Potential Mechanism of HXSJ Decoction in the Treatment of Venous Leg Ulcer: Based on the Association between Venous Leg Ulcers and Ferroptosis

preprint OA: closed
Full text JSON View at publisher
Full text 119,922 characters · extracted from preprint-html · click to expand
Potential Mechanism of HXSJ Decoction in the Treatment of Venous Leg Ulcer: Based on the Association between Venous Leg Ulcers and Ferroptosis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Potential Mechanism of HXSJ Decoction in the Treatment of Venous Leg Ulcer: Based on the Association between Venous Leg Ulcers and Ferroptosis Sunfeng Pan, Lie Xiong, Jiakun Li, Zhenjun Wang, Yujuan Su, Gaofeng Fang, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4239207/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 6 You are reading this latest preprint version Abstract Background: Venous leg ulcer (VLU) represents one of the most severe clinical manifestations in the progression of chronic venous diseases (CVD), imposes substantial burdens on both patients and society. The etiology of VLU is associated with the impairment of vascular endothelial cells. Methods: In clinical, a total of 10 patients diagnosed with VLU were enrolled in this study, and 4 types of skin tissue samples were collected from each patient, including normal, hyperpigmentation, lipodermatosclerosis, and VLU areas. Subsequently, the iron content and GPX activity were quantified. In vitro , iron overload models of HUVECs were established by exogenous 100 μ M FAC or 100 μ M Hemin to simulate simple iron overload and hemoglobin exudation, respectively. And ferroptosis medel was induced by 10 μ M Erastin. Meanwhile, Huoxue Shengji Decoction (HXSJ Decoction) as an external Chinese herbal decoction used in VLU treatment, has been incorporated into our in vitro study. Followed by the lipid peroxidation damage was evaluated by the content of malondialdehyde, protein carbonylation, ferrous ion, DCFH-DA and BODIPY™ 581/591 C11 staining; mitochondrial function was determined through ATP content and mitochondrial membrane potential (MMP) of JC-1 staining; the activation of Nrf2/system Xc - /GPX4 axis was assessed through GPX activity, GSH content, qPCR and western blot. Results: The clinical results showed that, before progressing to VLU, iron deposition in the affected tissues of CVD gradually intensifies ( P <0.05), and suddenly decreases in VLU stage ( P <0.01). Meanwhile, in hyperpigmentation stage, the GPX activity increased significantly ( P <0.05), with further deterioration of CVD, GPX activity was gradually suppressed ( P <0.05). The in vitro results indicate that irrespective of iron overload or ferroptosis models, HXSJ Decoction effectively upregulated the expression of Nrf2, xCT, and GPX4 ( P <0.05); inhibited the generation of malondialdehyde ( P <0.01) and protein carbonylation ( P <0.01), alleviated the accumulation of ferrous ions ( P <0.05); restored MMP, promoted ATP production ( P <0.05). Conclusions: Overall, this study suggested that iron accumulation-mediated inactivation of GPX4 is a significant contributing factor in VLU development through ferroptosis induction. Additionally, it revealed that the therapeutic mechanism of HXSJ Decoction potentially involves mitigating ferroptosis by activating the Nrf2/system Xc-/GPX4 pathway and alleviating the accumulation of ferrous ions. venous leg ulcer ferroptosis Chinese herbal compound iron overload HUVECs. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1 Background Venous leg ulcer (VLU) refers to cutaneous wounds that develop on the lower extremities as a result of venous hypertension, representing one of the most severe clinical manifestations in the progression of chronic venous diseases (CVD), encompassing approximately 70% of all lower limb ulcers [1] . The chronic pain and disability resulting from VLU exert a substantial impact on patients themselves, while also imposing significant financial burdens and labour force depletion on society [2] . Moreover, the challenge is further compounded by the impaired wound healing capacity and increased recurrence rate [3] . In normal physiology, wound healing is an intricately orchestrated biological process that can generally be categorized into four stages: hemostasis, inflammation, proliferation, and remodeling [4] . Angiogenesis plays a pivotal role in the wound healing process by facilitating the formation of granulation tissue [5] . Conversely, impairment of vascular endothelial cells (VECs) can result in the development of ulcers and delayed wound closure, which is considered a contributing factor to VLU [6] . In recent years, research have revealed that, hyperpigmentation (HPT) and lipodermatosclerosis (LDS) as the initial stages of VLU, characterized by iron deposition [7] . In clinical practice, our group has observed that once HPT progresses to LDS, risk of ulceration and recurrence increased significantly, and the wound healing capacity impaired. These clues imply a potential correlation between iron deposition and VLU that warrants further investigation. Ferroptosis as a programmed cell death that dependent on iron and lipid peroxidation [8] . Excessive iron, especially ferrous iron, lead to lipid peroxidation (LPO) through Fenton reaction. Iron overload is a contributing factor to the impaired healing of chronic skin ulcers (CSU), including VLU [9,10] . Moreover, recent studies have established a direct correlation between the ferroptosis of VECs and CSU [11,12] . The Nrf2/System Xc - /GPX4 pathway is crucial to mitigate LPO and ferroptosis [13] , inhibition of this pathway can induce ferroptosis without iron overload, compounds such as Erastin, RSL3, and Sorafenib. Huoxue Shengji Decoction (HXSJ Decoction) is an external Chinese herbal compound for treatment of VLU, which has been in clinical used for more than 10 years in our research group. The clinical research conducted by our team had demonstrated the significant efficacy of HXSJ Decoction in promoting angiogenesis and facilitating wound healing [14] . Here, we have preliminarily confirmed the involvement of ferroptosis in VLU through investigation on the skin tissue in different stages of VLU progression. And constructing models of iron overload and ferroptosis using human umbilical vein endothelial cells (HUVECs), to reveal the potential mechanisms of HXSJ Decoction in the treatment of VLU. 2 Methods 2.1 Clinical study 2.1.1 Ethics This study was conducted in accordance with the Declaration of Helsinki and approved by the Ethics Committee of Jiaxing Traditional Chinese Medicine Hospital (REC reference number: 2019KY0454). Informed consent forms were signed by each patient included in the study. 2.1.2 Clinical inclusion criteria Diagnostic criteria were as follows: (1) patients are classified as C5 according to the CEAP classification system [15] ; (2) patients aged 18~75 years; (3) after admission, patients underwent saphenous vein stripping surgery. 2.1.3 Clinical exclusion criteria Exclusion criteria were as follows: (1) arterial ischemic diseases, microvascular diseases, dermatological disorders, lymphatic disorders or other diseases impacting iron metabolism and cutaneous nutritional status; (2) organ failure, including cardiac, pulmonary, renal or hepatic dysfunction; (3) history of surgery and trauma in lower limbs; (4) in cases of severe systemic infection or concurrent serious underlying diseases; (5) pregnant or lactating; (6) with cancer or undergoing radiotherapy or chemotherapy; (7) participated in other clinical studies within the past 3 months. 2.1.4 Collection of clinical samples VLU tissue was obtained during the process of ulcer debridement by sampling from the junction between the ulcer and normal skin, including the base of the ulcer with a thickness of 3mm. A 3mm×5mm HPT tissue and LDS tissue were obtained during varicose vein surgery respectively, the incision was subsequently utilized for surgery. A 3mm×20mm normal tissue was obtained from the inguinal incision, which was subsequently utilized for great saphenous vein ligation. The typical HPT and LDS area illustrated in Figure 1. All samples were rinsed with saline, weighed, and embedded or frozen rapidly in liquid nitrogen for storage at -80℃. 2.1.5 Prussian blue staining The embedded clinical samples were stained according to the instructions of the Prussian Blue Staining Kit (E670109, Sangon, China), and photographed under upright microscope (Axio Scope.A1, Zeiss, Germany). 2.1.6 Immunohistochemistry (IHC) Following the sequential steps of slicing, dewaxing, and antigen retrieval, the clinical samples were incubated with GPX4 (ab125066, Abcam, UK) primary antibody and goat anti-rabbit (PV-8000D, ZSGB-BIO, China) secondary antibody. Subsequently, DAB staining was performed, and the samples were photographed under upright microscope. 2.1.7 Detection of iron content and GPX enzyme activity The clinical samples were homogenized with saline, and the supernatant was collected after centrifugation. According to the instructions of Tissue Iron Content Assay Kit (BC4355, Solarbio, China), GPX Activity Assay Kit (D799618, Sangon, China), and BCA Protein Assay Kit (C503051, Sangon, China), the results were measured using a microplate reader (Multiskan GO, Thermo, USA), and quantified by protein concentration. 2.2 Cell experiments 2.2.1 Cell culture and grouping The HUVECs were obtained from National Infrastructure of Cell Line Resource (Beijing, China), and cultured in DMEM medium (10569010, Gibco, USA) supplemented with 10% fetal bovine serum (10100147, Gibco, USA) and 100U/ml penicillin sodium -100 μ g/ml streptomycin sulfate (B540732, Sangon, China) at a 37℃ incubator (370, Thermo, USA) with 5% CO 2 . The iron overload models were established by 100 μ M Ferric Ammonium Citrate (FAC, A500061, Sangon, China) and 100 μ M Hemin (H140872, Aladdin, China) to simulate simple iron overload and hemoglobin exudation, respectively. 10 μ M Erastin (HY-15763, MCE, USA) was employed to establish a ferroptosis model. The experiment was conducted following a 24h intervention with HXSJ Decoction, in accordance with the experimental requirements. 2.2.2 Preparation of HXSJ Decoction The components of HXSJ Decoction are presented in Table 1. Astragali Radix (Cat. 170320) 15g, Salviae Miltiorrhizae Radix et Rhizoma (Cat. 170307) 20g, Carthami Flos (Cat. 170328) and Glycyrrhizae Radix et Rhizoma (Cat. 170301) 6g, were obtained from Anhui Jiayou Chinese Medicine Herb Pieces Co., Ltd.; Angelicae Sinensis Radix (Cat. 170202) 20g, Paridis Rhizoma (Cat. 170305) 10g were obtained from Zhejiang Chinese Medical University Medical Pieces Co., Ltd.; Olibanum (Cat. 170224) 10g, Bletillae Rhizoma (Cat. 170112) 10g, Myrrha (Cat. 170230) 10g were obtained from Jiaxing Oriental Chinese Medicine Decoction Pieces Co., Ltd.; Angelicae Dahuricae Radix (Cat. 44170201) 10g was obtained from Hangzhou Mintai Traditional Chinese Medicine Decoction Pipe Co., Ltd.. The aforementioned Chinese herbal medicine was extracted by hot reflux 1h with 1L 80% ethanol for 3 times, the extract was concentrated through rotary evaporation. Subsequently, the paste was dissolved in 80% ethanol to achieve a concentration of HXSJ Decoction at 500mg/ml, then filtered through a 0.22 μ m filter and stored at -20℃ for later use. Table 1. Components of HXSJ Decoction Name 1 Latin binomial nomenclature medicinal parts Astragali Radix Astragalus membranaceus (Fisch.) Bge. radix Salviae Miltiorrhizae Radix et Rhizoma Salvia miltiorrhiza Bge. radix and rhizoma Carthami Flos Carthamus tinctorius L. flower Glycyrrhizae Radix et Rhizoma Glycyrrhiza glabra L. radix and rhizoma Angelicae Sinensis Radix Angelica sinensis (Oliv.) Diels radix Paridis Rhizoma Paris polyphylla Smith var.yunnanensis (Franch.) Hand.-Mazz. rhizoma Olibanum Boswellia carterii Birdw. resin Bletillae Rhizoma Bletilla striata (Thunb.) Reichb.f. rhizoma Myrrha Commiphora myrrha Engl. resin Angelicae Dahuricae Radix Angelica dahurica (Fisch.ex Hoffm.) Benth.et Hook.f. radix 1: From the Chinese Pharmacopoeia (2020 editon) 2.2.3 Cell viability assay HUVECs were seeded into 96-well plates at 6×10 3 /well. Briefly, after intervention, each well was replaced with 100 μ l medium containing 10% CCK-8 reagent (E606335, Sangon, China), and subsequently incubated for 1h. The absorbance at 450nm was measured by a microplate reader. Cell viability = ( A experiment - A blank )/( A control - A blank )×100%. 2.2.4 Biochemical analysis HUVECs were seeded into 6-well plates at 2×10 5 /well. After intervention, cellular samples were harvested and analyzed using malondialdehyde (MDA) Content Assay Kit (D799762, Sangon, China), protein carbonylation (PCO) Content Assay Kit (D799768, Sangon, China), glutathione peroxidase (GPX) Activity Assay Kit, glutathione (GSH) Content Assay Kit (D799614, Sangon, China), Ferrous Iron Assay Kit (E-BC-K881-M, Elabscience, China) and BCA Protein Assay Kit. The results were measured using a microplate reader and quantified by protein concentration. 2.2.5 Detection of ATP content HUVECs were seeded into 6-well plates, then harvested after intervention. According to the instructions of ATP Assay Kit (S0026, Beyotime, China) and BCA Protein Assay Kit, the results were measured using a Luminometer (GloMax 20/20, Promega, USA) and a microplate reader, respectively. The results were quantified by protein concentration. 2.2.6 Intracellular reactive oxygen species (ROS) assay The fluorescent probe 2',7'-Dichlorofluorescein diacetate (DCFH-DA, 35845, Sigma, USA) was employed to quantify the levels of intracellular ROS. After cellular entry, the deacetylated derivative of DCFH-DA can be oxidized to a fluorescent product exhibiting green emission. Strictly following the instructions, briefly, HUVECs were incubated with 10 μ M DCFH-DA at 37℃ for 30min. After wash by PBS, the fluorescence images were photographed using fluorescence inverted microscope (Axio Observer D1, ZEISS, Germany) at FITC channel. 