bi-directional Sanger sequencing. Obtained sequences were aligned, and checked using BioEdit programme and BLASTn (NCBI, USA). Finally, sequence was submitted to GenBank (NCBI, USA). The sequences were aligned using Clustal W and Maximum-likelihood (ML) algorithm, which was further used to construct the phylogenetic tree in MEGA-X with bootstrapping at 500 replicates. The sequences of different tick species with more than 99% query coverage in BLASTn analysis were included in the study ( Supplementary Table 1 ). In-silico restriction enzyme (RE) sites analysis using online tool NEBcutter V2.0 ( https://nc2.neb.com/NEBcutter2/ ) was done for COX1 gene sequences of those tick species reacted in Primer-BLAST ( https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?LINK_LOC=BlastHome ) ( Supplementary Tables 2 and 3 ). Moreover, few Fastdigest® REs (AluI, SacI, HinfI, MspI) (Thermo Scientific, Lithuania) were used to digest amplified COX1 sequence of identified tick species. A 30 µl reaction was set up using 2 µl of 10X Fastdigest buffer, 10 µl of PCR product, 17 µl of NFW and 1 µl enzymes. The reaction was incubated at 37°C for 5–15 minutes as per manufacturer’s instruction. The digested products were resolved on 1.5% agarose gel and documented. Statistical analysis Collected data were compiled, tabulated and analyzed. Tick infestations to cattle were presented in percent and data among the different districts were analyzed by Chi-square test with difference at p ≤ 0.05 was considered as significant. Results Morphological identification of ticks Morphologically, ticks of two species, Hy. anatolicum and R. microplus were found on cattle (Figs. 1 and 2 ) . Based on morphological features such as body size, position of scutum, etc., ticks were classified as nymph, male and female. The size of engorged nymphs of R. microplus was measured as 2.102 ± 0.023 mm long and 1.201 ± 0.025 mm broad while no nymph of H. anatolicum was recorded in collected samples. The average size of male H. anatolicum and R. microplus was recorded as 3.094 ± 0.075 x 2.043 ± 0.063 mm and 1.730 ± 0.034 x 1.130 ± 0.019 mm, respectively. The size of females was found to be highly variable based on their stages of feeding. The size of young female Hy. anatolicum and R. microplus was recorded as 3.306 ± 0.221 x 2.257 ± 0.199 and 2.205 ± 0.085 x 1.315 ± 0.082, respectively. The difference between the size of male and female Hy. anatolicum was not significant (p > 0.05) while difference was found to be significant (p < 0.001) between male and female R. microplus . Nevertheless, the significant differences in size of male (p < 0.0001) and female (p < 0.01) ticks between the species were recorded. The ratio of length of mouth-part (LMP) to width of basis capitulum (WBC) of Hy. anatolicum (1.326 ± 0.065) was significantly higher (p < 0.001) compared to R. microplus (0.444 ± 0.006). Noticeable morphological features of both the tick species were recorded (Table 3 ). Table 3 Noticeable morphological features of Hy. anatolicum and R. microplus under stereo-zoom microscope Tick species Male Female Hy. anatolicum Common features Somewhat elongated body with long mouth part (longirostrate). Basis capituli is broadly hexagonal. Pale rings like mark on legs. Punctation distributions are sparse on scutum/conscutum. Presence of distinct convex eyes and festoons. Parma is pale in colour. Coxa I have large and equal length of internal and external spurs. Anal groove is posterior to anus. Comma shaped spiracles. Almost equal in size of 1st and 2nd segment of palp. Dorsal view Conscutum is convex and lightly punctuated. Short but distinct lateral grooves. Noticeable postero-median groove is present that does not reach to parma. Posterior outline of scutum is smooth. Scapular grooves reached to the posterior margin of scutum. Ventral view Presence of adanal, accessory adanal and sub-anal shields. Small sub-anal shield is directly posterior to adanal shield. Adanal shields are parallel to those of opposite side and have rounded ends. Bulged and small knob like genital operculum that is circular in outline. R. microplus Common features Short, straight capitulum (brevirostrate), inornate, festoon absent, coxae 1 have small paired spurs, hexagonal basis capitulum, spiracular plate is rounded or oval. Male is significantly smaller than female. Dorsal view Nearly oval shaped body, Distinct cornua, caudal appendages can be observed clearly, no festoon present. Nearly square shaped body, Scutum present anteriorly only. Ventral view Distinct adanal shields and accessory shields, A narrow caudal appendage. ‘U’ shaped posterior margin of genital aperture, Molecular characterization The partial sequences of COX1 gene of R. microplus and Hy. anatolicum were amplified at expected size of 214 bp and 495 bp, respectively without any non-specific reaction. Though, RCoIF1/RCoIR1 primer pairs did not show cross-reactivity with Hy. anatolicum but Hya_COI-237/Hya_COI-1267 primers pair cross-reacted to R. microplus as assessed in Pimer-BLAST analysis (Fig. 3 ). The 214 bp and 495 bp size of COX1 sequences of R. microplus and 495 bp size of COX1 sequences of Hy. anatolicum were generated and GenBank accessions were obtained (OP048960, OP048961 and OP048962). The 214 bp sequence of R. microplus was not subjected to additional study because it was confirmed to be 100% identical and fall within the 495 bp COX1 sequence of R. microplus . Alignment of 495 bp COX1 nucleotide sequences of both the identified tick species revealed 81.8% identity (20.9% divergence). The sequence divergence within Hy. anatolicum was comparatively lesser (0–1.6%) in comparison to different isolates of R. microplus (0–11.7%). However, Indian and other neighbour countries like Pakistan, Bangladesh, Myanmar isolates of R. microplus was found less divergence (0–2.5%). The same was reflected in phylogenetic analysis where Indian isolates were grouped in to clade C of R. microplus (Fig. 4 ). Similarly, isolates of Hy. anatolicum were formed into same clade under the broader group of Hyalomma (Fig. 4 ). The Primer-BLAST analysis suggests that the primer pairs RCoIF1/RCoIR1 and Hya COI-237/Hya COI-1267 may react with just a few other tick species in addition to the targeted tick species, such as R. microplus and Hy. anatolicum , respectively ( Supplementary table 2 and 3 ). In-silico RE analysis of COX1 gene of targeted tick species and cross-reactive tick species was recorded that can produce more than 100 bp cut and can produce the difference among the tick species ( Supplementary table 2 and 3 ). The 214 bp of COX1 sequences of R. microplus was enzymatically digested with Alu I but not with Sac I. Similarly, 495 bp of COX1 sequences of Hy. anatolicum was enzymatically digested with the restriction enzymes Hinf I, Msp I, Ava II and Alu I however the corresponding sequence of R. microplus was not digested with the same restriction enzymes (Fig. 5 ). Incidence of tick infestations in cattle Randomly, cattle (n = 860) were examined in small farms (n = 42), Gaushalas (n = 57) and Panjarapols (n = 8) located within the study area. Overall, 46.05% (n = 396) cattle were found to have visible tick infestation with insignificantly (p > 0.05) higher incidence in South Saurastra Region (47.42%, n = 303) compared to North Saurastra Region (42.08%, n = 93). District wise, the highest number of tick infested cattle were recorded in Gir-Somnath (50.32%, n = 78) followed by Junagadh (49.66%, n = 148), Rajkot (42.08%, n = 93) and lowest in Porbandar (41.40%, n = 77) district but the difference was not significant (p > 0.05). The pooled tick samples were identified as Hy. anatolicum , R. microplus and mixed, where both were present. Among the total 396 tick infested cattle, significantly highest (p < 0.001) number of cattle were found to be infested with Hy. anatolicum (70.96%, n = 281) compared to R. microplus (51.77%, n = 205) whereas, 22.73% (n = 90) cattle were found to infested with both the ticks spp. Accordingly, significantly higher infestation of Hy. anatolicum on cattle was recorded in Porbandar (p < 0.001), Gir-Somnath (p < 0.01) and Rajkot (p < 0.001) districts compared to R. microplus . However, the cattle of Junagadh district have equal incidence of Hy. anatolicum and R. microplus infestation. Moreover, the incidence of Hy. anatolicum infestation on cattle was found significantly higher in Rajkot (p < 0.001), Gir-Somnath and Porbandar (p 0.05) among the Rajkot, Gir-Somnath and Porbandar. In contrast, Rajkot had the substantially lower (p 0.05).The details of ticks identified from pooled samples of individual cattle from different districts were given in Table 1 . Discussion The current study identified the species of ticks that infest cattle in western part of India. Two significant tick species, R. microplus and Hy. anatolicum , were morphologically and molecularly identified and characterised in the present investigation from India. Hy. anatolicum is usually 3-hosts tick and trans-stadially transmit T. annulata parasite to the cattle causing bovine tropical theileriosis. The disease is very common in cattle where this tick species prevails (Kumar et al., 2020 , 2022 ; Thakre et al., 2022 ). Hyalomma ticks are also well known for maintenance and transmission of CCHF virus to human worldwide (Mourya et al., 2019 ). Hyalomma ticks are distinguished morphologically by being comparatively larger in size, with a relatively long hypostome (longirostrate), beady eyes, banded legs, and, in the case of the male, three pairs of anal plates. In the present investigation, adult male and female Hy. anatolicum were found to be 3.094 ± 0.075 to 3.308 ± 0.221 mm, respectively in length excluding length of mouth parts (0.718 ± 0.058 mm) which is near to the size of Hyalomma species along with other morphological features (Walker et al., 2003 ). The immature stages such as larvae and nymphs of Hy. anatolicum were not recorded in collection. The reason might be because of their small size and multi-hosts feeding nature on small mammals and birds (Kumar et al., 2020 ). Owing to the one-host tick, R. microplus engorged nymphs, male and female stages were recorded. The R. microplus is small sized tick (2–3 mm including mouth parts) with males significantly smaller (p < 0.001) as compared to females. Other morphological features were recorded such as presence of indistinct eyes, absence of festoons, broad and short capitulum (ratio of length of mouth-part to width of basis capitulum was found to be 0.444 ± 0.006) and presence of distinct adanal shields, accessory shields and narrow caudal appendages in male (Walker et al., 2003 ; Kamani et al., 2017 ). Even though these morphological characteristics can distinguish between the two different tick species with ease, it is typically difficult to accomplish this amongst closely related species since their features are so similar, necessitating a very high level of ability to avoid identification errors (Pervomaisky, 1950 ; Hoogstraal, 1956 ). In such a case, species level identification of an organism using a molecular technique may be employed as an alternate and supplementary tool (Amendt et al., 2004 ). The newly generated COX1 sequences of the two tick species, i.e., Hy. anatolicum (OP048961) and R. microplus (OP048960) were confirmed by BLASTn analysis (NCBI, USA), sequence identity matrix (> 