Photobiomodulation Combined with Human Umbilical Cord Mesenchymal Stem Cells Modulates the Polarization of Microglia

Photobiomodulation Combined with Human Umbilical Cord Mesenchymal Stem Cells Modulates the Polarization of Microglia | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Photobiomodulation Combined with Human Umbilical Cord Mesenchymal Stem Cells Modulates the Polarization of Microglia Na Li, Hongyu Zhu, Yuanhao Cai, Jun Guo, Pai Liu, Zhibo Han, Huancheng Wu, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4697618/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Neuroinflammation develops in neurodegenerative diseases. The severity of neuroinflammation is closely linked to microglial polarization. Different microglial phenotypes release inflammatory cytokines with distinct functions. Modulation of microglial polarization to alter neuroinflammation is a potential therapeutic strategy. Human umbilical cord mesenchymal stem cells (hUCMSCs) possess multiple stem cell properties that can be used to modulate inflammation. Various methods of pre-treatment of stem cells have shown enhanced efficacy in disease treatment. Photobiomodulation (PBM) is a non-invasive intervention that can reduce inflammation. Our in vitro experiments established a microglial cell inflammation model and demonstrated that PBM pre-treated hUCMSCs exhibited reduced the release of pro-inflammatory cytokines while promoting the expression of anti-inflammatory cytokines in microglia. This treatment significantly reduced the expression of Notch pathway-related genes in an inflammatory model, facilitated decreased M1 phenotype polarization, and increased M2 phenotype polarization in microglia. An animal inflammation model was established. In vivo studies showed that 808 nm light combined with hUCMSCs improved memory. and significantly reduced pro-inflammatory cytokines release in serum and brain tissue of male C57BL/6J mice, while promoting the expression of anti-inflammatory cytokines and M2 phenotype polarization of microglia. The results highlight the crucial role of 808 nm PBM in modulating microglial function and attenuating neuroinflammation through interaction with hUCMSCs. The findings offer novel insights into the molecular mechanisms of microglial polarization. HUCMSCs Photobiomodulation Neuroinflammation Microglial polarization Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Neuroinflammation is a key neurodegenerative disease marker. Chronic neuroinflammation releases pro-inflammatory cytokines and activates local immune cells [ 1 ], thereby impairing neuronal repair, causing mitochondrial dysfunction and breaking down the blood-brain barrier, disrupting tissue homeostasis, inducing neurotoxicity [ 2 ], and exacerbating neurodegeneration [ 3 ]. Microglia and astrocytes perform protective functions in the central nervous system [ 4 ]. Microglia can generate different polarization phenotypes to promote functional alterations and regulate neuroinflammation [ 5 ]. They can be polarised into a neurotoxic M1 phenotype or a neuroprotective M2 phenotype under various stimuli and stimulation degrees[ 6 ], which is crucial in inflammatory diseases. Therefore, the modulation of the M2 phenotype of microglia plays a pivotal role in the treatment of neurodegenerative diseases. Mesenchymal stem cells (MSCs) are useful for immunomodulatory therapy due to their paracrine effects [ 7 , 8 ]. Therapeutic efficacy predominantly relies on the paracrine signalling between cells [ 9 , 10 ]. The state of MSCs determines the transmitted signal [ 11 ]. Pre-treatment of MSCs enhances their immunomodulatory, suppressive, and regenerative effects. MSCs produce paracrine signals that modulate microglial polarization to promote anti-inflammatory M2 polarization, reducing neuroinflammation [ 12 – 14 ]. MSC therapy provides therapeutic strategies for numerous diseases. However, prolonged isolation and culture in vitro can cause MSCs to lose some of their biological functions. Pre-treatment of MSCs with different methods can alter the cell growth environment and secretion while improving survival and therapeutic efficacy [ 15 ]. Therefore, it is necessary to pretreat stem cells to improve the efficiency of microglial polarization modulation. Photobiomodulation (PBM) has the potential to significantly reduce inflammation, oedema, and pain and promote tissue regeneration [ 16 ]. The effectiveness of 808 nm near infrared light lies in its ability to modulate microglial polarization, inhibit neuroinflammation, and reduce neuronal injury, apoptosis, and neurodegeneration [ 17 ]. It has shown promise in slowing the progression of Alzheimer's disease (AD) [ 17 ] and improve motor function in mice with spinal cord injury [ 18 ]. Additionally, the use of 40 Hz light flickering can improve memory function in an AD animal model [ 19 ]. PBM can enhance the viability of MSCs in vitro and in animal models [ 20 ], alter related molecules in stem cell exosomes, and cause various therapeutic effects in pathological models [ 21 ]. PBM pre-treatment shows promise for improving the viability and antioxidant capacity of human umbilical cord mesenchymal stem cells (hUCMSCs) [ 22 , 23 ] while reducing the excessive secretion of inflammatory cytokines [ 24 ]. This treatment also promotes wound healing and angiogenesis [ 25 ], which are expected to maintain and enhance the properties of MSCs. These findings provide novel insights for future experimental and clinical trials [ 26 ]. Based on the above advantages, our study used PBM pre-treatment, followed by treatment of inflamed microglia and mice. The treatment’s impact on microglial M1/M2 polarization and the regulation of inflammation were investigated. The regulatory mechanisms of PBM in combination with hUCMSCs on microglial phenotypes and neuroinflammation were further investigated. Materials and Methods Cell Culture and Conditioned Medium BV2 mouse microglia cells purchased from Wuhan Pricella Biotechnology Co., Ltd. (China) were cultured in DMEM/F12 medium (Gibco, USA) supplemented with 10% foetal bovine serum (FBS, Gibco, USA) and 1% penicillin–streptomycin solution (Gibco, USA). hUCMSCs provided by Tianjin AmCellGene Co., Ltd. (China) were cultured in α-MEM (Gibco, USA) supplemented with 10% FBS and 1% penicillin–streptomycin solution. The conditioned medium of hUCMSCs (hUCMSC-CM): When the density of hUCMSCs reached 70–80%, cells were cultured under normal conditions or irradiated for 2 days at a dose of 3 J/cm 2 using a low-intensity semiconductor laser with continuous dual wavelengths of 635 nm and 808 nm at 20 mW/cm 2 . The culture was then changed to DMEM/F12 serum-free medium, and the supernatant was collected by centrifugation 24 h later. Experiment Grouping The cell groups were control, LPS (lipopolysaccharide; Solarbio, China), 635 nm (LPS + 635 nm), 808 nm (LPS + 808 nm), c-CM (LPS + hUCMSC-CM), 635-CM (LPS + hUCMSC-CM irradiated with 635 nm), and 808-CM (LPS + hUCMSC-CM irradiated with 808 nm). BV2 cells (1.5×10 5 cells/well) in six-well plates were induced using LPS for 12 h after 24 h of culture, except for the control group. The cells were cultured for 2 days. As shown in Fig. 1 A, the control and LPS groups were cultured for 2 days in DMEM/F12 containing 1% FBS. The 635 nm and 808 nm groups were irradiated twice daily for 2 days at a dose of 3 J/cm 2 in DMEM/F12 medium containing 1% FBS. The hUCMSC-CM groups were cultured for 2 days in conditioned medium prepared with 1% FBS after LPS induction. Animals were treated with non-contact PBM by placing the mice in a phototherapy box with identical power for 10 min, twice daily for 7 days. Thirty mice were randomly divided method into five groups (six mice per group) using the random number table: control group (WT), LPS group (LPS), hUCMSCs group (LPS + hUCMSCs), 808 nm group (LPS + 808 nm), and hUCMSCs + 808 nm group (LPS + hUCMSCs + 808 nm). All groups were randomly assigned and treated accordingly. The positions of the cages were randomised. Animals and Experimental Design All mice were purchased from Beijing Vital River Co., Ltd. (China). Male C57BL/6J specific pathogen-free mice (18–23 g, 6–8 weeks) were used in all experiments to avoid the influence of sex. All animal experiments adhered to the feeding requirements and strictly followed the regulations set by the Experimental Animal Ethics Committee (ethical clearance number: IRM-DWLL-2023017). The mice were maintained under standard control conditions. Mice with aberrant congenital locomotion were excluded from the study. For LPS modelling, mice were injected intraperitoneally with 2 mg/kg of 250 µg/mL LPS for 3 days. In the control group, normal saline (8 mL/kg) was injected intraperitoneally for 3 days. One day after administration, the mice were anaesthetised with isoflurane (RWD, China) and blood was collected from the posterior orbital vein for routine blood tests. hUCMSCs were injected into mice via the tail vein at a dose of 1×10 6 cells dissolved in saline. Before injection, the cells were irradiated twice daily for 3 days at 808 nm. The remaining groups were injected with 100 µL of saline via the tail vein. Except for the irradiation, all other conditions were the same for each group. After masking the groups, behavioural tests were performed on all mice. The next day, each mouse was anaesthetised with isoflurane using an animal anaesthesia machine and blood was collected via the retroorbital vein. All animals (n = 30) were sacrificed by cervical dislocation, and brain tissues and five internal organs were collected for further histopathological and biochemical evaluation. Adipogenic and osteogenic differentiation of hUCMSCs During osteogenic induction, the osteogenic medium (Cyagen, China) was changed every three days for a total of 21 days. For adipogenic induction (Cyagen, China), the lipogenic culture was alternated between solution A for three days and solution B for one day, spanning 20 days. At the end of the induction period, staining was performed, followed by three PBS washes. In each well, 500 µL of either Alizarin Red (Solarbio, China) or Oil Red O (Beyotime, China) was added. Staining was performed for 15 min at room temperature. Staining was completed by two rinses using distilled water. Finally, samples were photographed for further observation. Cell Viability Assay and Inflammatory Cytokines Assay hUCMSCs (5×10 3 cells/well) were seeded into 96-well plates. Cell proliferation was assessed using the MTT assay following irradiation at 635 nm and 808 nm. Tumour necrosis factor-alpha (TNF-α), interleukin (IL)-6, and IL-10 were identified by enzyme linked immunosorbent assay (ELISA) kits (Tongwei, Shanghai, China). The supernatant was extracted from the cell culture fluid, mouse brain tissue, and blood, added to the sample wells, incubated, and washed. The enzyme reagent was added again, incubated, and washed. The colour developed for 10 min, and the reaction was terminated. The absorbance was measured at 450 nm. Immunofluorescence Detection Cell culture was performed as previously described. After completion of the microglial culture, the cells were fixed in 4% paraformaldehyde, incubated with a permeabilising solution (Solarbio, China) and 5% goat serum (Solarbio, China). Subsequently, the samples were incubated with primary antibodies overnight at 4°C. The next day, after five washes, the secondary antibodies were incubated for 1 h. Primary antibodies used included: anti-CD86 (1:200, Solarbio, K000343P, China), anti-ARG1 (1:500, Solarbio, K009684P, China). Fluorescent secondary antibodies included: Goat anti-rabbit IgG labelled with fluorescein isothiocyanate (1:200, SF134; Solarbio, China) and Goat anti-rabbit IgG/Rhodamine B isothiocyanate (1:500, Solarbio, SR134, China). The plates were incubated with 4',6-diamidino-2-phenylindole (DAPI; Solarbio, China) for 5 min in the dark and then sealed with a drop of an anti-fluorescence quencher (Beyotime, China). The same procedure was performed for mouse brain sections. Images were acquired by laser-scanning confocal microscopy. Quantitative real-time PCR (RT-qPCR) hUCMSCs or microglia were plated (1.5×10 5 cells/well) in six-well plates and cultured, followed by irradiation or LPS stimulation and treatment. Total RNA was extracted using TRIzol reagent. mRNA was reverse transcribed to cDNA (TakaRa Bio, Japan) via a two-step process and stored at -20°C. SYBR Green Real-Time PCR (Takaa Bio, Japan) was used to quantify the relative RNA levels. The primer sequences are shown in Table 1 . The 2 −ΔΔCT statistic was used for analysis. Table 1 Forward and reverse primer sequences used for RT-qPCR Gene Forward primer sequence 5’ – 3’ Reverse primer sequence 5’ – 3’ Human NOTCH1 GAGGCGTGGCAGACTATGC CTTGTACTCCGTCAGCGTGA Human NOTCH2 CAACCGCAATGGAGGCTATG GCGAAGGCACAATCATCAATGTT Human Delta1 CTTTCGGCCACAGCACCTAT TGTCATCCTCGCAGAATCCAT Human Hes1 CACGACACCGGATAAACCAAA CTTTCATTTATTCTTGCTCTTCGTCTT Human GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG Mouse NOTCH1 ACACCGTGTAAGAATGCTGGA GCCTGCTGACATGATTTTCCTG Mouse NOTCH2 GACTGCCAATACTCCACCTCT CCATTTTCGCAGGGATGAGAT Mouse Delta1 GCAGGACCTTCTTTCGCGTAT AAGGGGAATCGGATGGGGTT Mouse Hes1 TCAGCGAGTGCATGAACGAG CATGGCGTTGATCTGGGTCA Mouse GAPDH AGGTCGGTGTGAACGGATTTG GGGGTCGTTGATGGCAACA Morris water maze test All the mice underwent localisation navigation experiments before LPS injection. Over a 7-day a training period, the mice were permitted to swim in each quadrant of the maze to find a fixed platform. The platforms were removed for the spatial exploration experiments. The spatial exploration experiment was repeated a the conclusion of the animal intervention treatment. The swimming activity of mice was monitored using an overhead video camera, and the tracks were plotted using UMATracker behavioural tracking software. Terminal deoxynucleotidyl transferase dUTP nick-end labelling (TUNEL) Assay and haematoxylin and eosin (HE) staining The brain tissues of mice were TUNEL (Solarbio, China). After incubation with the TUNEL reaction solution, DAPI was added, and the cells were incubated for 5 min. HE (Solarbio, China) staining was performed by removing the sections from distilled water, staining with haematoxylin for 5 min, and rinsing with eosin after colour separation. Sections were dehydrated in xylene until they became transparent. After staining was complete, the slices were sealed with a resin. Images were captured in a manner similar to that used for immunofluorescence staining. Statistical Analysis Results are shown as mean ± SD. Statistical comparisons between the groups were performed using one-way analysis of variance tests. For