2.2.7 LPO assay LPO was investigated by BODIPY™ 581/591 C11 (D3861, Thermo, USA), which converts red fluorescence to green fluorescence upon oxidation. Following the protocol described by Martinez et al . [17] , HUVECs were incubated with 2.5 μ M BODIPY™ 581/591 C11 at 37°C for 30min. After wash by PBS, the fluorescence images were photographed using fluorescence inverted microscope at FITC and Rhodamine channel. 2.2.8 Mitochondrial membrane potential (MMP) assay MMP was investigated by JC-1 (C2006, Beyotime, China), which converts red fluorescence to green fluorescence upon MMP decreases. Briefly, HUVECs were incubated with 10 μ g/ml JC-1 at 37°C for 30min. After washed by buffer, the fluorescence images were photographed using fluorescence inverted microscope at FITC and Rhodamine channel. 2.2.9 Quantitative PCR HUVECs were seeded into 6-well plates, then harvested after intervention. Total RNA was extracted by TRIzol (9109, Takara, Japan) and quantified by spectrophotometer (Quickdrop, Molecular Devices, USA). Subsequently, cDNA was synthesized by reverse transcription kit (RR036, Takara, Japan). The qPCR assay was performed with qPCR kit (RR820, Takara, Japan) on Real-Time PCR system (7500, ABI, USA) with 95°C for 30 s, 1 cycle; 95°C for 5s, 60° C for 34 s, 40 cycles. β-Actin served as reference, and the relative expression levels were calculated using the 2 - △△ Ct method. The primer sequences were listed in Table 2. Table 2 qPCR primer sequences Gene Forward sequence (5’- 3’) Reverse sequence (5’- 3’) Nrf2 AGTGTGGCATCACCAGAACA TGTTTGACACTTCCAGGGGC SLC7A11 CATCTCTCCTAAGGGCGTGC TAGTGACAGGACCCCACACA GPX4 CAGTGAGGCAAGACCGAAGT CCGAACTGGTTACACGGGAA β-Actin CCTGGCACCCAGCACAAT GGGCCGGACTCGTCATAC Nrf2 : nuclear factor erythroid 2-related factor 2; SLC7A11 : solute carrier family 7 member 11; GPX4 : glutathione peroxidase 4; β-Actin : actin beta. 2.2.10 Western blotting HUVECs were seeded into 6-well plates, then harvested after intervention. Total protein was extracted by RIPA lysis (C500005, Sangon, China) supplemented with protease inhibitor (C600380, Sangon, China) and quantified by BCA Protein Assay Kit. Subsequently, 20 μ g total protein was loaded onto a 10% SDS-PAGE gel and transferred to a PVDF membrane (F619534, Sangon, China). After blocking, the membrane was incubated with anti-Nrf2 (ab92946, abcam, UK), anti-xCT (ab175186, abcam, UK), anti-GPX4 (ab125066, abcam, UK), and anti-GAPDH (ab181602, abcam, UK) primary antibodies for 4°C overnight, and with goat anti-rabbit (ab6721, abcam, UK) secondary antibody for RT 1h. Finally, ECL luminescence reagent (C500044, Sangon, China) was used for visualization on a chemiluminescent imaging system (5200 multi, Tanon,China). 2.3 Statistical analysis Statistical analysis was performed on SPSS software (version 23.0, USA). The results were presented as mean ± SD or median (upper quartile, lower quartile) depending on the situation. Statistical comparisons were performed by one-way ANOVA or Friedman M test, P <0.05 was considered statistically significant. 3 Results 3.1 Clinical study 3.1.1 General data of clinical cases This study enrolled 10 patients (4 males and 6 females) with ULV, aged 61.7±8.1 years. Normal skin, HPT, LDS, and VLU samples were successfully collected from each patient without any adverse events occurring during surgery. All patients achieved favorable therapeutic outcomes following standardized treatment. 3.1.2 The progression of CVD accompanied with accumulation of iron and suppression of GPX The Prussian blue staining are shown in Figure 2A obtained from a typical patient. The results indicate that as CVD progresses, iron deposition in affected tissue gradually increased. However, there was an abrupt decline in iron accumulation, upon reaching VLU stage. The quantitative results of total iron content were shown in Figure 2C, which was consistent with the Prussian blue staining results. A significantly elevated levels were observed in the HPT area compared to the normal area ( P 0.05). Furthermore, a notable reduction was exhibited in the VLU area compared to LDS area ( P <0.01). Figure 2B showed the IHC result of GPX4 from a typical patient. As CVD progresses to the HPT stage, the expression of GPX4 was up-regulated. However, with further deterioration of CVD, the expression of GPX4 was gradually suppressed. The quantitative results of GPX activity were depicted in Figure 2D, demonstrating consistency with the IHC results. The GPX activity significantly increased in HPT area compared to normal area ( P <0.05). However, when CVD progressing to LDS, the GPX activity decreased significantly compared to HPT area ( P <0.01). As CVD reached VLU stage, a further decline in GPX activity was observed ( P <0.05). 3.2 Cellular experiments 3.2.1 HXSJ Decoction promoted the proliferation of HUVECs In this study, we employed different concentrations of HXSJ Decoction (0 μ g/ml-500 μ g/ml) on HUVECs for 24h, in order to investigate the impact of HXSJ Decoction on the proliferation of HUVECs. The results of the CCK8 assay (Figure 3A) demonstrated that HUVECs viability was most significantly increased at 10 μ g/ml HXSJ Decoction ( P <0.01). Subsequently, with the increasing of concentration, the cell viability gradually decreased in a concentration-dependent manner. Therefore, the concentration of 10 μ g/ml was selected for further experiments in this study. 3.2.2 HXSJ Decoction alleviates iron overload-induced damage in HUVECs We employed 100 μ M FAC and 100 μ M Hemin to establish an iron overload model. As shown in Figure 3B, HXSJ Decoction significantly restored the cell viability, which was inhibited by FAC or Hemin ( P <0.01). Additionally, MDA and PCO were measured as characteristic products of LPO. The results (Figure 3C, D) showed a significant increase in MDA and PCO contents induced by FAC and Hemin ( P <0.05), indicating that both FAC and Hemin lead to LPO damage. However, HXSJ Decoction could significantly reduce MDA and PCO contents ( P <0.01), mitigating LPO damage in HUVECs. Furthermore, these results were further supported by the evidence of DCFH-DA and BODIPY™ 581/591 C11 staining (Figure 3G, H). Mitochondrial dysfunction also as a pivotal characteristic of LPO, was evaluated by ATP content and MMP. Both FAC and Hemin significantly suppressed ATP production in HUVECs ( P <0.01), and effectively reversed by HXSJ Decoction ( P <0.01) (Figure 3E). The MMP of HUVECs were measured by JC-1 staining (Figure 3I), images illustrated the repression of MMP in HUVECs induced by FAC and Hemin, while HXSJ Decoction exhibited restorative effects on MMP. In iron overload model, the excessive Fe 2+ was crucial for LPO damage. Here, quantified Fe 2+ content in HUVECs (Figure 3F), the results demonstrated a significant increase in Fe 2+ content for FAC and Hemin ( P <0.01), and HXSJ Decoction could partially mitigated the accumulation of ferrous ion ( P <0.01). The above results indicate that HXSJ Decoction could effectively mitigates mitochondrial dysfunction in iron overload HUVECs induced by FAC and Hemin. 3.2.3 HXSJ Decoction mitigated LPO damage induced by iron overload through activating Nrf2/system Xc - /GPX4 pathway in HUVECs The Nrf2/system Xc - /GPX4 pathway plays a pivotal role in LPO defensing. In clinical practice, we have mentioned a significant decline in GPX expression during the deterioration of CVD, particularly in the LDS and VLU stages (Figure 2B, D). The GPX activity (Figure 4A) and the expression of GPX4 (Figure 4E, F) were also inhibited in the iron overload HUVECs induced by FAC and Hemin ( P <0.01). Additionally, we investigated other pivotal factors of Nrf2/system Xc - /GPX4 pathway. As expected, iron overload suppressed the expression of Nrf2 (Figure 4C, F) and xCT (Figure 4D, F), depleted GSH (Figure 4B), but did not significantly downregulate Nrf2 expression at the mRNA level ( P >0.05). Upon addition of HXSJ Decoction to the iron overload system, there was a significant increasing of GPX activity, restoration of GSH, and activation of Nrf2, xCT, and GPX4 expression ( P <0.01). 3.2.4 HXSJ Decoction mitigates ferroptosis induced by Erastin in HUVECs The above study suggests that HXSJ Decoction might mitigate LPO damage via activiting Nrf2/system Xc - /GPX4 pathway. To further confirm this effect on ferroptosis, 10 μ M Erastin was employed to induce ferroptosis in HUVECs. As shown in Figure 5A, HXSJ Decoction significantly restored the inhibition of Erastin on HUVECs viability ( P <0.01). To confirm the alleviation of HXSJ Decoction on Erastin-induced ferroptosis, MDA and PCO were quantified as shown in Figure 5B, C. HXSJ Decoction significantly reduces the content of MDA and PCO induced by Erastin in HUVECs ( P <0.01). And this evidence was validated by the DCFH-DA and BODIPY™ 581/591 C11 staining (Figure 5F, G). Furthermore, HXSJ Decoction has been demonstrated to restores mitochondrial damage effectively induced by Erastin. The depletion of ATP (Figure 5D) and the suppression of MMP (Figure 5H) induced by Erastin were significantly improved by HXSJ Decoction ( P <0.01). Erastin is commonly recognized as a system Xc - inhibitor to induce ferroptosis. However, our study revealed that Erastin also significantly accumulate Fe 2+ in HIVECs ( P <0.01), as shown in Figure 5E. And HXSJ Decoction could partially reduce the accumulation of Fe 2+ ( P <0.05). The above findings suggest that HXSJ Decoction exhibits potential in mitigating ferroptosis induced by Erastin. 3.2.5 HXSJ Decoction mitigated ferroptosis induced by Erastin through activating Nrf2/system Xc - /GPX4 pathway in HUVECs As previously mentioned, HXSJ Decoction mitigates LPO damage induced by iron overload through activating the Nrf2/system Xc - /GPX4 pathway, which was also observed in Erastin-induced ferroptosis of HUVECs. As shown in Figure 6A, B,HXSJ Decoction could significantly restore the inhibition of GPX activity and the depletion of GSH ( P <0.01). Further analysis of Nrf2/system Xc -/ GPX4 pathway (Figure 6C-F) revealed that Erastin significantly inhibited GPX4 expression ( P <0.01), while concurrently upregulating Nrf2 expression ( P <0.01). This phenomenon may be attributed to the negative feedback effect of GPX4 inhibition on upstream Nrf2 signaling pathway. Erastin is commonly recognized as an inhibitor of system Xc - , although this effect was not evident at the protein expression, but significantly upregulated the mRNA expression of SLC7A11 ( P <0.01). We hypothesized that this observation may be attributed to the dynamic equilibrium between transcription and translation of xCT. And HXSJ Decoction could significantly up-regulate the expression of Nrf2, xCT, and GPX4 ( P <0.01). Therefore, we proposed that HXSJ Decoction activate Nrf2/system Xc - /GPX4 pathway to mitigated ferroptosis. 4 Discussion Venous hypertension (VH) as the main pathogenesis of VLU, which caused by venous reflux, occlusion, weakness, and leg muscle pump incompetence. Currently, there is more comprehension of the etiology, pathology, and hemodynamic alterations in VLU, but the precise mechanisms are still controversial. Undoubtedly, vascular damage plays a pivotal role in ulcers development and chronicity [ 5 , 6 ] . The current research indicates that during the HPT and LDS stage, iron deposition occurs in the affected skin area [ 7 , 17 , 18 ] . Specifically, iron deposition block the exchange of substances between capillaries and tissues, leading to cellular hypoxia and metabolic disruption, which is a significant etiological determinant in the pathogenesis of ulcer formation [ 19 ] . Simultaneously, iron deposition also accelerates ulcer formation by mediating the release of inflammatory factors [ 20 , 21 ] . Ferroptosis was initially proposed by Dixon in 2012 as a programmed cell death that relies on iron and oxidation [ 8 ] . Different from the others, in morphology, ferroptosis is characterized by mitochondrial shrinkage, membrane density increasing and cristae disappearance; in biochemistry, ferroptosis primarily involves iron overload, LPO, Fenton reaction and cysteine depletion [ 22 ] . The iron overload is a pivotal factor in the generation of LPO. In normal, ferric and ferrous ions are in a physiological equilibrium, once this balance is disrupted, Fe 2+ stored in mitochondria, endoplasmic reticulum, and ferritin will be released into the cytoplasm, forming labile iron pool and triggering LPO production through Fenton reaction to induce ferroptosis [ 23 ] . The cystine/glutamate exchange system (System Xc − ), transports cystine into cells and releases glutamate into the extracellular space as 1:1. System Xc − consists of two protein components, the 4F2 heavy chain for membrane location and the xCT (SLC7A11) for transport activity. The intracellular cystine is synthesized into GSH by a series of enzymatic reactions and serves as the substrate for GPX4 [ 24 ] . GPX4 catalyzes the conversion of GSH to GSSG, thereby facilitating the metabolism of cytotoxic lipid peroxides (L-OOH) into non-cytotoxic liposomes (L-OH) [ 25 ] . Nrf2 as a main regulator of cellular antioxidant, which can not only regulate the system Xc − /GPX4 pathway, but also play a pivotal role in iron metabolism [ 26 ] . Therefore, depletion of GSH, inactivation of GPX4 and accumulation of iron may contribute to ferroptosis. In this study, our results indicated a progressive accumulation of iron during deterioration CVD, which was similar to others’ reports. Interestingly, as CVD progresses to the VLU stage, there is a rapid decrease in iron content, we suspected that