Morphological feminization in the hermit crabs (family Paguridae) induced by the rhizocephalan barnacles

preprint OA: closed
Full text JSON View at publisher
Full text 120,431 characters · extracted from preprint-html · click to expand
Morphological feminization in the hermit crabs (family Paguridae) induced by the rhizocephalan barnacles | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Morphological feminization in the hermit crabs (family Paguridae) induced by the rhizocephalan barnacles Asami Kajimoto, Aiko Iwasaki, Tsuyoshi Ohira, Kenji Toyota This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5940335/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 05 Jun, 2025 Read the published version in Zoological Letters → Version 1 posted 4 You are reading this latest preprint version Abstract Rhizocephalans (Thecostraca: Cirripedia) are parasitic crustaceans that infect a wide range of decapod hosts, including hermit crabs, crabs, and shrimps. These parasites exert profound effects on their hosts, inducing parasitic castration, suppressing the development of secondary sexual characteristics, feminizing male crabs, and altering male behavior that resembles that of females. In this study, we examined the secondary sexual characteristics of two hermit crabs– Pagurus lanuginosus from Asari Town (Hokkaido, Japan) on the Sea of Japan coast and Pagurus filholi from Chikura Town (Chiba, Japan) on the Pacific coast–both parasitized by Peltogasterella gracilis and Peltogaster sp., respectively. Specifically, we assessed the presence of secondary pleopods and the length of the right large cheliped. Our findings demonstrate that male P . lanuginosus and P . filholi parasitized by P . gracilis and Peltogaster sp. exhibit morphological changes and characteristics of females, confirming morphological feminization. Moreover, the magnitude of parasitic effect on morphological feminization varies between the two host species depending on the rhizocephalan genus. It indicates that the extent of feminization varied depending on the parasite genus. Notably, different parasite genera induced varying degrees of host modification, even within the same host species. Similarly, the level of feminization caused by a single parasite genus differed between host species. Our study highlights the importance to understand the characteristics of both the hermit crab host and rhizocephalan parasite to offer a crucial insights into the morphological feminization of the parasite within its host. Host-parasite interaction Feminization Second pleopod Cheliped length Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Parasitic infections play a crucial role in marine ecosystems, profoundly influencing the reproduction and population dynamics of their host species [ 1 , 2 ]. Among marine parasites, rhizocephalans (Thecostraca: Cirripedia) are particularly notable for their infection of various crustaceans, including hermit crabs [ 3 – 5 ], crabs [ 6 – 7 ], and shrimps [ 8 ]. These parasites exert a significant impact on their hosts by inducing parasitic castration, thereby eliminating their reproductive capability [ 9 ]. Rhizocepahalns exhibit highly specialized adaptations for infection [ 10 ]. Adult females display pronounced sexual dimorphism, hosting dwarf males within their bodies [ 10 – 14 ]. Structurally, the adult female consists of one or more externa (reproductive organs) and an interna, a root-like network that extracts nutrients from the host. Several rhizocephalan species, especially sacculinids, induce morphological feminization of secondary sexual characteristics in their male crab hosts. This transformation affects abdominal shape, chela size, and copulatory appendages [ 7 , 15 – 17 ]. A characteristic modification is the broadening of the male's normally narrow, semicircular abdomen into a female-like shape, particularly prominent in brachyuran crabs [ 7 , 15 – 17 ]. This morphological alteration enables parasitized males to accommodate a greater number of externa within their widened abdomens, facilitating increased offspring hatching [ 18 – 20 ]. Additionally, parasitized male crabs exhibit female-like behaviors, such as larval release activities, involving abdominal waving [ 21 ]. Other morphological changes include reduced chela size, modifications to copulatory appendages [ 7 , 16 , 22 ], and alterations in pleopod numbers [ 16 ]. Parasitic isopods (Bopyroidea) also induce morphological feminization of secondary sexual characteristics in their hosts [ 23 – 26 ]. However, while some studies suggest that bopyroid infection causes minimal harm to hosts [ 27 ], their impact differs from that of rhizocephalans. Unlike rhizocephalans, which chemically castrate their hosts [ 28 ], bopyroids impose an energetic burden, leading to reduced reproductive capability [ 24 , 29 ]. Although bopyroid infections are generally considered less harmful, rhizocephalans are known to exert more severe effects on their hosts [ 30 ]. Morphological feminization induced by rhizocephalans has been documented not only in crabs but also in anomuran and hermit crabs [ 31 – 34 ]. In hermit crabs, the second pleopod, typically a female-specific trait, is either vestigial or absent in males. However, in Pagurus samuelis parasitized by Peltogaster sp. and Pagurus ochotensis parasitized by Peltogasterella gracilis , the second pleopod develops in infected males [ 31 – 33 ]. Additionally, parasitized male P . ochotensis exhibits reduced right cheliped lengths compared to uninfected males, while this reduction is less pronounced in females [ 32 ]. Despite such findings, most studies have focused on single host-parasite pairs, leaving the variation in host effects across different rhizocephalan genera poorly understood. In this study, we observed the sympatric occurrence of P . gracilis and Peltogaster sp. P . gracilis has previously been reported in Asari and Chikura populations [ 5 , 35 , 36 ], whereas Peltogaste r sp. has primarily been documented in adjacent areas, such as Atsuta (Hokkaido, Japan Sea side) and the Boso Peninsula (Chiba Prefecture, Pacific side) [ 3 , 37 ]. The dispersal of rhizocephalans is primarily attributed to the passive distribution of their free-living larvae [ 38 ], making it reasonable that Peltogaster sp. inhabits Asari and Chikura populations. Thus, we investigated the effects of some rhizocephalan species, P . gracilis and Peltogaster sp., on hermit crabs from two distinct regions of Japan: Pagurus lanuginosus from Asari Town (Hokkaido, Japan) on the Sea of Japan coast and Pagurus filholi from Chikura Town (Chiba, Japan) on the Pacific coast. We compared the occurrence frequency of the second pleopod and cheliped length between unparasitized (without externa) and parasitized male hermit crabs. Then, we assessed the magnitude of parasitic effect on the morphological change in the two host species for each parasite to elucidate the impacts of these parasites on their hosts. Materials and methods Sample collection Unparasitized (externa-free) Pagurus lanuginosus were collected in September 2024 (Fig. 1 a, b). Specimens of P . lanuginosus