99% similarity within species) and phylogeny. Similarly, COX1 alone or other mitochondrial and/or ribosomal DNA fragments were employed for molecular characterization and confirmation of the tick species (Lv et al., 2014 ; Kamani et al., 2017 ; Roy et al., 2018 ). However, molecular identification based on COX1 gene is considered the best choice (Lv et al., 2014 ; Ernieenor et al., 2017 ). Yet, PCR-RFLP is widely used technique for discriminating the species at molecular level because of its cost and conveyance compared to sequence analysis. Two targeted species of ticks, R. microplus and Hy. anatolicum , may be distinguished in in-vitro RE analysis utilising only a few RE (Sac I, Hinf I, Msp I, Ava II, and Alu I ) , which were identified in in-silico RE analysis of 214 bp COX1 sequence of R. microplus and 495 bp COX1 sequences of Hy. anatolicum. Similarly, Schulz et al. (2020) used a set of restriction enzymes to distinguish between the different species of Hyalomma . Higher prevalence of H. anatolicum and R. microplus was recorded in cattle with the former being detected at a relatively greater rate than the latter. Short winter period and hot humid climatic conditions (with an average temperature of 36–37°C) of this region is highly suitable for the growth and development of TTBDs. The finding of these species in diverse ecological environments has been reported elsewhere. Several researchers, including Tavassoli et al. ( 2013 ) of West and North-West Iran, observed high prevalence of ixodid ticks, identifying Hyalomma spp. as the predominant tick species (71.56%) affecting cattle. According to an epidemiological study by Rony et al. ( 2010 ), the highest prevalence of R. microplus (45.63%) was found in Bangladesh's Gazipur area. According to Kabir et al. ( 2011 ), R. microplus is the most common ixodid tick in the Chittagong District of Bangladesh. In India, Singh and Rath ( 2013 ) observed maximum prevalence of R. microplus and Hy. anatolicum in the state of Punjab in India. Chhillar et al. ( 2014 ) observed that Hy. anatolicum and R. microplus are the most common vector species infesting buffalo and cattle in Haryana. Another study revealed that R. microplu s as common in Lucknow, Uttar Pradesh and Jammu district, Jammu and Kashmir (India), respectively (Kaur et al., 2015 ; Khajuria et al., 2015 ). Abdul et al. ( 2007 ) reported prevalence of Rhipicephalus ( Boophilus ) (46.1%) followed by Hyalomma (31.25%) and Rhipicephalus (17.93%). Patel et al. ( 2012 ) reported two species of ticks namely R. microplus and Hy. anatolicum as the most common tick species infesting Indian zebu cattle in Mathura district of India. The disparity between these studies could be explained by a variety of variables, such as agroecological and animal health practices, or management variations within the area under studies. The present investigation shows the wide variety and abundance of tick species that infest cattle in south western Gujarat, suggesting the possibility of the existence of other tick-borne pathogens in addition to those that are already known to exist there and warrants further investigation in order to establish proper control measures in this region. Conclusion In summary, the present research reveals the predominance of two distinct tick species, R. microplus and Hy. anatolicum infesting cattle in the studied region. The species validity of ticks was also further confirmed by PCR in integration with PCR-RFLP assay targeting COX I gene. The study findings clearly indicate that a combination of morphology and molecular data can be corroborated as an efficient tool for precise tick identification. Further, this is the first study reporting nucleotide sequences of COX1 in integration morphological identification of ticks from this part of Gujarat, India. Declarations Acknowledgments Authors are heartly thankful to Director of Research, Junagadh Agricultural University, Junagadh, Gujarat for proving necessary facilities and funds for research work. Authors are also thankful to Principal and Dean, College of Veterinary Science and Animal Husbandary, Junagadh, Gujarat for providing necessary administrative support during research. This is part of students Master Research programme. Author Contributions All authors contributed to the study conception and design. Protocol designed, Formal analysis and Validation by Binod Kumar, Vivek Kumar Singh, Jeemi Arbindbhai Patel; Methodology performed by Jeemi Arbindbhai Patel, Bhupendrakumar and Jamsubhai Thakre; Funding acquisition: Binod Kumar; Supervision- Binod Kumar, and Vivek Kumar Singh; Visualization: Jeemi Arbindbhai Patel, Bhupendrakumar Jamsubhai Thakre, and Nilima Nayankumar Brahmbhatt; Manuscript was written by Binod Kumar; Manuscript editing and review- Biswa Ranjan Maharana and Vivek Kumar Singh; finally, all the authors have read the article and approved for submission. Funding This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. The current research programme utilized the regular funds received from the University for the development of the department and student research. Disclosure statement No potential conflict of interest was reported by the author(s). Data Availability Data will be made available on request. References Abdul, M., Zabita, K., Bashir, A., Abdullah, A., 2007. Prevalence and identification of ixodid tick genera in frontier region Peshawar. J. Agri. Biol. Sci. 2 (1), 21-25. Ajith Kumar, K.G., Ravindran, R., Johns, J., Chandy, G., Rajagopal, K., Chandrasekhar, L., George, A.J., Ghosh, S., 2018. Ixodid tick vectors of wild mammals and reptiles of southern India. J. Arthropod. Borne Dis. 12(3), 276–285. Amrutha, B. M., Kumar, K. G. A., Kurbet, P. S., Varghese, A., Deepa, C. K., Pradeep, R. K., Nimisha, M., Asaf, M., Juliet, S., Ravindran, R., Ghosh, S., 2022. Morphological and molecular characterization of Rhipicephalus microplus and Rhipicephalus annulatus from selected states of southern India. Ticks Tick Borne Dis. 14(2), 102086. https://doi.org/10.1016/j.ttbdis.2022.102086 Amendt, J., Krettek, R., Zehner, R., 2004. Forensic entomology. Naturwissenschaften. 91(2), 51–65. https://doi.org/10.1007/s00114-003-0493-5 Boulanger, N., Boyer, P., Talagrand-Reboul, E., Hansmann, Y., 2019. Ticks and tick-borne diseases. Med. Mal. Infect. 49(2), 87–97. Brahma, R.K., Dixit, V., Sangwan, A.K., Doley, R., 2014. Identification and characterization of Rhipicephalus (Boophilus) microplus and Haemaphysalis bispinosa tick (Acari: Ixodidae) of North East India by ITS2 and 16S rDNA and morphological analysis. Exp. Appl. Acarol. 62(2), 253–265. https://doi.org/10.1007/s10493-013-9732-4 Chhillar, S., Singh, C.J., Harpreet, K., 2014. Investigations on some hard ticks (acari: ixodidae) infesting domestic buffalo and cattle from Haryana, India. J. Entomol. Zool. Stud. 2 (4), 99-104. Ernieenor, F., Ernna, G., Mariana, A., 2017. Phenotypic and genotypic identification of hard ticks of the genus Haemaphysalis (Acari: Ixodidae) in Peninsular Malaysia. Exp. Appl. Acarol. 71(4), 387–400. https://doi.org/10.1007/s10493-017-0120-3 Ghosh, S.P., 1991. Agroclimatic zone-specific research. ICAR, Krishi Anusandhan Bhavan, Pusa, New Delhi, India, 965 pp. Ghosh, S., Bansal, G.C., Gupta, S.C., Ray, D., Khan, M.Q., Irshad, H., Shahiduzzaman, M., Seitzer, U., Ahmed, J.S., 2007. Status of tick distribution in Bangladesh, India and Pakistan. Parasitol. Res. 101 Suppl 2, S207–S216. https://doi.org/10.1007/s00436-007-0684-7 Ghosh, S., Nagar, G., 2014. Problem of ticks and tick-borne diseases in India with special emphasis on progress in tick control research: A review. J. Vector Borne Dis. 51, 259-270. Hoogstraal, H., 1956. African Ixodoidea. I. Ticks of the Sudan (with special reference to Equatoria Province and with preliminary reviews of the genera Boophilus, Margaropus and Hyalomma ). United State Navy, Washington DC. Hurtado, O.J.B., Giraldo-Ríos, C., 2018. economic and health impact of the ticks in production animals. In M. Abubakar, & P. K. Perera (Eds.), Ticks and Tick-Borne Pathogens. IntechOpen. https://doi.org/10.5772/intechopen.81167 Kabir, M.H.B., Mondal, M.M.H., Eliyas, M., Mannan, M.A., Hashem, M.A., Debnath, N.C., 2011. An epidemiological survey on investigation of tick infestation in cattle at Chittagong District, Bangladesh. Afr. J. Microbiol. Res. 5 (4), 346-352. Kamani, J., Apanaskevich, D.A., Gutiérrez, R., Nachum-Biala, Y., Baneth, G., Harrus, S., 2017. Morphological and molecular identification of Rhipicephalus ( Boophilus ) microplus in Nigeria, West Africa: a threat to livestock health. Exp. Appl. Acarol. 73 , 283–296. https://doi.org/10.1007/s10493-017-0177-z Kandi, S., Chennuru, S., Chitichoti, J., Metta, M., Krovvidi, S., 2022. Morphological and molecular characterization of ticks infesting cattle and buffaloes in different agro-climatic zones in Andhra Pradesh, India, and factors associated with high tick prevalence. Int. J. Acarol. 48(3), 192-200. Kaur, D., Kamal, J., Mishra, S., 2015. Studies on prevalence of ixodid ticks infesting cattle and their control by plant extracts. IOSR-JBPS. 10 (6), 1-11. Khajuria, V., Godara, R., Yadav, A., Katoch, R., 2015. Prevalence of ixodid ticks in dairy animals of Jammu region . J. Parasit. Dis. 39 (3), 418–421. Kumar, B., Manjunathachar, H.V., Ghosh, S., 2020. A review on Hyalomma species infestations on human and animals and progress on management strategies. Heliyon. 6(12), e05675. doi: 10.1016/j.heliyon.2020.e05675 Kumar, B., Maharana, B.R., Thakre, B., Brahmbhatt, N.N., Joseph, J.P., 2022. 18S rRNA gene-based piroplasmid PCR: an assay for rapid and precise molecular screening of Theileria and Babesia species in animals. Acta Parasitol. 67(4), 1697–1707. https://doi.org/10.1007/s11686-022-00625-2 Low, V. L., Tay, S. T., Kho, K. L., Koh, F. X., Tan, T. K., Lim, Y. A., Ong, B. L., Panchadcharam, C., Norma-Rashid, Y., Sofian-Azirun, M., 2015. Molecular characterisation of the tick Rhipicephalus microplus in Malaysia: new insights into the cryptic diversity and distinct genetic assemblages throughout the world. Parasit. Vectors, 8, 341. https://doi.org/10.1186/s13071-015-0956-5 Lv, J., Wu, S., Zhang, Y., Chen, Y., Feng, C., Yuan, X., Jia, G., Deng, J., Wang, C., Wang, Q., Mei, L., Lin, X., 2014. Assessment of four DNA fragments (COI, 16S rDNA, ITS2, 12S rDNA) for species identification of the Ixodida (Acari: Ixodida). Parasit. Vectors. 7 , 93. https://doi.org/10.1186/1756-3305-7-93 Medlock, J.M., Hansford, K.M., Bormane, A., Derdakova, M., Estrada-Peña, A., George, J.C., Golovljova, I., Jaenson, T.G., Jensen, J.K., Jensen, P.M., Kazimirova, M., Oteo, J.A., Papa, A., Pfister, K., Plantard, O., Randolph, S.E., Rizzoli, A., Santos-Silva, M.M., Sprong, H., Vial, L., Hendrickx, G., Zeller, H., Van Bortel, W., 2013 Driving forces for changes in geographical distribution of Ixodes ricinus ticks in Europe. Parasit.Vectors. 6, 1. https://doi.org/10.1186/1756-3305-6-1 Mourya, D.T., Yadav, P.D., Gurav, Y.K., Pardeshi, P.G., Shete, A.M., Jain, R., Raval, D.D., Upadhyay, K.J., Patil, D.Y., 2019. Crimean Congo hemorrhagic fever serosurvey in humans for identifying high-risk populations and high-risk areas in the endemic state of Gujarat, India. BMC Infect. Dis. 19(1), 104. https://doi.org/10.1186/s12879-019-3740-x Patel, G., Daya, S., Amit, K.J., Vikrant, S., Santosh, K.V., 2012. Prevalence and seasonal variation in ixodid ticks on cattle of Mathura district, Uttar Pradesh. J. Parasit. Dis. 37 (2), 173–176. Patil, B.R., 2006. Dynamics of livestock development in Gujarat, India: Experiences of an Indian NGO. Patil, B.R. –[S.l.:s.n.]