may be attributed to the discharge of iron through ulcer exudate. And Yeoh-Ellerton et al . [ 27 ] also reported a elevated levels of ferritin in exudate from CSU. Our further research revealed that during the progression of HPT-LDS-VLU, there was an upregulation in GPX4, followed by a rapid decline. We postulate that iron deposition occurs after CVD, leading to oxidative damage. In this stage, the up-regulation of GPX4 maintains a delicate equilibrium between oxidation and antioxidation, ultimately manifesting as HPT. Once this delicate equilibrium is disrupted by factors such as trauma and infection, the maintenance of high GPX4 expression becomes compromised, resulting in ferroptosis, subsequently deteriorating to LDS and VLU. Ulcers usually occurred in severe HPT areas, and ulceration is more prone to occur once HPT progresses into LDS. This situation also reflects our speculation indirectly. Iron overload and ferroptosis are the triggers for HPT progress to VLU[9,10], and are the persistent barriers to ulcers healing [ 28 ] . Meanwhile, angiogenesis plays a crucial role in the ulcer healing [ 29 ] Therefore, mitigation of ferroptosis in VECs may be a potential strategy to promote VLU healing. In this study, we employed HUVECs, and utilized 100 µ M FAC and 100 µ M Hemin to establish iron overload models for simulation of simple iron overload and hemoglobin exudation respectively. The results revealed that HUVECs exhibited ferroptosis, characterized by inactivation of GPX4, depletion of GSH and accumulation of ferrous ion. Simultaneously, the external Chinese herbal compound HXSJ Decoction seemed to protect HUVECs from LPO damage induced by iron overload through activating Nrf2/system Xc − /GPX4 pathway. Furthermore, the ferroptosis inducer Erastin was experimented, and HXSJ Decoction still exhibited an activation on Nrf2/system Xc − /GPX4 pathway, mitigate ferroptosis concurrently. Therefore, we confirmed that HXSJ Decoction could mitigate ferroptosis of VEC and contribute to VLU healing. HXSJ Decoction is made of a variety of Chinese herbal medicines. In a previous clinical study conducted by our group, negative pressure wound therapy with instillation using HXSJ Decoction has achieved a satisfactory efficacy in the treatment of CSU, which could effectively accelerate microangiogenesis in granulation tissue and facilitate wound healing [ 14 ] . The alcohol-soluble components saponins and flavonoids found in Astragali Radix , Salviae Miltiorrhizae Radix et Rhizoma , Carthami Flos , and Glycyrrhizae Radix et Rhizoma within the HXSJ Decoction, exhibit anti-ferroptotic effects base on Nrf2/system Xc − /GPX4 pathway, such as Astragaloside [ 30 , 31 ] , Salvianolic acid [ 32 ] , Tanshinone [ 33 ] , Carthamin yellow [ 34 ] and Liquiritin [ 35 ] . 5 Conclusions In conclusion, this study suggests that ferroptosis, mediated by the accumulation of iron and the inactivation of GPX4, is a significant contributing factor in the process of VLU. Furthermore, employing HUVEC as an in vitro model, this study investigates the mechanism in the ferroptosis mitigation of HXSJ Decoction through activation of Nrf2/system Xc − /GPX4 pathway. Overall, this study present a potential novel approach for VLU treatment and strengthen the theoretical foundation for utilizing HXSJ Decoction in VLU therapy. Abbreviations VLU venous leg ulcer CVD chronic venous diseases GPX glutathione peroxidase HUVECs human umbilical vein endothelial cells FAC ferric ammonium citrate HXSJ Decoction Huoxue Shengji Decoction DCFH-DA 2',7'-Dichlorofluorescein diacetate ATP adenosine triphosphate MMP mitochondrial membrane potential Mrf2 nuclear factor erythroid 2-related factor system Xc − cystine/glutamate exchange system GSH glutathione qPCR quantitative polymerase chain reaction VECs vascular endothelial cells HPT hyperpigmentation LDS lipodermatosclerosis LPO lipid peroxidation CSU chronic skin ulcers MDA malondialdehyde PCO protein carbonylation ROS reactive oxygen species SLC7A11 solute carrier family 7 member 11 VH venous hypertension L-OOH lipid peroxides L-OH liposomes Declarations Ethics approval and consent to participate This study was conducted in accordance with the Declaration of Helsinki and approved by the Ethics Committee of Jiaxing Traditional Chinese Medicine Hospital (REC reference number: 2019KY0454). Informed consent forms were signed by each patient included in the study. Consent for publication Not applicable Availability of data and materials The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request. Competing interests The authors declare that they have no competing interests. Funding This research was funded by Zhejiang Public Welfare Technology Applied Research Projects (LGF21H270009, Sunfeng Pan), Basic Public Welfare Research Projects of Zhejiang Province (LTGC23H150001, Lie Xiong), Zhejiang Medical and Health Science Technology Projects (2023KY1227, Yanbo Shi), Zhejiang Traditional Chinese Medicine Science Technology Projects (2024ZR034, Zhaoyan Liu), and Multidisciplinary Innovation Team for Comprehensive Prevention and Treatment of Wound Diseases with Integrated Chinese and Western Medicine (2024, Sunfeng Pan). The science and technology program of Jiaxing City Science and Technology Bureau (2023AY40026, Yujuan Su), Key Project of National Administration of Traditional Chinese Medicine (2023JSGJ002, Sunfeng Pan). Authors' contributions Sunfeng Pan and Yanbo Shi contributed to conception and design of the study. Lie Xiong conducted most of the experiments and data analysis and wrote the manuscript draft. Sunfeng Pan, Zhenjun Wang, Yujuan Su, Gaofeng Fang, Minda Zhu, Jiakun Li, Jiayan Li and Zhaoyan Liu collected clinical samples. Sunfeng Pan and Hanqiang Shi participated in collecting data and the manuscript drafting. Sunfeng Pan, Chunmao Han and Yanbo Shi participated in the discussion and edited/revised the manuscript. All authors read and approved the final manuscript. Acknowledgements The authors thank the pathology department and related nursing staff that assisted us in the course of clinical research. References O'Donnell TF Jr, Passman MA, Marston WA, Ennis WJ, Dalsing M, Kistner RL, et al. Society for Vascular Surgery; American Venous Forum. Management of venous leg ulcers: clinical practice guidelines of the Society for Vascular Surgery ® and the American Venous Forum. J Vasc Surg. 2014;60(2 Suppl):3S-59S. Kolluri R, Lugli M, Villalba L, Varcoe R, Maleti O, Gallardo F, et al. An estimate of the economic burden of venous leg ulcers associated with deep venous disease. Vasc Med. 2022;27(1):63-72. Finlayson KJ, Parker CN, Miller C, Gibb M, Kapp S, Ogrin R, et al. Predicting the likelihood of venous leg ulcer recurrence: The diagnostic accuracy of a newly developed risk assessment tool. Int Wound J. 2018;15(5):686-694. Liu Y, Yang X, Liu Y, Jiang T, Ren S, Chen J, et al. NRF2 signalling pathway: New insights and progress in the field of wound healing. J Cell Mol Med. 2021;25(13):5857–5868. Ackermann M, Pabst AM, Houdek JP, Ziebart T, Konerding MA. Priming with proangiogenic growth factors and endothelial progenitor cells improves revascularization in linear diabetic wounds. Int J Mol Med. 2014;33(4):833-839. Pastar I, Balukoff NC, Marjanovic J, Chen VY, Stone RC, Tomic-Canic M. Molecular Pathophysiology of Chronic Wounds: Current State and Future Directions. Cold Spring Harb Perspect Biol. 2023;15(4):a041243. Caggiati A, Rosi C, Casini A, Cirenza M, Petrozza V, Acconcia MC, et al. Skin iron deposition characterises lipodermatosclerosis and leg ulcer. Eur J Vasc Endovasc Surg. 2010;40(6):777-782. Dixon SJ, Lemberg KM, Lamprecht MR, Skouta R, Zaitsev EM, Gleason CE, et al. Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell. 2012;149(5):1060-1072. Wright JA, Richards T, Srai SK. The role of iron in the skin and cutaneous wound healing. Front Pharmacol. 2014;5:156. Raffetto JD, Ligi D, Maniscalco R, Khalil RA, Mannello F. Why Venous Leg Ulcers Have Difficulty Healing: Overview on Pathophysiology, Clinical Consequences, and Treatment. J Clin Med. 2020;10(1):29. Bi M, Li D, Zhang J. Research progress and insights on the role of ferroptosis in wound healing. Int Wound J. 2023;20(6):2473-2481. Yuan W, Xia H, Xu Y, Xu C, Chen N, Shao C, et al. The role of ferroptosis in endothelial cell dysfunction. Cell Cycle. 2022;21(18):1897-1914. Liu M, Kong XY, Yao Y, Wang XA, Yang W, Wu H, et al. The critical role and molecular mechanisms of ferroptosis in antioxidant systems: a narrative review. Ann Transl Med. 2022;10(6):368. Pan S, Xiong L, Wang Z, Su Y, Fang G, Zhu M, et al. Therapeutic Effect and Mechanism of Negative Pressure Wound Therapy with Huoxue Shengji Decoction Instillation for Chronic Skin Ulcers. Evid Based Complement Alternat Med. 2022;2022:5183809. Lurie F, Passman M, Meisner M, Dalsing M, Masuda E, Welch H, et al. The 2020 update of the CEAP classification system and reporting standards. J Vasc Surg Venous Lymphat Disord. 2020;8(3):342-352. Martinez AM, Kim A, Yang WS. Detection of Ferroptosis by BODIPY™ 581/591 C11. Methods Mol Biol. 2020;2108:125-130. Zamboni P, Izzo M, Tognazzo S, Carandina S, De Palma M, Catozzi L,et al. The overlapping of local iron overload and HFE mutation in venous leg ulcer pathogenesis. Free Radic Biol Med. 2006;40(10):1869-1873. Ferris AE, Harding KG. An overview of the relationship between anaemia, iron, and venous leg ulcers. Int Wound J. 2019;16(6):1323-1329. Caggiati A, Franceschini M, Heyn R, Rosi C. Skin erythrodiapedesis during chronic venous disorders. J Vasc Surg. 2011;53(6):1649-1653. Crawford JM, Lal BK, Durán WN, Pappas PJ. Pathophysiology of venous ulceration. J Vasc Surg Venous Lymphat Disord. 2017;5(4):596-605. Sindrilaru A, Peters T, Wieschalka S, Baican C, Baican A, Peter H, et al. An unrestrained proinflammatory M1 macrophage population induced by iron impairs wound healing in humans and mice. J Clin Invest. 2011;121(3):985-997. Li J, Cao F, Yin HL, Huang ZJ, Lin ZT, Mao N, et al. Ferroptosis: past, present and future. Cell Death Dis. 2020;11(2):88. Latunde-Dada GO. Ferroptosis: Role of lipid peroxidation, iron and ferritinophagy. Biochim Biophys Acta Gen Subj. 2017;1861(8):1893-1900. Conrad M, Sato H. The oxidative stress-inducible cystine/glutamate antiporter, system x (c) (-) : cystine supplier and beyond. Amino Acids. 2012;42(1):231-246. Yang WS, SriRamaratnam R, Welsch ME, Shimada K, Skouta R, Viswanathan VS, Cheah JH, et al. Regulation of ferroptotic cancer cell death by GPX4. Cell. 2014;156(1-2):317-331. Dodson M, Castro-Portuguez R, Zhang DD. NRF2 plays a critical role in mitigating lipid peroxidation and ferroptosis. Redox Biol. 2019;23:101107. Yeoh-Ellerton S, Stacey MC. Iron and 8-isoprostane levels in acute and chronic wounds. J Invest Dermatol. 2003;121(4):918-925. Feng J, Wang J, Wang Y, Huang X, Shao T, Deng X, et al. Oxidative Stress and Lipid Peroxidation: Prospective Associations Between Ferroptosis and Delayed Wound Healing in Diabetic Ulcers. Front Cell Dev Biol. 2022;10:898657. Veith AP, Henderson K, Spencer A, Sligar AD, Baker AB. Therapeutic strategies for enhancing angiogenesis in wound healing. Adv Drug Deliv Rev. 2019;146:97-125. Sheng S, Xu J, Liang Q, Hong L, Zhang L. Astragaloside IV Inhibits Bleomycin-Induced Ferroptosis in Human Umbilical Vein Endothelial Cells by Mediating LPC. Oxid Med Cell Longev. 2021;2021:6241242. Luo LF, Guan P, Qin LY, Wang JX, Wang N, Ji ES. Astragaloside IV inhibits adriamycin-induced cardiac ferroptosis by enhancing Nrf2 signaling. Mol Cell Biochem. 2021;476(7):2603-2611. Shen Y, Shen X, Wang S, Zhang Y, Wang Y, Ding Y, et al. Protective effects of Salvianolic acid B on rat ferroptosis in myocardial infarction through upregulating the Nrf2 signaling pathway. Int Immunopharmacol. 2022;112:109257. Wu C, Duan F, Yang R, Dai Y, Chen X, Li S. 15, 16-Dihydrotanshinone I protects against ischemic stroke by inhibiting ferroptosis via the activation of nuclear factor erythroid 2-related factor 2. Phytomedicine. 