parasitized by peltogasterellids or peltogastrids were also collected from the shore at Asari, Otaru City, Hokkaido, Japan (43.176°N, 141.068°E) (Figs. 1 c and 1 d). Collections were conducted in November 2017, monthly from June to October 2018, and in June, July, September, and November 2019, June, September, and November 2020, September and October 2022, and September 2024. Unparasitized Pagurus filholii wer e collected in June and October 2024 (Figs. 1 e and 1 f). Specimens of P . filholi parasitized by peltogasterellids or peltogastrids were collected from the coastal area near Chikura, Minamiboso City, Chiba, Japan (34.924◦N, 139.942◦E) in March 2023, as well as in June and October 2024 (Figs. 1 g and 1 h). All specimens were preserved in absolute ethanol for subsequent analysis. Species identification based on morphological characteristics and cytochrome c oxidase subunit 1 (COI) sequencing Species identification based on morphological characteristics and cytochrome c oxidase subunit 1 (COI) sequencing To identify rhizocephalan species, we first observed the morphology of the externae. Peltogasterellids have colonial, elongated externae, with colors ranging from white to yellowish [ 3 , 4 ]. In contrast, peltogastrids have oval-shaped externae, with colors transitioning from red (immature) to olive and green (mature) [ 4 , 39 ]. Subsequently, a portion of the externae from peltogasterellids (n = 4 from Asari, n = 4 from Chikura) and peltogastrids (n = 4 from Asari, n = 4 from Chikura) was excised for DNA extraction. The samples were taken from randomly selected parasitized hermit crabs preserved in absolute ethanol at room temperature. Genomic DNA was extracted from the tissue samples using a DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. For rhizocephalan species identification, the mitochondrial COI gene regions were amplified by PCR using a primer pair; crust-cox1f (ACTAATCACAAR GAYATTGG) [ 40 ] and HCO2198 (TAAACTTCAGGGTGACCAAAAAATCA) [ 41 ], under the following conditions: 94°C for 7 min followed by 35 cycles at 94°C for 30 s, 45°C for 30 s, and 72°C for 2 min, with a final extension at 72°C for 7 min. TaKaRa Ex Taq or TaKaRa Ex Taq Hot Start Version (Takara, Shiga, Japan) was used for PCR reactions at 50 µL volume. PCR products were treated with a QIAquick PCR Purification Kit (Qiagen, Hilden, Germany). The sequence of the PCR product was verified by DNA sequencing using the Eurofins sequencing service (Eurofins Genomics, Tokyo, Japan). The eight sequences of peltogasterellids and the eight sequences of peltogastrids obtained were deposited in the DNA Data Bank of Japan (DDBJ) under the accession numbers LC865649–LC865664. Measurements of morphological traits The sex of all hermit crabs was determined by observing the presence of female gonopores under a stereoscopic dissecting microscope. To evaluate the effect of rhizocephalan parasitism on hermit crab morphology, shield length (Figs. 1 a and 1 e), and right large cheliped length (Figs. 1 a and 1 e) were measured using a digital caliper. Additionally, the presence of a second pleopod was confirmed under a stereoscopic dissecting microscope. Statistical analysis To investigate the effect of rhizocephalan infection on the morphological feminization of male hermit crabs, the frequency of a second pleopod was compared between unparasitized and parasitized males in the Asari and Chikura populations using Fisher’s exact test. Cheliped length, a secondary sexual characteristic, was used as an indicator of rhizocephalan infection. To assess the effect of parasitism on relative cheliped length in the Asari and Chikura populations, the equality of regression slopes was tested using shield length as a covariate. Statistical analyses were conducted using SAS version 9.4 (SAS Institute Inc., Cary, NC, USA). The following groups were included in the analysis: unparasitized males with or without a second pleopod, unparasitized females, parasitized males with or without a second pleopod, and parasitized females. If no significant interaction between factors was detected, analysis of covariance (ANCOVA) was performed with shield length as a covariate. For comparisons of the magnitude of parasitic effect on morphological feminization between parasite species for each host species, Hedges’ \(\:g\) was calculated as a measure of effect size [ 42 ]. We calculated the effect sizes as the difference between the mean cheliped/shield length of the parasitized male and unparasitized hermit crabs. We used unparasitized male and female as the baseline for parasitic effects and calculated the effect size for each as follows: $$\:g=\frac{{X}_{parasitized}-{X}_{unparasitized}}{S}j$$ , where \(\:S\) is the pooled standard deviation and calculated as $$\:S=\sqrt{\frac{{(N}_{parasitized}-1)\:{S}_{parasitized}^{2}+{(N}_{unparasitized}-1)\:{S}_{unparasitized}^{2}}{{N}_{parasitized}+{N}_{unparasitized}}}$$ . Here, \(\:{S}_{parasitized}\) and \(\:{S}_{unparasitized}\) are the standard deviations of cheliped/shield length in parasitized and unparasitized groups, respectively. \(\:j\) is a weighting factor based on the number of individuals ( \(\:N\) ) in each case, for the two groups, and is calculated as follows: $$\:j=1-\frac{3}{{4(N}_{parasitized}+{N}_{unparasitized}-2)-1}$$ . The 95% confidence interval (CI) was generated using bootstrapping procedures with 2,000 iterations [ 43 ]. Negative values of the effect size in x-axis and y-axis denote smaller cheliped/shield length compared to unparasitized male and female and positive values denote larger cheliped/shield length, vice versa. When a CI does not include zero, it indicates a statistically significant effect size. We conducted the analyses for effect size using R (version 4.2.2; R Core Team, 2022) and the following R packages: 'ggplot2' (version 3.4.4) for data visualization, 'dplyr' (version 1.1.3) for data manipulation, and 'BootES' (version 1.3.0) for bootstrapping procedures. Results Occurrence of hermit crabs with peltogasterellids or peltogastrids In the Asari population, 65 males and 88 females were unparasitized (externa-free), while 171 males and 207 females were infected with peltogasterellids, and eleven males and twelve females with peltogastrids. In the Chikura population, 30 males and 41 females were unparasitized, while 42 males and 32 females were parasitized by peltogasterellids, and 47 males and 45 females by peltogastrids. Rhizocephalan species identification COI sequencing identified all eight peltogasterellids as Peltogasterella gracilis based on their morphology and sequence similarity (98.44–100%) with reference data (accession numbers: MK604154, OR481992). Among the peltogastrids, those from Asari showed 98.95–100% identity with Peltogaster sp. (accession numbers: OR481986, OR481989), while those from Chikura included three individuals matching Peltogaster postica (99.67–99.84%, MK604147) and one matching Peltogaster lineata (99.01%, MK604142). Due to the lack of prior studies on Peltogaster sp. parasitizing hermit crabs in Asari and Chikura, its identification was limited to the genus level. Presence of the second