correlation analysis, P ≤ 0.05 was considered to indicate significance. Experiments were independently repeated at least three times. GraphPad Prism version 8.0 (GraphPad, USA) was used to generate plots. Results PBM combined with hUCMSCs reduces BV2 cell inflammation The differentiation potential of hUCMSCs was assessed through osteogenic and adipogenic differentiation. After 21 days of osteogenic induction, the cells demonstrated multilayered growth, and the accumulated calcium nodules appeared red after Alizarin Red staining. After 20 days of adipogenic induction, numerous lipid droplets formed in the cytoplasm, which stained dark purple with Oil Red O (Fig. 1 B). These results indicate that hUCMSCs have differentiation potential and can maintain a good and stable cell state. Subsequently, hUCMSCs were irradiated with a 635/808 nm laser (Fig. 1 C). The 635 nm light had the most significant effect on the proliferation of hUCMSCs, while the 808 nm light also promoted proliferation. Next, the effects of LPS on microglia were investigated. LPS concentrations of 1, 2, 4, and 8 µg/mL were screened for their effects on cellular inflammation (Fig. 1 D). The different concentrations of LPS contributed to increased secretion of the pro-inflammatory cytokines TNF-α and IL-6 in BV2 cells. The LPS concentration of 2 µg/mL was selected for subsequent experiments. LPS-induced changes in the expression levels of inflammatory cytokines in BV2 cells were observed in response to different therapeutic interventions (Fig. 1 E). Compared with the control group, the expressions of the pro-inflammatory cytokines TNF-α and IL-6 were significantly higher and the expression of the anti-inflammatory cytokine IL-10 was significantly lower in the LPS group. Compared with the LPS group, TNF-α and IL-6 expressions were increased in the 635 nm group and secretion of IL-6 was promoted in the 808 nm group. However, the c-CM, 635-CM and 808-CM groups all significantly reduced LPS-induced TNF-α and IL-6 expressions, while promoting the IL-10 anti-inflammatory cytokine expression levels. The findings suggest that hUCMSCs or 808 nm light combined with hUCMSCs can effectively regulate inflammatory cytokines expression and have a better therapeutic effect in improving neuroinflammation. PBM combined with hUCMSCs promotes M2 polarization in BV2 cells Next, we investigated whether different therapeutic interventions affected the phenotype of BV2 microglia. Immunofluorescent staining for M1-type markers was performed using CD86 (Fig. 2 A, C). Compared to the control group, the fluorescence intensity of the LPS group was significantly increased. CD86 fluorescence intensity increased in the 635 nm group and notably decreased in the c-CM, 635-CM, and 808-CM groups compared with the LPS group. Staining for the Arg-1 (Fig. 2 B, D), an M2-type marker, showed a significant decrease in fluorescence intensity in the LPS group compared with the control group. However, the 808 nm, c-CM, and 808-CM groups exhibited significantly increased Arg-1 fluorescence intensity compared to the LPS-reduced group. The collective findings indicate that treatment with 808-CM group resulted in a significantly decreased LPS-induced CD86 expression and increased Arg-1 expression in BV2 cells, promoted polarization towards the M2 phenotype. PBM combined with hUCMSCs inhibits expression of Notch signalling pathway The Notch signalling pathway is involved in the inflammatory response and plays a crucial role in microglial activation [ 27 ] (Fig. 3 A). First, we investigated the effect of PBM with 635/808 nm light on the Notch pathway in hUCMSCs (Fig. 3 B). The 635 nm group showed a significant increase in Notch1 mRNA levels, with a tendency toward increased Notch2 and Delta1 mRNA levels in hUCMSCs. The 808 nm group showed significantly decreased mRNA expression of Notch2, Delta1, and Hes1 in hUCMSCs. The mRNA levels of Notch signalling pathway proteins were examined in BV2 cells (Fig. 3 C). Compared with the control group, the LPS group showed significantly increased Notch1, Notch2, Delta1, and Hes1 mRNA expression. Compared to the LPS group, the Notch pathway mRNA expression levels were markedly increased in the 635 nm group and the Notch2 mRNA expression level was reduced in the 808 nm group. The c-CM, 635-CM, and 808-CM groups showed significantly decreased Notch1 and Notch2 mRNA expression during the inflammatory state. Delta1 and Hes1 mRNA expression was decreased. The findings support the conclusion that 808 nm light combined with hUCMSCs can significantly inhibit Notch pathway expression in BV2 cells and alleviate neuroinflammation. PBM combined with hUCMSCs improves learning and memory ability in a mouse model of inflammation The experimental design is shown in Fig. 4 A. As shown in Fig. 4 B, after LPS modelling, there was a significant decrease in the body weight of mice, and the percentage of lymphocytes and the percentage and number of neutrophils in the blood were outside the normal range (Fig. 4 C). These results confirmed the successful establishment of the inflammatory mouse model. Morris water maze experiments were conducted on all groups of mice (Fig. 4 D). As depicted in Fig. 4 E- 4 F, compared to the control group, the number of platform crossings notably decreased, and the escape latency significantly increased in the LPS group. Following various intervention treatments, the number of platform crossings increased, and the escape latency was significantly reduced compared to the LPS group. Next, TUNEL staining was performed on the brains of mice in each group (Fig. 4 G). The number of apoptotic cells increased in the LPS group compared to the control group, whereas a decline was noted in the brains of mice treated with various interventions relative to the LPS group. These findings suggest that each therapeutic intervention enhanced spatial learning and memory and reduced apoptosis in the brains of mice with inflammation. PBM combined with hUCMSCs promotes M2 phenotypic polarization of microglia in inflammatory mice Microglial polarization was assessed in normal and inflamed mice by immunofluorescent labelling of the M2-type marker, Arg-1, in the cortex and CA1 regions (Fig. 5 A). The cells were loosely arranged and the Arg-1 fluorescence intensity decreased in the LPS group than that in the control group. Following intervention in all groups, Arg-1 fluorescence intensity was enhanced in the cortex and CA1 regions compared to that in the LPS group. These results suggest that treatment with hUCMSCs/808 nm light, either alone or in combination promotes microglial Arg-1 expression and M2 polarization in the brains of inflamed mice. The inflammatory cytokines TNF-α, IL-6, and IL-10 were measured in the serum and brain tissue of mice (Fig. 5 B, C). TNF-α and IL-6 expression levels were notably raised in serum and brain tissues of the LPS group compared to the control group. Conversely, IL-10 expression was significantly reduced. In contrast to the LPS group, TNF-α expression levels were significantly lower in serum and brain tissues of mice treated with hUCMSCs and hUCMSCs + 808 nm groups. Following all therapeutic interventions, mice with induced inflammation exhibited a reduction in serum IL-6 expression levels as well as in brain tissue in the 808 nm and hUCMSCs + 808 nm groups. In contrast, in the mice, IL-10 expression in all therapeutic intervention groups was increased, except for the serum of hUCMSCs. In contrast, 808 nm light combined with treatment with hUCMSCs was significant in promoting the expression of anti-inflammatory cytokines and inhibiting the expression of pro-inflammatory cytokines. Safety assessment of PBM combined with hUCMSCs in inflammatory mice The visceral tissues of mice were collected for HE staining (Fig. 6 A). Objective evaluation of tissue sections showed no significant inflammation or toxicity in mice after each intervention compared with the control group. Additionally, HE-stained sections of mouse retinas revealed no significant changes in the inner and outer nuclear layers following each intervention, compared with control group (Fig. 6 B). Discussion A comprehensive study on the effects of PBM combined with hUCMSCs on microglial polarization in inflammatory states was conducted. Microglia differentiate into either M1 or M2 phenotype and perform distinct roles upon detecting potentially injurious or anomalous signals via crucial signalling pathways. In response central nervous system injury, microglia activate the neuroprotective M2 phenotype to release neurotrophic factors and phagocytose. However, sustained activation results in changes in microglial function [ 5 ], an excessive release of inflammatory mediators resulting in neuronal death, and an enhanced neurotoxic M1 phenotype, which inhibits M2 phenotype expression. This inhibition plays a key role in neurodegenerative diseases [ 28 ]. First, we investigated the polarization status of microglia and discovered that both treatment with hUCMSCs and PBM combined with hUCMSCs decreased CD86 expression in inflamed BV2 cells. There was no significant difference in CD86 expression between the control and 808-CM groups, indicating that 808-CM inhibited M1 phenotype polarization more efficiently. In addition, 808-CM promoted microglial differentiation into the M2 phenotype under inflammatory conditions. Administration of hUCMSCs at 808 nm, or in combination with inflamed mice, resulted in the promotion of M2 phenotype polarization of microglia, as well as enhanced learning and memory in mice. The findings indicate that the combination treatment promotes microglial polarization and has a protective effects in both cells and animals. Consistent with experimentally findings, previous studies have demonstrated that modulation of microglial polarization could enhance the protective effects of microglia. Light with a wavelength of 1070 nm alters microglial polarization, reduces M1-like microglia around cortical blood vessels, and improves cognition and memory [ 29 ]. Melatonin can reduce apoptosis and modulate microglial polarization towards the M2 phenotype, which has a neuroprotective role in brain injury caused by ischaemic stroke [ 30 ]. Electroacupuncture enhances the expression of M2 microglia, regulates neuronal excitability, and produces analgesic effects [ 31 ]. Exosomes originating from bone marrow MSCs modulate microglial polarization and ameliorate cerebral ischaemia/reperfusion injury [ 32 ]. Additionally, hUCMSC therapy inhibits M1 microglia and apoptosis, promotes microglial M2 polarization, and improves ataxia in inflamed mice [ 33 ]. The persistent release of pro-inflammatory cytokines by hyperactivated microglia leads to heightened neuroinflammation and exacerbates neurodegenerative diseases [ 34 ]. Factors such as LPS, TNF-α, and cellular debris stimulate microglia to secrete inflammatory factors, further exacerbating neuroinflammation [ 35 ]. We used LPS at different concentrations to induce microglia and found that it promoted the secretion of pro-inflammatory cytokines. Memory behaviour is impaired in LPS-treated mice, and accumulation of pro-inflammatory factors is induced in the hippocampus [ 36 ]. Our findings are consistent with previous research demonstrating that inflammatory conditions in mice lead to increased secretion of inflammatory factors in brain tissues and serum. Additionally, mice with inflammation exhibit impaired learning and memory abilities in a water maze test. Investigating strategies to reduce neuroinflammation may enable the treatment of patients with neurodegenerative diseases [ 37 ]. Bioactive factors secreted in MSCs have immunomodulatory effects [ 38 ]. In MSC therapy, AD patients show attenuated neuroinflammation, restored blood-brain barrier function, and improved cognition [ 39 ], while stroke patients exhibit reduced inflammation in the brain and periphery [ 40 ]. Exosomes derived from atorvastatin-pretreated MSCs can promote cardiac function recovery, reduce apoptosis, and inhibit inflammatory factor secretion in the peri-infarct area [ 41 ]. Additionally, PBM has a modulatory effect on inflammatory microglia and in animal models. The application of 810 nm light promoted the recovery of motor function in spinal cord-injured mice, reduced apoptosis, inhibited neurotoxic microglial activation, and alleviated neuroinflammation [ 18 ]. Near infrared light enhances learning and memory in both humans and animal models [ 42 , 43 ]. Moreover, treatment with coenzyme Q10 and 810 nm light alone or together can boost cognitive function, decrease levels of TNF-α and IL-1β, and alleviate neuroinflammation in mice with cerebral ischaemia [ 44 ]. However, there is limited research regarding the use of PBM pre-treated MSCs in therapy. Our findings show that treatment with 808-CM did not significantly alter the expression of pro-inflammatory and anti-inflammatory cytokines in inflammatory microglia compared to the control group. Nevertheless, it effectively regulated the levels of inflammatory cytokines in activated microglia. These findings suggest that 808-CM has a better therapeutic effect on microglia in the inflammatory state. A more significant difference in the expression of inflammatory factors in inflammatory mice with the 808 nm light combination treatment compared to the LPS group was observed. Different microglial phenotypes release various factors and have different functions [ 28 , 45 ]. Treatment with 808-CM in cells and 808 nm light combined with hUCMSCs in inflammatory mice significantly inhibited TNF-α and IL-6 expression while promoting M2 phenotype polarization, promoted IL-10 expression, and improved learning and memory ability in inflammatory mice. Hence, stem cell therapy along with non-invasive PBM appears to have broad prospects, and can produce superior therapeutic effects than stem cells. The Notch pathway regulates gliogenesis and neuronal differentiation. In addition, it is involved in inflammatory response processes [ 46 ] and pathological events [ 47 ] in the central nervous system. Furthermore, the Notch signalling pathway plays a crucial role in microglial activation and inflammatory processes in neuroinflammatory diseases. Our study indicates that LPS upregulates the expression of the Notch pathway, thereby inducing microglia to adopt the M1 phenotype and promoting neuroinflammation. Consistent with previous research, Notch signalling orchestrates the activation of microglia, contributing to neuroinflammation [ 48 ]. Our research shows that treatment with either hUCMSCs or PBM combined with hUCMSCs within BV2 inflammatory cells leads to a significant reduction in Notch