2023;114:154790. Guo H, Zhu L, Tang P, Chen D, Li Y, Li J, et al. Carthamin yellow improves cerebral ischemia‑reperfusion injury by attenuating inflammation and ferroptosis in rats. Int J Mol Med. 2021;47(4):52. Tan H, Chen J, Li Y, Li Y, Zhong Y, Li G, et al. Glabridin, a bioactive component of licorice, ameliorates diabetic nephropathy by regulating ferroptosis and the VEGF/Akt/ERK pathways. Mol Med. 2022;28(1):58. Additional Declarations No competing interests reported. Supplementary Files SupplementarymaterialforWesternblots.pdf GraphicalAbstract.png Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 10 Jan, 2025 Reviewers invited by journal 06 Sep, 2024 Editor assigned by journal 03 Sep, 2024 Editor invited by journal 17 Apr, 2024 Submission checks completed at journal 17 Apr, 2024 First submitted to journal 08 Apr, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4239207","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":293418943,"identity":"4e6f4aea-c968-4a6d-a16a-dbd165b53ba2","order_by":0,"name":"Sunfeng Pan","email":"","orcid":"","institution":"Zhejiang University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Sunfeng","middleName":"","lastName":"Pan","suffix":""},{"id":293418945,"identity":"40417138-042e-432d-8472-59fef1de73ab","order_by":1,"name":"Lie Xiong","email":"","orcid":"","institution":"Zhejiang Chinese Medical University Affiliated Jiaxing Traditional Chinese Medicine Hospital","correspondingAuthor":false,"prefix":"","firstName":"Lie","middleName":"","lastName":"Xiong","suffix":""},{"id":293418946,"identity":"b91a89e9-75dd-4b9e-8013-20bac5c28f44","order_by":2,"name":"Jiakun Li","email":"","orcid":"","institution":"Zhejiang Chinese Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jiakun","middleName":"","lastName":"Li","suffix":""},{"id":293418947,"identity":"f74fe842-812e-4bd8-9b77-2ce4fb07c549","order_by":3,"name":"Zhenjun Wang","email":"","orcid":"","institution":"Zhejiang Chinese Medical University Affiliated Jiaxing Traditional Chinese Medicine Hospital","correspondingAuthor":false,"prefix":"","firstName":"Zhenjun","middleName":"","lastName":"Wang","suffix":""},{"id":293418948,"identity":"4599720c-8c90-4eb9-b41b-3123b96cc1da","order_by":4,"name":"Yujuan Su","email":"","orcid":"","institution":"Zhejiang Chinese Medical University Affiliated Jiaxing Traditional Chinese Medicine Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yujuan","middleName":"","lastName":"Su","suffix":""},{"id":293418949,"identity":"3a85a5e6-b532-4128-8b27-cd39bd9e3c5d","order_by":5,"name":"Gaofeng Fang","email":"","orcid":"","institution":"Zhejiang Chinese Medical University Affiliated Jiaxing Traditional Chinese Medicine Hospital","correspondingAuthor":false,"prefix":"","firstName":"Gaofeng","middleName":"","lastName":"Fang","suffix":""},{"id":293418950,"identity":"55d60f2a-db0a-42dc-9fb0-624d0b0b0961","order_by":6,"name":"Minda Zhu","email":"","orcid":"","institution":"Zhejiang Chinese Medical University Affiliated Jiaxing Traditional Chinese Medicine Hospital","correspondingAuthor":false,"prefix":"","firstName":"Minda","middleName":"","lastName":"Zhu","suffix":""},{"id":293418951,"identity":"bf6af8bb-99f4-4266-8ae6-379aa1585a56","order_by":7,"name":"Hanqiang Shi","email":"","orcid":"","institution":"Zhejiang Chinese Medical University Affiliated Jiaxing Traditional Chinese Medicine Hospital","correspondingAuthor":false,"prefix":"","firstName":"Hanqiang","middleName":"","lastName":"Shi","suffix":""},{"id":293418952,"identity":"aaf1dd23-74af-44ff-bf08-1c55d0ce5ac1","order_by":8,"name":"Jiayan Li","email":"","orcid":"","institution":"Zhejiang Chinese Medical University Affiliated Jiaxing Traditional Chinese Medicine Hospital","correspondingAuthor":false,"prefix":"","firstName":"Jiayan","middleName":"","lastName":"Li","suffix":""},{"id":293418953,"identity":"54d652d6-ea5f-4371-ad44-1d5868aed6e9","order_by":9,"name":"Zhaoyan Liu","email":"","orcid":"","institution":"Zhejiang Chinese Medical University Affiliated Jiaxing Traditional Chinese Medicine Hospital","correspondingAuthor":false,"prefix":"","firstName":"Zhaoyan","middleName":"","lastName":"Liu","suffix":""},{"id":293418954,"identity":"740275de-1c9d-471d-aa75-6735c008d08b","order_by":10,"name":"Chunmao Han","email":"","orcid":"","institution":"the Second Affiliated Hospital of Zhejiang University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"Chunmao","middleName":"","lastName":"Han","suffix":""},{"id":293418955,"identity":"b0ba1a6a-ee47-4742-bb9e-4c1043573416","order_by":11,"name":"Yanbo Shi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3ElEQVRIiWNgGAWjYDACCcYGIHkAxGR8kFBRQ5oWZoMHZ44RowVMgrWwST5sYSasQ352c5vEzx135Pjbjz+rSGxgY+Bv707Aq8XgzsE2yd4zz4wlzuSY3UjcIcMgcebsBvxaJBLbJHjbDiduYMhhu5F4hg0okotfi/yMxDbJvyAt/M+fFSS2MRPWwnAjsU0abItEghkDUVoMbiQ2W8u2Af1y442xRMKZYzwE/SI/I/3hzbdtwBDrT3/48UdFDTDoegk4jIGBRQKZx0NIOQgwfyBG1SgYBaNgFIxgAAAnXk5bKxs3KwAAAABJRU5ErkJggg==","orcid":"","institution":"Zhejiang Chinese Medical University Affiliated Jiaxing Traditional Chinese Medicine Hospital","correspondingAuthor":true,"prefix":"","firstName":"Yanbo","middleName":"","lastName":"Shi","suffix":""}],"badges":[],"createdAt":"2024-04-09 02:29:27","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4239207/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4239207/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":55323384,"identity":"5ee954d0-83fa-49bb-83a8-bef74f75ab74","added_by":"auto","created_at":"2024-04-25 16:43:03","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":304412,"visible":true,"origin":"","legend":"\u003cp\u003eschematic diagram of VLU\u003c/p\u003e\n\u003cp\u003eA: the LDS area around ulcer; B: the HPT area close to ankle.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4239207/v1/7efcec23ab17f4bad7fc8ace.png"},{"id":55322331,"identity":"ecf6e4f6-1a4d-46fd-8cd6-739e8d37bfec","added_by":"auto","created_at":"2024-04-25 16:27:03","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":599060,"visible":true,"origin":"","legend":"\u003cp\u003eIron accumulation and GPX suppression in distinct pathological regions of VLU patients\u003c/p\u003e\n\u003cp\u003ePrussian blue staining (A) and GPX4 IHC (B) in distinct pathological regions of VLU patients, scale bar: 200\u003cem\u003eμ\u003c/em\u003em. Total iron (C) and GPX activity (D) in distinct pathological regions of VLU patients. **: \u003cem\u003eP\u003c/em\u003e\u0026lt;0.01; *: \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05; n.s.: no significance.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4239207/v1/509773b2e41364137f5b85da.png"},{"id":55322336,"identity":"14c7f00b-7e47-41a9-9540-39764f4152c6","added_by":"auto","created_at":"2024-04-25 16:27:03","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":424144,"visible":true,"origin":"","legend":"\u003cp\u003eHXSJ Decoction mitigated LPO damage and mitochondrial injury induced by iron overload in HUVECs\u003c/p\u003e\n\u003cp\u003e(A) Effects of HXSJ Decoction on cell viability in HUVECs. Cell viability (B), MDA content (C), PCO content (D), ATP content (E), and Fe\u003csup\u003e2+\u003c/sup\u003e content (F) in iron overload HUVECs. Fluorescence images of DCFH-DA staining (G), BODIPY 581/591 C11 staining (H), and JC-1 staining (I) in HUVECs, scale bar: 100\u003cem\u003eμ\u003c/em\u003em. **: \u003cem\u003eP\u003c/em\u003e\u0026lt;0.01; *: \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05; n.s.: no significance.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4239207/v1/6f0785f4bb63a5354ba57011.png"},{"id":55322338,"identity":"6bc8c602-283d-41be-bc05-680b77297548","added_by":"auto","created_at":"2024-04-25 16:27:03","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":131066,"visible":true,"origin":"","legend":"\u003cp\u003eHXSJ Decoction mitigated LPO damage through activating Nrf2/system Xc\u003csup\u003e-\u003c/sup\u003e/GPX4 pathway in iron overload HUVECs\u003c/p\u003e\n\u003cp\u003eGPX activity (A), and GSH content (B) in iron overload HUVECs. Relative mRNA expression of Nrf2 (C), SLC7A11 (D), and GPX4 (E) in iron overload HUVECs. (F) Western blots of Nrf2, xCT, and GPX4 in iron overload HUVECs. **: \u003cem\u003eP\u003c/em\u003e\u0026lt;0.01; *: \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05; n.s.: no significance.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4239207/v1/d3639d605a192a5104aecbb1.png"},{"id":55322337,"identity":"ec80dbe7-7809-4077-b5aa-dbdd38e24e46","added_by":"auto","created_at":"2024-04-25 16:27:03","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":330705,"visible":true,"origin":"","legend":"\u003cp\u003eHXSJ Decoction alleviated ferroptosis induced by Erastin in HUVECs\u003c/p\u003e\n\u003cp\u003eCell viability (A), MDA content (B), PCO content (C), ATP content (D), and Fe\u003csup\u003e2+\u003c/sup\u003e content (E) in Erastin induced HUVECs. Fluorescence images of DCFH-DA staining (F), BODIPY 581/591 C11 staining (G), and JC-1 staining (H) in HUVECs, scale bar: 100\u003cem\u003eμ\u003c/em\u003em. **: \u003cem\u003eP\u003c/em\u003e\u0026lt;0.01; *: \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05; n.s.: no significance.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-4239207/v1/84fb2bc39ebd0d10b2ac3ea1.png"},{"id":55322339,"identity":"6ff166fa-6721-4dee-bad8-2ccc2b372f27","added_by":"auto","created_at":"2024-04-25 16:27:03","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":94888,"visible":true,"origin":"","legend":"\u003cp\u003eHXSJ Decoction alleviated ferroptosis induced by Erastin through activating Nrf2/system Xc\u003csup\u003e-\u003c/sup\u003e/GPX4 pathway in HUVECs\u003c/p\u003e\n\u003cp\u003eGPX activity (A), and GSH content (B) in Erastin induced HUVECs. Relative mRNA expression of Nrf2 (C), SLC7A11 (D), and GPX4 (E) in Erastin induced HUVECs. (F) Western blots of Nrf2, xCT, and GPX4 in Erastin induced HUVECs. **: \u003cem\u003eP\u003c/em\u003e\u0026lt;0.01; *: \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05; n.s.: no significance.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-4239207/v1/b8ceb8e1d904f1124ddf9aaf.png"},{"id":55324595,"identity":"b5a11894-e537-4754-b931-6e460e160f6b","added_by":"auto","created_at":"2024-04-25 16:51:04","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2358915,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4239207/v1/ec9f1721-0e58-4ccf-aed3-c282243f57f8.pdf"},{"id":55322332,"identity":"dbf50c6a-791c-4dd8-8cf4-b68276401ce4","added_by":"auto","created_at":"2024-04-25 16:27:03","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":2217106,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementarymaterialforWesternblots.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4239207/v1/c19c4dce3cae6950afef351d.pdf"},{"id":55323101,"identity":"55c130b0-e0fc-4ced-94c9-3491a2d26b11","added_by":"auto","created_at":"2024-04-25 16:35:03","extension":"png","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":174838,"visible":true,"origin":"","legend":"","description":"","filename":"GraphicalAbstract.png","url":"https://assets-eu.researchsquare.com/files/rs-4239207/v1/976704f48cb8a28c90cce65c.png"}],"financialInterests":"No competing interests reported.","formattedTitle":"Potential Mechanism of HXSJ Decoction in the Treatment of Venous Leg Ulcer: Based on the Association between Venous Leg Ulcers and Ferroptosis","fulltext":[{"header":"1 Background","content":"\u003cp\u003eVenous leg ulcer (VLU) refers to cutaneous wounds that develop on the lower extremities as a result of venous hypertension, representing one of the most severe clinical manifestations in the progression of chronic venous diseases (CVD), encompassing approximately 70% of all lower limb ulcers\u003csup\u003e[1]\u003c/sup\u003e. The chronic pain and disability resulting from VLU exert a substantial impact on patients themselves, while also imposing significant financial burdens and labour force depletion on society\u003csup\u003e[2]\u003c/sup\u003e. Moreover, the challenge is further compounded by the impaired wound healing capacity and increased recurrence rate\u003csup\u003e[3]\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eIn normal physiology, wound healing is an intricately orchestrated biological process that can generally be categorized into four stages: hemostasis, inflammation, proliferation, and remodeling\u003csup\u003e[4]\u003c/sup\u003e. Angiogenesis plays a pivotal role in the wound healing process by facilitating the formation of granulation tissue\u003csup\u003e[5]\u003c/sup\u003e. Conversely, impairment of vascular endothelial cells (VECs) can result in the development of ulcers and delayed wound closure, which is considered a contributing factor to VLU\u003csup\u003e[6]\u003c/sup\u003e. In recent years, research have revealed that, hyperpigmentation (HPT) and lipodermatosclerosis (LDS) as the initial stages of VLU, characterized by iron deposition\u003csup\u003e[7]\u003c/sup\u003e. In clinical practice, our group has observed that once HPT progresses to LDS, risk of ulceration and recurrence increased significantly, and the wound healing capacity impaired. These clues imply a potential correlation between iron deposition and VLU that warrants further investigation.\u003c/p\u003e\n\u003cp\u003eFerroptosis as a programmed cell death that dependent on iron and lipid peroxidation\u003csup\u003e[8]\u003c/sup\u003e. Excessive iron, especially ferrous iron, lead to lipid peroxidation (LPO) through Fenton reaction. Iron overload is a contributing factor to the impaired healing of chronic skin ulcers (CSU), including VLU\u003csup\u003e[9,10]\u003c/sup\u003e.\u0026nbsp;Moreover, recent studies have established a direct correlation between the ferroptosis of VECs and CSU\u003csup\u003e[11,12]\u003c/sup\u003e. The Nrf2/System Xc\u003csup\u003e-\u003c/sup\u003e/GPX4 pathway is crucial to mitigate LPO and ferroptosis\u003csup\u003e[13]\u003c/sup\u003e, inhibition of this pathway can induce ferroptosis without iron overload, compounds such as Erastin, RSL3, and Sorafenib.\u003c/p\u003e\n\u003cp\u003eHuoxue Shengji Decoction (HXSJ Decoction) is an external Chinese herbal compound for treatment of VLU, which has been in clinical used for more than 10 years in our research group. The clinical research conducted by our team had demonstrated the significant efficacy of HXSJ Decoction in promoting angiogenesis and facilitating wound healing\u003csup\u003e[14]\u003c/sup\u003e. Here, we have preliminarily confirmed the involvement of ferroptosis in VLU through investigation on the skin tissue in different stages of VLU progression. And constructing models of iron overload and ferroptosis using human umbilical vein endothelial cells (HUVECs), to reveal the potential mechanisms of HXSJ Decoction in the treatment of VLU.\u003c/p\u003e"},{"header":"2 Methods","content":"\u003cp\u003e\u003cstrong\u003e2.1 \u0026nbsp; \u0026nbsp; Clinical study\u003c/strong\u003e\u003c/p\u003e\n\u003ch3\u003e2.1.1\u0026nbsp;\u0026nbsp;Ethics\u003c/h3\u003e\n\u003cp\u003eThis study was conducted in accordance with the Declaration of Helsinki and approved by the Ethics Committee of Jiaxing Traditional Chinese Medicine Hospital (REC reference\u0026nbsp;number: 2019KY0454). Informed consent forms were signed by each patient included in the study.\u003c/p\u003e\n\u003ch3\u003e2.1.2\u0026nbsp;\u0026nbsp;Clinical inclusion criteria\u003c/h3\u003e\n\u003cp\u003eDiagnostic criteria were as follows: (1) patients are classified as C5 according to the CEAP classification system\u003csup\u003e[15]\u003c/sup\u003e; (2) patients aged 18~75 years; (3) after admission, patients underwent saphenous vein stripping surgery.