pleopod in parasitized male hermit crabs The elongated second pleopod is a female-specific morphological characteristic of P . lanuginosus and P . filholi (Figs. 1k and 1n), typically present only as a vestigial structure in unparasitized P . lanuginosus males and P . filholi males (Figs. 1i and 1l). However, a second pleopod was observed in P . lanuginosus and P . filholi males parasitized by P . gracilis or Peltogaster sp. in this study (Figs. j and 1m). Among male P . lanuginosus , individuals parasitized by P . gracilis exhibited a significantly higher frequency of a second pleopod compared to unparasitized individuals (Table 1; Fisher’s exact test, p < 0.01). Conversely, males parasitized by Peltogaster sp. had a significantly lower frequency of a second pleopod compared to those parasitized by P . gracilis (Table 1; Fisher’s exact test, p < 0.01). Similarly, among male P . filholi , the frequency of a second pleopod was significantly higher in individuals parasitized by P . gracilis compared to unparasitized individuals (Table 1; Fisher’s exact test, p < 0.01). Moreover, males parasitized by Peltogaster sp. exhibited a substantially lower frequency of a second pleopod compared to those parasitized by P . gracilis (Table 1; Fisher’s exact test, p < 0.01). Allometric variation in cheliped length between unparasitized and parasitized hermit crabs In both host species, P . lanuginosus and P . filholi , the right cheliped length of individuals parasitized by P . gracilis or Peltogaster sp. was significantly smaller than that of unparasitized ones and more similar to that of females (Fig. 2, 3). Distinct differences were observed in the relationship between shield length and right cheliped length in unparasitized male and female P . lanuginosus (Table 2a; Fig. 2A). For the regression lines of unparasitized males with a second pleopod, no significant differences were detected compared to those of unparasitized males and females (Table 2b; Fig. 2A). Similarly, cheliped length of males parasitized by P . gracilis ,without or with a second pleopod,were obsereved clear difference compared to those of unparasitized males (Table 2c, d; Fig. 2B). The regression lines of males parasitized by P . gracilis closely resembled those of unparasitized females, particulary for parasitized males with a second pleopod, whose regression lines overlapped with those of unparasitized females (Fig. 2B). In contrast, in males parasitized by Peltogaster sp. regardless of the presence of a second pleopod, showed no significant differences in cheliped length compared to unparasitized males, although the small sample sizes limited statistical power (Table 2e, f; Fig. 2C). Among P . lanuginosus females, no significant differences in cheliped length were detected between unparasitized individuals and those parasitized by either P . gracilis or Peltogaster sp., with their regression lines overlapping (Table 2g, h; Fig. 2D). In P . filholi , a significant difference was observed in the slopes of regression lines for cheliped length between unparasitized males and females (Table 3a; Fig. 3A). For unparasitized males with a second pleopod, significant differences in cheliped length were found compared to both unparasitized males and females, with their regression line being closer to that of the females (Table 3b; Fig. 3A). Clear differences in cheliped length were also observed between P . filholi males parasitized by P . gracilis and unparasitized individuals, with the regression line of parasitized males approaching that of females (Table 3c; Fig. 3B). For males parasitized by P . gracilis with a second pleopod, the slope of the regression line differed significantly from that of unparasitized males (Table 3d; Fig. 3B). Additionally, significant differences in cheliped length were observed compared to unparasitized females, although no differences were detected when compared to males parasitized by P . gracilis without a second pleopod (Table 3d; Fig. 3B). Cheliped length in males parasitized by Peltogaster sp. also differed significantly from that of unparasitized males (Table 3e; Fig. 3C). The slope of the regression line for males parasitized by Peltogaster sp. differed significantly from that of unparasitized females (Table 3e; Fig. 3C). Although the small sample size hindered precise analysis of P . filholi males parasitized by Peltogaster sp. with a second pleopod, their cheliped length overlapped with that of females parasitized by Peltogaster sp. (Fig. 3C). For P . filholi parasitized by either P . gracilis or Peltogaster sp., the regression lines were parallel to those of unparasitized females, with significant differences in cheliped length observed between these groups (Table 3f, g; Fig. 3D). Comparison of the parasitic effect on morphological feminization between parasite species for P . lanuginosus and P . filholi Although the cheliped/shield length ratios of males parasitized by P . gracilis or Peltogaster sp. were significantly smaller than those of unparasitized males (x-axis) in both hermit crab species, P . lanuginosus and P . filholi , the effect size of morphological feminization (negative value on the x-axis, deviation from 0 on the y-axis) varied among parasite species depending on host species (Fig. 4). The magnitude of the negative parasitic effect on the cheliped/shield length ratio was more pronounced in P . filholi compared to P . lanuginosus when compared to unparasitized males (x-axis), while the cheliped/shield length ratio was more similar to that of unparasitized females (y-axis) in P . lanuginosus than in P . filholi . Among parasite species, the negative effect on cheliped/shield length ratios relative to unparasitized males was greater in Peltogaster sp. than in P . gracilis for P . lanuginosus , but was similar between the two parasites for P . filholi . In comparison to unparasite females, the cheliped/shield length ratios in Peltogaster sp. were more similar to those of unparasitized females (y = 0) than in P . gracilis for P . lanuginosus , however, a contrasting pattern was observed in P . filholi (Fig. 4). Discussion Presence of a second pleopod in males parasitized by P . gracilis or Peltogaster sp. The presence of the second pleopod, absent in unparasitized males, was observed in males of both P . lanuginosus and P . filholi , indicating that parasitized males exhibit morphological changes resembling female-specific characteristics. This observation is consistent with previous reports by Shiino 1931 [31], Oguro 1955 [32], and Nielsen 1970 [33]. The transformation of pleopod composition suggests that parasitized males develop structures resembling the egg-carrying appendages of females, likely to protect and support rhizocephalan externae. The frequency of second pleopod appearance in males parasitized by P . gracilis was consistently higher than in those parasitized by Peltogaster sp., indicating that the extent of parasitic influence varies among the rhizocephalan genus. One distinguishing feature between these parasites is the number and morphology of externae: P . gracilis typically exhibits multiple, elongate