pathway expression and M1 phenotype polarization, with 808 nm light pre-treatment of hUCMSCs having a more significant effect. This phenomenon may be attributed to the reduced expression of the Notch pathway in hUCMSCs induced by 808 nm light. Furthermore, many medicines can modulate macrophage polarization by targeting the Notch signalling pathway [ 49 ]. Irisin attenuates post-ischaemic inflammation and neuronal apoptosis, and ameliorates neurological dysfunction by modulating the Notch pathway [ 50 ]. Lipoxin A4 inhibits the expressions of Notch-1, Hes1, induced nitric oxide synthase, and CD32, and enhances M2 microglial cell expression, which has a protective effect against ischaemic stroke [ 51 ]. Extracellular vesicles from stem cells in adipose tissue effectively decrease macrophage polarization towards M1 and reduce inflammation by modulating Notch-miR148a-3p signalling [ 52 ]. Therefore, regulation of the Notch signalling pathway is a promising subject for research into the prevention and treatment of neuroinflammatory diseases. Nevertheless, our study discovered that 635 nm light and 808 nm light had distinct effects on the Notch signalling pathway. The specific differences between the two wavelengths have not been investigated in depth. To gain a more efficient understanding of its relationship with neuroinflammation, it may be worthwhile to investigate the molecular mechanisms involved in Notch distinctions at different wavelengths. Conclusion In conclusion, our study demonstrates the efficacy of combining PBM with hUCMSCs to mitigate neuroinflammation. The activation of microglia towards the M1 phenotype is evident, characterised by increased secretion of pro-inflammatory factors and heightened expression of the Notch signalling pathway. Concurrent treatment with 808 nm light and hUCMSCs effectively suppressed Notch pathway expression and promoted M2 polarization, which facilitated the protective function of microglia and restored impaired memory in mice. This indicates that PBM combined with hUCMSCs treatment may be a promising treatment modality for attenuating neuroinflammation. Declarations Funding This study was supported by the National Natural Science Foundation of China (U23A2089, 22103055); Hebei Natural Science Foundation(F2024110001)；and open Project of Tianjin Key Laboratory of Optoelectronic Detection Technology and System (No.2024LODTS215, 2024LODTS216). Competing interests The authors have declared that no competing interest exists. Author contributions NL: Assist to complete the experiment and analyse and interpret the data. HYZ: Data interpretation, visualization, manuscript revision. YHC: Conception and design, data collection and analysis and manuscript writing. JG and PL: Data analysis and curate. ZBH: Provision of study material and data collection. HCW: Assist to complete the experiment and analysis of data. YL: Conceptualisation, validation, and financial support. HLC: Conception and design, data analysis, supervision, and financial support. All the authors have approved the final manuscript. Data availability All data generated or analysed during this study are included in this published article. Ethics approval Consent to participate Animal experiments and procedures were carried out in accordance with the protocol Approval No. IRM-DWLL-2023017, and approved by the Experimental Animal Ethics Committee, Institute of Radiological Medicine, Chinese Academy of Medical Sciences on February 28, 2023. Consent to participate and publication Not applicable. Acknowledgments Not applicable References Rowitch DH, Kriegstein AR (2010) Developmental genetics of vertebrate glial-cell specification. Nature 468:214–222. https://doi.org/10.1038/nature09611 Klein RS, Hunter CA (2017) Protective and pathological immunity during central nervous system infections. Immunity 46:891–909. https://doi.org/10.1016/j.immuni.2017.06.012 Sweeney MD, Sagare AP, Zlokovic BV (2018) Blood-brain barrier breakdown in Alzheimer disease and other neurodegenerative disorders. Nat Rev Neurol 14:133–150. https://doi.org/10.1038/nrneurol.2017.188 Medzhitov R (2008) Origin and physiological roles of inflammation. Nature 454:428–435. https://doi.org/10.1038/nature07201 West PK, McCorkindale AN, Guennewig B, Ashhurst TM, Viengkhou B, Hayashida E et al (2022) The cytokines interleukin-6 and interferon-α induce distinct microglia phenotypes. J Neuroinflammation 19:96. https://doi.org/10.1186/s12974-022-02441-x Medrano-Jiménez E, Meza-Sosa KF, Urbán-Aragón JA, Secundino I, Pedraza-Alva G, Pérez-Martínez L (2022) Microglial activation in alzheimer's disease: The role of flavonoids and micrornas. J Leukoc Biol 112:47–77. https://doi.org/10.1002/jlb.3mr1021-531r Zhou Y, Yamamoto Y, Xiao Z, Ochiya T (2019) The immunomodulatory functions of mesenchymal stromal/stem cells mediated via paracrine activity. J Clin Med 8. https://doi.org/10.3390/jcm8071025 Nan C, Zhang Y, Zhang A, Shi Y, Yan D, Sun Z et al (2024) Exosomes derived from human umbilical cord mesenchymal stem cells decrease neuroinflammation and facilitate the restoration of nerve function in rats suffering from intracerebral hemorrhage. Molecular and cellular biochemistry. https://doi.org/10.1007/s11010-024-04954-w Turturici G, Tinnirello R, Sconzo G, Geraci F (2014) Extracellular membrane vesicles as a mechanism of cell-to-cell communication: Advantages and disadvantages. Am J Physiol Cell Physiol 306:C621–633. https://doi.org/10.1152/ajpcell.00228.2013 Zhang B, Yin Y, Lai RC, Tan SS, Choo AB, Lim SK (2014) Mesenchymal stem cells secrete immunologically active exosomes. Stem Cells Dev 23:1233–1244. https://doi.org/10.1089/scd.2013.0479 Noronha NC, Mizukami A, Caliári-Oliveira C, Cominal JG, Rocha JLM, Covas DT et al (2019) Priming approaches to improve the efficacy of mesenchymal stromal cell-based therapies. Stem Cell Res Ther 10:131. https://doi.org/10.1186/s13287-019-1224-y Park HJ, Oh SH, Kim HN, Jung YJ, Lee PH (2016) Mesenchymal stem cells enhance α-synuclein clearance via M2 microglia polarization in experimental and human parkinsonian disorder. Acta Neuropathol 132:685–701. https://doi.org/10.1007/s00401-016-1605-6 Li Y, Sun M, Wang X, Cao X, Li N, Pei D et al (2022) Dental stem cell-derived extracellular vesicles transfer miR-330-5p to treat traumatic brain injury by regulating microglia polarization. Int J Oral Sci 14:44. https://doi.org/10.1038/s41368-022-00191-3 Wang F, Jiang M, Chi Y, Huang G, Jin M (2023) Exosomes from circrna-ptpn4 can modify adsc treatment and repair nerve damage caused by cerebral infarction by shifting microglial M1/M2 polarization. Molecular and cellular biochemistry. https://doi.org/10.1007/s11010-023-04824-x Sadatpoor SO, Salehi Z, Rahban D, Salimi A (2020) Manipulated mesenchymal stem cells applications in neurodegenerative diseases. Int J Stem Cells 13:24–45. https://doi.org/10.15283/ijsc19031 Dompe C, Moncrieff L, Matys J, Grzech-Leśniak K, Kocherova I, Bryja A et al (2020) Photobiomodulation-underlying mechanism and clinical applications. J Clin Med 9. https://doi.org/10.3390/jcm9061724 Yang L, Wu C, Parker E, Li Y, Dong Y, Tucker L et al (2022) Non-invasive photobiomodulation treatment in an Alzheimer disease-like transgenic rat model. Theranostics 12:2205–2231. https://doi.org/10.7150/thno.70756 Wang X, Li X, Zuo X, Liang Z, Ding T, Li K et al (2021) Photobiomodulation inhibits the activation of neurotoxic microglia and astrocytes by inhibiting Lcn2/JAK2-STAT3 crosstalk after spinal cord injury in male rats. J Neuroinflamm 18:256. https://doi.org/10.1186/s12974-021-02312-x Martorell AJ, Paulson AL, Suk HJ, Abdurrob F, Drummond GT, Guan W et al (2019) Multi-sensory gamma stimulation ameliorates alzheimer's-associated pathology and improves cognition. Cell 177:256–271e222. https://doi.org/10.1016/j.cell.2019.02.014 Mostafavinia A, Dehdehi L, Ghoreishi SK, Hajihossainlou B, Bayat M (2017) Effect of in vivo low-level laser therapy on bone marrow-derived mesenchymal stem cells in ovariectomy-induced osteoporosis of rats. J Photochem Photobiol B 175:29–36. https://doi.org/10.1016/j.jphotobiol.2017.08.021 Schneider C, Dungel P, Priglinger E, Danzer M, Schädl B, Nürnberger S (2021) The impact of photobiomodulation on the chondrogenic potential of adipose-derived stromal/stem cells. J Photochem photobiology B Biology 221:112243. https://doi.org/10.1016/j.jphotobiol.2021.112243 Chen H, Wang H, Li Y, Liu W, Wang C, Chen Z (2016) Biological effects of low-level laser irradiation on umbilical cord mesenchymal stem cells. https://doi.org/10.1063/1.4948442 . AIP Advances 6 Chen H, Wu H, Yin H, Wang J, Dong H, Chen Q et al (2019) Effect of photobiomodulation on neural differentiation of human umbilical cord mesenchymal stem cells. Lasers Med Sci 34:667–675. https://doi.org/10.1007/s10103-018-2638-y Chen H, Cai Y, Sun S, Pan Z, Han Z, Liu P et al (2022) Repair effect of photobiomodulation combined with human umbilical cord mesenchymal stem cells on rats with acute lung injury. J Photochem photobiology B Biology 234:112541. https://doi.org/10.1016/j.jphotobiol.2022.112541 Kim K, Lee J, Jang H, Park S, Na J, Myung JK et al (2019) Photobiomodulation enhances the angiogenic effect of mesenchymal stem cells to mitigate radiation-induced enteropathy. Int J Mol Sci 20. https://doi.org/10.3390/ijms20051131 Hu C, Li L (2018) Preconditioning influences mesenchymal stem cell properties in vitro and in vivo. J Cell Mol Med 22:1428–1442. https://doi.org/10.1111/jcmm.13492 Yao L, Kan EM, Kaur C, Dheen ST, Hao A, Lu J et al (2013) Notch-1 signaling regulates microglia activation via NF-κB pathway after hypoxic exposure in vivo and in vitro . PLoS ONE 8:e78439. https://doi.org/10.1371/journal.pone.0078439 Jurga AM, Paleczna M, Kuter KZ (2020) Overview of general and discriminating markers of differential microglia phenotypes. Front Cell Neurosci 14:198. https://doi.org/10.3389/fncel.2020.00198 Tao L, Liu Q, Zhang F, Fu Y, Zhu X, Weng X et al (2021) Microglia modulation with 1070-nm light attenuates Abeta burden and cognitive impairment in alzheimer's disease mouse model. Light Sci Appl 10:179. https://doi.org/10.1038/s41377-021-00617-3 Li D, He T, Zhang Y, Liu J, Zhao H, Wang D et al (2023) Melatonin regulates microglial polarization and protects against ischemic stroke-induced brain injury in mice. Exp Neurol 367:114464. https://doi.org/10.1016/j.expneurol.2023.114464 Wu Q, Zheng Y, Yu J, Ying X, Gu X, Tan Q et al (2023) Electroacupuncture alleviates neuropathic pain caused by SNL by promoting M2 microglia polarization through PD-L1. Int Immunopharmacol 123:110764. https://doi.org/10.1016/j.intimp.2023.110764 Liu X, Zhang M, Liu H, Zhu R, He H, Zhou Y et al (2021) Bone marrow mesenchymal stem cell-derived exosomes attenuate cerebral ischemia-reperfusion injury-induced neuroinflammation and pyroptosis by modulating microglia M1/M2 phenotypes. Exp Neurol 341:113700. https://doi.org/10.1016/j.expneurol.2021.113700 Nam Y, Yoon D, Hong J, Kim MS, Lee TY, Kim KS et al (2020) Therapeutic effects of human mesenchymal stem cells in a mouse model of cerebellar ataxia with neuroinflammation. J Clin Med 9. https://doi.org/10.3390/jcm9113654 Ahmad MA, Kareem O, Khushtar M, Akbar M, Haque MR, Iqubal A et al (2022) Neuroinflammation: A potential risk for dementia. Int J Mol Sci 23. https://doi.org/10.3390/ijms23020616 Guo LT, Wang SQ, Su J, Xu LX, Ji ZY, Zhang RY et al (2019) Baicalin ameliorates neuroinflammation-induced depressive-like behavior through inhibition of toll-like receptor 4 expression via the PI3K/AKT/FoxO1 pathway. J Neuroinflammation 16:95. https://doi.org/10.1186/s12974-019-1474-8 Zhao WX, Zhang JH, Cao JB, Wang W, Wang DX, Zhang XY et al (2017) Acetaminophen attenuates lipopolysaccharide-induced cognitive impairment through antioxidant activity. J Neuroinflammation 14:17. https://doi.org/10.1186/s12974-016-0781-6 Zhang W, Xiao D, Mao Q, Xia H (2023) Role of neuroinflammation in neurodegeneration development. Signal Transduct Target therapy 8:267. https://doi.org/10.1038/s41392-023-01486-5 Das M, Mayilsamy K, Mohapatra SS, Mohapatra S (2019) Mesenchymal stem cell therapy for the treatment of traumatic brain injury: Progress and prospects. Rev Neurosci 30:839–855. https://doi.org/10.1515/revneuro-2019-0002 Kim J, Lee Y, Lee S, Kim K, Song M, Lee J (2020) Mesenchymal stem cell therapy and alzheimer's disease: Current status and future perspectives. J Alzheimers Dis 77:1–14. https://doi.org/10.3233/jad-200219 Anthony S, Cabantan D, Monsour M, Borlongan CV (2022) Neuroinflammation, stem cells, and stroke. Stroke 53:1460–1472. https://doi.org/10.1161/strokeaha.121.036948 Huang P, Wang L, Li Q, Tian X, Xu J, Xu J et al (2020) Atorvastatin enhances the therapeutic efficacy of mesenchymal stem cells-derived exosomes in acute myocardial infarction via up-regulating long non-coding RNA H19. Cardiovasc Res 116:353–367. https://doi.org/10.1093/cvr/cvz139 Hamblin MR (2018) Photobiomodulation for traumatic brain injury and stroke. J Neurosci Res 96:731–743. https://doi.org/10.1002/jnr.24190 Saieva S, Taglialatela G (2022) Near-infrared light reduces glia activation and modulates neuroinflammation in the brains of diet-induced obese mice. Sci Rep 12:10848. https://doi.org/10.1038/s41598-022-14812-8 Salehpour F, Farajdokht F, Mahmoudi J, Erfani M, Farhoudi M, Karimi P et al (2019) Photobiomodulation and coenzyme q(10) treatments attenuate cognitive impairment associated with model of transient global brain ischemia in artificially aged mice. Front Cell Neurosci 13:74. https://doi.org/10.3389/fncel.2019.00074 Atta AA, Ibrahim WW, Mohamed AF, Abdelkader NF (2023) Microglia polarization in nociplastic pain: Mechanisms and perspectives. Inflammopharmacology 31:1053–1067. https://doi.org/10.1007/s10787-023-01216-x Zhang Q, Wang C, Liu Z, Liu X, Han C, Cao X et al (2012) Notch signal suppresses toll-like receptor-triggered inflammatory responses in macrophages by inhibiting extracellular signal-regulated kinase 1/2-mediated nuclear factor κb activation. J Biol Chem 287:6208–6217. https://doi.org/10.1074/jbc.M111.310375 Kao TK, Chang CY, Ou YC, Chen WY, Kuan YH, Pan HC et al (2013) Tetramethylpyrazine reduces cellular inflammatory response following permanent focal cerebral ischemia in rats. Exp Neurol 247:188–201. https://doi.org/10.1016/j.expneurol.2013.04.010 Liang S-Q, Li P-H, Hu Y-Y, Zhao J-L, Shao F-Z, Kuang F et al (2023) Myeloid-specific blockade of notch signaling alleviates dopaminergic neurodegeneration in parkinson’s disease by dominantly regulating resident microglia activation through NF-κB signaling. Frontiers in Immunology 14. https://doi.org/10.3389/fimmu.2023.1193081 Wang C, Ma C, Gong L, Guo Y, Fu K, Zhang Y et al (2021) Macrophage polarization and its role in liver disease. Front Immunol 12:803037. https://doi.org/10.3389/fimmu.2021.803037 Jin Z, Guo P, Li X, Ke J, Wang Y, Wu H (2019) Neuroprotective effects of irisin against cerebral ischemia/ reperfusion injury via Notch signaling pathway. Biomed Pharmacother 120:109452. https://doi.org/10.1016/j.biopha.2019.109452 Li QQ, Ding DH, Wang XY, Sun YY, Wu J (2021) Lipoxin A4 regulates microglial M1/M2 polarization after cerebral ischemia-reperfusion injury via the Notch signaling pathway. Exp Neurol 339:113645. https://doi.org/10.1016/j.expneurol.2021.113645 Bai X, Li J, Li L, Liu M, Liu Y, Cao M et al (2020) Extracellular vesicles from adipose tissue-derived stem cells affect Notch-mir148a-3p axis to regulate polarization of macrophages and alleviate sepsis in mice. Front Immunol 11:1391. https://doi.org/10.3389/fimmu.2020.01391 Additional Declarations No competing interests reported. Supplementary Files GraphicalAbstract.tif GraphicalAbstractSignificanceStatement.