\u003c/p\u003e\n\u003ch3\u003e2.1.3\u0026nbsp;\u0026nbsp;Clinical exclusion criteria\u003c/h3\u003e\n\u003cp\u003eExclusion criteria were as follows: (1) arterial ischemic diseases, microvascular diseases, dermatological disorders, lymphatic disorders or other diseases impacting iron metabolism and cutaneous nutritional status; (2) organ failure, including cardiac, pulmonary, renal or hepatic dysfunction; (3) history of surgery and trauma in lower limbs; (4) in cases of severe systemic infection or concurrent serious underlying diseases; (5) pregnant or lactating; (6) with cancer or undergoing radiotherapy or chemotherapy; (7) participated in other clinical studies within the past 3 months.\u003c/p\u003e\n\u003ch3\u003e2.1.4\u0026nbsp;\u0026nbsp;Collection of clinical samples\u003c/h3\u003e\n\u003cp\u003eVLU tissue was obtained during the process of ulcer debridement by sampling from the junction between the ulcer and normal skin, including the base of the ulcer with a thickness of 3mm. A 3mm\u0026times;5mm HPT tissue and LDS tissue were obtained during varicose vein surgery respectively, the incision was subsequently utilized for surgery. A 3mm\u0026times;20mm normal tissue was obtained from the inguinal incision, which was subsequently utilized for great saphenous vein ligation. The typical HPT and LDS area illustrated in Figure 1. All samples were rinsed with saline, weighed, and embedded or frozen rapidly in liquid nitrogen for storage at -80℃.\u003c/p\u003e\n\u003ch3\u003e2.1.5\u0026nbsp;\u0026nbsp;Prussian blue staining\u003c/h3\u003e\n\u003cp\u003eThe embedded clinical samples were stained according to the instructions of the Prussian Blue Staining Kit (E670109, Sangon, China), and photographed under upright microscope (Axio Scope.A1, Zeiss, Germany).\u003c/p\u003e\n\u003ch3\u003e2.1.6\u0026nbsp;\u0026nbsp;Immunohistochemistry (IHC)\u003c/h3\u003e\n\u003cp\u003eFollowing the sequential steps of slicing, dewaxing, and antigen retrieval, the clinical samples were incubated with GPX4 (ab125066, Abcam, UK) primary antibody and goat anti-rabbit (PV-8000D, ZSGB-BIO, China) secondary antibody. Subsequently, DAB staining was performed, and the samples were photographed under upright microscope.\u003c/p\u003e\n\u003ch3\u003e2.1.7\u0026nbsp;\u0026nbsp;Detection of iron content and GPX enzyme activity\u003c/h3\u003e\n\u003cp\u003eThe clinical samples were homogenized with saline, and the supernatant was collected after centrifugation. According to the instructions of Tissue Iron Content Assay Kit (BC4355, Solarbio, China), GPX Activity Assay Kit (D799618, Sangon, China), and BCA Protein Assay Kit (C503051, Sangon, China), the results were measured using a microplate reader (Multiskan GO, Thermo, USA), and quantified by protein concentration.\u003c/p\u003e\n\u003ch2\u003e2.2\u0026nbsp; \u0026nbsp; \u0026nbsp;Cell experiments\u003c/h2\u003e\n\u003ch3\u003e2.2.1\u0026nbsp;\u0026nbsp;Cell culture and grouping\u003c/h3\u003e\n\u003cp\u003eThe HUVECs were obtained from National Infrastructure of Cell Line Resource (Beijing, China), and cultured in DMEM medium (10569010, Gibco, USA) supplemented with 10% fetal bovine serum (10100147, Gibco, USA) and 100U/ml penicillin sodium -100\u003cem\u003e\u0026mu;\u003c/em\u003eg/ml streptomycin sulfate (B540732, Sangon, China) at a 37℃ incubator (370, Thermo, USA) with 5% CO\u003csub\u003e2\u003c/sub\u003e.\u0026nbsp;The\u0026nbsp;iron overload models were\u0026nbsp;established by 100\u003cem\u003e\u0026mu;\u003c/em\u003eM Ferric Ammonium Citrate (FAC, A500061, Sangon, China) and 100\u003cem\u003e\u0026mu;\u003c/em\u003eM Hemin (H140872, Aladdin, China) to\u0026nbsp;simulate simple iron overload and hemoglobin exudation, respectively.\u0026nbsp;10\u003cem\u003e\u0026mu;\u003c/em\u003eM Erastin (HY-15763, MCE, USA) was employed to establish a ferroptosis model. The experiment was conducted following a 24h intervention with HXSJ Decoction, in accordance with the experimental requirements.\u003c/p\u003e\n\u003ch3\u003e2.2.2\u0026nbsp;\u0026nbsp;Preparation of HXSJ Decoction\u003c/h3\u003e\n\u003cp\u003eThe components of HXSJ Decoction are presented in Table 1.\u0026nbsp;\u003cem\u003eAstragali Radix\u003c/em\u003e (Cat. 170320) 15g, \u003cem\u003eSalviae Miltiorrhizae Radix et Rhizoma\u003c/em\u003e (Cat. 170307) 20g, \u003cem\u003eCarthami Flos\u003c/em\u003e (Cat. 170328) and \u003cem\u003eGlycyrrhizae Radix et Rhizoma\u003c/em\u003e (Cat. 170301) 6g, were obtained from Anhui Jiayou Chinese Medicine Herb Pieces Co., Ltd.; \u003cem\u003eAngelicae Sinensis Radix\u003c/em\u003e (Cat. 170202) 20g, \u003cem\u003eParidis Rhizoma\u003c/em\u003e (Cat. 170305) 10g were obtained from Zhejiang Chinese Medical University Medical Pieces Co., Ltd.; \u003cem\u003eOlibanum\u003c/em\u003e (Cat. 170224) 10g, \u003cem\u003eBletillae Rhizoma\u003c/em\u003e (Cat. 170112) 10g, \u003cem\u003eMyrrha\u003c/em\u003e (Cat. 170230) 10g were obtained from Jiaxing Oriental Chinese Medicine Decoction Pieces Co., Ltd.; \u003cem\u003eAngelicae Dahuricae Radix\u003c/em\u003e (Cat. 44170201) 10g was obtained from Hangzhou Mintai Traditional Chinese Medicine Decoction Pipe Co., Ltd.. The aforementioned Chinese herbal medicine was extracted by hot reflux 1h with 1L 80% ethanol for 3 times, the extract was concentrated through rotary evaporation. Subsequently, the paste was dissolved in 80% ethanol to achieve a concentration of HXSJ Decoction at 500mg/ml, then filtered through a 0.22\u003cem\u003e\u0026mu;\u003c/em\u003em filter and stored at -20℃\u0026nbsp;for later use.\u003c/p\u003e\n\u003cp\u003eTable 1. Components of\u0026nbsp;HXSJ Decoction\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"100%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"32.6530612244898%\"\u003e\n \u003cp\u003eName\u003csup\u003e1\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"52.04081632653061%\"\u003e\n \u003cp\u003eLatin binomial nomenclature\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.306122448979592%\"\u003e\n \u003cp\u003emedicinal parts\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"32.6530612244898%\"\u003e\n \u003cp\u003eAstragali Radix\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"52.04081632653061%\"\u003e\n \u003cp\u003e\u003cem\u003eAstragalus membranaceus (Fisch.) Bge.\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.306122448979592%\"\u003e\n \u003cp\u003eradix\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"32.6530612244898%\"\u003e\n \u003cp\u003eSalviae Miltiorrhizae Radix et Rhizoma\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"52.04081632653061%\"\u003e\n \u003cp\u003e\u003cem\u003eSalvia miltiorrhiza Bge.\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.306122448979592%\"\u003e\n \u003cp\u003eradix and rhizoma\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"32.6530612244898%\"\u003e\n \u003cp\u003eCarthami Flos\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"52.04081632653061%\"\u003e\n \u003cp\u003e\u003cem\u003eCarthamus tinctorius L.\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.306122448979592%\"\u003e\n \u003cp\u003eflower\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"32.6530612244898%\"\u003e\n \u003cp\u003eGlycyrrhizae Radix et Rhizoma\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"52.04081632653061%\"\u003e\n \u003cp\u003e\u003cem\u003eGlycyrrhiza glabra L.\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.306122448979592%\"\u003e\n \u003cp\u003eradix and rhizoma\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"32.6530612244898%\"\u003e\n \u003cp\u003eAngelicae Sinensis Radix\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"52.04081632653061%\"\u003e\n \u003cp\u003e\u003cem\u003eAngelica sinensis (Oliv.) Diels\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.306122448979592%\"\u003e\n \u003cp\u003eradix\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"32.6530612244898%\"\u003e\n \u003cp\u003eParidis Rhizoma\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"52.04081632653061%\"\u003e\n \u003cp\u003e\u003cem\u003eParis polyphylla Smith var.yunnanensis (Franch.) Hand.-Mazz.\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.306122448979592%\"\u003e\n \u003cp\u003erhizoma\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"32.6530612244898%\"\u003e\n \u003cp\u003eOlibanum\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"52.04081632653061%\"\u003e\n \u003cp\u003e\u003cem\u003eBoswellia carterii Birdw.\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.306122448979592%\"\u003e\n \u003cp\u003eresin\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"32.6530612244898%\"\u003e\n \u003cp\u003eBletillae Rhizoma\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"52.04081632653061%\"\u003e\n \u003cp\u003e\u003cem\u003eBletilla striata (Thunb.) Reichb.f.\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.306122448979592%\"\u003e\n \u003cp\u003erhizoma\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"32.6530612244898%\"\u003e\n \u003cp\u003eMyrrha\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"52.04081632653061%\"\u003e\n \u003cp\u003e\u003cem\u003eCommiphora myrrha Engl.\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.306122448979592%\"\u003e\n \u003cp\u003eresin\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"32.6530612244898%\"\u003e\n \u003cp\u003eAngelicae Dahuricae Radix\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"52.04081632653061%\"\u003e\n \u003cp\u003e\u003cem\u003eAngelica dahurica (Fisch.ex Hoffm.)\u0026nbsp;\u003c/em\u003e\u003cem\u003eBenth.et Hook.f.\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"15.306122448979592%\"\u003e\n \u003cp\u003eradix\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e1: From the Chinese Pharmacopoeia (2020 editon)\u003c/p\u003e\n\u003ch3\u003e2.2.3\u0026nbsp;\u0026nbsp;Cell viability assay\u003c/h3\u003e\n\u003cp\u003eHUVECs were seeded into 96-well plates at 6\u0026times;10\u003csup\u003e3\u003c/sup\u003e/well. Briefly, after intervention, each well was replaced with 100\u003cem\u003e\u0026mu;\u003c/em\u003el medium containing 10% CCK-8 reagent (E606335, Sangon, China), and subsequently incubated for 1h. The absorbance at 450nm was measured by a microplate reader.\u0026nbsp;Cell viability\u0026nbsp;= (\u003cem\u003eA\u003c/em\u003e\u003csub\u003eexperiment\u003c/sub\u003e-\u003cem\u003eA\u003c/em\u003e\u003csub\u003eblank\u0026nbsp;\u003c/sub\u003e)/(\u003cem\u003eA\u003csub\u003econtrol\u003c/sub\u003e\u003c/em\u003e-\u003cem\u003eA\u003c/em\u003e\u003csub\u003eblank\u003c/sub\u003e)\u0026times;100%.\u003c/p\u003e\n\u003ch3\u003e2.2.4\u0026nbsp;\u0026nbsp;Biochemical analysis\u003c/h3\u003e\n\u003cp\u003eHUVECs were seeded into 6-well plates at 2\u0026times;10\u003csup\u003e5\u003c/sup\u003e/well. After intervention, cellular samples were harvested and analyzed using\u0026nbsp;malondialdehyde (MDA) Content Assay Kit (D799762, Sangon, China),\u0026nbsp;protein carbonylation\u0026nbsp;(PCO) Content Assay Kit (D799768, Sangon, China),\u0026nbsp;glutathione peroxidase\u0026nbsp;(GPX) Activity Assay Kit, glutathione\u0026nbsp;(GSH) Content Assay Kit (D799614, Sangon, China), Ferrous Iron Assay Kit (E-BC-K881-M, Elabscience, China) and BCA Protein Assay Kit. The results were measured using a microplate reader and quantified by protein concentration.\u003c/p\u003e\n\u003ch3\u003e2.2.5\u0026nbsp;\u0026nbsp;Detection of ATP content\u003c/h3\u003e\n\u003cp\u003eHUVECs were seeded into 6-well plates, then harvested after intervention. According to the instructions of ATP Assay Kit (S0026, Beyotime, China) and BCA Protein Assay Kit, the results were measured using a Luminometer (GloMax 20/20, Promega, USA) and a microplate reader, respectively. The results were quantified by protein concentration.\u003c/p\u003e\n\u003ch3\u003e2.2.6\u0026nbsp;\u0026nbsp;Intracellular reactive oxygen species (ROS) assay\u003c/h3\u003e\n\u003cp\u003eThe fluorescent probe 2\u0026apos;,7\u0026apos;-Dichlorofluorescein diacetate (DCFH-DA, 35845, Sigma, USA) was employed to quantify the levels of intracellular ROS. After cellular entry, the deacetylated derivative of DCFH-DA can be oxidized to a fluorescent product exhibiting green emission. Strictly following the instructions, briefly, HUVECs were incubated with 10\u003cem\u003e\u0026mu;\u003c/em\u003eM DCFH-DA at 37℃ for 30min. After wash by PBS, the fluorescence images were photographed using fluorescence inverted microscope (Axio Observer D1, ZEISS, Germany) at FITC channel.\u003c/p\u003e\n\u003ch3\u003e2.2.7\u0026nbsp;\u0026nbsp;LPO assay\u003c/h3\u003e\n\u003cp\u003eLPO was investigated by BODIPY\u0026trade; 581/591 C11 (D3861, Thermo, USA), which converts red fluorescence to green fluorescence upon oxidation. Following the protocol described by Martinez \u003cem\u003eet al\u003c/em\u003e.\u003csup\u003e[17]\u003c/sup\u003e, HUVECs were incubated with 2.5\u003cem\u003e\u0026mu;\u003c/em\u003eM BODIPY\u0026trade; 581/591 C11 at 37\u0026deg;C for 30min. After wash by PBS, the fluorescence images were photographed using fluorescence inverted microscope at FITC and Rhodamine channel.\u003c/p\u003e\n\u003ch3\u003e2.2.8\u0026nbsp;\u0026nbsp;Mitochondrial membrane potential (MMP) assay\u003c/h3\u003e\n\u003cp\u003eMMP was investigated by JC-1 (C2006, Beyotime, China), which converts red fluorescence to green fluorescence upon MMP decreases. Briefly, HUVECs were incubated with 10\u003cem\u003e\u0026mu;\u003c/em\u003eg/ml JC-1 at 37\u0026deg;C for 30min. After washed by buffer, the fluorescence images were photographed using fluorescence inverted microscope at FITC and Rhodamine channel.