. Ill. PhD thesis Wageningen University. –With ref.– With summaries in English and Dutch. ISBN: 90-8504-530-4 pages158. Pervomaisky, G.S., 1950. Interspecific hybridization of Ixodidae. Dokl Akad Nauk SSSR. 73(5), 1033–1036. Rony, S.A., Mondal, M.M.H., Begum, N., Islam, M.A., Affroze, S., 2010. Epidemiology of ectoparasitic infestations in cattle at Bhawal forest area, Gazipur. Bangladesh J. Vet. Med. 8 (1), 27–33. Rooman, M., Assad, Y., Tabassum, S., Sultan, S., Ayaz, S., Khan, M.F., Khan, S.N., Ali, R., 2021. A cross-sectional survey of hard ticks and molecular characterization of Rhipicephalus microplus parasitizing domestic animals of Khyber Pakhtunkhwa, Pakistan. PloS One. 16(8), e0255138. https://doi.org/10.1371/journal.pone.0255138 Roy, B.C., Estrada-Peña, A., Krücken, J., Rehman, A., Nijhof, A.M., 2018. Morphological and phylogenetic analyses of Rhipicephalus microplus ticks from Bangladesh, Pakistan and Myanmar. Ticks Tick Borne Dis. 9(5), 1069–1079. https://doi.org/10.1016/j.ttbdis.2018.03.035 Semenza, J.C., Paz, S., 2021. Climate change and infectious disease in Europe: impact, projection and adaptation. Lancet Reg. Health Eur. 9(100), 230. https://doi.org/10.1016/j.lanepe.2021. 100230 Senbill, H., Tanaka, T., Karawia, D., Rahman, S., Zeb, J., Sparagano, O., Baruah, A., 2022. Morphological identification and molecular characterization of economically important ticks (Acari: Ixodidae) from North and North-Western Egypt. Acta Trop. 231, 106438. doi: 10.1016/j.actatropica.2022.106438. Shahhosseini, N., Wong, G., Babuadze, G., Camp, J.V., Ergonul, O., Kobinger, G.P., Chinikar, S., Nowotny, N., 2021. Crimean-Congo Hemorrhagic Fever virus in Asia, Africa and Europe. Microorganisms. 9(9), 1907. https://doi.org/10.3390/microorganisms9091907 Singh, N.K., Rath, S.S., 2013. Epidemiology of ixodid ticks in cattle population of various agro climatic zones of Punjab, India. Asian Pac. J. Trop. Med. 12 (3), 947-951. Taylor, M., Coop, B., Wall, R., 2015. Veterinary Parasitology, 4 th Edition, Wiley-Blackwell publication, 1032p. Tavassoli, M., Tabatabaei, M., Mohammadi, M., Esmaeilnejad, B., Mohamadpour, H., 2013. PCR-based detection of Babesia spp. infection in collected ticks from cattle in West and North-West of Iran. J. Arthropod. Borne Dis. 7 (2), 132-138. Thakre, B.J., Kumar, B., Vagh, A., Brahmbhatt, N.N., Gamit, K., 2022. Comparative studies on detection of Theileria annulata infection by clinical, parasitological and molecular techniques in buffaloes ( Bubalus bubalis ). Veterinarski Arhiv (in press). Walker, A., Bouattour, A., Camicas, J.L., Estrada-Pen˜a, A., Horak, I.G., Latif, A.A., Pegram, R.G., Preston, P.M., 2003. Ticks of domestic animals in Africa: a guide to identification of species. The University of Edinburgh, Edinburgh. Wallace, D.M., 1987. Large and small scale phenol extractions, in: Berger S.L., Kimmel R. (Eds.), Guide to molecular cloning techniques, Academic Press, Orlando, pp. 31–41. Well, J.D., Stevens, J.R., 2008. Application of DNA-based methods in forensic entomology. Annu. Rev. Entomol. 53, 103–120. https://doi.org/10.1146/annurev.ento.52.110405.091423 Supplementary Files SupplementaryTable1.docx SupplementaryTable2.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4010374","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":286691274,"identity":"4bc360a7-90a1-4bfe-b09c-1d125ea06f2b","order_by":0,"name":"Jeemi Arbindbhai Patel","email":"","orcid":"","institution":"Kamdhenu University","correspondingAuthor":false,"prefix":"","firstName":"Jeemi","middleName":"Arbindbhai","lastName":"Patel","suffix":""},{"id":286691275,"identity":"d03f90f8-8cb4-4b05-bd2c-95ab88688a33","order_by":1,"name":"Binod Kumar","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA30lEQVRIiWNgGAWjYDCCA2xgKgFESXwAEmzspGiRnAHSwkysFhAhzQMiCWnhu30sTepGzb08Punmg7dtfm2T52NmYPzwMQe3Fslzacekc44VF7PJHEu2zu27bdjGzMAsOXMbbi0GZ9jbpHPYEhLbJHLMpHN7bjMCtbAx8xLU8g+qxbLntj0RWtiOSee2QbUw/LidSFCL5Bk2kBcSitkk0pItextuJ7cxMzbj9QvfGTbD2znfEvLkZyQfvPHjz23b+e3NBz98xKMFFTC2gckGYtWDwB9SFI+CUTAKRsFIAQCq7U0MpZ2/pwAAAABJRU5ErkJggg==","orcid":"","institution":"Kamdhenu University","correspondingAuthor":true,"prefix":"","firstName":"Binod","middleName":"","lastName":"Kumar","suffix":""},{"id":286691276,"identity":"c3b46b19-2820-4420-a3cb-4d78c3c4c546","order_by":2,"name":"Bhupendrakumar Jamsubhai Thakre","email":"","orcid":"","institution":"Kamdhenu University","correspondingAuthor":false,"prefix":"","firstName":"Bhupendrakumar","middleName":"Jamsubhai","lastName":"Thakre","suffix":""},{"id":286691277,"identity":"365580e7-2906-46dc-a3d8-ed9ceed394f9","order_by":3,"name":"Nilima Nayankumar Brahmbhatt","email":"","orcid":"","institution":"Kamdhenu University","correspondingAuthor":false,"prefix":"","firstName":"Nilima","middleName":"Nayankumar","lastName":"Brahmbhatt","suffix":""},{"id":286691278,"identity":"e73b1e0e-9fd7-44ef-bc66-59eb6b28cd07","order_by":4,"name":"Biswa Ranjan Maharana","email":"","orcid":"","institution":"Lala Lajpat Rai University of Veterinary and Animal Sciences","correspondingAuthor":false,"prefix":"","firstName":"Biswa","middleName":"Ranjan","lastName":"Maharana","suffix":""},{"id":286691279,"identity":"8f7c5ad7-baff-48c7-87a0-31036280481d","order_by":5,"name":"Vivek Kumar Singh","email":"","orcid":"","institution":"Kamdhenu University","correspondingAuthor":false,"prefix":"","firstName":"Vivek","middleName":"Kumar","lastName":"Singh","suffix":""}],"badges":[],"createdAt":"2024-03-04 03:31:37","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4010374/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4010374/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":54159114,"identity":"faf8b5e1-ab3a-4c24-99dc-1aeac6a4804a","added_by":"auto","created_at":"2024-04-05 12:48:30","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":606491,"visible":true,"origin":"","legend":"\u003cp\u003eMorphological identification of nymphs and adults of \u003cem\u003eR. microplus\u003c/em\u003e through microscopy.\u003c/p\u003e","description":"","filename":"floatimage1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4010374/v1/7e1e3f3dd734032c2455b5d5.jpg"},{"id":54159102,"identity":"f5498e75-8aff-418e-bc09-9d400630eb30","added_by":"auto","created_at":"2024-04-05 12:48:28","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":794184,"visible":true,"origin":"","legend":"\u003cp\u003eMorphological identification of adults of \u003cem\u003eHy. anatolicum\u003c/em\u003e through microscopy.\u003c/p\u003e","description":"","filename":"floatimage2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4010374/v1/86ca22166cc2f869e78a756d.jpg"},{"id":54159100,"identity":"cd914414-52c0-4dd2-a2bc-4d379a8da975","added_by":"auto","created_at":"2024-04-05 12:48:27","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":190499,"visible":true,"origin":"","legend":"\u003cp\u003eAmplification of partial fragment of COX1 gene of \u003cem\u003eR. microplus\u003c/em\u003e and \u003cem\u003eHy. anatolicum\u003c/em\u003e. Lane 1 and 3:- \u003cem\u003eHy. anatolicum\u003c/em\u003e DNA reacted to RCoIF1/RCoIR1 and Hya_COI-237/Hya_COI-1267 primers pairs, respectively. Lane 2 and 4: \u003cem\u003eR. microplus\u003c/em\u003e DNA reacted to RCoIF1/RCoIR1 and Hya_COI-237/Hya_COI-1267 primers pairs, respectively. M. 100 bp plus DNA ladder (Thermo Scientific, Lithuania), band size (from lower to upper): 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1500, 2000, 3000 bp.\u003c/p\u003e","description":"","filename":"floatimage3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4010374/v1/be56f65b72d5ff362407ee18.jpg"},{"id":54159119,"identity":"d4451ea5-136c-429e-85d0-95b42613acbd","added_by":"auto","created_at":"2024-04-05 12:48:32","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":316140,"visible":true,"origin":"","legend":"\u003cp\u003eConstruction of cytochrome c oxidase subunit 1 (COX1) based phylogenetic tree of Junagadh isolates of \u003cem\u003eHy. anatolicum\u003c/em\u003e and \u003cem\u003eR. microplus\u003c/em\u003e with other isolates and tick species. [\u003cstrong\u003eStatistical Method\u003c/strong\u003e: \u0026nbsp;Maximum-likelihood; \u003cstrong\u003eModel\u003c/strong\u003e: General Time Reversible (GTR) + Gamma distribution (+\u003cem\u003eG\u003c/em\u003e) with 5 rate categories and by assuming that a certain fraction of sites are evolutionarily invariable (+I); \u003cstrong\u003eBootstrap value\u003c/strong\u003e: 500; Neighbor-Join and BioNJ algorithms]\u003c/p\u003e","description":"","filename":"floatimage4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4010374/v1/54aa89db8962fc98b600774f.jpg"},{"id":54159117,"identity":"969eecc0-9edb-4b86-8f08-12809b54b89a","added_by":"auto","created_at":"2024-04-05 12:48:31","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":217776,"visible":true,"origin":"","legend":"\u003cp\u003eRestriction enzyme digestion of [A.] 214 bp COX1 gene fragments of \u003cem\u003eR. microplus\u003c/em\u003e {Lane 1. undigested PCR product, Lane 2. digested with \u003cem\u003eAlu\u003c/em\u003eI (112 and 102 bp fragments) and Lane 3. digested with \u003cem\u003eSac\u003c/em\u003eI (no digestion)}; [B.]. 495 bp COX1 gene fragments of \u003cem\u003eR. microplus\u003c/em\u003e {Lane 4. digested with \u003cem\u003eHinf\u003c/em\u003eI (no digestion), Lane 5. digested with \u003cem\u003eMsp\u003c/em\u003eI (no digestion) and Lane 6. digested with \u003cem\u003eAlu\u003c/em\u003eI (no digestion)}; [C.]. 495 bp COX1 gene fragments of \u003cem\u003eHy. anatolicum\u003c/em\u003e {Lane 7. digested with \u003cem\u003eHinf\u003c/em\u003eI (212 and 283 bp fragments), Lane 8. digested with \u003cem\u003eMsp\u003c/em\u003eI (228 and 267 bp fragments) and Lane 9. digested with \u003cem\u003eAlu\u003c/em\u003eI (157 and 338 bp fragments)}. M- 100 bp plus DNA ladder (Thermo Scientific, Lithuania), band size (from lower to upper): 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1500, 2000, 3000 bp.