externae, whereas Peltogaster sp. possesses a single, oval-shaped externa [3, 4], a pattern also observed in this study. Grooming behavior by hosts is critical for maintaining rhizocephalan externae, as undergroomed externae can become fouled and necrotic [44]. In P . gracilis , which produces multiple externae, the presence of a second pleopod in male hosts may facilitate grooming. However, second pleopods were also observed in some unparasitized males. In the hermit crab genera Paguristes and Pseudopaguristes , which have no reported cases of rhizocephalan parasitism, the absence of the second pleopod in males has been observed [45, 46]. The presence of a second pleopod in some males without externae may indicate previous rhizocephalan infection. These individuals may have lost their externae or could be in the early stages of infection, where the interna is developing before the formation of the externae. To confirm the actual prevalence of parasitism, dissections of host abdomens and DNA barcoding analysis of rhizocephalan interna are necessary. Reduction of cheliped length in males parasitized by P . gracilis or Peltogaster sp. In males parasitized by P . gracilis , cheliped lengths were significantly reduced compared to unparasitized individuals, regardless of the presence of a second pleopod. This indicates a clear morphological feminization effect, consistent with previous findings [32]. In contrast, males parasitized by Peltogaster sp. showed no reduction in cheliped length in P . lanuginosus , although reductions were observed in P . filholi . Furthermore, P . filholi parasitized by P . gracilis had a significantly smaller cheliped length compared to P . lanuginosus parasitized by P . gracilis ; the parasitic effect size differed between host species. On the other hand, no such apparent difference in terms of cheliped size reduction was observed between P . lanuginosus and P . filholi parasitized by Peltogaster sp.; the parasitic effect sizes were similar in both host species. These findings highlight the genus-specific impact of rhizocephalan on their hosts. Notably, Different parasite genera induced varying degrees of host modification, even within the same host species. Similarly, the level of feminization caused by a single parasite genus differed between host species, and some rhizocephalan species, such as P . gracilis in this study, exhibited differences in the parasitic effect size on the host. Nielsen 1970 [33] also noted that the extent of morphological changes varies among rhizocephalan species and that the same parasite species may exert different effects depending on the host species. However, in interspecific analysis of the host species, the cheliped length of parasitized P . lanuginosus was closer to that of females than that of parasitized P . filholi , regardless of the parasite species. The difference may be attributed to the smaller male-to-female ratio of cheliped/shield length in P . lanuginosus compared to P . filholi , an inherent species-specific characteristic of the hermit crabs. The parasitic effect size of rhizocephalans is likely to be determined by the amount of energy that they extract from the host since the parasite ensures its reproduction success by castrating or sterilizing the host to absorb the host’s reproductive energy [47]. Parasitic castrations often induce changes in the host's behavior and metabolism [47, 48] Energy extraction by rhizocephalans is thought to depend on the number of eggs, egg size, number of breeding events per externa, and number of reproductive externae [19]. However, these factors have not been well-documented for P . gracilis , P . postica , and P . lineata . The different peltogastrid species Peltogaster paguri , which typically possesses one oval-shape externa, undergoes 3–5 breeding events [49], with each event producing between several hundred and 28,000 eggs [49, 50]. Comparable numbers of eggs and breeding events per externae are anticipated for P . postica and P . lineata used in this study. In contrast, the breeding potential per externa remains unclear in peltogasterellids, which possess one or more externae. However, all the externae possess reproductive potential, each capable of at least two breeding events [36]. Therefore, the amount of energy extracted by rhizocephalans from the host may vary between species, leading to differences in parasitic effect sizes on the host. To investigate the relationship between the energy extracted through castration and molting suppression and the parasitic effect on the host, it is crucial to clarify the number of breeding events, number of eggs, egg size, and number of reproductive externae in peltogasterellids and Peltogasterids through long-term rearing experiments. Although Nagler et al. 2017 [19] suggest that host utilization varies among rhizocephalan species, few studies have compared parasitic effect sizes across multiple rhizocephalan and host species. This study is the first to compare not only the effects of two rhizocephalan parasites, P . gracilis and Peltogaster sp., on their host hermit crabs in two geographically distinct populations but also the parasitic effect size between two host species, P . lanuginosus and P . filholi , parasitized by either P . gracilis or Peltogaster sp. However, the lack of species-level identification of Pelrtogaster sp. in this study limits the interpretation of these dynamics. Rhizocephalans have highly simplified external morphology, lacking distinct diagnostic characteristics, which has led to the reliance on histological surveys for species identification [39]. Additionally, unidentified Peltogaster sp., which cannot be distinguished based on external morphology and COI data, further complicates species identification in this study. To gain a more comprehensive understanding of the impacts of rhizocephalans on their host species, future studies should compare host–parasite relationships not only among Paguridae, P . gracilis , and Peltogaster sp., but also across other hermit crab hosts and rhizocephalan species. Morphological feminization in hermit crabs caused by rhizocephalans has been documented for species such as Peltogaster paguri (family Peltogastridae) and P . gracilis (family Peltogasterellidae), which parasitize various Paguridae hosts, including Pagurus pubescens , P . ochotensis , and P . pectinatus [51]. A recent transcriptome study [52] suggests that rhizocephalan parasites may alter neurotransmitter secretion in the eyestalk and thoracic ganglia, leading to feminized morphology and behavior in male hosts. However, the molecular mechanisms underlying morphological feminization remain unclear. Future research should employ comparative transcriptomics of parasitized and unparasitized hosts, along with neurobiological analyses, including neuronal activity tracking and immunohistochemical labeling, to elucidate the mechanisms driving rhizocephalan–induced morphological feminization in hermit crabs. Conclusions Rhizocephalans are significant parasites of decapods, including hermit crabs, crabs, and shrimps. This study is the first to compare the effects