\u003c/p\u003e\n\u003ch3\u003e2.2.9\u0026nbsp;\u0026nbsp;Quantitative\u0026nbsp;PCR\u003c/h3\u003e\n\u003cp\u003eHUVECs were seeded into 6-well plates, then harvested after intervention. Total RNA was extracted by TRIzol (9109, Takara, Japan) and quantified by spectrophotometer (Quickdrop, Molecular Devices, USA). Subsequently, cDNA was synthesized by reverse transcription kit (RR036, Takara, Japan). The qPCR assay was performed with qPCR kit (RR820, Takara, Japan) on Real-Time PCR system (7500, ABI, USA) with 95\u0026deg;C for 30 s, 1 cycle; 95\u0026deg;C for 5s, 60\u0026deg; C for 34 s, 40 cycles. \u0026beta;-Actin served as reference, and the relative expression levels were calculated using the 2\u003csup\u003e-\u003c/sup\u003e\u003csup\u003e△△\u003c/sup\u003e\u003csup\u003eCt\u003c/sup\u003e method. The primer sequences were listed in Table 2.\u003c/p\u003e\n\u003cp\u003eTable 2 qPCR primer sequences\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"100%\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.3265306122449%\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"43.87755102040816%\"\u003e\n \u003cp\u003eForward sequence (5\u0026rsquo;- 3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"39.795918367346935%\"\u003e\n \u003cp\u003eReverse sequence (5\u0026rsquo;- 3\u0026rsquo;)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.3265306122449%\"\u003e\n \u003cp\u003e\u003cem\u003eNrf2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"43.87755102040816%\"\u003e\n \u003cp\u003eAGTGTGGCATCACCAGAACA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"39.795918367346935%\"\u003e\n \u003cp\u003eTGTTTGACACTTCCAGGGGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.3265306122449%\"\u003e\n \u003cp\u003e\u003cem\u003eSLC7A11\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"43.87755102040816%\"\u003e\n \u003cp\u003eCATCTCTCCTAAGGGCGTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"39.795918367346935%\"\u003e\n \u003cp\u003eTAGTGACAGGACCCCACACA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.3265306122449%\"\u003e\n \u003cp\u003e\u003cem\u003eGPX4\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"43.87755102040816%\"\u003e\n \u003cp\u003eCAGTGAGGCAAGACCGAAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"39.795918367346935%\"\u003e\n \u003cp\u003eCCGAACTGGTTACACGGGAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.3265306122449%\"\u003e\n \u003cp\u003e\u003cem\u003e\u0026beta;-Actin\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"43.87755102040816%\"\u003e\n \u003cp\u003eCCTGGCACCCAGCACAAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"39.795918367346935%\"\u003e\n \u003cp\u003eGGGCCGGACTCGTCATAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cem\u003eNrf2\u003c/em\u003e: nuclear factor erythroid 2-related factor 2; \u003cem\u003eSLC7A11\u003c/em\u003e: solute carrier family 7 member 11; \u003cem\u003eGPX4\u003c/em\u003e: glutathione peroxidase 4; \u003cem\u003e\u0026beta;-Actin\u003c/em\u003e: actin beta.\u003c/p\u003e\n\u003ch3\u003e2.2.10\u0026nbsp;\u0026nbsp;Western blotting\u003c/h3\u003e\n\u003cp\u003eHUVECs were seeded into 6-well plates, then harvested after intervention. Total protein was extracted by RIPA lysis (C500005, Sangon, China) supplemented with protease inhibitor (C600380, Sangon, China) and quantified by BCA Protein Assay Kit. Subsequently, 20\u003cem\u003e\u0026mu;\u003c/em\u003eg total protein was loaded onto a 10% SDS-PAGE gel and transferred to a PVDF membrane (F619534, Sangon, China). After blocking, the membrane was incubated with anti-Nrf2 (ab92946, abcam, UK), anti-xCT (ab175186, abcam, UK), anti-GPX4 (ab125066, abcam, UK), and anti-GAPDH (ab181602, abcam, UK) primary antibodies for 4\u0026deg;C overnight, and with goat anti-rabbit (ab6721, abcam, UK) secondary antibody for RT 1h. Finally, ECL luminescence reagent (C500044, Sangon, China) was used for visualization on a chemiluminescent imaging system (5200\u0026nbsp;multi, Tanon,China).\u003c/p\u003e\n\u003ch2\u003e2.3\u0026nbsp; \u0026nbsp; \u0026nbsp;Statistical analysis\u003c/h2\u003e\n\u003cp\u003eStatistical analysis was performed on SPSS software (version 23.0, USA). The results were presented as mean \u0026plusmn; SD\u0026nbsp;or median (upper quartile, lower quartile) depending on the situation. Statistical comparisons were performed by one-way ANOVA or Friedman M test, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05 was considered statistically significant.\u003c/p\u003e"},{"header":"3 Results","content":"\u003ch2\u003e3.1\u0026nbsp; \u0026nbsp; \u0026nbsp;Clinical study\u003c/h2\u003e\n\u003ch3\u003e3.1.1\u0026nbsp;\u0026nbsp;General data of clinical cases\u003c/h3\u003e\n\u003cp\u003eThis study enrolled 10 patients (4 males and 6 females) with ULV, aged 61.7\u0026plusmn;8.1 years. Normal\u0026nbsp;skin, HPT, LDS, and VLU samples were successfully collected from each patient without any adverse events occurring during surgery. All patients achieved favorable therapeutic outcomes following standardized treatment.\u003c/p\u003e\n\u003ch3\u003e3.1.2\u0026nbsp;\u0026nbsp;The progression of CVD accompanied with accumulation of iron and suppression of GPX\u003c/h3\u003e\n\u003cp\u003eThe Prussian blue staining are\u0026nbsp;shown in Figure 2A obtained from a typical patient. The results indicate that as CVD progresses, iron deposition in affected tissue gradually increased. However, there was an abrupt decline in iron accumulation, upon reaching VLU stage. The quantitative results of total iron content were shown in Figure 2C, which was consistent with the Prussian blue staining results. A significantly elevated levels were observed in the HPT area compared to the normal area (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05), while no significant difference was found between the LDS and HPT area (\u003cem\u003eP\u003c/em\u003e\u0026gt;0.05). Furthermore, a notable reduction was exhibited in the VLU area compared to LDS area (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01).\u003c/p\u003e\n\u003cp\u003eFigure 2B showed the IHC result of GPX4 from a typical patient. As CVD progresses to the HPT stage, the expression of GPX4 was up-regulated. However, with further deterioration of CVD, the expression of GPX4 was gradually suppressed. The quantitative results of GPX activity were depicted in Figure 2D, demonstrating consistency with the IHC results. The GPX activity significantly increased in HPT area compared to normal area (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05). However, when CVD progressing to LDS, the GPX activity decreased significantly compared to HPT area (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01). As CVD reached VLU stage, a further decline in GPX activity was observed (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05).\u003c/p\u003e\n\u003ch2\u003e3.2\u0026nbsp; \u0026nbsp; \u0026nbsp;Cellular experiments\u003c/h2\u003e\n\u003ch3\u003e3.2.1\u0026nbsp;\u0026nbsp;HXSJ Decoction promoted the proliferation of HUVECs\u003c/h3\u003e\n\u003cp\u003eIn this study, we employed different concentrations of HXSJ Decoction (0\u003cem\u003e\u0026mu;\u003c/em\u003eg/ml-500\u003cem\u003e\u0026mu;\u003c/em\u003eg/ml) on HUVECs for 24h, in order to investigate the impact of HXSJ Decoction on the proliferation of HUVECs. The results of the CCK8 assay (Figure 3A) demonstrated that HUVECs viability was most significantly increased at 10\u003cem\u003e\u0026mu;\u003c/em\u003eg/ml HXSJ Decoction (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01). Subsequently, with the increasing of\u0026nbsp;concentration, the cell viability gradually decreased in a concentration-dependent manner. Therefore, the concentration of 10\u003cem\u003e\u0026mu;\u003c/em\u003eg/ml was selected for further experiments in this study.\u003c/p\u003e\n\u003ch3\u003e3.2.2\u0026nbsp;\u0026nbsp;HXSJ Decoction alleviates iron overload-induced damage in HUVECs\u003c/h3\u003e\n\u003cp\u003eWe employed 100\u003cem\u003e\u0026mu;\u003c/em\u003eM FAC and 100\u003cem\u003e\u0026mu;\u003c/em\u003eM Hemin to establish an iron overload model. As shown in Figure 3B, HXSJ Decoction significantly restored the cell viability, which was inhibited by FAC or Hemin (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01). Additionally, MDA and PCO were measured as characteristic products of LPO. The results (Figure 3C, D) showed a significant increase in MDA and PCO contents induced by FAC and Hemin (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05), indicating that both FAC and Hemin lead to LPO damage. However, HXSJ Decoction could significantly reduce MDA and PCO contents (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01), mitigating LPO damage in HUVECs. Furthermore, these results were further supported by the evidence of DCFH-DA and BODIPY\u0026trade; 581/591 C11 staining (Figure 3G, H). Mitochondrial dysfunction also as a pivotal characteristic of LPO, was evaluated by ATP content and MMP. Both FAC and Hemin significantly suppressed ATP production in HUVECs (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01), and effectively reversed by HXSJ Decoction (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01) (Figure 3E). The MMP of HUVECs were measured by JC-1 staining (Figure 3I), images illustrated the repression of MMP in HUVECs induced by FAC and Hemin, while HXSJ Decoction exhibited restorative effects on MMP. In iron overload model, the excessive Fe\u003csup\u003e2+\u003c/sup\u003e was crucial for LPO damage. Here, quantified Fe\u003csup\u003e2+\u003c/sup\u003e content in HUVECs (Figure 3F), the results demonstrated a significant increase in Fe\u003csup\u003e2+\u003c/sup\u003e content for FAC and Hemin (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01), and HXSJ Decoction could partially mitigated the accumulation of ferrous ion (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01). The above results indicate that HXSJ Decoction could effectively mitigates mitochondrial dysfunction in iron overload HUVECs induced by FAC and Hemin.\u003c/p\u003e\n\u003ch3\u003e3.2.3\u0026nbsp;\u0026nbsp;HXSJ Decoction mitigated LPO damage induced by iron overload through activating Nrf2/system Xc\u003csup\u003e-\u003c/sup\u003e/GPX4 pathway in HUVECs\u003c/h3\u003e\n\u003cp\u003eThe Nrf2/system Xc\u003csup\u003e-\u003c/sup\u003e/GPX4 pathway plays a pivotal role in LPO defensing. In clinical practice, we have mentioned a significant decline in GPX expression during the deterioration of CVD, particularly in the LDS and VLU stages (Figure 2B, D). The GPX activity (Figure 4A) and the expression of GPX4 (Figure 4E, F) were also inhibited in the iron overload HUVECs induced by FAC and Hemin (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01). Additionally, we investigated other pivotal factors of Nrf2/system Xc\u003csup\u003e-\u003c/sup\u003e/GPX4 pathway. As expected, iron overload suppressed the expression of Nrf2 (Figure 4C, F) and xCT (Figure 4D, F), depleted GSH (Figure 4B), but did not significantly downregulate Nrf2 expression at the mRNA level (\u003cem\u003eP\u003c/em\u003e\u0026gt;0.05). Upon addition of HXSJ Decoction to the iron overload system, there was a significant increasing of GPX activity, restoration of GSH, and activation of Nrf2, xCT, and GPX4 expression (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01).\u003c/p\u003e\n\u003ch3\u003e3.2.4\u0026nbsp;\u0026nbsp;HXSJ Decoction mitigates ferroptosis induced by Erastin in HUVECs\u003c/h3\u003e\n\u003cp\u003eThe above study suggests that HXSJ Decoction might mitigate LPO damage via activiting Nrf2/system Xc\u003csup\u003e-\u003c/sup\u003e/GPX4 pathway. To further confirm this effect on ferroptosis, 10\u003cem\u003e\u0026mu;\u003c/em\u003eM Erastin was employed to induce ferroptosis in HUVECs. As shown in Figure 5A, HXSJ Decoction significantly restored the inhibition of Erastin on HUVECs viability (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01). To confirm the alleviation of HXSJ Decoction on Erastin-induced ferroptosis, MDA and PCO were quantified as shown in Figure 5B, C. HXSJ Decoction significantly reduces the content of MDA and PCO induced by Erastin in HUVECs (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01). And this evidence was validated by the DCFH-DA and BODIPY\u0026trade; 581/591 C11 staining (Figure 5F, G). Furthermore, HXSJ Decoction has been demonstrated to restores mitochondrial damage effectively induced by Erastin. The depletion of ATP (Figure 5D) and the suppression of MMP (Figure 5H) induced by Erastin were significantly improved by HXSJ Decoction (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01). Erastin is commonly recognized as a system Xc\u003csup\u003e-\u003c/sup\u003e inhibitor to induce ferroptosis. However, our study revealed that Erastin also significantly accumulate Fe\u003csup\u003e2+\u003c/sup\u003e in HIVECs (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01), as shown in Figure 5E. And HXSJ Decoction could partially reduce the accumulation of Fe\u003csup\u003e2+\u003c/sup\u003e (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05). The above findings suggest that HXSJ Decoction exhibits potential in mitigating ferroptosis induced by Erastin.