\u003c/p\u003e","description":"","filename":"floatimage5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4010374/v1/d9f80caf06f67db73cde8f62.jpg"},{"id":55164648,"identity":"1fbfc955-44d3-421b-ac11-d0bfa6018f0a","added_by":"auto","created_at":"2024-04-23 13:58:15","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":806562,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4010374/v1/39fdfcba-4b41-4930-9ee8-3c0fa476a40b.pdf"},{"id":54159104,"identity":"af7d8dd6-7d31-4119-bb97-1243595577be","added_by":"auto","created_at":"2024-04-05 12:48:28","extension":"docx","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":17681,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable1.docx","url":"https://assets-eu.researchsquare.com/files/rs-4010374/v1/edc11ed2d077e7cfd7a3cce4.docx"},{"id":54159118,"identity":"1471d80c-4882-44b2-a6a8-b99c15b38832","added_by":"auto","created_at":"2024-04-05 12:48:31","extension":"docx","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":18127,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTable2.docx","url":"https://assets-eu.researchsquare.com/files/rs-4010374/v1/346d22f04ff0325fca9951db.docx"}],"financialInterests":"","formattedTitle":"Morphological and molecular characterization of Ixodid ticks infesting cattle in western India","fulltext":[{"header":"Introduction","content":"\u003cp\u003eTicks are obligatory haematophagus arthropods which pose a significant medical and veterinary health risk on a global scale owing to the direct harm they impose on their hosts and just because they serve as vectors for a wide range of human and animal pathogens. Dairy industry in particular suffers huge economic losses because of ticks and tick-borne diseases (TTBDs) in tropical and sub-tropical countries including India. Therefore it is crucial to monitor and maintain surveillance of the key vector species in order to understand their epidemiology, distribution or abundance in a particular geographical area. This is not only provides knowledge about the vector but also help in the assessment of the vector-borne diseases. This is crucial when discussing how climate change affects vector populations and the dynamics of the transmission of vector-borne diseases (Medlock et al., 2013; Semenza \u0026amp; Paz, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe direct and indirect impacts of TTBDs are well documented (Ghosh and Nagar, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Hurtado and Giraldo-R\u0026iacute;os, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). At least 106 species have been reported from India (Ghosh et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2007\u003c/span\u003e) out of the 904 valid tick species identified globally (Ajith Kumar et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Of the reported tick species, \u003cem\u003eRhipicephalus microplus\u003c/em\u003e and \u003cem\u003eHyalomma anatolicum\u003c/em\u003e are the most widely distributed economically important tick species infesting Indian cattle, sheep, goat, buffaloes. These are also known to transmit \u003cem\u003eBabesia bigemina, Anaplasma marginale, Theileria annulata, T. buffeli, T. lestoquardi\u003c/em\u003e (Ghosh et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2007\u003c/span\u003e, Ghosh and Nagar, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Moreover, \u003cem\u003eHyalomma\u003c/em\u003e ticks are also known for maintenance and transmission of Crimean Congo Hemorrhagic fever (CCHF) virus to humans which is frequently reported in India (Ghosh and Nagar, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Mourya et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2019\u003c/span\u003e) and from other parts of the world (Boulanger et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Shahhosseini et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). However, till now, the distribution of these tick species in this region is poorly known and not well characterized.\u003c/p\u003e \u003cp\u003eAlthough, the body of ticks is not distinctly divided as other arthropods like insects, but they can be divided into three regions: anterior head and mouth region called Gnathosoma, middle leg region called Podosoma and posterior region that includes anus, festoon and other structures called Opisthosoma. Various anatomical features are available on both dorsal and ventral sides of the tick. The variations in these structures are used for identification purposes. They also have different life stages like eggs, larvae, nymphs and adults of different size and morphological features (Taylor et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTraditional taxonomical identification of ticks was based on the morphological features of adult ticks observed under a microscope. Despite the significance of morphological characterization as a fundamental component of tick identification, its application is restricted to the presence of entomological expertise, the availability of dichotomous keys or comparative illustrations, morphologically similar taxa, tick specimen integrity, or engorgement status, especially for immature stages (Senbill et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Well and Stevens, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). Additionally, this demands for extensive morphological and taxonomic expertise and experience. In such a case, complementary tools for precise tick identification are provided by molecular methods based on the amplification and sequencing of mitochondrial and/or ribosomal DNA fragments (Brahma et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Ernieenor et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Cytochrome c oxidase-1 (COX1) gene is most frequently used marker and reported first choice for tick species identification (Lv et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Ernieenor et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The molecular methods like PCR amplification of suitable fragment of genome followed by sequence analysis are the usual and recommended methods for the precise identification of an organism (Amendt et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2004\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThere are only very few reports on the morphological and molecular characterization of common bovine tick species \u003cem\u003eR. microplus\u003c/em\u003e and \u003cem\u003eHy. anatolicum\u003c/em\u003e from India (Low et al., \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Roy et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Kandi et al., \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Amrutha et al., 2023). Particularly, information are lacking regarding the status of the common bovine tick, \u003cem\u003eHy. anatolicum\u003c/em\u003e and \u003cem\u003eR. microplus\u003c/em\u003e, from western India in public domain. Accordingly, in the present investigation both traditional and molecular approaches were used for the identification and characterization of ticks infesting the cattle in western region of India.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eArea under study\u003c/h2\u003e \u003cp\u003eThe study was conducted in western part of India that included four districts of Gujarat states namely, Junagadh (21\u0026deg; 31\u0026acute; N and 70\u0026deg; 28\u0026acute; E), Rajkot (22\u0026deg; 3\u0026acute; N and 70\u0026deg; 78\u0026acute; E), Gir-Somnath (21\u0026deg; 01\u0026acute; N and 70\u0026deg; 72\u0026acute; E) and Porbandar (21\u0026deg; 68\u0026acute; N and 69\u0026deg; 81\u0026acute; E). These areas fall under two agro-climatic zones, i.e., North Saurashtra and South Saurashtra of Gujarat having dry sub-humid climate (Ghosh, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e1991\u003c/span\u003e). The weather is marked by an arid and dry climate, with a moderate rainfall during the monsoons and moist weather owing to the Arabian Sea and the Gulf of Cambay. Among the four districts, only Rajkot is land-locked while Junagadh, Gir-Somanath and Porbander have boundaries with Arabian Sea. The average minimum temperature is around 10\u0026deg;C in winters and reaches a maximum of 42\u0026deg;C during dry hot summers (Patil, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2006\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eCollection of tick\u003c/h2\u003e \u003cp\u003eStandard procedures and bio-safety measures were followed during collection of tick sample from animals (Walker et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Rooman et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Ticks were collected randomly from cattle population of farms, gaushalas and panjrapoles located under the area of the study during the months of April, 2017 to March, 2018 (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Animals were thoroughly examined for any tick infestation and male and female ticks in different stages were collected from the body of animals using forceps without damage. Five to eight ticks collected from an individual animal were pooled and labelled as one sample. The collected tick samples were transferred into a small plastic bag and marked. During the study period, 396 tick samples were collected, brought to laboratory, washed with tap water and preserved in 70% ethanol.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eDetails of tick samples collected and species of tick recorded on cattle in four district of western India\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eAgro-Climatic Zones\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eDistricts\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNo. of Farms/\u003c/p\u003e \u003cp\u003eGausalas/\u003c/p\u003e \u003cp\u003ePanjarapols visited\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eNo. of cattle examined\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"4\" nameend=\"c8\" namest=\"c5\"\u003e \u003cp\u003eNo. of cattle infested with tick species\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003e\u003cem\u003eH. anatolicum\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eR. microplus\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eMixed infestations\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eSouth Saurastra Region\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eJunagadh\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e37\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e298\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e60\u003c/p\u003e \u003cp\u003e(40.54%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e60\u003c/p\u003e \u003cp\u003e(40.54%))\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e28\u003c/p\u003e \u003cp\u003e(18.92%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e148 (49.66%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePorbandar\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e186\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e39\u003c/p\u003e \u003cp\u003e(50.65%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e18\u003c/p\u003e \u003cp\u003e(23.38%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e20\u003c/p\u003e \u003cp\u003e(25.97%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e77 (41.40%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGir-somanath\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e155\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e37\u003c/p\u003e \u003cp\u003e(47.44%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e21\u003c/p\u003e \u003cp\u003e(26.92%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e20\u003c/p\u003e \u003cp\u003e(25.64%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e78 (50.32%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNorth Saurastra Region\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRajkot\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e221\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e55\u003csup\u003e*\u003c/sup\u003e\u003c/p\u003e \u003cp\u003e(59.14%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e16\u003c/p\u003e \u003cp\u003e(17.20%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e22\u003c/p\u003e \u003cp\u003e(23.66%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e93 (42.08%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTotal:\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e107\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e860\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e191 (48.23%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e115\u003c/p\u003e \u003cp\u003e(29.04%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c7\"\u003e \u003cp\u003e90\u003c/p\u003e \u003cp\u003e(22.73%)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c8\"\u003e \u003cp\u003e396 (46.05%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"8\"\u003e*\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 between Junagadh and Rajkot\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eMorphological Identification of tick\u003c/h2\u003e \u003cp\u003eCollected ticks were identified under stereo-zoom microscope (Olympus SZ61, Japan) based on morphology using standard identification key. Briefly, consistent and unique key features of ticks were used for genus level identification, and standard key characteristics were used for species level identification afterwards (Taylor et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Walker et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). Identified ticks were stored in 70% ethanol.