of the rhizocephalan parasites P . gracilis and Peltogaster sp. on their host hermit crabs, P . lanuginosus and P . filholi , from two geographically distinct populations (Asari Town, Hokkaido, and Chikura Town, Chiba, Japan). The frequency of second pleopod appearance was consistently higher in males parasitized by P . gracilis than in those parasitized by Peltogaster sp. Furthermore, cheliped length was significantly reduced in males parasitized by P . gracilis compared to unparasitized individuals, whereas males parasitized by Peltogaster sp. exhibited no reduction in cheliped length in P . lanuginosus , although reductions were observed in P . filholi . This study demonstrates that P . gracilis and Peltogaster sp. induce morphological feminization in their host. Additionally, parasitic effects were significantly different between P . lanuginosus and P . filholi parasitized by P . gracilis , whereas similar parasitic effects were observed between the two host species parasitized by Peltogaster sp. These findings indicate that the impact of rhizocephalan infection on host morphology varies by rhizocephalan and host species. Future research should compare host–parasite relationships across other hermit crab hosts and rhizocephalan species to better understand the mechanisms underlying these host–parasite interactions. Declarations Acknowledgements We offer our deepest condolences to Prof. Toru Takahashi, Kumamoto Health Science University (retired), and Dr. Ryota Yoshida, Ochanomizu University, for their valuable comments on this manuscript. We express our gratitude to Prof. Yoichi Yusa, Nara Women’s University, and Mr. Kenji Kato, Shikoku Aquarium, for sampling. We thank all of the members of the Laboratory of Physiological Ecology, Hiroshima University, for their kind help. Authors’ contributions AK prepared specimens. AK and KT designed this study, conducted measurements, and drafted the manuscript. AK, AI, and KT analyzed the data. AI and TO improved the manuscript. Funding This work was supported by the Sasakawa Scientific Research Grant from The Japan Science Society to AK (2022-4015), Japan Science and Technology Agency fellowship to AK (JPMJFS2127), grant from Research Institute of Marine Invertebrates (KO2024-04) to AK, and JSPS KAKENHI grant to KT (24K09616). Availability of data and materials The datasets during the current study are available from the corresponding author on request. Ethics approval and consent to participate in rhizocephalan barnacles and Paguridae (invertebrates) were used for this study. No vertebrate or human individuals or tissues were used. The experimental design and procedures of this study adhered to the guidelines set by the Institutional Animal Care and Use Committee of Kanagawa University. All animal experiments complied with the ARRIVE guidelines [53]. Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. Author details 1 Department of Biological Sciences, Faculty of Science, Kanagawa University, 3-27-1, Rokkakubashi, Kanagawa-ku, Yokohama-city, Kanagawa, 221-8686, Japan. 2 Asamushi Research Center for Marine Biology, Graduate School of Life Sciences, Tohoku University, 9 Sakamoto, Asamushi, Aomori 039-3501, Japan. 3 Department of Biological Science and Technology, Faculty of Advanced Engineering, Tokyo University of Science, 6-3-1 Niijuku, Katsushika-ku, Tokyo 125-8585, Japan. 4 Department of Bioresource Science, Graduate School of Integrated Sciences for Life, Hiroshima University, 1-4-4, Kagamiyama, Higashihiroshima-shi, Hiroshima 739-8528, Japan. References Kuris AM. Trophic interactions: similarity of parasitic castrators to parasitoids. Q. Rev. Biol. 1974;49(2):129–148. Kuris AM, Lafferty KD. Modelling crustacean fisheries: effects of parasites on management strategies. Can. J. Fish. Aquat. Sci. 1992;49(2):327–336. Yoshida R, Hirose M, Hirose E. Hermit crab host prevalence by species of Peltogastridae (Cirripedia: Rhizocephala): hosts vary with locations on the Pacific coast in mainland Japan. J. Crustac. Biol. 2014;34(4):467–480. Jung J, Yoshida R, Kim W. Diversity of parasitic peltogastrid barnacles (Crustacea: Cirripedia: Rhizocephala) on hermit crabs in Korea. Zool. Stud. 2019;58(33). Kajimoto A, Høeg JT, Kato K, Yusa Y. Variations in life cycle and seasonal sex ratio in the rhizocephalan Peltogasterella gracilis (Boschma, 1927)(Cirripedia: Rhizocephala: Peltogasterellidae). J. Crustac. Biol. 2022;42(4):ruac057. Lützen J, Jensen KH, Glenner H. Life history of Sacculina carcini Thompson, 1836 (Cirripedia: Rhizocephala: Sacculinidae) and the intermoult cycle of its host, the shore crab Carcinus maenas (Linnaeus, 1758)(Decapoda: Brachyura: Carcinidae). J. Crustac. Biol. 2018;38(4):413–419. Toyota K, Ito T, Morishima K, Hanazaki R, Ohira T. Sacculina-Induced Morphological Feminization in the Grapsid Crab Pachygrapsus crassipes . Zool. Sci. 2023;40(5):367–374. Lützen J, Itani G, Jespersen Å, Hong JS, Rees D, Glenner H. On a new species of parasitic barnacle (Crustacea: Rhizocephala), Sacculina shiinoi sp. nov., parasitizing Japanese mud shrimps Upogebia spp. (Decapoda: Thalassinidea: Upogebiidae), including a description of a novel morphological structure in the Rhizocephala. Zool. Sci. 2016;33(2):204–212. Hines AH, Alvarez F, Reed SA. Introduced and native populations of a marine parasitic castrator: variation in prevalence of the rhizocephalan Loxothylacus panopaei in xanthid crabs. Bull. Mar. Sci. 1997;61(2):197–214. Høeg JT. The biology and life cycle of the Cirripedia Rhizocephala. J. Mar. Biol. Assoc. U.K. 1995;75: 517–550. Høeg JT. Sex and the single cirripede: a phylogenetic perspective. In: Schram FR, Høeg JT, editors. New frontiers in barnacle evolution. Crustacean Issues. Vol. 10. Rotterdam: A.A. Balkema; 1995. p. 195–208. Høeg JT, Lützen J. Life cycle and reproduction in the Cirripedia Rhizocephala. Oceanogr Mar Biol Annu Rev. 1995;33:427–485. Høeg JT, Rees DJ, Jensen PC, Glenner H. Unravelling the evolution of the Rhizocephala: a case study for molecular-based phylogeny in the parasitic Crustacea. In: Smit NJ, Bruce NKL, Hadfield KA, editors. Parasitic Crustacea: State of knowledge and future trends. Zool Monogr. Vol. 3. Feldhar H, Schmidt-Rhaesa A, series editors. Cham: Springer; 2019. p. 387–419. Høeg JT, Noever C, Rees DA, Crandall KA, Glenner H. A new molecular phylogeny-based taxonomy of parasitic barnacles (Crustacea: Cirripedia: Rhizocephala). Zool. J. Linnean Soc. 2020;190(2):632–653. Alvarez F, Calderon J. Distribution of Loxothylacus texanus (Cirripedia: Rhizocephala) parasitizing crabs of the genus Callinectes in the southwestern Gulf of Mexico. Gulf and Caribbean Research. 1996;9(3):205–210. Kristensen T, Nielsen AI, Jørgensen AI, Mouritsen KN, Glenner H, Christensen JT, Lützen J, Høeg JT. The selective advantage of host feminization: a case study of the green crab Carcinus maenas and the parasitic barnacle Sacculina carcini . Mar. Biol. 2012;159(9):2015–2023. Waiho K, Fazhan H, Glenner H, Ikhwanuddin M. Infestation of parasitic rhizocephalan barnacles Sacculina beauforti (Cirripedia, Rhizocephala) in edible mud crab, Scylla olivacea . PeerJ. 