\u003c/p\u003e\n\u003ch3\u003e3.2.5 \u0026nbsp;HXSJ Decoction mitigated ferroptosis induced by Erastin through activating Nrf2/system Xc\u003csup\u003e-\u003c/sup\u003e/GPX4 pathway in HUVECs\u003c/h3\u003e\n\u003cp\u003eAs previously mentioned, HXSJ Decoction mitigates LPO damage induced by iron overload through activating the Nrf2/system Xc\u003csup\u003e-\u003c/sup\u003e/GPX4 pathway, which was also observed in Erastin-induced ferroptosis of HUVECs. As shown in\u0026nbsp;Figure 6A, B,HXSJ Decoction could significantly restore the inhibition of GPX activity and the depletion of GSH (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01). Further analysis of Nrf2/system Xc\u003csup\u003e-/\u003c/sup\u003eGPX4 pathway (Figure 6C-F) revealed that Erastin significantly inhibited GPX4 expression (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01), while concurrently upregulating Nrf2 expression (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01). This phenomenon may be attributed to the\u0026nbsp;negative feedback effect of GPX4 inhibition on upstream Nrf2 signaling pathway. Erastin is commonly recognized as an inhibitor of system Xc\u003csup\u003e-\u003c/sup\u003e, although this effect was not evident at the protein expression, but significantly upregulated the mRNA expression of SLC7A11 (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01). We hypothesized that this observation may be attributed to the dynamic equilibrium between transcription and translation of xCT. And HXSJ Decoction could significantly up-regulate the expression of Nrf2, xCT, and GPX4 (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01). Therefore, we proposed that HXSJ Decoction activate Nrf2/system Xc\u003csup\u003e-\u003c/sup\u003e/GPX4 pathway to mitigated ferroptosis.\u003c/p\u003e"},{"header":"4 Discussion","content":"\u003cp\u003eVenous hypertension (VH) as the main pathogenesis of VLU, which caused by venous reflux, occlusion, weakness, and leg muscle pump incompetence. Currently, there is more comprehension of the etiology, pathology, and hemodynamic alterations in VLU, but the precise mechanisms are still controversial. Undoubtedly, vascular damage plays a pivotal role in ulcers development and chronicity\u003csup\u003e[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. The current research indicates that during the HPT and LDS stage, iron deposition occurs in the affected skin area\u003csup\u003e[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. Specifically, iron deposition block the exchange of substances between capillaries and tissues, leading to cellular hypoxia and metabolic disruption, which is a significant etiological determinant in the pathogenesis of ulcer formation\u003csup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e. Simultaneously, iron deposition also accelerates ulcer formation by mediating the release of inflammatory factors\u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eFerroptosis was initially proposed by Dixon in 2012 as a programmed cell death that relies on iron and oxidation\u003csup\u003e[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]\u003c/sup\u003e. Different from the others, in morphology, ferroptosis is characterized by mitochondrial shrinkage, membrane density increasing and cristae disappearance; in biochemistry, ferroptosis primarily involves iron overload, LPO, Fenton reaction and cysteine depletion\u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e. The iron overload is a pivotal factor in the generation of LPO. In normal, ferric and ferrous ions are in a physiological equilibrium, once this balance is disrupted, Fe\u003csup\u003e2+\u003c/sup\u003e stored in mitochondria, endoplasmic reticulum, and ferritin will be released into the cytoplasm, forming labile iron pool and triggering LPO production through Fenton reaction to induce ferroptosis\u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]\u003c/sup\u003e. The cystine/glutamate exchange system (System Xc\u003csup\u003e\u0026minus;\u003c/sup\u003e), transports cystine into cells and releases glutamate into the extracellular space as 1:1. System Xc\u003csup\u003e\u0026minus;\u003c/sup\u003e consists of two protein components, the 4F2 heavy chain for membrane location and the xCT (SLC7A11) for transport activity. The intracellular cystine is synthesized into GSH by a series of enzymatic reactions and serves as the substrate for GPX4\u003csup\u003e[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e. GPX4 catalyzes the conversion of GSH to GSSG, thereby facilitating the metabolism of cytotoxic lipid peroxides (L-OOH) into non-cytotoxic liposomes (L-OH)\u003csup\u003e[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]\u003c/sup\u003e. Nrf2 as a main regulator of cellular antioxidant, which can not only regulate the system Xc\u003csup\u003e\u0026minus;\u003c/sup\u003e/GPX4 pathway, but also play a pivotal role in iron metabolism\u003csup\u003e[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]\u003c/sup\u003e. Therefore, depletion of GSH, inactivation of GPX4 and accumulation of iron may contribute to ferroptosis.\u003c/p\u003e \u003cp\u003eIn this study, our results indicated a progressive accumulation of iron during deterioration CVD, which was similar to others\u0026rsquo; reports. Interestingly, as CVD progresses to the VLU stage, there is a rapid decrease in iron content, we suspected that may be attributed to the discharge of iron through ulcer exudate. And Yeoh-Ellerton \u003cem\u003eet al\u003c/em\u003e.\u003csup\u003e[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e also reported a elevated levels of ferritin in exudate from CSU. Our further research revealed that during the progression of HPT-LDS-VLU, there was an upregulation in GPX4, followed by a rapid decline. We postulate that iron deposition occurs after CVD, leading to oxidative damage. In this stage, the up-regulation of GPX4 maintains a delicate equilibrium between oxidation and antioxidation, ultimately manifesting as HPT. Once this delicate equilibrium is disrupted by factors such as trauma and infection, the maintenance of high GPX4 expression becomes compromised, resulting in ferroptosis, subsequently deteriorating to LDS and VLU. Ulcers usually occurred in severe HPT areas, and ulceration is more prone to occur once HPT progresses into LDS. This situation also reflects our speculation indirectly.\u003c/p\u003e \u003cp\u003eIron overload and ferroptosis are the triggers for HPT progress to VLU[9,10], and are the persistent barriers to ulcers healing\u003csup\u003e[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/sup\u003e. Meanwhile, angiogenesis plays a crucial role in the ulcer healing\u003csup\u003e[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/sup\u003e Therefore, mitigation of ferroptosis in VECs may be a potential strategy to promote VLU healing. In this study, we employed HUVECs, and utilized 100\u003cem\u003e\u0026micro;\u003c/em\u003eM FAC and 100\u003cem\u003e\u0026micro;\u003c/em\u003eM Hemin to establish iron overload models for simulation of simple iron overload and hemoglobin exudation respectively. The results revealed that HUVECs exhibited ferroptosis, characterized by inactivation of GPX4, depletion of GSH and accumulation of ferrous ion. Simultaneously, the external Chinese herbal compound HXSJ Decoction seemed to protect HUVECs from LPO damage induced by iron overload through activating Nrf2/system Xc\u003csup\u003e\u0026minus;\u003c/sup\u003e/GPX4 pathway. Furthermore, the ferroptosis inducer Erastin was experimented, and HXSJ Decoction still exhibited an activation on Nrf2/system Xc\u003csup\u003e\u0026minus;\u003c/sup\u003e/GPX4 pathway, mitigate ferroptosis concurrently. Therefore, we confirmed that HXSJ Decoction could mitigate ferroptosis of VEC and contribute to VLU healing.\u003c/p\u003e \u003cp\u003eHXSJ Decoction is made of a variety of Chinese herbal medicines. In a previous clinical study conducted by our group, negative pressure wound therapy with instillation using HXSJ Decoction has achieved a satisfactory efficacy in the treatment of CSU, which could effectively accelerate microangiogenesis in granulation tissue and facilitate wound healing\u003csup\u003e[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/sup\u003e. The alcohol-soluble components saponins and flavonoids found in \u003cem\u003eAstragali Radix\u003c/em\u003e, \u003cem\u003eSalviae Miltiorrhizae Radix et Rhizoma\u003c/em\u003e, \u003cem\u003eCarthami Flos\u003c/em\u003e, and \u003cem\u003eGlycyrrhizae Radix et Rhizoma\u003c/em\u003e within the HXSJ Decoction, exhibit anti-ferroptotic effects base on Nrf2/system Xc\u003csup\u003e\u0026minus;\u003c/sup\u003e/GPX4 pathway, such as Astragaloside\u003csup\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/sup\u003e, Salvianolic acid\u003csup\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/sup\u003e, Tanshinone\u003csup\u003e[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e, Carthamin yellow\u003csup\u003e[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/sup\u003e and Liquiritin\u003csup\u003e[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e"},{"header":"5 Conclusions","content":"\u003cp\u003eIn conclusion, this study suggests that ferroptosis, mediated by the accumulation of iron and the inactivation of GPX4, is a significant contributing factor in the process of VLU. Furthermore, employing HUVEC as an in vitro model, this study investigates the mechanism in the ferroptosis mitigation of HXSJ Decoction through activation of Nrf2/system Xc\u003csup\u003e\u0026minus;\u003c/sup\u003e/GPX4 pathway. Overall, this study present a potential novel approach for VLU treatment and strengthen the theoretical foundation for utilizing HXSJ Decoction in VLU therapy.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eVLU\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003evenous leg ulcer\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCVD\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003echronic venous diseases\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eGPX\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eglutathione peroxidase\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eHUVECs\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ehuman umbilical vein endothelial cells\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eFAC\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eferric ammonium citrate\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eHXSJ Decoction\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eHuoxue Shengji Decoction\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eDCFH-DA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003e2',7'-Dichlorofluorescein diacetate\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eATP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eadenosine triphosphate\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eMMP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003emitochondrial membrane potential\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eMrf2\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003enuclear factor erythroid 2-related factor\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003esystem Xc\u003csup\u003e\u0026minus;\u003c/sup\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ecystine/glutamate exchange system\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eGSH\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eglutathione\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eqPCR\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003equantitative polymerase chain reaction\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eVECs\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003evascular endothelial cells\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eHPT\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ehyperpigmentation\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eLDS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003elipodermatosclerosis\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eLPO\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003elipid peroxidation\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCSU\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003echronic skin ulcers\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eMDA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003emalondialdehyde\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePCO\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eprotein carbonylation\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eROS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ereactive oxygen species\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eSLC7A11\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003esolute carrier family 7 member 11\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eVH\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003evenous hypertension\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eL-OOH\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003elipid peroxides\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eL-OH\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eliposomes\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was conducted in accordance with the Declaration of Helsinki and approved by the Ethics Committee of Jiaxing Traditional Chinese Medicine Hospital (REC reference\u0026nbsp;number: 2019KY0454). Informed consent forms were signed by each patient included in the study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was funded by Zhejiang Public Welfare Technology Applied Research Projects (LGF21H270009, Sunfeng Pan), Basic Public Welfare Research Projects\u0026nbsp;of Zhejiang Province\u0026nbsp;(LTGC23H150001, Lie Xiong), Zhejiang Medical and Health Science Technology Projects (2023KY1227, Yanbo Shi), Zhejiang Traditional Chinese Medicine Science Technology Projects (2024ZR034,\u0026nbsp;Zhaoyan Liu), and Multidisciplinary Innovation Team for Comprehensive Prevention\u0026nbsp;and Treatment of Wound Diseases with Integrated Chinese and Western Medicine (2024, Sunfeng Pan). The science and technology program of Jiaxing City Science and Technology Bureau (2023AY40026, Yujuan Su), Key Project of National Administration of Traditional Chinese Medicine (2023JSGJ002, Sunfeng Pan).