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eMolecular identification of tick\u003c/h2\u003e \u003cp\u003eThirty adult ticks (15 of each genus) were randomly selected for molecular confirmation and characterization. Individually whole genomic DNA was isolated using conventional method. After ethanol evaporation from preserved ticks, they were mechanically crushed in 1 ml lysis buffer (NaCl 0.1M, Tris-HCl 0.21M, pH8 EDTA 0.05M, SDS 0.5%) using mortar and pestle and incubated in 56\u0026deg;C water bath for 16 hours after mixing with proteinase K (100 \u0026micro;g/ml). Subsequently, extraction protocol was followed as per Phenol-Chloroform methods (Wallace, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e1987\u003c/span\u003e). Finally, the DNA was precipitated with absolute ethanol and resuspended in 200 \u0026micro;l of nuclease free water. The quality of DNA was checked on 1% agarose gel, quantified spectrophotometrically (Nanodrop spectrophotometer) and stored at -20\u0026deg;C.\u003c/p\u003e \u003cp\u003eTo amplify the fragments of cytochrome c oxidase subunit I (COX1) gene of \u003cem\u003eR. microplus\u003c/em\u003e, PCR primers were designed using Primer3web tools (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://primer3.ut.ee/\u003c/span\u003e\u003cspan address=\"https://primer3.ut.ee/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) based on sequences available in GenBank (Accession no. MK889213). However, published primers were used for amplification of COX1 gene of \u003cem\u003eH. anatolicum\u003c/em\u003e (Schulz et al., 2020) (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). PCR primers were synthesized at Eurofins Genomics India Pvt. Ltd., Bengaluru, India.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eDetails of primers used for amplification of partial sequences of COX1 gene of \u003cem\u003eH. anatolicum\u003c/em\u003e and \u003cem\u003eR. microplus\u003c/em\u003e\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer ID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimers (5\u0026acute;\u0026rarr; 3\u0026acute;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTick species\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eExpected amplification\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eReferences\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRCoIF1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003egtaattgtaactgcccacgca\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eR. microplus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e214 bp (79\u0026ndash;292 bp)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003ePresent study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eRCoIR1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ettcatccagttcctgcacct\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHya_COI-237\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003etggtaatgatcaaatttataatgta\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eHyalomma\u003c/em\u003e spp.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e495 bp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eSchulz et al., 2020\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHya_COI-1267\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecgatctgttaataatatagtaat\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eA 25 \u0026micro;l PCR reaction was set up using 12.5 \u0026micro;l of 2X DreamTaq Green PCR master mix (Thermo Scientific, Lithuania), 1 \u0026micro;l each of forward and reverse primers (10 \u0026micro;M each), 1 \u0026micro;l DNA and 9.5 \u0026micro;l of NFW. The reaction mixture was incubated in a gradient thermal cycler (Applied Bio System, USA) at optimized condition viz., initial denaturation for 5 min at 95\u0026deg;C, 32 cycles of denaturation (30 s at 94\u0026deg;C), annealing (30 s at 52\u0026deg;C for \u003cem\u003eR. microplus\u003c/em\u003e and 50\u0026deg;C for \u003cem\u003eH. anatolicum\u003c/em\u003e) and extension (30 s at 72\u0026deg;C), and lastly final extension (5 min at 72\u0026deg;C). The amplified product was visualized under UV on 1.2% agarose gel containing ethidium bromide and photographed in gel documentation system (Gel Doc, USA). Randomly, 10 \u0026micro;l of PCR purified product (GeneJET Gel Extraction and DNA Cleanup Micro Kit, Thermo Scientific, Lithuania) from each tick species were submitted to commercial house (Eurofins Genomics India Pvt. Ltd., Bengaluru, India) for bi-directional Sanger sequencing. Obtained sequences were aligned, and checked using BioEdit programme and BLASTn (NCBI, USA). Finally, sequence was submitted to GenBank (NCBI, USA). The sequences were aligned using Clustal\u003cem\u003eW\u003c/em\u003e and Maximum-likelihood (ML) algorithm, which was further used to construct the phylogenetic tree in MEGA-X with bootstrapping at 500 replicates. The sequences of different tick species with more than 99% query coverage in BLASTn analysis were included in the study (\u003cb\u003eSupplementary Table\u0026nbsp;1\u003c/b\u003e).\u003c/p\u003e \u003cp\u003e \u003cem\u003eIn-silico\u003c/em\u003e restriction enzyme (RE) sites analysis using online tool NEBcutter V2.0 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://nc2.neb.com/NEBcutter2/\u003c/span\u003e\u003cspan address=\"https://nc2.neb.com/NEBcutter2/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was done for COX1 gene sequences of those tick species reacted in Primer-BLAST (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?LINK_LOC=BlastHome\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?LINK_LOC=BlastHome\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) (\u003cb\u003eSupplementary Tables\u0026nbsp;2 and 3\u003c/b\u003e). Moreover, few Fastdigest\u0026reg; REs (AluI, SacI, HinfI, MspI) (Thermo Scientific, Lithuania) were used to digest amplified COX1 sequence of identified tick species. A 30 \u0026micro;l reaction was set up using 2 \u0026micro;l of 10X Fastdigest buffer, 10 \u0026micro;l of PCR product, 17 \u0026micro;l of NFW and 1 \u0026micro;l enzymes. The reaction was incubated at 37\u0026deg;C for 5\u0026ndash;15 minutes as per manufacturer\u0026rsquo;s instruction. The digested products were resolved on 1.5% agarose gel and documented.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eCollected data were compiled, tabulated and analyzed. Tick infestations to cattle were presented in percent and data among the different districts were analyzed by Chi-square test with difference at \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.05 was considered as significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eMorphological identification of ticks\u003c/h2\u003e \u003cp\u003eMorphologically, ticks of two species, \u003cem\u003eHy. anatolicum\u003c/em\u003e and \u003cem\u003eR. microplus\u003c/em\u003e were found on cattle (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. Based on morphological features such as body size, position of scutum, etc., ticks were classified as nymph, male and female. The size of engorged nymphs of \u003cem\u003eR. microplus\u003c/em\u003e was measured as 2.102\u0026thinsp;\u0026plusmn;\u0026thinsp;0.023 mm long and 1.201\u0026thinsp;\u0026plusmn;\u0026thinsp;0.025 mm broad while no nymph of \u003cem\u003eH. anatolicum\u003c/em\u003e was recorded in collected samples. The average size of male \u003cem\u003eH. anatolicum\u003c/em\u003e and \u003cem\u003eR. microplus\u003c/em\u003e was recorded as 3.094\u0026thinsp;\u0026plusmn;\u0026thinsp;0.075 x 2.043\u0026thinsp;\u0026plusmn;\u0026thinsp;0.063 mm and 1.730\u0026thinsp;\u0026plusmn;\u0026thinsp;0.034 x 1.130\u0026thinsp;\u0026plusmn;\u0026thinsp;0.019 mm, respectively. The size of females was found to be highly variable based on their stages of feeding. The size of young female \u003cem\u003eHy. anatolicum\u003c/em\u003e and \u003cem\u003eR. microplus\u003c/em\u003e was recorded as 3.306\u0026thinsp;\u0026plusmn;\u0026thinsp;0.221 x 2.257\u0026thinsp;\u0026plusmn;\u0026thinsp;0.199 and 2.205\u0026thinsp;\u0026plusmn;\u0026thinsp;0.085 x 1.315\u0026thinsp;\u0026plusmn;\u0026thinsp;0.082, respectively. The difference between the size of male and female \u003cem\u003eHy. anatolicum\u003c/em\u003e was not significant (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05) while difference was found to be significant (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) between male and female \u003cem\u003eR. microplus\u003c/em\u003e. Nevertheless, the significant differences in size of male (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) and female (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) ticks between the species were recorded. The ratio of length of mouth-part (LMP) to width of basis capitulum (WBC) of \u003cem\u003eHy. anatolicum\u003c/em\u003e (1.326\u0026thinsp;\u0026plusmn;\u0026thinsp;0.065) was significantly higher (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) compared to \u003cem\u003eR. microplus\u003c/em\u003e (0.444\u0026thinsp;\u0026plusmn;\u0026thinsp;0.006). Noticeable morphological features of both the tick species were recorded (Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e\u003cb\u003e).\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eNoticeable morphological features of \u003cem\u003eHy. anatolicum\u003c/em\u003e and \u003cem\u003eR. microplus\u003c/em\u003e under stereo-zoom microscope\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTick species\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e\u003cem\u003eHy. anatolicum\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCommon features\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eSomewhat elongated body with long mouth part (longirostrate). Basis capituli is broadly hexagonal. Pale rings like mark on legs. Punctation distributions are sparse on scutum/conscutum. Presence of distinct convex eyes and festoons. Parma is pale in colour. Coxa I have large and equal length of internal and external spurs. Anal groove is posterior to anus. Comma shaped spiracles. Almost equal in size of 1st and 2nd segment of palp.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDorsal view\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eConscutum is convex and lightly punctuated. Short but distinct lateral grooves. Noticeable postero-median groove is present that does not reach to parma.