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4697618","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":323854518,"identity":"5d89170c-15df-4a08-b2b9-46d381f17aac","order_by":0,"name":"Na Li","email":"","orcid":"","institution":"Tiangong University","correspondingAuthor":false,"prefix":"","firstName":"Na","middleName":"","lastName":"Li","suffix":""},{"id":323854519,"identity":"51cee3ca-77ea-42f8-b031-240a856acc09","order_by":1,"name":"Hongyu Zhu","email":"","orcid":"","institution":"Tiangong University","correspondingAuthor":false,"prefix":"","firstName":"Hongyu","middleName":"","lastName":"Zhu","suffix":""},{"id":323854520,"identity":"f9ed336a-4026-4edb-8cde-1ec2b76c54c3","order_by":2,"name":"Yuanhao Cai","email":"","orcid":"","institution":"Medicine \u0026Technology College of Zunyi Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yuanhao","middleName":"","lastName":"Cai","suffix":""},{"id":323854521,"identity":"858cd3b1-abd2-4728-ac2e-a5ec07268485","order_by":3,"name":"Jun Guo","email":"","orcid":"","institution":"Tiangong University","correspondingAuthor":false,"prefix":"","firstName":"Jun","middleName":"","lastName":"Guo","suffix":""},{"id":323854522,"identity":"e6e0a0e6-2977-4ced-8c08-7d5bf3e45a9a","order_by":4,"name":"Pai Liu","email":"","orcid":"","institution":"Tiangong University","correspondingAuthor":false,"prefix":"","firstName":"Pai","middleName":"","lastName":"Liu","suffix":""},{"id":323854523,"identity":"4f715819-93df-4115-a4f9-12dd5f8df79d","order_by":5,"name":"Zhibo Han","email":"","orcid":"","institution":"AmCellGene Co., Ltd","correspondingAuthor":false,"prefix":"","firstName":"Zhibo","middleName":"","lastName":"Han","suffix":""},{"id":323854524,"identity":"3fc32392-8393-45a5-98ee-1e870ff9c733","order_by":6,"name":"Huancheng Wu","email":"","orcid":"","institution":"Tiangong University","correspondingAuthor":false,"prefix":"","firstName":"Huancheng","middleName":"","lastName":"Wu","suffix":""},{"id":323854525,"identity":"1b46814d-841c-4fbe-a480-95925139bf34","order_by":7,"name":"Yi Liu","email":"","orcid":"","institution":"Tiangong University","correspondingAuthor":false,"prefix":"","firstName":"Yi","middleName":"","lastName":"Liu","suffix":""},{"id":323854526,"identity":"67794a3c-3ff9-4eb9-8713-27c9528aa5e4","order_by":8,"name":"Hongli Chen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABDklEQVRIiWNgGAWjYDACCQYGZhDNx8x8gCEBLsxGhBY2ZrbEBhK1MPAYNiCE8Wjhn9187HFBxR27Nnae7w8e1Nyx65duv8DwoewwUKoBqxaJO8fSjWeceZbcxsy7sSHh2LPkmXPOFDDOOHcYKHUAqxYDiRwzad62w8lsYC1sh5MNbuQkMANFgFIJOLTkf4Nq4XnYkPAPquUvXi05bCAtdkAtjA2JQIbBjfQDzIx4tEjcSDOT5jlzOAEYyIYzEvsOJ0jOyGE42HMunUfiBnYt/DOSn0nzVBy25+c//ODjj29AhkT6wwc/yqzl+Gdg1wIDiQ0IBo/BASCDB696ILBHYrA/IKR6FIyCUTAKRhYAALWyXvrYDgylAAAAAElFTkSuQmCC","orcid":"","institution":"Tiangong University","correspondingAuthor":true,"prefix":"","firstName":"Hongli","middleName":"","lastName":"Chen","suffix":""}],"badges":[],"createdAt":"2024-07-06 16:24:24","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4697618/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4697618/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":61495690,"identity":"89d854ad-7381-46fb-9698-0e461e253f4f","added_by":"auto","created_at":"2024-07-31 11:44:45","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":3681500,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of PBM on activity of hUCMSCs and combination treatment on inflammatory factors. \u003cstrong\u003eA\u003c/strong\u003e Schematic diagram of the experimental cell research design. \u003cstrong\u003eB\u003c/strong\u003e The differentiation ability of hUCMSCs was detected using Alizarin Red staining and Oil Red O staining. \u003cstrong\u003eC\u003c/strong\u003e MTT viability assay of hUCMSCs on 635/808 nm irradiation. \u003cstrong\u003eD\u003c/strong\u003e Detection of levels of TNF-α and IL-6 pro-inflammatory factors in BV2 cells at different concentrations of LPS using ELISA. \u003cstrong\u003eE\u003c/strong\u003e ELISA determination of TNF-α, IL-6, and IL-10 levels in BV2 cells after treatment with 635 nm, 808 nm, c-CM, 635-CM, and 808-CM. Data are mean ± SD of at least three independent experiments. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 and \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 versus the control group; \u003csup\u003e#\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 and \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 versus the LPS group\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4697618/v1/f7b527217c3098db3a6ad75f.jpg"},{"id":61495641,"identity":"bdb29a49-b000-4cb1-a235-d626685ac0db","added_by":"auto","created_at":"2024-07-31 11:44:39","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":11855354,"visible":true,"origin":"","legend":"\u003cp\u003eThe combination of 808 nm light with hUCMSCs treatment promotes microglial polarization. \u003cstrong\u003eA, B\u003c/strong\u003e Fluorescence imaging of the M1 marker CD86 and the M2 marker Arg-1 after treatment \u003cem\u003ein vitro\u003c/em\u003e cell culture. \u003cstrong\u003eC, D\u003c/strong\u003e Relative fluorescent intensities of CD86 and Arg-1 analysed using Image J software. Data are presented as mean ± SD of at least three independent experiments. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 and \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 versus the control group; \u003csup\u003e#\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 and \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 versus the LPS group; Scale bar = 100 µm\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4697618/v1/33a093fd7e25f71a3ba1b796.jpg"},{"id":61495643,"identity":"470a65ae-59ac-4b5e-8566-9dc7f52fc8f0","added_by":"auto","created_at":"2024-07-31 11:44:39","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2570538,"visible":true,"origin":"","legend":"\u003cp\u003ePBM affects the expression of the Notch signalling pathway in hUCMSCs and BV2 cells. \u003cstrong\u003eA\u003c/strong\u003e Role of the Notch signalling pathway in BV2 cells. \u003cstrong\u003eB\u003c/strong\u003e RT-PCR analysis of Notch signal mRNA expression following irradiation of hUCMSCs with 635/808 nm. \u003cstrong\u003eC\u003c/strong\u003e RT-PCR analysis of the Notch signalling pathway mRNA after treatment in BV2 cells. The 2\u003csup\u003e−ΔΔCT\u003c/sup\u003e statistic was utilised for analysis. Data are presented as mean ± SD of at least three independent experiments.\u003csup\u003e *\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 and \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 versus the control group; \u003csup\u003e#\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 and \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 versus the LPS group\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4697618/v1/804e312b0b5907b10a927b92.jpg"},{"id":61495691,"identity":"a5cf3600-dd02-4c5b-ac00-680b4733d216","added_by":"auto","created_at":"2024-07-31 11:44:46","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":4851091,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of treatment on learning and memory in mice with inflammation. \u003cstrong\u003eA\u003c/strong\u003e Schematic diagram of the experimental design in animal research. \u003cstrong\u003eB\u003c/strong\u003e Recorded weight of mice at the end of treatment. \u003cstrong\u003eC\u003c/strong\u003e Recording changes in the percentages of lymphocytes and neutrophils, and number in mice before completion of treatment. \u003cstrong\u003eD\u003c/strong\u003e Representative tracking plots of mice on the test day. \u003cstrong\u003eE, F\u003c/strong\u003e Number of platform crossings and escape latency in the spatial exploration experiment in the Morris water maze test were recorded and analysed.\u003cstrong\u003e G\u003c/strong\u003e TUNEL assay identified apoptotic cells in the brain region were labelled with green fluorescence and counterstained with DAPI to detect the nucleus; scale bar = 50 µm. The white arrows in the magnified images point to typical apoptotic cells; scale bar = 5 µm. Data are presented as mean ± SEM. \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 versus the control group; \u003csup\u003e#\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 and \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 versus the LPS group\u003c/p\u003e","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4697618/v1/1647772168474350f14e8c2e.jpg"},{"id":61495644,"identity":"86d24e06-cc7f-4340-be7f-c9edc4e5b18a","added_by":"auto","created_at":"2024-07-31 11:44:39","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":3761143,"visible":true,"origin":"","legend":"\u003cp\u003eTreatment regulates neuroinflammation and promotes Arg-1 expression. \u003cstrong\u003eA\u003c/strong\u003e Fluorescence imaging of M2 marker Arg-1 after treatment in the cortex and CA1 regions of the hippocampus; scale bar = 50 µm. The magnified images show the typical microglia expressing Arg-1; scale bar = 5 µm. \u003cstrong\u003eB, C\u003c/strong\u003e Inflammatory ELISA detection of the levels of TNF-α, IL-6, and IL-10 in serum and brain tissues. Data are presented as mean ± SD of at least three independent experiments. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 and \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 versus the control group; \u003csup\u003e#\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05 and \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01 versus the LPS group\u003c/p\u003e","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4697618/v1/0eb26d1001a4598a81c48b33.jpg"},{"id":61497184,"identity":"2061c8b1-861b-4d26-8d24-6e0f274b53eb","added_by":"auto","created_at":"2024-07-31 12:00:39","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":10050637,"visible":true,"origin":"","legend":"\u003cp\u003eTreatment has no impact on the safety of the inflamed mice. \u003cstrong\u003eA\u003c/strong\u003e HE-stained sections of heart, liver, spleen, lung and kidney from mice; scale bar = 50 µm. \u003cstrong\u003eB\u003c/strong\u003e HE-stained sections of mice retinas were performed on the treated mice; scale bar = 20 µm\u003c/p\u003e","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4697618/v1/8e8a745597ec99a0d7037c2c.jpg"},{"id":61600342,"identity":"3596ac32-d4b1-49a6-98b3-8e7706fc74eb","added_by":"auto","created_at":"2024-08-01 17:36:51","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":37478636,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4697618/v1/1f082ea2-77b5-4d43-b0de-75fe32059bee.pdf"},{"id":61495645,"identity":"475aca9e-9cf6-418e-b52d-6cc6454f15fc","added_by":"auto","created_at":"2024-07-31 11:44:40","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":19149228,"visible":true,"origin":"","legend":"","description":"","filename":"GraphicalAbstract.tif","url":"https://assets-eu.researchsquare.com/files/rs-4697618/v1/65533bc47c451aabd1c50b0a.tif"},{"id":61496504,"identity":"987706a9-5c60-4a44-869a-2c62220bc8cb","added_by":"auto","created_at":"2024-07-31 11:52:39","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":300801,"visible":true,"origin":"","legend":"","description":"","filename":"GraphicalAbstractSignificanceStatement.docx","url":"https://assets-eu.researchsquare.com/files/rs-4697618/v1/072a2fd03636ac6700a2822b.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Photobiomodulation Combined with Human Umbilical Cord Mesenchymal Stem Cells Modulates the Polarization of Microglia","fulltext":[{"header":"Introduction","content":"\u003cp\u003eNeuroinflammation is a key neurodegenerative disease marker. Chronic neuroinflammation releases pro-inflammatory cytokines and activates local immune cells [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e], thereby impairing neuronal repair, causing mitochondrial dysfunction and breaking down the blood-brain barrier, disrupting tissue homeostasis, inducing neurotoxicity [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e], and exacerbating neurodegeneration [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Microglia and astrocytes perform protective functions in the central nervous system [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Microglia can generate different polarization phenotypes to promote functional alterations and regulate neuroinflammation [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. They can be polarised into a neurotoxic M1 phenotype or a neuroprotective M2 phenotype under various stimuli and stimulation degrees[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], which is crucial in inflammatory diseases. Therefore, the modulation of the M2 phenotype of microglia plays a pivotal role in the treatment of neurodegenerative diseases.\u003c/p\u003e \u003cp\u003eMesenchymal stem cells (MSCs) are useful for immunomodulatory therapy due to their paracrine effects [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Therapeutic efficacy predominantly relies on the paracrine signalling between cells [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. The state of MSCs determines the transmitted signal [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Pre-treatment of MSCs enhances their immunomodulatory, suppressive, and regenerative effects. MSCs produce paracrine signals that modulate microglial polarization to promote anti-inflammatory M2 polarization, reducing neuroinflammation [\u003cspan additionalcitationids=\"CR13\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. MSC therapy provides therapeutic strategies for numerous diseases. However, prolonged isolation and culture \u003cem\u003ein vitro\u003c/em\u003e can cause MSCs to lose some of their biological functions. Pre-treatment of MSCs with different methods can alter the cell growth environment and secretion while improving survival and therapeutic efficacy [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Therefore, it is necessary to pretreat stem cells to improve the efficiency of microglial polarization modulation.