2017;5:e3419. Rees D, Glenner H. Control region sequences indicate that multiple externae represent multiple infections by Sacculina carcini (Cirripedia: Rhizocephala). Ecol. Evol. 2014;4(16):3290–3297. Nagler C, Hörnig MK, Haug JT, Noever C, Høeg JT, Glenner H. The bigger, the better? Volume measurements of parasites and hosts: Parasitic barnacles (Cirripedia, Rhizocephala) and their decapod hosts. PloS one. 2017;12(7):e0179958. Mouritsen KN, Geyti SN, Lützen J, Høeg JT, Glenner H. Population dynamics and development of the rhizocephalan Sacculina carcini , parasitic on the shore crab Carcinus maenas . Dis. Aquat. Org. 2018;131(3):199–211. Takahashi T, Iwashige A, Matsuura S. Behavioral manipulation of the shore crab, Hemigrapsus sanguineus by the rhizocephalan barnacle, Sacculina polygenea . Crustacean Res. 1997;26:153–161. Hartnoll RG. Parasitic castration of Macropodia longirostris (Fabricius) by a sacculinid. Crustaceana.1962; 295–300. Beck JT. The effects of an isopod castrator, Probopyrus pandalicola , on the sex characters of one of its caridean shrimp hosts, Palaemonetes paludosus . Biol. Bull. ;158(1):1–15. O’Brien J, Wyk PV. Effects of crustacean parasitic castrators (epicaridean isopods and rhizocephalan barnacles) on growth of crustacean host. In: Wenner AM, editor. Crustacean Issues. Vol. 3. Rotterdam: A.A. Balkema; 1985. p. 191–218. Woods L, Chapman JW, Dumbauld BR. The effects of a blood-sucking parasite from castration to feminization. REU Summer Reports. 2006;1–11. Newport: Oregon State University, Hatfield Marine Science Center. Inui N, Oguchi K, Shinji J, Okanishi M, Shimomura M, Miura T. Parasitism-induced intersexuality in a sexually dimorphic varunid crab, Ptychognathus ishii (Decapoda: Varunidae). Zool. Sci. 2021;38(5):416–426. Calado R, Vitorino A, Dinis MT. Bopyrid isopods do not castrate the simultaneously hermaphroditic shrimp Lysmata amboinensis (Decapoda: Hippolytidae). Dis. Aquat. Org. 2006;73(1):73–76. Boyko CB, Williams JD. Crustacean parasites as phylogenetic indicators in decapod evolution. In: Martin JW, Crandall KA, Felder DL, editors. Crustacean Issues. Boca Raton: CRC Press; 2009. p. 197–220. de Barros MS, da Silva Neto LS, Calado TC. First record of parasitism by Probopyrus pandalicola (Isopoda, Bopyridae) on the freshwater prawn Macrobrachium acanthurus (Decapoda, Palaemonidae) and ecological interactions. J. Parasit. Dis. 2021;45:273–278. Corral JM, Henmi Y, Itani G. Differences in the parasitic effects of a bopyrid isopod and rhizocephalan barnacle on the portunid crab, Charybdis bimaculata . Parasitol. Int. 2021;81:102283. Shiino SM. Studies on the Modification of Sexual Characters in Eupagurus samuelis caused by a Rhizocephalan Parasite Peltogaster sp. Mem. Coll. Sci. Kyoto Imp. Univ. Ser. B. 1931;7(2):63–101. Oguro C. On the sacculinization of the hermit-crab, Eupagurus ochotensis (Brandt). Annot. Zool. Jpn. 1955;28(2):100–105. Nielsen SO. The effects of the rhizocephalan parasites Peltogaster paguri Rathke and Gemmosaccus sulcatus (Lilljeborg) on five species of paguridan hosts (Crustacea Decapoda). Sarsia, 1970;42(1):17–32. Faria F, Boyko C, Mantelatto F. Parasitization of the white spotwrist hermit crab, Pagurus criniticornis (Dana, 1852)(Decapoda, Anomura), by the rhizocephalan barnacle Peltogasterella socialis (Müller, 1863)(Cirripedia, Rhizocephala) from southeastern Brazil. Anim. Biol. 2007;57(3):315–327. Kajimoto A, Toyota K, Ohira T, Yusa Y. Transcriptomic analysis of sexually dimorphic cypris larvae of the rhizocephalan barnacle Peltogasterella gracilis . Comp. Biochem. Physiol. D Genomics Proteomics. 2024;52:101342. Kajimoto A, Yanagimachi R, Takahashi T, Yusa Y. Sex Determination by a Univalent Chromosome in the Rhizocephalan Peltogasterella gracilis (Cirripedia: Rhizocephala: Peltogasterellidae). Biol. Bull. 2024;246(2):000–000. Hokkaido-san Kontorui no Seikatsu-shi, Tokuni Complemental Male no Seishoku Kinō ni Tsuite (Shinrigaku/Seitaigaku). Zool. Mag. 1956;65(3–4):113. Tsuchida K, Lützen J, Nishida M. Sympatric three-species infection by Sacculina parasites (Cirripedia: Rhizocephala: Sacculinidae) of an intertidal grapsoid crab. J. Crustac. Biol. 2006;26(4):474–479. Yoshida R, Osawa M, Hirose M, Hirose E. A new genus and two new species of Peltogastridae (Crustacea: Cirripedia: Rhizocephala) parasitizing hermit crabs from Okinawa Island (Ryukyu Archipelago, Japan), and their DNA-barcodes. Zool. Sci. 2011;28(11):853–862. Podsiadlowski L, Bartolomaeus T. Organization of the mitochondrial genome of mantis shrimp Pseudosquilla ciliata (Crustacea: Stomatopoda). Mar. Biotechnol. 2005;7:618–624. Folmer O, Black M, Hoeh W, Lutz R. Vrijenhoek R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 1994;3:294–299. Hedges LV. Distribution theory for Glass’s estimator of effect size and related estimators. J. Educ. Stat. 1981(2);6:107–128. Kirby KN, Gerlanc D. Boot ES: An R package for bootstrap confidence intervals on effect sizes. Behav. Res. Methods. 2013;45:905–927. Ritchie LE, Høeg JT. The life history of Lernaeodiscus porcellanae (Cirripedia: Rhizocephala) and co-evolution with its porcellanid host. J. Crustac. Biol. 1981;1(3):334–347. McLaughlin PA. A review of the hermit crab (Decapoda: Anomura: Paguridea) fauna of southern Thailand, with particular emphasis on the Andaman Sea, and descriptions of three new species. PMBC Special Publication. 2002;23(2):385–460. Rahayu DL. Hermit crabs of Singapore (Crustacea: Decapoda: Anomura: Diogenidae, Paguridae), with description of two new species. Raffles Bull. Zool. 2022;1:70. Lafferty KD, Kuris AM. Parasitic castration: the evolution and ecology of body snatchers. Trends Parasitol. 2009;25(12):564–572. Baudoin M. Host castration as a parasitic strategy. Evolution. 1975;1:335–352. Høeg JT, Lützen J. Crustacea Rhizocephala. In: Brattegard T, Christiansen M, Sneli J, eds. Marine Invertebrates of Scandinavia. Norwegian University Press; 1985. p. 92. Barnes MA. Egg production in cirripedes. Oceanogr. Mar. Biol. 1989;27:91–166. Miroliubov A, Borisenko I, Nesterenko M, Lianguzova A, Ilyutkin S, Lapshin N, Dobrovolskij A. Specialized structures on the border between rhizocephalan parasites and their host’s nervous system reveal potential sites for host-parasite interactions. Sci. Rep. 2020;10(1):1128. Feng C, Zhang J, Bao J, Luan D, Jiang N, Chen Q. Transcriptome analysis of germ cell changes in male Chinese mitten crabs ( Eriocheir sinensis ) induced by rhizocephalan parasite, Polyascus gregaria . Front. Mar. Sci. 2023;10:1144448. Percie du Sert N, Hurst V, Ahluwalia A, Alam S, Avey MT, Baker M, Browne WJ, Clark A, Cuthill IC, Dirnagl U, Emerson M. The ARRIVE guidelines 2.0: updated guidelines for reporting animal research. J. Cereb. Blood Flow Metab. 