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePosterior outline of scutum is smooth. Scapular grooves reached to the posterior margin of scutum.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eVentral view\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePresence of adanal, accessory adanal and sub-anal shields. Small sub-anal shield is directly posterior to adanal shield. Adanal shields are parallel to those of opposite side and have rounded ends.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBulged and small knob like genital operculum that is circular in outline.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e\u003cem\u003eR. microplus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCommon features\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eShort, straight capitulum (brevirostrate), inornate, festoon absent, coxae 1 have small paired spurs, hexagonal basis capitulum, spiracular plate is rounded or oval. Male is significantly smaller than female.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eDorsal view\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNearly oval shaped body, Distinct cornua, caudal appendages can be observed clearly, no festoon present.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNearly square shaped body, Scutum present anteriorly only.\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eVentral view\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDistinct adanal shields and accessory shields, A narrow caudal appendage.\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u0026lsquo;U\u0026rsquo; shaped posterior margin of genital aperture,\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eMolecular characterization\u003c/h2\u003e \u003cp\u003eThe partial sequences of COX1 gene of \u003cem\u003eR. microplus\u003c/em\u003e and \u003cem\u003eHy. anatolicum\u003c/em\u003e were amplified at expected size of 214 bp and 495 bp, respectively without any non-specific reaction. Though, RCoIF1/RCoIR1 primer pairs did not show cross-reactivity with \u003cem\u003eHy. anatolicum\u003c/em\u003e but Hya_COI-237/Hya_COI-1267 primers pair cross-reacted to \u003cem\u003eR. microplus\u003c/em\u003e as assessed in Pimer-BLAST analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The 214 bp and 495 bp size of COX1 sequences of \u003cem\u003eR. microplus\u003c/em\u003e and 495 bp size of COX1 sequences of \u003cem\u003eHy. anatolicum\u003c/em\u003e were generated and GenBank accessions were obtained (OP048960, OP048961 and OP048962). The 214 bp sequence of \u003cem\u003eR. microplus\u003c/em\u003e was not subjected to additional study because it was confirmed to be 100% identical and fall within the 495 bp COX1 sequence of \u003cem\u003eR. microplus\u003c/em\u003e. Alignment of 495 bp COX1 nucleotide sequences of both the identified tick species revealed 81.8% identity (20.9% divergence). The sequence divergence within \u003cem\u003eHy. anatolicum\u003c/em\u003e was comparatively lesser (0\u0026ndash;1.6%) in comparison to different isolates of \u003cem\u003eR. microplus\u003c/em\u003e (0\u0026ndash;11.7%). However, Indian and other neighbour countries like Pakistan, Bangladesh, Myanmar isolates of \u003cem\u003eR. microplus\u003c/em\u003e was found less divergence (0\u0026ndash;2.5%). The same was reflected in phylogenetic analysis where Indian isolates were grouped in to clade C of \u003cem\u003eR. microplus\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Similarly, isolates of \u003cem\u003eHy. anatolicum\u003c/em\u003e were formed into same clade under the broader group of \u003cem\u003eHyalomma\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe Primer-BLAST analysis suggests that the primer pairs RCoIF1/RCoIR1 and Hya COI-237/Hya COI-1267 may react with just a few other tick species in addition to the targeted tick species, such as \u003cem\u003eR. microplus\u003c/em\u003e and \u003cem\u003eHy. anatolicum\u003c/em\u003e, respectively (\u003cb\u003eSupplementary table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003e2\u003c/span\u003e and 3\u003c/b\u003e). In-silico RE analysis of COX1 gene of targeted tick species and cross-reactive tick species was recorded that can produce more than 100 bp cut and can produce the difference among the tick species (\u003cb\u003eSupplementary table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003e2\u003c/span\u003e and 3\u003c/b\u003e). The 214 bp of COX1 sequences of \u003cem\u003eR. microplus\u003c/em\u003e was enzymatically digested with \u003cem\u003eAlu\u003c/em\u003eI but not with \u003cem\u003eSac\u003c/em\u003eI. Similarly, 495 bp of COX1 sequences of \u003cem\u003eHy. anatolicum\u003c/em\u003e was enzymatically digested with the restriction enzymes \u003cem\u003eHinf\u003c/em\u003eI, \u003cem\u003eMsp\u003c/em\u003eI, \u003cem\u003eAva\u003c/em\u003eII and \u003cem\u003eAlu\u003c/em\u003eI however the corresponding sequence of \u003cem\u003eR. microplus\u003c/em\u003e was not digested with the same restriction enzymes (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eIncidence of tick infestations in cattle\u003c/h2\u003e \u003cp\u003eRandomly, cattle (n\u0026thinsp;=\u0026thinsp;860) were examined in small farms (n\u0026thinsp;=\u0026thinsp;42), Gaushalas (n\u0026thinsp;=\u0026thinsp;57) and Panjarapols (n\u0026thinsp;=\u0026thinsp;8) located within the study area. Overall, 46.05% (n\u0026thinsp;=\u0026thinsp;396) cattle were found to have visible tick infestation with insignificantly (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05) higher incidence in South Saurastra Region (47.42%, n\u0026thinsp;=\u0026thinsp;303) compared to North Saurastra Region (42.08%, n\u0026thinsp;=\u0026thinsp;93). District wise, the highest number of tick infested cattle were recorded in Gir-Somnath (50.32%, n\u0026thinsp;=\u0026thinsp;78) followed by Junagadh (49.66%, n\u0026thinsp;=\u0026thinsp;148), Rajkot (42.08%, n\u0026thinsp;=\u0026thinsp;93) and lowest in Porbandar (41.40%, n\u0026thinsp;=\u0026thinsp;77) district but the difference was not significant (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05).\u003c/p\u003e \u003cp\u003eThe pooled tick samples were identified as \u003cem\u003eHy. anatolicum\u003c/em\u003e, \u003cem\u003eR. microplus\u003c/em\u003e and mixed, where both were present. Among the total 396 tick infested cattle, significantly highest (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) number of cattle were found to be infested with \u003cem\u003eHy. anatolicum\u003c/em\u003e (70.96%, n\u0026thinsp;=\u0026thinsp;281) compared to \u003cem\u003eR. microplus\u003c/em\u003e (51.77%, n\u0026thinsp;=\u0026thinsp;205) whereas, 22.73% (n\u0026thinsp;=\u0026thinsp;90) cattle were found to infested with both the ticks spp. Accordingly, significantly higher infestation of \u003cem\u003eHy. anatolicum\u003c/em\u003e on cattle was recorded in Porbandar (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), Gir-Somnath (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) and Rajkot (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) districts compared to \u003cem\u003eR. microplus\u003c/em\u003e. However, the cattle of Junagadh district have equal incidence of \u003cem\u003eHy. anatolicum\u003c/em\u003e and \u003cem\u003eR. microplus\u003c/em\u003e infestation. Moreover, the incidence of \u003cem\u003eHy. anatolicum\u003c/em\u003e infestation on cattle was found significantly higher in Rajkot (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001), Gir-Somnath and Porbandar (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) compared to Junagadh whereas differences were not significant (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05) among the Rajkot, Gir-Somnath and Porbandar. In contrast, Rajkot had the substantially lower (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) incidence of \u003cem\u003eR. microplus\u003c/em\u003e infestations on cattle than Junagadh, whereas differences between the other districts were insignificant (p\u0026thinsp;\u0026gt;\u0026thinsp;0.05).The details of ticks identified from pooled samples of individual cattle from different districts were given in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe current study identified the species of ticks that infest cattle in western part of India. Two significant tick species, \u003cem\u003eR. microplus\u003c/em\u003e and \u003cem\u003eHy. anatolicum\u003c/em\u003e, were morphologically and molecularly identified and characterised in the present investigation from India. \u003cem\u003eHy. anatolicum\u003c/em\u003e is usually 3-hosts tick and trans-stadially transmit \u003cem\u003eT. annulata\u003c/em\u003e parasite to the cattle causing bovine tropical theileriosis. The disease is very common in cattle where this tick species prevails (Kumar et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2020\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Thakre et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). \u003cem\u003eHyalomma\u003c/em\u003e ticks are also well known for maintenance and transmission of CCHF virus to human worldwide (Mourya et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). \u003cem\u003eHyalomma\u003c/em\u003e ticks are distinguished morphologically by being comparatively larger in size, with a relatively long hypostome (longirostrate), beady eyes, banded legs, and, in the case of the male, three pairs of anal plates. In the present investigation, adult male and female \u003cem\u003eHy. anatolicum\u003c/em\u003e were found to be 3.094\u0026thinsp;\u0026plusmn;\u0026thinsp;0.075 to 3.308\u0026thinsp;\u0026plusmn;\u0026thinsp;0.221 mm, respectively in length excluding length of mouth parts (0.718\u0026thinsp;\u0026plusmn;\u0026thinsp;0.058 mm) which is near to the size of \u003cem\u003eHyalomma\u003c/em\u003e species along with other morphological features (Walker et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). The immature stages such as larvae and nymphs of \u003cem\u003eHy. anatolicum\u003c/em\u003e were not recorded in collection. The reason might be because of their small size and multi-hosts feeding nature on small mammals and birds (Kumar et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Owing to the one-host tick, \u003cem\u003eR. microplus\u003c/em\u003e engorged nymphs, male and female stages were recorded. The \u003cem\u003eR. microplus\u003c/em\u003e is small sized tick (2\u0026ndash;3 mm including mouth parts) with males significantly smaller (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) as compared to females. Other morphological features were recorded such as presence of indistinct eyes, absence of festoons, broad and short capitulum (ratio of length of mouth-part to width of basis capitulum was found to be 0.444\u0026thinsp;\u0026plusmn;\u0026thinsp;0.006) and presence of distinct adanal shields, accessory shields and narrow caudal appendages in male (Walker et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Kamani et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Even though these morphological characteristics can distinguish between the two different tick species with ease, it is typically difficult to accomplish this amongst closely related species since their features are so similar, necessitating a very high level of ability to avoid identification errors (Pervomaisky, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e1950\u003c/span\u003e; Hoogstraal, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e1956\u003c/span\u003e). In such a case, species level identification of an organism using a molecular technique may be employed as an alternate and supplementary tool (Amendt et al., \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). The newly generated COX1 sequences of the two tick species, i.e., \u003cem\u003eHy. anatolicum\u003c/em\u003e (OP048961) and \u003cem\u003eR. microplus\u003c/em\u003e (OP048960) were confirmed by BLASTn analysis (NCBI, USA), sequence identity matrix (\u0026gt;\u0026thinsp;99% similarity within species) and phylogeny. Similarly, COX1 alone or other mitochondrial and/or ribosomal DNA fragments were employed for molecular characterization and confirmation of the tick species (Lv et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Kamani et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Roy et al., \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). However, molecular identification based on COX1 gene is considered the best choice (Lv et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Ernieenor et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Yet, PCR-RFLP is widely used technique for discriminating the species at molecular level because of its cost and conveyance compared to sequence analysis. Two targeted species of ticks, \u003cem\u003eR. microplus\u003c/em\u003e and \u003cem\u003eHy. anatolicum\u003c/em\u003e, may be distinguished in in-vitro RE analysis utilising only a few RE \u003cem\u003e(Sac\u003c/em\u003eI, \u003cem\u003eHinf\u003c/em\u003eI, \u003cem\u003eMsp\u003c/em\u003eI, \u003cem\u003eAva\u003c/em\u003eII, \u003cem\u003eand Alu\u003c/em\u003eI\u003cem\u003e)\u003c/em\u003e, which were identified in in-silico RE analysis of 214 bp COX1 sequence of \u003cem\u003eR. microplus\u003c/em\u003e and 495 bp COX1 sequences of \u003cem\u003eHy. anatolicum.\u003c/em\u003e Similarly, Schulz et al. (2020) used a set of restriction enzymes to distinguish between the different species of \u003cem\u003eHyalomma\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eHigher prevalence of \u003cem\u003eH. anatolicum\u003c/em\u003e and \u003cem\u003eR. microplus\u003c/em\u003e was recorded in cattle with the former being detected at a relatively greater rate than the latter. Short winter period and hot humid climatic conditions (with an average temperature of 36\u0026ndash;37\u0026deg;C) of this region is highly suitable for the growth and development of TTBDs. The finding of these species in diverse ecological environments has been reported elsewhere. Several researchers, including Tavassoli et al. (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) of West and North-West Iran, observed high prevalence of ixodid ticks, identifying \u003cem\u003eHyalomma\u003c/em\u003e spp. as the predominant tick species (71.56%) affecting cattle. According to an epidemiological study by Rony et al. (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2010\u003c/span\u003e), the highest prevalence of \u003cem\u003eR. microplus\u003c/em\u003e (45.63%) was found in Bangladesh's Gazipur area. According to Kabir et al. (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2011\u003c/span\u003e), R. \u003cem\u003emicroplus\u003c/em\u003e is the most common ixodid tick in the Chittagong District of Bangladesh. In India, Singh and Rath (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) observed maximum prevalence of \u003cem\u003eR. microplus\u003c/em\u003e and \u003cem\u003eHy. anatolicum\u003c/em\u003e in the state of Punjab in India. Chhillar et al. (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) observed that \u003cem\u003eHy. anatolicum\u003c/em\u003e and \u003cem\u003eR. microplus\u003c/em\u003e are the most common vector species infesting buffalo and cattle in Haryana. Another study revealed that \u003cem\u003eR. microplu\u003c/em\u003es as common in Lucknow, Uttar Pradesh and Jammu district, Jammu and Kashmir (India), respectively (Kaur et al., \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Khajuria et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Abdul et al. (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2007\u003c/span\u003e) reported prevalence of \u003cem\u003eRhipicephalus\u003c/em\u003e (\u003cem\u003eBoophilus\u003c/em\u003e) (46.1%) followed by \u003cem\u003eHyalomma\u003c/em\u003e (31.25%) and \u003cem\u003eRhipicephalus\u003c/em\u003e (17.93%). Patel et al. (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2012\u003c/span\u003e) reported two species of ticks namely \u003cem\u003eR. microplus\u003c/em\u003e and \u003cem\u003eHy. anatolicum\u003c/em\u003e as the most common tick species infesting Indian zebu cattle in Mathura district of India. The disparity between these studies could be explained by a variety of variables, such as agroecological and animal health practices, or management variations within the area under studies. The present investigation shows the wide variety and abundance of tick species that infest cattle in south western Gujarat, suggesting the possibility of the existence of other tick-borne pathogens in addition to those that are already known to exist there and warrants further investigation in order to establish proper control measures in this region.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn summary, the present research reveals the predominance of two distinct tick species, \u003cem\u003eR. microplus\u003c/em\u003e and \u003cem\u003eHy. anatolicum\u003c/em\u003e infesting cattle in the studied region. The species validity of ticks was also further confirmed by PCR in integration with PCR-RFLP assay targeting COX I gene. The study findings clearly indicate that a combination of morphology and molecular data can be corroborated as an efficient tool for precise tick identification. Further, this is the first study reporting nucleotide sequences of COX1 in integration morphological identification of ticks from this part of Gujarat, India.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAuthors are heartly thankful to Director of Research, Junagadh Agricultural University, Junagadh, Gujarat for proving necessary facilities and funds for research work. Authors are also thankful to Principal and Dean, College of Veterinary Science and Animal Husbandary, Junagadh, Gujarat for providing necessary administrative support during research. This is part of students Master Research programme.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors contributed to the study conception and design. Protocol designed, Formal analysis and Validation by Binod Kumar, Vivek Kumar Singh, Jeemi Arbindbhai Patel; Methodology performed by Jeemi Arbindbhai Patel, Bhupendrakumar and Jamsubhai Thakre; Funding acquisition: Binod Kumar; Supervision- Binod Kumar, and Vivek Kumar Singh; Visualization: Jeemi Arbindbhai Patel, Bhupendrakumar Jamsubhai Thakre, and Nilima Nayankumar Brahmbhatt; Manuscript was written by Binod Kumar; Manuscript editing and review- Biswa Ranjan Maharana and Vivek Kumar Singh; finally, all the authors have read the article and approved for submission.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. The current research programme utilized the regular funds received from the University for the development of the department and student research.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDisclosure statement\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo potential conflict of interest was reported by the author(s).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData will be made available on request.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAbdul, M., Zabita, K., Bashir, A., Abdullah, A., 2007. Prevalence and identification of ixodid tick genera in frontier region Peshawar. J. Agri. Biol. Sci. \u003cstrong\u003e2\u003c/strong\u003e(1), 21-25.\u003c/li\u003e\n\u003cli\u003eAjith Kumar, K.G., Ravindran, R., Johns, J., Chandy, G., Rajagopal, K., Chandrasekhar, L., George, A.J., Ghosh, S., 2018. Ixodid tick vectors of wild mammals and reptiles of southern India. J. Arthropod. Borne Dis. 12(3), 276\u0026ndash;285.\u003c/li\u003e\n\u003cli\u003eAmrutha, B. M., Kumar, K. G. A., Kurbet, P. S., Varghese, A., Deepa, C. K., Pradeep, R. K., Nimisha, M., Asaf, M., Juliet, S., Ravindran, R., Ghosh, S., 2022. Morphological and molecular characterization of \u003cem\u003eRhipicephalus microplus\u003c/em\u003e and \u003cem\u003eRhipicephalus annulatus\u003c/em\u003e from selected states of southern India. Ticks Tick Borne Dis. 14(2), 102086. https://doi.org/10.1016/j.ttbdis.2022.102086\u003c/li\u003e\n\u003cli\u003eAmendt, J., Krettek, R., Zehner, R., 2004. Forensic entomology. Naturwissenschaften. 91(2), 51\u0026ndash;65. https://doi.org/10.1007/s00114-003-0493-5\u003c/li\u003e\n\u003cli\u003eBoulanger, N., Boyer, P., Talagrand-Reboul, E., Hansmann, Y., 2019. Ticks and tick-borne diseases. Med. Mal. Infect. 49(2), 87\u0026ndash;97.\u003c/li\u003e\n\u003cli\u003eBrahma, R.K., Dixit, V., Sangwan, A.K., Doley, R., 2014. Identification and characterization of \u003cem\u003eRhipicephalus (Boophilus) microplus\u003c/em\u003e and \u003cem\u003eHaemaphysalis bispinosa \u003c/em\u003etick (Acari: Ixodidae) of North East India by ITS2 and 16S rDNA and morphological analysis. Exp. Appl. Acarol. 62(2), 253\u0026ndash;265. https://doi.org/10.1007/s10493-013-9732-4\u003c/li\u003e\n\u003cli\u003eChhillar, S., Singh, C.J., Harpreet, K., 2014. Investigations on some hard ticks (acari: ixodidae) infesting domestic buffalo and cattle from Haryana, India. J. Entomol. Zool. Stud. \u003cstrong\u003e2\u003c/strong\u003e(4), 99-104.\u003c/li\u003e\n\u003cli\u003eErnieenor, F., Ernna, G., Mariana, A., 2017. Phenotypic and genotypic identification of hard ticks of the genus \u003cem\u003eHaemaphysalis\u003c/em\u003e (Acari: Ixodidae) in Peninsular Malaysia. Exp. Appl. Acarol. 71(4), 387\u0026ndash;400. https://doi.org/10.1007/s10493-017-0120-3 \u003c/li\u003e\n\u003cli\u003eGhosh, S.P., 1991. Agroclimatic zone-specific research. ICAR, Krishi Anusandhan Bhavan, Pusa, New Delhi, India, 965 pp.\u003c/li\u003e\n\u003cli\u003eGhosh, S., Bansal, G.C., Gupta, S.C., Ray, D., Khan, M.Q., Irshad, H., Shahiduzzaman, M., Seitzer, U., Ahmed, J.S., 2007. Status of tick distribution in Bangladesh, India and Pakistan. Parasitol. Res. 101 Suppl 2, S207\u0026ndash;S216. https://doi.org/10.1007/s00436-007-0684-7\u003c/li\u003e\n\u003cli\u003eGhosh, S., Nagar, G., 2014. Problem of ticks and tick-borne diseases in India with special emphasis on progress in tick control research: A review. J. Vector Borne Dis. 51, 259-270.\u003c/li\u003e\n\u003cli\u003eHoogstraal, H., 1956. African Ixodoidea. I. Ticks of the Sudan (with special reference to Equatoria Province and with preliminary reviews of the genera \u003cem\u003eBoophilus, Margaropus\u003c/em\u003e and \u003cem\u003eHyalomma\u003c/em\u003e). United State Navy, Washington DC. \u003c/li\u003e\n\u003cli\u003eHurtado, O.J.B., Giraldo-R\u0026iacute;os, C., 2018. economic and health impact of the ticks in production animals. In M. Abubakar, \u0026amp; P. K. Perera (Eds.), Ticks and Tick-Borne Pathogens. IntechOpen. https://doi.org/10.5772/intechopen.81167\u003c/li\u003e\n\u003cli\u003eKabir, M.H.B., Mondal, M.M.H., Eliyas, M., Mannan, M.A., Hashem, M.A., Debnath, N.C., 2011. An epidemiological survey on investigation of tick infestation in cattle at Chittagong District, Bangladesh. Afr. J. Microbiol. Res.