\u003c/p\u003e \u003cp\u003ePhotobiomodulation (PBM) has the potential to significantly reduce inflammation, oedema, and pain and promote tissue regeneration [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. The effectiveness of 808 nm near infrared light lies in its ability to modulate microglial polarization, inhibit neuroinflammation, and reduce neuronal injury, apoptosis, and neurodegeneration [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. It has shown promise in slowing the progression of Alzheimer's disease (AD) [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e] and improve motor function in mice with spinal cord injury [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Additionally, the use of 40 Hz light flickering can improve memory function in an AD animal model [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. PBM can enhance the viability of MSCs \u003cem\u003ein vitro\u003c/em\u003e and in animal models [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], alter related molecules in stem cell exosomes, and cause various therapeutic effects in pathological models [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. PBM pre-treatment shows promise for improving the viability and antioxidant capacity of human umbilical cord mesenchymal stem cells (hUCMSCs) [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e] while reducing the excessive secretion of inflammatory cytokines [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. This treatment also promotes wound healing and angiogenesis [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], which are expected to maintain and enhance the properties of MSCs. These findings provide novel insights for future experimental and clinical trials [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eBased on the above advantages, our study used PBM pre-treatment, followed by treatment of inflamed microglia and mice. The treatment\u0026rsquo;s impact on microglial M1/M2 polarization and the regulation of inflammation were investigated. The regulatory mechanisms of PBM in combination with hUCMSCs on microglial phenotypes and neuroinflammation were further investigated.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell Culture and Conditioned Medium\u003c/h2\u003e \u003cp\u003eBV2 mouse microglia cells purchased from Wuhan Pricella Biotechnology Co., Ltd. (China) were cultured in DMEM/F12 medium (Gibco, USA) supplemented with 10% foetal bovine serum (FBS, Gibco, USA) and 1% penicillin\u0026ndash;streptomycin solution (Gibco, USA). hUCMSCs provided by Tianjin AmCellGene Co., Ltd. (China) were cultured in α-MEM (Gibco, USA) supplemented with 10% FBS and 1% penicillin\u0026ndash;streptomycin solution.\u003c/p\u003e \u003cp\u003eThe conditioned medium of hUCMSCs (hUCMSC-CM): When the density of hUCMSCs reached 70\u0026ndash;80%, cells were cultured under normal conditions or irradiated for 2 days at a dose of 3 J/cm\u003csup\u003e2\u003c/sup\u003e using a low-intensity semiconductor laser with continuous dual wavelengths of 635 nm and 808 nm at 20 mW/cm\u003csup\u003e2\u003c/sup\u003e. The culture was then changed to DMEM/F12 serum-free medium, and the supernatant was collected by centrifugation 24 h later.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eExperiment Grouping\u003c/h2\u003e \u003cp\u003eThe cell groups were control, LPS (lipopolysaccharide; Solarbio, China), 635 nm (LPS\u0026thinsp;+\u0026thinsp;635 nm), 808 nm (LPS\u0026thinsp;+\u0026thinsp;808 nm), c-CM (LPS\u0026thinsp;+\u0026thinsp;hUCMSC-CM), 635-CM (LPS\u0026thinsp;+\u0026thinsp;hUCMSC-CM irradiated with 635 nm), and 808-CM (LPS\u0026thinsp;+\u0026thinsp;hUCMSC-CM irradiated with 808 nm). BV2 cells (1.5\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells/well) in six-well plates were induced using LPS for 12 h after 24 h of culture, except for the control group. The cells were cultured for 2 days. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA, the control and LPS groups were cultured for 2 days in DMEM/F12 containing 1% FBS. The 635 nm and 808 nm groups were irradiated twice daily for 2 days at a dose of 3 J/cm\u003csup\u003e2\u003c/sup\u003e in DMEM/F12 medium containing 1% FBS. The hUCMSC-CM groups were cultured for 2 days in conditioned medium prepared with 1% FBS after LPS induction. Animals were treated with non-contact PBM by placing the mice in a phototherapy box with identical power for 10 min, twice daily for 7 days. Thirty mice were randomly divided method into five groups (six mice per group) using the random number table: control group (WT), LPS group (LPS), hUCMSCs group (LPS\u0026thinsp;+\u0026thinsp;hUCMSCs), 808 nm group (LPS\u0026thinsp;+\u0026thinsp;808 nm), and hUCMSCs\u0026thinsp;+\u0026thinsp;808 nm group (LPS\u0026thinsp;+\u0026thinsp;hUCMSCs\u0026thinsp;+\u0026thinsp;808 nm). All groups were randomly assigned and treated accordingly. The positions of the cages were randomised.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eAnimals and Experimental Design\u003c/h2\u003e \u003cp\u003eAll mice were purchased from Beijing Vital River Co., Ltd. (China). Male C57BL/6J specific pathogen-free mice (18\u0026ndash;23 g, 6\u0026ndash;8 weeks) were used in all experiments to avoid the influence of sex. All animal experiments adhered to the feeding requirements and strictly followed the regulations set by the Experimental Animal Ethics Committee (ethical clearance number: IRM-DWLL-2023017).\u003c/p\u003e \u003cp\u003eThe mice were maintained under standard control conditions. Mice with aberrant congenital locomotion were excluded from the study. For LPS modelling, mice were injected intraperitoneally with 2 mg/kg of 250 \u0026micro;g/mL LPS for 3 days. In the control group, normal saline (8 mL/kg) was injected intraperitoneally for 3 days. One day after administration, the mice were anaesthetised with isoflurane (RWD, China) and blood was collected from the posterior orbital vein for routine blood tests. hUCMSCs were injected into mice via the tail vein at a dose of 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e cells dissolved in saline. Before injection, the cells were irradiated twice daily for 3 days at 808 nm. The remaining groups were injected with 100 \u0026micro;L of saline via the tail vein. Except for the irradiation, all other conditions were the same for each group. After masking the groups, behavioural tests were performed on all mice. The next day, each mouse was anaesthetised with isoflurane using an animal anaesthesia machine and blood was collected via the retroorbital vein. All animals (n\u0026thinsp;=\u0026thinsp;30) were sacrificed by cervical dislocation, and brain tissues and five internal organs were collected for further histopathological and biochemical evaluation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eAdipogenic and osteogenic differentiation of hUCMSCs\u003c/h2\u003e \u003cp\u003eDuring osteogenic induction, the osteogenic medium (Cyagen, China) was changed every three days for a total of 21 days. For adipogenic induction (Cyagen, China), the lipogenic culture was alternated between solution A for three days and solution B for one day, spanning 20 days. At the end of the induction period, staining was performed, followed by three PBS washes. In each well, 500 \u0026micro;L of either Alizarin Red (Solarbio, China) or Oil Red O (Beyotime, China) was added. Staining was performed for 15 min at room temperature. Staining was completed by two rinses using distilled water. Finally, samples were photographed for further observation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eCell Viability Assay and Inflammatory Cytokines Assay\u003c/h2\u003e \u003cp\u003ehUCMSCs (5\u0026times;10\u003csup\u003e3\u003c/sup\u003e cells/well) were seeded into 96-well plates. Cell proliferation was assessed using the MTT assay following irradiation at 635 nm and 808 nm. Tumour necrosis factor-alpha (TNF-α), interleukin (IL)-6, and IL-10 were identified by enzyme linked immunosorbent assay (ELISA) kits (Tongwei, Shanghai, China). The supernatant was extracted from the cell culture fluid, mouse brain tissue, and blood, added to the sample wells, incubated, and washed. The enzyme reagent was added again, incubated, and washed. The colour developed for 10 min, and the reaction was terminated. The absorbance was measured at 450 nm.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence Detection\u003c/h2\u003e \u003cp\u003eCell culture was performed as previously described. After completion of the microglial culture, the cells were fixed in 4% paraformaldehyde, incubated with a permeabilising solution (Solarbio, China) and 5% goat serum (Solarbio, China). Subsequently, the samples were incubated with primary antibodies overnight at 4\u0026deg;C. The next day, after five washes, the secondary antibodies were incubated for 1 h. Primary antibodies used included: anti-CD86 (1:200, Solarbio, K000343P, China), anti-ARG1 (1:500, Solarbio, K009684P, China). Fluorescent secondary antibodies included: Goat anti-rabbit IgG labelled with fluorescein isothiocyanate (1:200, SF134; Solarbio, China) and Goat anti-rabbit IgG/Rhodamine B isothiocyanate (1:500, Solarbio, SR134, China). The plates were incubated with 4',6-diamidino-2-phenylindole (DAPI; Solarbio, China) for 5 min in the dark and then sealed with a drop of an anti-fluorescence quencher (Beyotime, China). The same procedure was performed for mouse brain sections. Images were acquired by laser-scanning confocal microscopy.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative real-time PCR (RT-qPCR)\u003c/h2\u003e \u003cp\u003ehUCMSCs or microglia were plated (1.5\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells/well) in six-well plates and cultured, followed by irradiation or LPS stimulation and treatment. Total RNA was extracted using TRIzol reagent. mRNA was reverse transcribed to cDNA (TakaRa Bio, Japan) via a two-step process and stored at -20\u0026deg;C. SYBR Green Real-Time PCR (Takaa Bio, Japan) was used to quantify the relative RNA levels. The primer sequences are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The 2\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e statistic was used for analysis.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eForward and reverse primer sequences used for RT-qPCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eForward primer sequence 5\u0026rsquo; \u0026ndash; 3\u0026rsquo;\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eReverse primer sequence 5\u0026rsquo; \u0026ndash; 3\u0026rsquo;\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eHuman NOTCH1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAGGCGTGGCAGACTATGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCTTGTACTCCGTCAGCGTGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eHuman NOTCH2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAACCGCAATGGAGGCTATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCGAAGGCACAATCATCAATGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eHuman Delta1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTTTCGGCCACAGCACCTAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTGTCATCCTCGCAGAATCCAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eHuman Hes1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACGACACCGGATAAACCAAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCTTTCATTTATTCTTGCTCTTCGTCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eHuman GAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGAGCGAGATCCCTCCAAAAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGGCTGTTGTCATACTTCTCATGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eMouse NOTCH1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACACCGTGTAAGAATGCTGGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGCCTGCTGACATGATTTTCCTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eMouse NOTCH2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGACTGCCAATACTCCACCTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCCATTTTCGCAGGGATGAGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eMouse Delta1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCAGGACCTTCTTTCGCGTAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAAGGGGAATCGGATGGGGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eMouse Hes1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCAGCGAGTGCATGAACGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCATGGCGTTGATCTGGGTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eMouse GAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGGTCGGTGTGAACGGATTTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGGGGTCGTTGATGGCAACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eMorris water maze test\u003c/h2\u003e \u003cp\u003eAll the mice underwent localisation navigation experiments before LPS injection. Over a 7-day a training period, the mice were permitted to swim in each quadrant of the maze to find a fixed platform. The platforms were removed for the spatial exploration experiments. The spatial exploration experiment was repeated a the conclusion of the animal intervention treatment. The swimming activity of mice was monitored using an overhead video camera, and the tracks were plotted using UMATracker behavioural tracking software.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eTerminal deoxynucleotidyl transferase dUTP nick-end labelling (TUNEL) Assay and haematoxylin and eosin (HE) staining\u003c/h2\u003e \u003cp\u003eThe brain tissues of mice were TUNEL (Solarbio, China). After incubation with the TUNEL reaction solution, DAPI was added, and the cells were incubated for 5 min. HE (Solarbio, China) staining was performed by removing the sections from distilled water, staining with haematoxylin for 5 min, and rinsing with eosin after colour separation. Sections were dehydrated in xylene until they became transparent. After staining was complete, the slices were sealed with a resin. Images were captured in a manner similar to that used for immunofluorescence staining.