2020;40(9):1769–1777. Tables Tables 1 to 3 are available in the Supplementary Files section Supplementary Files Morphologicalfeminizationtable1.docx Morphologicalfeminizationtable2.docx Morphologicalfeminizationtable3.docx Cite Share Download PDF Status: Published Journal Publication published 05 Jun, 2025 Read the published version in Zoological Letters → Version 1 posted Reviewers agreed at journal 24 Apr, 2025 Reviewers invited by journal 24 Apr, 2025 Editor assigned by journal 22 Apr, 2025 First submitted to journal 20 Apr, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5940335","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":447392154,"identity":"baf4a690-5005-4d99-9810-b5931db4b1cf","order_by":0,"name":"Asami Kajimoto","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABJ0lEQVRIiWNgGAWjYLCCBBBxAMZgYGB8ACR4+IjTAtHDbADSwkbQqgNwzQxsEmASh0L+/sNPNzxgOJzYd/zs4Q8Pf9hE8/efMav8mmMnw8bA/PDRDUwtEjfSzG4kALXMPJOXJpGQkJY740aO2W3ZbclAh7EZG+dgseYGA0TLhgM5ZkC/HM5tuMFjdltyGzNQCw+bNBYt8uePf4NoOf/G+ENCwv/c+efPmBVLbqvHqcUAaDhEy40cA6DDDuSCrGP8uO0wTi2GN3LKbiQYpBvPvPHGTCIhLTl34420YmnGbcd52Jix+0Xu/PFtN39UWMv2nc8x/vjDxi533vnDGz/+3FZtz8/e/PAxNu9DnNeMymfmAZO4lINBHSqX8Qde1aNgFIyCUTDCAACrjG7c06RPMAAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0003-1469-1159","institution":"Kanagawa University - Yokohama Campus: Kanagawa Daigaku","correspondingAuthor":true,"prefix":"","firstName":"Asami","middleName":"","lastName":"Kajimoto","suffix":""},{"id":447392155,"identity":"4d1ffe2a-52b0-464a-b135-f6ebc08bfda7","order_by":1,"name":"Aiko Iwasaki","email":"","orcid":"","institution":"Tohoku University: Tohoku Daigaku","correspondingAuthor":false,"prefix":"","firstName":"Aiko","middleName":"","lastName":"Iwasaki","suffix":""},{"id":447392156,"identity":"f9a2f5fb-5805-47f5-9bc3-373cb939ea97","order_by":2,"name":"Tsuyoshi Ohira","email":"","orcid":"","institution":"Kanagawa University: Kanagawa Daigaku","correspondingAuthor":false,"prefix":"","firstName":"Tsuyoshi","middleName":"","lastName":"Ohira","suffix":""},{"id":447392157,"identity":"d64f487c-7e26-49bd-b87f-97c7137ad883","order_by":3,"name":"Kenji Toyota","email":"","orcid":"","institution":"Hiroshima University: Hiroshima Daigaku","correspondingAuthor":false,"prefix":"","firstName":"Kenji","middleName":"","lastName":"Toyota","suffix":""}],"badges":[],"createdAt":"2025-02-01 07:06:59","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5940335/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5940335/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s40851-025-00252-5","type":"published","date":"2025-06-05T15:57:03+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":81354260,"identity":"495c9586-f839-42b9-ad42-f33a5823a2d4","added_by":"auto","created_at":"2025-04-25 07:11:44","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":16336492,"visible":true,"origin":"","legend":"\u003cp\u003eSpecimens of host hermit crabs and rhizocephalan parasites used in this study. Unparasitized \u003cem\u003ePagurus lanuginosus \u003c/em\u003emale (\u003cstrong\u003ea\u003c/strong\u003e) and female (\u003cstrong\u003eb\u003c/strong\u003e). \u003cem\u003eP\u003c/em\u003e. \u003cem\u003elanuginosus\u003c/em\u003e parasitized by \u003cem\u003ePeltogasterella\u003c/em\u003e \u003cem\u003egracilis\u003c/em\u003e(\u003cstrong\u003ec\u003c/strong\u003e) or \u003cem\u003ePeltogaster \u003c/em\u003esp. (\u003cstrong\u003ed\u003c/strong\u003e) (white arrows). Unparasitized \u003cem\u003ePagurus filholi \u003c/em\u003emale (\u003cstrong\u003ee\u003c/strong\u003e) and female (\u003cstrong\u003ef\u003c/strong\u003e). \u003cem\u003eP\u003c/em\u003e. \u003cem\u003efilholi\u003c/em\u003eparasitized by \u003cem\u003eP\u003c/em\u003e. \u003cem\u003egracilis\u003c/em\u003e (\u003cstrong\u003eg\u003c/strong\u003e) or \u003cem\u003ePeltogaster \u003c/em\u003esp. (\u003cstrong\u003eh\u003c/strong\u003e) (white arrows). Pleopods of \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e lanuginosus \u003c/em\u003emale without a second pleopod (\u003cstrong\u003ei\u003c/strong\u003e), with a second pleopod (\u003cstrong\u003ej\u003c/strong\u003e) and female (\u003cstrong\u003ek\u003c/strong\u003e). Pleopods of \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e filholi \u003c/em\u003emale without a second pleopod (\u003cstrong\u003el\u003c/strong\u003e), with a second pleopod (\u003cstrong\u003em\u003c/strong\u003e) and female (\u003cstrong\u003en\u003c/strong\u003e). CL, cheliped length. SL, shield length. P2, second pleopod. P3, third pleopod. P4, forth pleopod. P5, fifth pleopod.\u003c/p\u003e","description":"","filename":"Fig.1.png","url":"https://assets-eu.researchsquare.com/files/rs-5940335/v1/158dc5237fff2d04b2cad2c8.png"},{"id":81354258,"identity":"38b3257c-bde1-4d2a-8a9b-30d95ecdcf56","added_by":"auto","created_at":"2025-04-25 07:11:44","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":998085,"visible":true,"origin":"","legend":"\u003cp\u003eAllometric variation in cheliped length of \u003cem\u003ePagurus lanuginosus \u003c/em\u003eamong unparasitized males and females (A), males parasitized by \u003cem\u003eP\u003c/em\u003e.\u003cem\u003egracilis \u003c/em\u003e(\u003cem\u003ePe-l\u003c/em\u003e) (B) or \u003cem\u003ePeltogaster\u003c/em\u003e (\u003cem\u003ePe-t\u003c/em\u003e) sp. (C), and females parasitized by \u003cem\u003ePe-l\u003c/em\u003e or\u003cem\u003e Pe-t\u003c/em\u003e (D). P2, second pleopod\u003c/p\u003e","description":"","filename":"Fig.2.png","url":"https://assets-eu.researchsquare.com/files/rs-5940335/v1/894887391a0b715bdc114020.png"},{"id":81354259,"identity":"fb4492fc-1c79-4afe-a451-03dd7d9850fe","added_by":"auto","created_at":"2025-04-25 07:11:44","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1889630,"visible":true,"origin":"","legend":"\u003cp\u003eAllometric variation in cheliped length of \u003cem\u003ePagurus filholi \u003c/em\u003eamong unparasitized males and females (A), males parasitized by \u003cem\u003ePeltogasterella gracilis \u003c/em\u003e(\u003cem\u003ePe-l\u003c/em\u003e) (B) or \u003cem\u003ePeltogaster\u003c/em\u003e (\u003cem\u003ePe-t\u003c/em\u003e) sp. (C), and females parasitized by \u003cem\u003ePe-l\u003c/em\u003e or\u003cem\u003e Pe-t\u003c/em\u003e as well as males parasitized by\u003cem\u003e Pe-l\u003c/em\u003e (D). P2, second pleopod\u003c/p\u003e","description":"","filename":"Fig.3.png","url":"https://assets-eu.researchsquare.com/files/rs-5940335/v1/8b49dcd44d60263bbe9defd0.png"},{"id":81354580,"identity":"a249cfde-e159-49f5-80f9-29165d3431eb","added_by":"auto","created_at":"2025-04-25 07:19:44","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":313237,"visible":true,"origin":"","legend":"\u003cp\u003eEffect sizes of cheliped/shield length ratios between \u003cem\u003ePagurus lanuginosus\u003c/em\u003e and \u003cem\u003ePagurus filholi \u003c/em\u003eparasitized by \u003cem\u003ePeltogasterella gracilis\u003c/em\u003e or \u003cem\u003ePeltogaster\u003c/em\u003e sp. compared to unparasitized \u003cem\u003eP\u003c/em\u003e. \u003cem\u003elanuginosus\u003c/em\u003eand \u003cem\u003eP\u003c/em\u003e. \u003cem\u003efilholi\u003c/em\u003e males (y-axis) and females (x-axis), respectively\u003c/p\u003e","description":"","filename":"Fig.4.png","url":"https://assets-eu.researchsquare.com/files/rs-5940335/v1/555ebad3a2855ca89ef7d716.png"},{"id":84242478,"identity":"0036d6ef-bdb3-4e01-9f78-ebaff75b3b9d","added_by":"auto","created_at":"2025-06-09 