\u003cstrong\u003e 5\u003c/strong\u003e(4), 346-352.\u003c/li\u003e\n\u003cli\u003eKamani, J., Apanaskevich, D.A., Guti\u0026eacute;rrez, R., Nachum-Biala, Y., Baneth, G., Harrus, S., 2017. Morphological and molecular identification of \u003cem\u003eRhipicephalus\u003c/em\u003e (\u003cem\u003eBoophilus\u003c/em\u003e) \u003cem\u003emicroplus\u003c/em\u003e in Nigeria, West Africa: a threat to livestock health. Exp. Appl. Acarol. \u003cstrong\u003e73\u003c/strong\u003e, 283\u0026ndash;296. https://doi.org/10.1007/s10493-017-0177-z\u003c/li\u003e\n\u003cli\u003eKandi, S., Chennuru, S., Chitichoti, J., Metta, M., Krovvidi, S., 2022. Morphological and molecular characterization of ticks infesting cattle and buffaloes in different agro-climatic zones in Andhra Pradesh, India, and factors associated with high tick prevalence. Int. J. Acarol. 48(3), 192-200.\u003c/li\u003e\n\u003cli\u003eKaur, D., Kamal, J., Mishra, S., 2015. Studies on prevalence of ixodid ticks infesting cattle and their control by plant extracts. IOSR-JBPS.\u003cstrong\u003e 10\u003c/strong\u003e(6), 1-11.\u003c/li\u003e\n\u003cli\u003eKhajuria, V., Godara, R., Yadav, A., Katoch, R., 2015. Prevalence of ixodid ticks in dairy animals of Jammu region\u003cem\u003e. \u003c/em\u003eJ. Parasit. Dis.\u003cstrong\u003e 39\u003c/strong\u003e(3), 418\u0026ndash;421.\u003c/li\u003e\n\u003cli\u003eKumar, B., Manjunathachar, H.V., Ghosh, S., 2020. A review on \u003cem\u003eHyalomma\u003c/em\u003e species infestations on human and animals and progress on management strategies. Heliyon. 6(12), e05675. doi: 10.1016/j.heliyon.2020.e05675\u003c/li\u003e\n\u003cli\u003eKumar, B., Maharana, B.R., Thakre, B., Brahmbhatt, N.N., Joseph, J.P., 2022. 18S rRNA gene-based piroplasmid PCR: an assay for rapid and precise molecular screening of \u003cem\u003eTheileria\u003c/em\u003e and \u003cem\u003eBabesia\u003c/em\u003e species in animals. Acta Parasitol. 67(4), 1697\u0026ndash;1707. https://doi.org/10.1007/s11686-022-00625-2\u003c/li\u003e\n\u003cli\u003eLow, V. L., Tay, S. T., Kho, K. L., Koh, F. X., Tan, T. K., Lim, Y. A., Ong, B. L., Panchadcharam, C., Norma-Rashid, Y., Sofian-Azirun, M., 2015. Molecular characterisation of the tick \u003cem\u003eRhipicephalus microplus\u003c/em\u003e in Malaysia: new insights into the cryptic diversity and distinct genetic assemblages throughout the world. Parasit. Vectors, 8, 341. https://doi.org/10.1186/s13071-015-0956-5\u003c/li\u003e\n\u003cli\u003eLv, J., Wu, S., Zhang, Y., Chen, Y., Feng, C., Yuan, X., Jia, G., Deng, J., Wang, C., Wang, Q., Mei, L., Lin, X., 2014. Assessment of four DNA fragments (COI, 16S rDNA, ITS2, 12S rDNA) for species identification of the Ixodida (Acari: Ixodida). Parasit. Vectors. \u003cem\u003e7\u003c/em\u003e, 93. https://doi.org/10.1186/1756-3305-7-93\u003c/li\u003e\n\u003cli\u003eMedlock, J.M., Hansford, K.M., Bormane, A., Derdakova, M., Estrada-Pe\u0026ntilde;a, A., George, J.C., Golovljova, I., Jaenson, T.G., Jensen, J.K., Jensen, P.M., Kazimirova, M., Oteo, J.A., Papa, A., Pfister, K., Plantard, O., Randolph, S.E., Rizzoli, A., Santos-Silva, M.M., Sprong, H., Vial, L., Hendrickx, G., Zeller, H., Van Bortel, W., 2013 Driving forces for changes in geographical distribution of Ixodes ricinus ticks in Europe. Parasit.Vectors. 6, 1. https://doi.org/10.1186/1756-3305-6-1\u003c/li\u003e\n\u003cli\u003eMourya, D.T., Yadav, P.D., Gurav, Y.K., Pardeshi, P.G., Shete, A.M., Jain, R., Raval, D.D., Upadhyay, K.J., Patil, D.Y., 2019. Crimean Congo hemorrhagic fever serosurvey in humans for identifying high-risk populations and high-risk areas in the endemic state of Gujarat, India. BMC Infect. Dis. 19(1), 104. https://doi.org/10.1186/s12879-019-3740-x\u003c/li\u003e\n\u003cli\u003ePatel, G., Daya, S., Amit, K.J., Vikrant, S., Santosh, K.V., 2012. Prevalence and seasonal variation in ixodid ticks on cattle of Mathura district, Uttar Pradesh. J. Parasit. Dis. \u003cstrong\u003e37\u003c/strong\u003e(2), 173\u0026ndash;176.\u003c/li\u003e\n\u003cli\u003ePatil, B.R., 2006. Dynamics of livestock development in Gujarat, India: Experiences of an Indian NGO. Patil, B.R. \u0026ndash;[S.l.:s.n.]. Ill. PhD thesis Wageningen University. \u0026ndash;With ref.\u0026ndash; With summaries in English and Dutch. ISBN: 90-8504-530-4 pages158.\u003c/li\u003e\n\u003cli\u003ePervomaisky, G.S., 1950. Interspecific hybridization of Ixodidae. Dokl Akad Nauk SSSR. 73(5), 1033\u0026ndash;1036.\u003c/li\u003e\n\u003cli\u003eRony, S.A., Mondal, M.M.H., Begum, N., Islam, M.A., Affroze, S., 2010. Epidemiology of ectoparasitic infestations in cattle at Bhawal forest area, Gazipur. Bangladesh J. Vet. Med. \u003cstrong\u003e8\u003c/strong\u003e(1), 27\u0026ndash;33.\u003c/li\u003e\n\u003cli\u003eRooman, M., Assad, Y., Tabassum, S., Sultan, S., Ayaz, S., Khan, M.F., Khan, S.N., Ali, R., 2021. A cross-sectional survey of hard ticks and molecular characterization of \u003cem\u003eRhipicephalus microplus\u003c/em\u003e parasitizing domestic animals of Khyber Pakhtunkhwa, Pakistan. PloS One. 16(8), e0255138. https://doi.org/10.1371/journal.pone.0255138\u003c/li\u003e\n\u003cli\u003eRoy, B.C., Estrada-Pe\u0026ntilde;a, A., Kr\u0026uuml;cken, J., Rehman, A., Nijhof, A.M., 2018. Morphological and phylogenetic analyses of \u003cem\u003eRhipicephalus microplus\u003c/em\u003e ticks from Bangladesh, Pakistan and Myanmar. Ticks Tick Borne Dis. 9(5), 1069\u0026ndash;1079. https://doi.org/10.1016/j.ttbdis.2018.03.035\u003c/li\u003e\n\u003cli\u003eSemenza, J.C., Paz, S., 2021. Climate change and infectious disease in Europe: impact, projection and adaptation. Lancet Reg. Health Eur. 9(100), 230. https://doi.org/10.1016/j.lanepe.2021. 100230\u003c/li\u003e\n\u003cli\u003eSenbill, H., Tanaka, T., Karawia, D., Rahman, S., Zeb, J., Sparagano, O., Baruah, A., 2022. Morphological identification and molecular characterization of economically important ticks (Acari: Ixodidae) from North and North-Western Egypt. Acta Trop. 231, 106438. doi: 10.1016/j.actatropica.2022.106438.\u003c/li\u003e\n\u003cli\u003eShahhosseini, N., Wong, G., Babuadze, G., Camp, J.V., Ergonul, O., Kobinger, G.P., Chinikar, S., Nowotny, N., 2021. Crimean-Congo Hemorrhagic Fever virus in Asia, Africa and Europe. Microorganisms. 9(9), 1907. https://doi.org/10.3390/microorganisms9091907\u003c/li\u003e\n\u003cli\u003eSingh, N.K., Rath, S.S., 2013. Epidemiology of ixodid ticks in cattle population of various agro climatic zones of Punjab, India. Asian Pac. J. Trop. Med. \u003cstrong\u003e12\u003c/strong\u003e(3), 947-951.\u003c/li\u003e\n\u003cli\u003eTaylor, M., Coop, B., Wall, R., 2015. Veterinary Parasitology, 4\u003csup\u003eth\u003c/sup\u003e Edition, Wiley-Blackwell publication, 1032p.\u003c/li\u003e\n\u003cli\u003eTavassoli, M., Tabatabaei, M., Mohammadi, M., Esmaeilnejad, B., Mohamadpour, H., 2013. PCR-based detection of \u003cem\u003eBabesia \u003c/em\u003espp. infection in collected ticks from cattle in West and North-West of Iran. J. Arthropod. Borne Dis.\u003cstrong\u003e 7\u003c/strong\u003e(2), 132-138.\u003c/li\u003e\n\u003cli\u003eThakre, B.J., Kumar, B., Vagh, A., Brahmbhatt, N.N., Gamit, K., 2022. Comparative studies on detection of \u003cem\u003eTheileria annulata\u003c/em\u003e infection by clinical, parasitological and molecular techniques in buffaloes (\u003cem\u003eBubalus bubalis\u003c/em\u003e). Veterinarski Arhiv (in press).\u003c/li\u003e\n\u003cli\u003eWalker, A., Bouattour, A., Camicas, J.L., Estrada-Pen\u0026tilde;a, A., Horak, I.G., Latif, A.A., Pegram, R.G., Preston, P.M., 2003. Ticks of domestic animals in Africa: a guide to identification of species. The University of Edinburgh, Edinburgh. \u003c/li\u003e\n\u003cli\u003eWallace, D.M., 1987. Large and small scale phenol extractions, in: Berger S.L., Kimmel R. (Eds.), Guide to molecular cloning techniques, Academic Press, Orlando, pp. 31\u0026ndash;41.\u003c/li\u003e\n\u003cli\u003eWell, J.D., Stevens, J.R., 2008. Application of DNA-based methods in forensic entomology. Annu. Rev. Entomol. 53, 103\u0026ndash;120. https://doi.org/10.1146/annurev.ento.52.110405.091423\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Hyalomma anatolicum, Rhipicephalus microplus, cattle, COX1, PCR-RFLP, western India.","lastPublishedDoi":"10.21203/rs.3.rs-4010374/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4010374/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eTicks are well known for its potential as vectors second only to mosquitoes. They are considered to be the important vectors of many disease-causing pathogens in domesticated animals as well as in humans. For any strategic control of pest or pathogens, their identification and epidemiological knowledge is very much essential. Accordingly, a total of 860 cattle were examined from more than 100 farms, Gausalas and Panjrapoles in four districts of western India where 46.05% (n=396) cattle were found to be infested with ticks. The collected tick samples were examined under stereo-zoom microscope and ticks were identified morphologically as either \u003cem\u003eHyalomma\u003c/em\u003e \u003cem\u003eanatolicum \u003c/em\u003eor \u003cem\u003eRhipicephalus microplus\u003c/em\u003e. Which was further confirmed by PCR assay targeting cytochrome c oxidase subunit I (cox1) gene followed by sequence analysis. \u0026nbsp;The interspecific divergence between current isolates of \u003cem\u003eHy. anatolicum\u003c/em\u003e and \u003cem\u003eR. microplus\u003c/em\u003ewas 20.9%. The wider range of intraspecific divergence was recorded in \u003cem\u003eR. microplus\u003c/em\u003e (0 - 11.7%) compared to \u003cem\u003eHy. anatolicum\u003c/em\u003e (0 -1.6%), globally. In phylogenetic analysis Indian isolates of \u003cem\u003eR. microplus\u003c/em\u003eclustered with \u003cem\u003eR. microplus\u003c/em\u003e clade C. Additionally, a more applicable test, \u003cem\u003eIn-silico\u003c/em\u003e followed by PCR-RFLP restriction enzyme analysis, was employed to differentiate between the two tick species. Among the total 396 tick infested cattle, significantly higher (p\u0026lt;0.001) number of cattle were found to be infested with \u003cem\u003eH. anatolicum\u003c/em\u003e (70.96%, n=281) as compared to \u003cem\u003eR. microplus \u003c/em\u003e(51.77%, n=205) whereas, 22.73% (n=90) cattle were found to be infested with mixed tick infestation of both. The study indicate that \u003cem\u003eHy. anatolicum\u003c/em\u003e and \u003cem\u003eR. microplus\u003c/em\u003e ticks of western region of India is same as other parts of country.\u003c/p\u003e","manuscriptTitle":"Morphological and molecular characterization of Ixodid ticks infesting cattle in western India","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-05 12:48:04","doi":"10.21203/rs.3.rs-4010374/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"623f5142-c8ec-45c0-90b6-e0097786beed","owner":[],"postedDate":"April 5th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-04-23T13:50:07+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-05 12:48:04","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4010374","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4010374","identity":"rs-4010374","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}