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eResults are shown as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. Statistical comparisons between the groups were performed using one-way analysis of variance tests. For correlation analysis, \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026le;\u0026thinsp;0.05 was considered to indicate significance. Experiments were independently repeated at least three times. GraphPad Prism version 8.0 (GraphPad, USA) was used to generate plots.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003ePBM combined with hUCMSCs reduces BV2 cell inflammation\u003c/h2\u003e \u003cp\u003eThe differentiation potential of hUCMSCs was assessed through osteogenic and adipogenic differentiation. After 21 days of osteogenic induction, the cells demonstrated multilayered growth, and the accumulated calcium nodules appeared red after Alizarin Red staining. After 20 days of adipogenic induction, numerous lipid droplets formed in the cytoplasm, which stained dark purple with Oil Red O (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). These results indicate that hUCMSCs have differentiation potential and can maintain a good and stable cell state.\u003c/p\u003e \u003cp\u003eSubsequently, hUCMSCs were irradiated with a 635/808 nm laser (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). The 635 nm light had the most significant effect on the proliferation of hUCMSCs, while the 808 nm light also promoted proliferation.\u003c/p\u003e \u003cp\u003eNext, the effects of LPS on microglia were investigated. LPS concentrations of 1, 2, 4, and 8 \u0026micro;g/mL were screened for their effects on cellular inflammation (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). The different concentrations of LPS contributed to increased secretion of the pro-inflammatory cytokines TNF-α and IL-6 in BV2 cells. The LPS concentration of 2 \u0026micro;g/mL was selected for subsequent experiments. LPS-induced changes in the expression levels of inflammatory cytokines in BV2 cells were observed in response to different therapeutic interventions (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). Compared with the control group, the expressions of the pro-inflammatory cytokines TNF-α and IL-6 were significantly higher and the expression of the anti-inflammatory cytokine IL-10 was significantly lower in the LPS group. Compared with the LPS group, TNF-α and IL-6 expressions were increased in the 635 nm group and secretion of IL-6 was promoted in the 808 nm group. However, the c-CM, 635-CM and 808-CM groups all significantly reduced LPS-induced TNF-α and IL-6 expressions, while promoting the IL-10 anti-inflammatory cytokine expression levels. The findings suggest that hUCMSCs or 808 nm light combined with hUCMSCs can effectively regulate inflammatory cytokines expression and have a better therapeutic effect in improving neuroinflammation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003ePBM combined with hUCMSCs promotes M2 polarization in BV2 cells\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eNext, we investigated whether different therapeutic interventions affected the phenotype of BV2 microglia. Immunofluorescent staining for M1-type markers was performed using CD86 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, C). Compared to the control group, the fluorescence intensity of the LPS group was significantly increased. CD86 fluorescence intensity increased in the 635 nm group and notably decreased in the c-CM, 635-CM, and 808-CM groups compared with the LPS group. Staining for the Arg-1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB, D), an M2-type marker, showed a significant decrease in fluorescence intensity in the LPS group compared with the control group. However, the 808 nm, c-CM, and 808-CM groups exhibited significantly increased Arg-1 fluorescence intensity compared to the LPS-reduced group. The collective findings indicate that treatment with 808-CM group resulted in a significantly decreased LPS-induced CD86 expression and increased Arg-1 expression in BV2 cells, promoted polarization towards the M2 phenotype.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003ePBM combined with hUCMSCs inhibits expression of Notch signalling pathway\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eThe Notch signalling pathway is involved in the inflammatory response and plays a crucial role in microglial activation [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e] (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). First, we investigated the effect of PBM with 635/808 nm light on the Notch pathway in hUCMSCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). The 635 nm group showed a significant increase in Notch1 mRNA levels, with a tendency toward increased Notch2 and Delta1 mRNA levels in hUCMSCs. The 808 nm group showed significantly decreased mRNA expression of Notch2, Delta1, and Hes1 in hUCMSCs.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe mRNA levels of Notch signalling pathway proteins were examined in BV2 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). Compared with the control group, the LPS group showed significantly increased Notch1, Notch2, Delta1, and Hes1 mRNA expression. Compared to the LPS group, the Notch pathway mRNA expression levels were markedly increased in the 635 nm group and the Notch2 mRNA expression level was reduced in the 808 nm group. The c-CM, 635-CM, and 808-CM groups showed significantly decreased Notch1 and Notch2 mRNA expression during the inflammatory state. Delta1 and Hes1 mRNA expression was decreased. The findings support the conclusion that 808 nm light combined with hUCMSCs can significantly inhibit Notch pathway expression in BV2 cells and alleviate neuroinflammation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003ePBM combined with hUCMSCs improves learning and memory ability in a mouse model of inflammation\u003c/h2\u003e \u003cp\u003eThe experimental design is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB, after LPS modelling, there was a significant decrease in the body weight of mice, and the percentage of lymphocytes and the percentage and number of neutrophils in the blood were outside the normal range (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). These results confirmed the successful establishment of the inflammatory mouse model.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eMorris water maze experiments were conducted on all groups of mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). As depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE-\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF, compared to the control group, the number of platform crossings notably decreased, and the escape latency significantly increased in the LPS group. Following various intervention treatments, the number of platform crossings increased, and the escape latency was significantly reduced compared to the LPS group. Next, TUNEL staining was performed on the brains of mice in each group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG). The number of apoptotic cells increased in the LPS group compared to the control group, whereas a decline was noted in the brains of mice treated with various interventions relative to the LPS group. These findings suggest that each therapeutic intervention enhanced spatial learning and memory and reduced apoptosis in the brains of mice with inflammation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003ePBM combined with hUCMSCs promotes M2 phenotypic polarization of microglia in inflammatory mice\u003c/h2\u003e \u003cp\u003eMicroglial polarization was assessed in normal and inflamed mice by immunofluorescent labelling of the M2-type marker, Arg-1, in the cortex and CA1 regions (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). The cells were loosely arranged and the Arg-1 fluorescence intensity decreased in the LPS group than that in the control group. Following intervention in all groups, Arg-1 fluorescence intensity was enhanced in the cortex and CA1 regions compared to that in the LPS group. These results suggest that treatment with hUCMSCs/808 nm light, either alone or in combination promotes microglial Arg-1 expression and M2 polarization in the brains of inflamed mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe inflammatory cytokines TNF-α, IL-6, and IL-10 were measured in the serum and brain tissue of mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB, C). TNF-α and IL-6 expression levels were notably raised in serum and brain tissues of the LPS group compared to the control group. Conversely, IL-10 expression was significantly reduced. In contrast to the LPS group, TNF-α expression levels were significantly lower in serum and brain tissues of mice treated with hUCMSCs and hUCMSCs\u0026thinsp;+\u0026thinsp;808 nm groups. Following all therapeutic interventions, mice with induced inflammation exhibited a reduction in serum IL-6 expression levels as well as in brain tissue in the 808 nm and hUCMSCs\u0026thinsp;+\u0026thinsp;808 nm groups. In contrast, in the mice, IL-10 expression in all therapeutic intervention groups was increased, except for the serum of hUCMSCs. In contrast, 808 nm light combined with treatment with hUCMSCs was significant in promoting the expression of anti-inflammatory cytokines and inhibiting the expression of pro-inflammatory cytokines.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eSafety assessment of PBM combined with hUCMSCs in inflammatory mice\u003c/h2\u003e \u003cp\u003eThe visceral tissues of mice were collected for HE staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). Objective evaluation of tissue sections showed no significant inflammation or toxicity in mice after each intervention compared with the control group. Additionally, HE-stained sections of mouse retinas revealed no significant changes in the inner and outer nuclear layers following each intervention, compared with control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eA comprehensive study on the effects of PBM combined with hUCMSCs on microglial polarization in inflammatory states was conducted. Microglia differentiate into either M1 or M2 phenotype and perform distinct roles upon detecting potentially injurious or anomalous signals via crucial signalling pathways. In response central nervous system injury, microglia activate the neuroprotective M2 phenotype to release neurotrophic factors and phagocytose. However, sustained activation results in changes in microglial function [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], an excessive release of inflammatory mediators resulting in neuronal death, and an enhanced neurotoxic M1 phenotype, which inhibits M2 phenotype expression. This inhibition plays a key role in neurodegenerative diseases [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFirst, we investigated the polarization status of microglia and discovered that both treatment with hUCMSCs and PBM combined with hUCMSCs decreased CD86 expression in inflamed BV2 cells. There was no significant difference in CD86 expression between the control and 808-CM groups, indicating that 808-CM inhibited M1 phenotype polarization more efficiently. In addition, 808-CM promoted microglial differentiation into the M2 phenotype under inflammatory conditions. Administration of hUCMSCs at 808 nm, or in combination with inflamed mice, resulted in the promotion of M2 phenotype polarization of microglia, as well as enhanced learning and memory in mice. The findings indicate that the combination treatment promotes microglial polarization and has a protective effects in both cells and animals. Consistent with experimentally findings, previous studies have demonstrated that modulation of microglial polarization could enhance the protective effects of microglia. Light with a wavelength of 1070 nm alters microglial polarization, reduces M1-like microglia around cortical blood vessels, and improves cognition and memory [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Melatonin can reduce apoptosis and modulate microglial polarization towards the M2 phenotype, which has a neuroprotective role in brain injury caused by ischaemic stroke [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Electroacupuncture enhances the expression of M2 microglia, regulates neuronal excitability, and produces analgesic effects [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Exosomes originating from bone marrow MSCs modulate microglial polarization and ameliorate cerebral ischaemia/reperfusion injury [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Additionally, hUCMSC therapy inhibits M1 microglia and apoptosis, promotes microglial M2 polarization, and improves ataxia in inflamed mice [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe persistent release of pro-inflammatory cytokines by hyperactivated microglia leads to heightened neuroinflammation and exacerbates neurodegenerative diseases [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Factors such as LPS, TNF-α, and cellular debris stimulate microglia to secrete inflammatory factors, further exacerbating neuroinflammation [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. We used LPS at different concentrations to induce microglia and found that it promoted the secretion of pro-inflammatory cytokines. Memory behaviour is impaired in LPS-treated mice, and accumulation of pro-inflammatory factors is induced in the hippocampus [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Our findings are consistent with previous research demonstrating that inflammatory conditions in mice lead to increased secretion of inflammatory factors in brain tissues and serum. Additionally, mice with inflammation exhibit impaired learning and memory abilities in a water maze test.