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSunfeng Pan and Yanbo Shi contributed to conception and design of the study. Lie Xiong conducted most of the experiments and data analysis and wrote the manuscript\u0026nbsp;draft. Sunfeng Pan,\u0026nbsp;Zhenjun Wang, Yujuan Su, Gaofeng Fang, Minda Zhu, Jiakun Li, Jiayan Li and Zhaoyan Liu collected clinical samples. Sunfeng Pan and Hanqiang Shi participated in collecting data and the manuscript\u0026nbsp;drafting. Sunfeng Pan, Chunmao Han and Yanbo Shi participated in the discussion and\u0026nbsp;edited/revised the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors thank the pathology department and related nursing staff that assisted us in the course of clinical research.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eO\u0026apos;Donnell TF Jr, Passman MA, Marston WA, Ennis WJ, Dalsing M, Kistner RL, et al. Society for Vascular Surgery; American Venous Forum. Management of venous leg ulcers: clinical practice guidelines of the Society for Vascular Surgery\u003csup\u003e\u0026reg;\u003c/sup\u003e and the American Venous Forum. J Vasc Surg. 2014;60(2 Suppl):3S-59S.\u003c/li\u003e\n\u003cli\u003eKolluri R, Lugli M, Villalba L, Varcoe R, Maleti O, Gallardo F, et al. An estimate of the economic burden of venous leg ulcers associated with deep venous disease. Vasc Med. 2022;27(1):63-72.\u003c/li\u003e\n\u003cli\u003eFinlayson KJ, Parker CN, Miller C, Gibb M, Kapp S, Ogrin R, et al. Predicting the likelihood of venous leg ulcer recurrence: The diagnostic accuracy of a newly developed risk assessment tool. Int Wound J. 2018;15(5):686-694.\u003c/li\u003e\n\u003cli\u003eLiu Y, Yang X, Liu Y, Jiang T, Ren S, Chen J, et al. NRF2 signalling pathway: New insights and progress in the field of wound healing. J Cell Mol Med. 2021;25(13):5857\u0026ndash;5868.\u003c/li\u003e\n\u003cli\u003eAckermann M, Pabst AM, Houdek JP, Ziebart T, Konerding MA. Priming with proangiogenic growth factors and endothelial progenitor cells improves revascularization in linear diabetic wounds. Int J Mol Med. 2014;33(4):833-839.\u003c/li\u003e\n\u003cli\u003ePastar I, Balukoff NC, Marjanovic J, Chen VY, Stone RC, Tomic-Canic M. Molecular Pathophysiology of Chronic Wounds: Current State and Future Directions. Cold Spring Harb Perspect Biol. 2023;15(4):a041243.\u003c/li\u003e\n\u003cli\u003eCaggiati A, Rosi C, Casini A, Cirenza M, Petrozza V, Acconcia MC, et al. Skin iron deposition characterises lipodermatosclerosis and leg ulcer. Eur J Vasc Endovasc Surg. 2010;40(6):777-782.\u003c/li\u003e\n\u003cli\u003eDixon SJ, Lemberg KM, Lamprecht MR, Skouta R, Zaitsev EM, Gleason CE, et al. Ferroptosis: an iron-dependent form of nonapoptotic cell death. Cell. 2012;149(5):1060-1072.\u003c/li\u003e\n\u003cli\u003eWright JA, Richards T, Srai SK. The role of iron in the skin and cutaneous wound healing. Front Pharmacol. 2014;5:156.\u003c/li\u003e\n\u003cli\u003eRaffetto JD, Ligi D, Maniscalco R, Khalil RA, Mannello F. Why Venous Leg Ulcers Have Difficulty Healing: Overview on Pathophysiology, Clinical Consequences, and Treatment. J Clin Med. 2020;10(1):29.\u003c/li\u003e\n\u003cli\u003eBi M, Li D, Zhang J. Research progress and insights on the role of ferroptosis in wound healing. Int Wound J. 2023;20(6):2473-2481.\u003c/li\u003e\n\u003cli\u003eYuan W, Xia H, Xu Y, Xu C, Chen N, Shao C, et al. The role of ferroptosis in endothelial cell dysfunction. Cell Cycle. 2022;21(18):1897-1914.\u003c/li\u003e\n\u003cli\u003eLiu M, Kong XY, Yao Y, Wang XA, Yang W, Wu H, et al. The critical role and molecular mechanisms of ferroptosis in antioxidant systems: a narrative review. Ann Transl Med. 2022;10(6):368.\u003c/li\u003e\n\u003cli\u003ePan S, Xiong L, Wang Z, Su Y, Fang G, Zhu M, et al. Therapeutic Effect and Mechanism of Negative Pressure Wound Therapy with Huoxue Shengji Decoction Instillation for Chronic Skin Ulcers. Evid Based Complement Alternat Med. 2022;2022:5183809.\u003c/li\u003e\n\u003cli\u003eLurie F, Passman M, Meisner M, Dalsing M, Masuda E, Welch H, et al. The 2020 update of the CEAP classification system and reporting standards. J Vasc Surg Venous Lymphat Disord. 2020;8(3):342-352.\u003c/li\u003e\n\u003cli\u003eMartinez AM, Kim A, Yang WS. Detection of Ferroptosis by BODIPY\u0026trade; 581/591 C11. Methods Mol Biol. 2020;2108:125-130.\u003c/li\u003e\n\u003cli\u003eZamboni P, Izzo M, Tognazzo S, Carandina S, De Palma M, Catozzi L,et al. The overlapping of local iron overload and HFE mutation in venous leg ulcer pathogenesis. Free Radic Biol Med. 2006;40(10):1869-1873.\u003c/li\u003e\n\u003cli\u003eFerris AE, Harding KG. An overview of the relationship between anaemia, iron, and venous leg ulcers. Int Wound J. 2019;16(6):1323-1329.\u003c/li\u003e\n\u003cli\u003eCaggiati A, Franceschini M, Heyn R, Rosi C. Skin erythrodiapedesis during chronic venous disorders. J Vasc Surg. 2011;53(6):1649-1653.\u003c/li\u003e\n\u003cli\u003eCrawford JM, Lal BK, Dur\u0026aacute;n WN, Pappas PJ. Pathophysiology of venous ulceration. J Vasc Surg Venous Lymphat Disord. 2017;5(4):596-605.\u003c/li\u003e\n\u003cli\u003eSindrilaru A, Peters T, Wieschalka S, Baican C, Baican A, Peter H, et al. An unrestrained proinflammatory M1 macrophage population induced by iron impairs wound healing in humans and mice. J Clin Invest. 2011;121(3):985-997.\u003c/li\u003e\n\u003cli\u003eLi J, Cao F, Yin HL, Huang ZJ, Lin ZT, Mao N, et al. Ferroptosis: past, present and future. Cell Death Dis. 2020;11(2):88.\u003c/li\u003e\n\u003cli\u003eLatunde-Dada GO. Ferroptosis: Role of lipid peroxidation, iron and ferritinophagy. Biochim Biophys Acta Gen Subj. 2017;1861(8):1893-1900.\u003c/li\u003e\n\u003cli\u003eConrad M, Sato H. The oxidative stress-inducible cystine/glutamate antiporter, system x (c) (-) : cystine supplier and beyond. Amino Acids. 2012;42(1):231-246.\u003c/li\u003e\n\u003cli\u003eYang WS, SriRamaratnam R, Welsch ME, Shimada K, Skouta R, Viswanathan VS, Cheah JH, et al. Regulation of ferroptotic cancer cell death by GPX4. Cell. 2014;156(1-2):317-331.\u003c/li\u003e\n\u003cli\u003eDodson M, Castro-Portuguez R, Zhang DD. NRF2 plays a critical role in mitigating lipid peroxidation and ferroptosis. Redox Biol. 2019;23:101107.\u003c/li\u003e\n\u003cli\u003eYeoh-Ellerton S, Stacey MC. Iron and 8-isoprostane levels in acute and chronic wounds. J Invest Dermatol. 2003;121(4):918-925.\u003c/li\u003e\n\u003cli\u003eFeng J, Wang J, Wang Y, Huang X, Shao T, Deng X, et al. Oxidative Stress and Lipid Peroxidation: Prospective Associations Between Ferroptosis and Delayed Wound Healing in Diabetic Ulcers. Front Cell Dev Biol. 2022;10:898657.\u003c/li\u003e\n\u003cli\u003eVeith AP, Henderson K, Spencer A, Sligar AD, Baker AB. Therapeutic strategies for enhancing angiogenesis in wound healing. Adv Drug Deliv Rev. 2019;146:97-125.\u003c/li\u003e\n\u003cli\u003eSheng S, Xu J, Liang Q, Hong L, Zhang L. Astragaloside IV Inhibits Bleomycin-Induced Ferroptosis in Human Umbilical Vein Endothelial Cells by Mediating LPC. Oxid Med Cell Longev. 2021;2021:6241242.\u003c/li\u003e\n\u003cli\u003eLuo LF, Guan P, Qin LY, Wang JX, Wang N, Ji ES. Astragaloside IV inhibits adriamycin-induced cardiac ferroptosis by enhancing Nrf2 signaling. Mol Cell Biochem. 2021;476(7):2603-2611.\u003c/li\u003e\n\u003cli\u003eShen Y, Shen X, Wang S, Zhang Y, Wang Y, Ding Y, et al. Protective effects of Salvianolic acid B on rat ferroptosis in myocardial infarction through upregulating the Nrf2 signaling pathway. Int Immunopharmacol. 2022;112:109257.\u003c/li\u003e\n\u003cli\u003eWu C, Duan F, Yang R, Dai Y, Chen X, Li S. 15, 16-Dihydrotanshinone I protects against ischemic stroke by inhibiting ferroptosis via the activation of nuclear factor erythroid 2-related factor 2. Phytomedicine. 2023;114:154790.\u003c/li\u003e\n\u003cli\u003eGuo H, Zhu L, Tang P, Chen D, Li Y, Li J, et al. Carthamin yellow improves cerebral ischemia‑reperfusion injury by attenuating inflammation and ferroptosis in rats. Int J Mol Med. 2021;47(4):52.\u003c/li\u003e\n\u003cli\u003eTan H, Chen J, Li Y, Li Y, Zhong Y, Li G, et al. Glabridin, a bioactive component of licorice, ameliorates diabetic nephropathy by regulating ferroptosis and the VEGF/Akt/ERK pathways. Mol Med. 2022;28(1):58.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-complementary-medicine-and-therapies","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bcam","sideBox":"Learn more about [BMC Complementary Medicine and Therapies](https://bmccomplementmedtherapies.biomedcentral.com/)","snPcode":"","submissionUrl":"","title":"BMC Complementary Medicine and Therapies","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"venous leg ulcer, ferroptosis, Chinese herbal compound, iron overload, HUVECs.","lastPublishedDoi":"10.21203/rs.3.rs-4239207/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4239207/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e Venous leg ulcer (VLU) represents one of the most severe clinical manifestations in the progression of chronic venous diseases (CVD), imposes substantial burdens on both patients and society. The etiology of VLU is associated with the impairment of vascular endothelial cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods:\u003c/strong\u003e In clinical, a total of 10 patients diagnosed with VLU were enrolled in this study, and 4 types of skin tissue samples were collected from each patient, including normal, hyperpigmentation, lipodermatosclerosis, and VLU areas. Subsequently, the iron content and GPX activity were quantified. \u003cem\u003eIn vitro\u003c/em\u003e, iron overload models of HUVECs were established by exogenous 100\u003cem\u003eμ\u003c/em\u003eM FAC or 100\u003cem\u003eμ\u003c/em\u003eM Hemin to simulate simple iron overload and hemoglobin exudation, respectively. And ferroptosis medel was induced by 10\u003cem\u003eμ\u003c/em\u003eM Erastin. Meanwhile, Huoxue Shengji Decoction (HXSJ Decoction) as an external Chinese herbal decoction used in VLU treatment, has been incorporated into our \u003cem\u003ein vitro\u003c/em\u003e study. Followed by the lipid peroxidation damage was evaluated by the content of malondialdehyde, protein carbonylation, ferrous ion, DCFH-DA and BODIPY™ 581/591 C11 staining; mitochondrial function was determined through ATP content and mitochondrial membrane potential (MMP) of JC-1 staining; the activation of Nrf2/system Xc\u003csup\u003e-\u003c/sup\u003e/GPX4 axis was assessed through GPX activity, GSH content, qPCR and western blot.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e The clinical results showed that, before progressing to VLU, iron deposition in the affected tissues of CVD gradually intensifies (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05), and suddenly decreases in VLU stage (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01). Meanwhile, in hyperpigmentation stage, the GPX activity increased significantly (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05), with further deterioration of CVD, GPX activity was gradually suppressed (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05). The \u003cem\u003ein vitro\u003c/em\u003e results indicate that irrespective of iron overload or ferroptosis models, HXSJ Decoction effectively upregulated the expression of Nrf2, xCT, and GPX4 (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05); inhibited the generation of malondialdehyde (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01) and protein carbonylation (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.01), alleviated the accumulation of ferrous ions (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05); restored MMP, promoted ATP production (\u003cem\u003eP\u003c/em\u003e\u0026lt;0.05).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions:\u003c/strong\u003e Overall, this study suggested that iron accumulation-mediated inactivation of GPX4 is a significant contributing factor in VLU development through ferroptosis induction. Additionally, it revealed that the therapeutic mechanism of HXSJ Decoction potentially involves mitigating ferroptosis by activating the Nrf2/system Xc-/GPX4 pathway and alleviating the accumulation of ferrous ions.\u003c/p\u003e","manuscriptTitle":"Potential Mechanism of HXSJ Decoction in the Treatment of Venous Leg Ulcer: Based on the Association between Venous Leg Ulcers and Ferroptosis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-25 16:26:58","doi":"10.21203/rs.3.rs-4239207/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-01-10T14:06:11+00:00","index":"","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-09-06T07:20:35+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-09-03T09:47:08+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-04-17T05:43:50+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-04-17T05:28:31+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Complementary Medicine and Therapies","date":"2024-04-09T02:25:41+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-complementary-medicine-and-therapies","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bcam","sideBox":"Learn more about [BMC Complementary Medicine and Therapies](https://bmccomplementmedtherapies.biomedcentral.com/)","snPcode":"","submissionUrl":"","title":"BMC Complementary Medicine and Therapies","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"0046fbf9-6f1c-4255-b79f-0f0784bdd63d","owner":[],"postedDate":"April 25th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2025-11-06T12:53:22+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-25 16:26:58","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4239207","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4239207","identity":"rs-4239207","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00