\u003c/p\u003e \u003cp\u003eInvestigating strategies to reduce neuroinflammation may enable the treatment of patients with neurodegenerative diseases [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Bioactive factors secreted in MSCs have immunomodulatory effects [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. In MSC therapy, AD patients show attenuated neuroinflammation, restored blood-brain barrier function, and improved cognition [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e], while stroke patients exhibit reduced inflammation in the brain and periphery [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Exosomes derived from atorvastatin-pretreated MSCs can promote cardiac function recovery, reduce apoptosis, and inhibit inflammatory factor secretion in the peri-infarct area [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Additionally, PBM has a modulatory effect on inflammatory microglia and in animal models. The application of 810 nm light promoted the recovery of motor function in spinal cord-injured mice, reduced apoptosis, inhibited neurotoxic microglial activation, and alleviated neuroinflammation [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Near infrared light enhances learning and memory in both humans and animal models [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Moreover, treatment with coenzyme Q10 and 810 nm light alone or together can boost cognitive function, decrease levels of TNF-α and IL-1β, and alleviate neuroinflammation in mice with cerebral ischaemia [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eHowever, there is limited research regarding the use of PBM pre-treated MSCs in therapy. Our findings show that treatment with 808-CM did not significantly alter the expression of pro-inflammatory and anti-inflammatory cytokines in inflammatory microglia compared to the control group. Nevertheless, it effectively regulated the levels of inflammatory cytokines in activated microglia. These findings suggest that 808-CM has a better therapeutic effect on microglia in the inflammatory state. A more significant difference in the expression of inflammatory factors in inflammatory mice with the 808 nm light combination treatment compared to the LPS group was observed. Different microglial phenotypes release various factors and have different functions [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Treatment with 808-CM in cells and 808 nm light combined with hUCMSCs in inflammatory mice significantly inhibited TNF-α and IL-6 expression while promoting M2 phenotype polarization, promoted IL-10 expression, and improved learning and memory ability in inflammatory mice. Hence, stem cell therapy along with non-invasive PBM appears to have broad prospects, and can produce superior therapeutic effects than stem cells.\u003c/p\u003e \u003cp\u003eThe Notch pathway regulates gliogenesis and neuronal differentiation. In addition, it is involved in inflammatory response processes [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e] and pathological events [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e] in the central nervous system. Furthermore, the Notch signalling pathway plays a crucial role in microglial activation and inflammatory processes in neuroinflammatory diseases. Our study indicates that LPS upregulates the expression of the Notch pathway, thereby inducing microglia to adopt the M1 phenotype and promoting neuroinflammation. Consistent with previous research, Notch signalling orchestrates the activation of microglia, contributing to neuroinflammation [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. Our research shows that treatment with either hUCMSCs or PBM combined with hUCMSCs within BV2 inflammatory cells leads to a significant reduction in Notch pathway expression and M1 phenotype polarization, with 808 nm light pre-treatment of hUCMSCs having a more significant effect. This phenomenon may be attributed to the reduced expression of the Notch pathway in hUCMSCs induced by 808 nm light. Furthermore, many medicines can modulate macrophage polarization by targeting the Notch signalling pathway [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Irisin attenuates post-ischaemic inflammation and neuronal apoptosis, and ameliorates neurological dysfunction by modulating the Notch pathway [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. Lipoxin A4 inhibits the expressions of Notch-1, Hes1, induced nitric oxide synthase, and CD32, and enhances M2 microglial cell expression, which has a protective effect against ischaemic stroke [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. Extracellular vesicles from stem cells in adipose tissue effectively decrease macrophage polarization towards M1 and reduce inflammation by modulating Notch-miR148a-3p signalling [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. Therefore, regulation of the Notch signalling pathway is a promising subject for research into the prevention and treatment of neuroinflammatory diseases. Nevertheless, our study discovered that 635 nm light and 808 nm light had distinct effects on the Notch signalling pathway. The specific differences between the two wavelengths have not been investigated in depth. To gain a more efficient understanding of its relationship with neuroinflammation, it may be worthwhile to investigate the molecular mechanisms involved in Notch distinctions at different wavelengths.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn conclusion, our study demonstrates the efficacy of combining PBM with hUCMSCs to mitigate neuroinflammation. The activation of microglia towards the M1 phenotype is evident, characterised by increased secretion of pro-inflammatory factors and heightened expression of the Notch signalling pathway. Concurrent treatment with 808 nm light and hUCMSCs effectively suppressed Notch pathway expression and promoted M2 polarization, which facilitated the protective function of microglia and restored impaired memory in mice. This indicates that PBM combined with hUCMSCs treatment may be a promising treatment modality for attenuating neuroinflammation.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the National Natural Science Foundation of China (U23A2089, 22103055); Hebei Natural Science Foundation(F2024110001)；and open Project of Tianjin Key Laboratory of Optoelectronic Detection Technology and System (No.2024LODTS215, 2024LODTS216).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have declared that no competing interest exists.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNL: Assist to complete the experiment and analyse and interpret the data. HYZ: Data interpretation, visualization, manuscript revision. YHC: Conception and design,\u0026nbsp;data collection and analysis\u0026nbsp;and manuscript writing. JG and PL: Data analysis and curate. ZBH: Provision of study material and data collection. HCW: Assist\u0026nbsp;to complete the experiment\u0026nbsp;and analysis of data. YL: Conceptualisation, validation,\u0026nbsp;and\u0026nbsp;financial support. HLC: Conception and design, data analysis, supervision, and\u0026nbsp;financial support. All the authors have approved the final manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analysed during this study are included in this published article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval Consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAnimal experiments and procedures were carried out in accordance with the protocol Approval No. IRM-DWLL-2023017, and approved by the Experimental Animal Ethics Committee, Institute of Radiological Medicine, Chinese Academy of Medical Sciences on February 28, 2023.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to participate\u003c/strong\u003e \u003cstrong\u003eand\u003c/strong\u003e \u003cstrong\u003epublication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eRowitch DH, Kriegstein AR (2010) Developmental genetics of vertebrate glial-cell specification. Nature 468:214\u0026ndash;222. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nature09611\u003c/span\u003e\u003cspan address=\"10.1038/nature09611\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKlein RS, Hunter CA (2017) Protective and pathological immunity during central nervous system infections. Immunity 46:891\u0026ndash;909. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.immuni.2017.06.012\u003c/span\u003e\u003cspan address=\"10.1016/j.immuni.2017.06.012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSweeney MD, Sagare AP, Zlokovic BV (2018) Blood-brain barrier breakdown in Alzheimer disease and other neurodegenerative disorders. Nat Rev Neurol 14:133\u0026ndash;150. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nrneurol.2017.188\u003c/span\u003e\u003cspan address=\"10.1038/nrneurol.2017.188\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMedzhitov R (2008) Origin and physiological roles of inflammation. Nature 454:428\u0026ndash;435. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nature07201\u003c/span\u003e\u003cspan address=\"10.1038/nature07201\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWest PK, McCorkindale AN, Guennewig B, Ashhurst TM, Viengkhou B, Hayashida E et al (2022) The cytokines interleukin-6 and interferon-α induce distinct microglia phenotypes. J Neuroinflammation 19:96. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12974-022-02441-x\u003c/span\u003e\u003cspan address=\"10.1186/s12974-022-02441-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMedrano-Jim\u0026eacute;nez E, Meza-Sosa KF, Urb\u0026aacute;n-Arag\u0026oacute;n JA, Secundino I, Pedraza-Alva G, P\u0026eacute;rez-Mart\u0026iacute;nez L (2022) Microglial activation in alzheimer's disease: The role of flavonoids and micrornas. J Leukoc Biol 112:47\u0026ndash;77. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/jlb.3mr1021-531r\u003c/span\u003e\u003cspan address=\"10.1002/jlb.3mr1021-531r\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou Y, Yamamoto Y, Xiao Z, Ochiya T (2019) The immunomodulatory functions of mesenchymal stromal/stem cells mediated via paracrine activity. J Clin Med 8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/jcm8071025\u003c/span\u003e\u003cspan address=\"10.3390/jcm8071025\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNan C, Zhang Y, Zhang A, Shi Y, Yan D, Sun Z et al (2024) Exosomes derived from human umbilical cord mesenchymal stem cells decrease neuroinflammation and facilitate the restoration of nerve function in rats suffering from intracerebral hemorrhage. Molecular and cellular biochemistry. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11010-024-04954-w\u003c/span\u003e\u003cspan address=\"10.1007/s11010-024-04954-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTurturici G, Tinnirello R, Sconzo G, Geraci F (2014) Extracellular membrane vesicles as a mechanism of cell-to-cell communication: Advantages and disadvantages. Am J Physiol Cell Physiol 306:C621\u0026ndash;633. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1152/ajpcell.00228.2013\u003c/span\u003e\u003cspan address=\"10.1152/ajpcell.00228.2013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang B, Yin Y, Lai RC, Tan SS, Choo AB, Lim SK (2014) Mesenchymal stem cells secrete immunologically active exosomes. Stem Cells Dev 23:1233\u0026ndash;1244. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1089/scd.2013.0479\u003c/span\u003e\u003cspan address=\"10.1089/scd.2013.0479\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNoronha NC, Mizukami A, Cali\u0026aacute;ri-Oliveira C, Cominal JG, Rocha JLM, Covas DT et al (2019) Priming approaches to improve the efficacy of mesenchymal stromal cell-based therapies. Stem Cell Res Ther 10:131. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s13287-019-1224-y\u003c/span\u003e\u003cspan address=\"10.1186/s13287-019-1224-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePark HJ, Oh SH, Kim HN, Jung YJ, Lee PH (2016) Mesenchymal stem cells enhance α-synuclein clearance via M2 microglia polarization in experimental and human parkinsonian disorder. Acta Neuropathol 132:685\u0026ndash;701. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00401-016-1605-6\u003c/span\u003e\u003cspan address=\"10.1007/s00401-016-1605-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Y, Sun M, Wang X, Cao X, Li N, Pei D et al (2022) Dental stem cell-derived extracellular vesicles transfer miR-330-5p to treat traumatic brain injury by regulating microglia polarization. Int J Oral Sci 14:44. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41368-022-00191-3\u003c/span\u003e\u003cspan address=\"10.1038/s41368-022-00191-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang F, Jiang M, Chi Y, Huang G, Jin M (2023) Exosomes from circrna-ptpn4 can modify adsc treatment and repair nerve damage caused by cerebral infarction by shifting microglial M1/M2 polarization. Molecular and cellular biochemistry. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11010-023-04824-x\u003c/span\u003e\u003cspan address=\"10.1007/s11010-023-04824-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSadatpoor SO, Salehi Z, Rahban D, Salimi A (2020) Manipulated mesenchymal stem cells applications in neurodegenerative diseases. Int J Stem Cells 13:24\u0026ndash;45. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.15283/ijsc19031\u003c/span\u003e\u003cspan address=\"10.15283/ijsc19031\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDompe C, Moncrieff L, Matys J, Grzech-Leśniak K, Kocherova I, Bryja A et al (2020) Photobiomodulation-underlying mechanism and clinical applications. J Clin Med 9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/jcm9061724\u003c/span\u003e\u003cspan address=\"10.3390/jcm9061724\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang L, Wu C, Parker E, Li Y, Dong Y, Tucker L et al (2022) Non-invasive photobiomodulation treatment in an Alzheimer disease-like transgenic rat model. Theranostics 12:2205\u0026ndash;2231. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.7150/thno.70756\u003c/span\u003e\u003cspan address=\"10.7150/thno.70756\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang X, Li X, Zuo X, Liang Z, Ding T, Li K et al (2021) Photobiomodulation inhibits the activation of neurotoxic microglia and astrocytes by inhibiting Lcn2/JAK2-STAT3 crosstalk after spinal cord injury in male rats. J Neuroinflamm 18:256. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12974-021-02312-x\u003c/span\u003e\u003cspan address=\"10.1186/s12974-021-02312-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartorell AJ, Paulson AL, Suk HJ, Abdurrob F, Drummond GT, Guan W et al (2019) Multi-sensory gamma stimulation ameliorates alzheimer's-associated pathology and improves cognition. Cell 177:256\u0026ndash;271e222. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cell.2019.02.014\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2019.02.014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMostafavinia A, Dehdehi L, Ghoreishi SK, Hajihossainlou B, Bayat M (2017) Effect of in vivo low-level laser therapy on bone marrow-derived mesenchymal stem cells in ovariectomy-induced osteoporosis of rats. J Photochem Photobiol B 175:29\u0026ndash;36. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jphotobiol.2017.08.021\u003c/span\u003e\u003cspan address=\"10.1016/j.jphotobiol.2017.08.021\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchneider C, Dungel P, Priglinger E, Danzer M, Sch\u0026auml;dl B, N\u0026uuml;rnberger S (2021) The impact of photobiomodulation on the chondrogenic potential of adipose-derived stromal/stem cells. J Photochem photobiology B Biology 221:112243. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jphotobiol.2021.112243\u003c/span\u003e\u003cspan address=\"10.1016/j.jphotobiol.2021.112243\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen H, Wang H, Li Y, Liu W, Wang C, Chen Z (2016) Biological effects of low-level laser irradiation on umbilical cord mesenchymal stem cells. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1063/1.4948442\u003c/span\u003e\u003cspan address=\"10.1063/1.4948442\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. AIP Advances 6\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen H, Wu H, Yin H, Wang J, Dong H, Chen Q et al (2019) Effect of photobiomodulation on neural differentiation of human umbilical cord mesenchymal stem cells. Lasers Med Sci 34:667\u0026ndash;675. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10103-018-2638-y\u003c/span\u003e\u003cspan address=\"10.1007/s10103-018-2638-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen H, Cai Y, Sun S, Pan Z, Han Z, Liu P et al (2022) Repair effect of photobiomodulation combined with human umbilical cord mesenchymal stem cells on rats with acute lung injury. J Photochem photobiology B Biology 234:112541. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jphotobiol.2022.112541\u003c/span\u003e\u003cspan address=\"10.1016/j.jphotobiol.2022.112541\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim K, Lee J, Jang H, Park S, Na J, Myung JK et al (2019) Photobiomodulation enhances the angiogenic effect of mesenchymal stem cells to mitigate radiation-induced enteropathy. Int J Mol Sci 20. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms20051131\u003c/span\u003e\u003cspan address=\"10.3390/ijms20051131\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu C, Li L (2018) Preconditioning influences mesenchymal stem cell properties in vitro and in vivo. J Cell Mol Med 22:1428\u0026ndash;1442. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/jcmm.13492\u003c/span\u003e\u003cspan address=\"10.1111/jcmm.13492\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYao L, Kan EM, Kaur C, Dheen ST, Hao A, Lu J et al (2013) Notch-1 signaling regulates microglia activation via NF-κB pathway after hypoxic exposure in vivo and \u003cem\u003ein vitro\u003c/em\u003e. PLoS ONE 8:e78439. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0078439\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0078439\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJurga AM, Paleczna M, Kuter KZ (2020) Overview of general and discriminating markers of differential microglia phenotypes. Front Cell Neurosci 14:198. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fncel.2020.00198\u003c/span\u003e\u003cspan address=\"10.3389/fncel.2020.00198\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTao L, Liu Q, Zhang F, Fu Y, Zhu X, Weng X et al (2021) Microglia modulation with 1070-nm light attenuates Abeta burden and cognitive impairment in alzheimer's disease mouse model. Light Sci Appl 10:179. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41377-021-00617-3\u003c/span\u003e\u003cspan address=\"10.1038/s41377-021-00617-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi D, He T, Zhang Y, Liu J, Zhao H, Wang D et al (2023) Melatonin regulates microglial polarization and protects against ischemic stroke-induced brain injury in mice. Exp Neurol 367:114464. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.expneurol.2023.114464\u003c/span\u003e\u003cspan address=\"10.1016/j.expneurol.2023.114464\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu Q, Zheng Y, Yu J, Ying X, Gu X, Tan Q et al (2023) Electroacupuncture alleviates neuropathic pain caused by SNL by promoting M2 microglia polarization through PD-L1. Int Immunopharmacol 123:110764. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.intimp.2023.110764\u003c/span\u003e\u003cspan address=\"10.1016/j.intimp.2023.110764\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu X, Zhang M, Liu H, Zhu R, He H, Zhou Y et al (2021) Bone marrow mesenchymal stem cell-derived exosomes attenuate cerebral ischemia-reperfusion injury-induced neuroinflammation and pyroptosis by modulating microglia M1/M2 phenotypes. Exp Neurol 341:113700. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.expneurol.2021.113700\u003c/span\u003e\u003cspan address=\"10.1016/j.expneurol.2021.113700\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNam Y, Yoon D, Hong J, Kim MS, Lee TY, Kim KS et al (2020) Therapeutic effects of human mesenchymal stem cells in a mouse model of cerebellar ataxia with neuroinflammation. J Clin Med 9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/jcm9113654\u003c/span\u003e\u003cspan address=\"10.3390/jcm9113654\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAhmad MA, Kareem O, Khushtar M, Akbar M, Haque MR, Iqubal A et al (2022) Neuroinflammation: A potential risk for dementia. Int J Mol Sci 23. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms23020616\u003c/span\u003e\u003cspan address=\"10.3390/ijms23020616\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo LT, Wang SQ, Su J, Xu LX, Ji ZY, Zhang RY et al (2019) Baicalin ameliorates neuroinflammation-induced depressive-like behavior through inhibition of toll-like receptor 4 expression via the PI3K/AKT/FoxO1 pathway. J Neuroinflammation 16:95. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12974-019-1474-8\u003c/span\u003e\u003cspan address=\"10.1186/s12974-019-1474-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao WX, Zhang JH, Cao JB, Wang W, Wang DX, Zhang XY et al (2017) Acetaminophen attenuates lipopolysaccharide-induced cognitive impairment through antioxidant activity. J Neuroinflammation 14:17. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12974-016-0781-6\u003c/span\u003e\u003cspan address=\"10.1186/s12974-016-0781-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang W, Xiao D, Mao Q, Xia H (2023) Role of neuroinflammation in neurodegeneration development. Signal Transduct Target therapy 8:267. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41392-023-01486-5\u003c/span\u003e\u003cspan address=\"10.1038/s41392-023-01486-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDas M, Mayilsamy K, Mohapatra SS, Mohapatra S (2019) Mesenchymal stem cell therapy for the treatment of traumatic brain injury: Progress and prospects. Rev Neurosci 30:839\u0026ndash;855. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1515/revneuro-2019-0002\u003c/span\u003e\u003cspan address=\"10.1515/revneuro-2019-0002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim J, Lee Y, Lee S, Kim K, Song M, Lee J (2020) Mesenchymal stem cell therapy and alzheimer's disease: Current status and future perspectives. J Alzheimers Dis 77:1\u0026ndash;14. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3233/jad-200219\u003c/span\u003e\u003cspan address=\"10.3233/jad-200219\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnthony S, Cabantan D, Monsour M, Borlongan CV (2022) Neuroinflammation, stem cells, and stroke. Stroke 53:1460\u0026ndash;1472. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1161/strokeaha.121.036948\u003c/span\u003e\u003cspan address=\"10.1161/strokeaha.121.036948\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang P, Wang L, Li Q, Tian X, Xu J, Xu J et al (2020) Atorvastatin enhances the therapeutic efficacy of mesenchymal stem cells-derived exosomes in acute myocardial infarction via up-regulating long non-coding RNA H19. Cardiovasc Res 116:353\u0026ndash;367. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/cvr/cvz139\u003c/span\u003e\u003cspan address=\"10.1093/cvr/cvz139\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHamblin MR (2018) Photobiomodulation for traumatic brain injury and stroke. J Neurosci Res 96:731\u0026ndash;743. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/jnr.24190\u003c/span\u003e\u003cspan address=\"10.1002/jnr.24190\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaieva S, Taglialatela G (2022) Near-infrared light reduces glia activation and modulates neuroinflammation in the brains of diet-induced obese mice. Sci Rep 12:10848. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-022-14812-8\u003c/span\u003e\u003cspan address=\"10.1038/s41598-022-14812-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSalehpour F, Farajdokht F, Mahmoudi J, Erfani M, Farhoudi M, Karimi P et al (2019) Photobiomodulation and coenzyme q(10) treatments attenuate cognitive impairment associated with model of transient global brain ischemia in artificially aged mice. Front Cell Neurosci 13:74. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fncel.2019.00074\u003c/span\u003e\u003cspan address=\"10.3389/fncel.2019.00074\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAtta AA, Ibrahim WW, Mohamed AF, Abdelkader NF (2023) Microglia polarization in nociplastic pain: Mechanisms and perspectives. Inflammopharmacology 31:1053\u0026ndash;1067. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10787-023-01216-x\u003c/span\u003e\u003cspan address=\"10.1007/s10787-023-01216-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Q, Wang C, Liu Z, Liu X, Han C, Cao X et al (2012) Notch signal suppresses toll-like receptor-triggered inflammatory responses in macrophages by inhibiting extracellular signal-regulated kinase 1/2-mediated nuclear factor κb activation. J Biol Chem 287:6208\u0026ndash;6217. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1074/jbc.M111.310375\u003c/span\u003e\u003cspan address=\"10.1074/jbc.M111.310375\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKao TK, Chang CY, Ou YC, Chen WY, Kuan YH, Pan HC et al (2013) Tetramethylpyrazine reduces cellular inflammatory response following permanent focal cerebral ischemia in rats. Exp Neurol 247:188\u0026ndash;201. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.expneurol.2013.04.010\u003c/span\u003e\u003cspan address=\"10.1016/j.expneurol.2013.04.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiang S-Q, Li P-H, Hu Y-Y, Zhao J-L, Shao F-Z, Kuang F et al (2023) Myeloid-specific blockade of notch signaling alleviates dopaminergic neurodegeneration in parkinson\u0026rsquo;s disease by dominantly regulating resident microglia activation through NF-κB signaling. Frontiers in Immunology 14. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fimmu.2023.1193081\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2023.1193081\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang C, Ma C, Gong L, Guo Y, Fu K, Zhang Y et al (2021) Macrophage polarization and its role in liver disease. Front Immunol 12:803037. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fimmu.2021.803037\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2021.803037\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJin Z, Guo P, Li X, Ke J, Wang Y, Wu H (2019) Neuroprotective effects of irisin against cerebral ischemia/ reperfusion injury via Notch signaling pathway. Biomed Pharmacother 120:109452. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biopha.2019.109452\u003c/span\u003e\u003cspan address=\"10.1016/j.biopha.2019.109452\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi QQ, Ding DH, Wang XY, Sun YY, Wu J (2021) Lipoxin A4 regulates microglial M1/M2 polarization after cerebral ischemia-reperfusion injury via the Notch signaling pathway. Exp Neurol 339:113645. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.expneurol.2021.113645\u003c/span\u003e\u003cspan address=\"10.1016/j.expneurol.2021.113645\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBai X, Li J, Li L, Liu M, Liu Y, Cao M et al (2020) Extracellular vesicles from adipose tissue-derived stem cells affect Notch-mir148a-3p axis to regulate polarization of macrophages and alleviate sepsis in mice. Front Immunol 11:1391. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fimmu.2020.01391\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2020.01391\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"HUCMSCs, Photobiomodulation, Neuroinflammation, Microglial polarization","lastPublishedDoi":"10.21203/rs.3.rs-4697618/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4697618/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eNeuroinflammation develops in neurodegenerative diseases. The severity of neuroinflammation is closely linked to microglial polarization. Different microglial phenotypes release inflammatory cytokines with distinct functions. Modulation of microglial polarization to alter neuroinflammation is a potential therapeutic strategy. Human umbilical cord mesenchymal stem cells (hUCMSCs) possess multiple stem cell properties that can be used to modulate inflammation. Various methods of pre-treatment of stem cells have shown enhanced efficacy in disease treatment. Photobiomodulation (PBM) is a non-invasive intervention that can reduce inflammation. Our \u003cem\u003ein vitro\u003c/em\u003e experiments established a microglial cell inflammation model and demonstrated that PBM pre-treated hUCMSCs exhibited reduced the release of pro-inflammatory cytokines while promoting the expression of anti-inflammatory cytokines in microglia. This treatment significantly reduced the expression of Notch pathway-related genes in an inflammatory model, facilitated decreased M1 phenotype polarization, and increased M2 phenotype polarization in microglia. An animal inflammation model was established. \u003cem\u003eIn vivo\u003c/em\u003e studies showed that 808 nm light combined with hUCMSCs improved memory. and significantly reduced pro-inflammatory cytokines release in serum and brain tissue of male C57BL/6J mice, while promoting the expression of anti-inflammatory cytokines and M2 phenotype polarization of microglia. The results highlight the crucial role of 808 nm PBM in modulating microglial function and attenuating neuroinflammation through interaction with hUCMSCs. The findings offer novel insights into the molecular mechanisms of microglial polarization.\u003c/p\u003e","manuscriptTitle":"Photobiomodulation Combined with Human Umbilical Cord Mesenchymal Stem Cells Modulates the Polarization of Microglia","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-07-31 11:44:33","doi":"10.21203/rs.3.rs-4697618/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"a29b3e59-602f-48e0-90b0-8179d510d093","owner":[],"postedDate":"July 31st, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-08-01T17:34:38+00:00","versionOfRecord":[],"versionCreatedAt":"2024-07-31 11:44:33","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4697618","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4697618","identity":"rs-4697618","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}