16:07:41","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":18640306,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5940335/v1/9c010509-782a-4a8c-9b5b-b15ed609d38d.pdf"},{"id":81354263,"identity":"5780d9b7-d84b-4b51-89e3-2c7e08ce670e","added_by":"auto","created_at":"2025-04-25 07:11:44","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":20962,"visible":true,"origin":"","legend":"","description":"","filename":"Morphologicalfeminizationtable1.docx","url":"https://assets-eu.researchsquare.com/files/rs-5940335/v1/dcb1b2538a25ef03dbe6117f.docx"},{"id":81354261,"identity":"b14b571b-df42-4f8d-83bf-5b8654e0dacc","added_by":"auto","created_at":"2025-04-25 07:11:44","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":23218,"visible":true,"origin":"","legend":"","description":"","filename":"Morphologicalfeminizationtable2.docx","url":"https://assets-eu.researchsquare.com/files/rs-5940335/v1/3cbecd286899f1cd58ba3727.docx"},{"id":81354266,"identity":"65268f67-bf3f-4b6a-9d40-798f7558534b","added_by":"auto","created_at":"2025-04-25 07:11:45","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":22484,"visible":true,"origin":"","legend":"","description":"","filename":"Morphologicalfeminizationtable3.docx","url":"https://assets-eu.researchsquare.com/files/rs-5940335/v1/7de7e8d846f9b09a631319cc.docx"}],"financialInterests":"","formattedTitle":"Morphological feminization in the hermit crabs (family Paguridae) induced by the rhizocephalan barnacles","fulltext":[{"header":"Introduction","content":"\u003cp\u003eParasitic infections play a crucial role in marine ecosystems, profoundly influencing the reproduction and population dynamics of their host species [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Among marine parasites, rhizocephalans (Thecostraca: Cirripedia) are particularly notable for their infection of various crustaceans, including hermit crabs [\u003cspan additionalcitationids=\"CR4\" citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], crabs [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], and shrimps [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. These parasites exert a significant impact on their hosts by inducing parasitic castration, thereby eliminating their reproductive capability [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Rhizocepahalns exhibit highly specialized adaptations for infection [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Adult females display pronounced sexual dimorphism, hosting dwarf males within their bodies [\u003cspan additionalcitationids=\"CR11 CR12 CR13\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Structurally, the adult female consists of one or more externa (reproductive organs) and an interna, a root-like network that extracts nutrients from the host.\u003c/p\u003e \u003cp\u003eSeveral rhizocephalan species, especially sacculinids, induce morphological feminization of secondary sexual characteristics in their male crab hosts. This transformation affects abdominal shape, chela size, and copulatory appendages [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan additionalcitationids=\"CR16\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. A characteristic modification is the broadening of the male's normally narrow, semicircular abdomen into a female-like shape, particularly prominent in brachyuran crabs [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan additionalcitationids=\"CR16\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. This morphological alteration enables parasitized males to accommodate a greater number of externa within their widened abdomens, facilitating increased offspring hatching [\u003cspan additionalcitationids=\"CR19\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Additionally, parasitized male crabs exhibit female-like behaviors, such as larval release activities, involving abdominal waving [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Other morphological changes include reduced chela size, modifications to copulatory appendages [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], and alterations in pleopod numbers [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Parasitic isopods (Bopyroidea) also induce morphological feminization of secondary sexual characteristics in their hosts [\u003cspan additionalcitationids=\"CR24 CR25\" citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. However, while some studies suggest that bopyroid infection causes minimal harm to hosts [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], their impact differs from that of rhizocephalans. Unlike rhizocephalans, which chemically castrate their hosts [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], bopyroids impose an energetic burden, leading to reduced reproductive capability [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Although bopyroid infections are generally considered less harmful, rhizocephalans are known to exert more severe effects on their hosts [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eMorphological feminization induced by rhizocephalans has been documented not only in crabs but also in anomuran and hermit crabs [\u003cspan additionalcitationids=\"CR32 CR33\" citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. In hermit crabs, the second pleopod, typically a female-specific trait, is either vestigial or absent in males. However, in \u003cem\u003ePagurus samuelis\u003c/em\u003e parasitized by \u003cem\u003ePeltogaster\u003c/em\u003e sp. and \u003cem\u003ePagurus ochotensis\u003c/em\u003e parasitized by \u003cem\u003ePeltogasterella gracilis\u003c/em\u003e, the second pleopod develops in infected males [\u003cspan additionalcitationids=\"CR32\" citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Additionally, parasitized male \u003cem\u003eP\u003c/em\u003e. \u003cem\u003eochotensis\u003c/em\u003e exhibits reduced right cheliped lengths compared to uninfected males, while this reduction is less pronounced in females [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Despite such findings, most studies have focused on single host-parasite pairs, leaving the variation in host effects across different rhizocephalan genera poorly understood.\u003c/p\u003e \u003cp\u003eIn this study, we observed the sympatric occurrence of \u003cem\u003eP\u003c/em\u003e. \u003cem\u003egracilis\u003c/em\u003e and \u003cem\u003ePeltogaster\u003c/em\u003e sp. \u003cem\u003eP\u003c/em\u003e. \u003cem\u003egracilis\u003c/em\u003e has previously been reported in Asari and Chikura populations [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e], whereas \u003cem\u003ePeltogaste\u003c/em\u003er sp. has primarily been documented in adjacent areas, such as Atsuta (Hokkaido, Japan Sea side) and the Boso Peninsula (Chiba Prefecture, Pacific side) [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. The dispersal of rhizocephalans is primarily attributed to the passive distribution of their free-living larvae [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e], making it reasonable that \u003cem\u003ePeltogaster\u003c/em\u003e sp. inhabits Asari and Chikura populations. Thus, we investigated the effects of some rhizocephalan species, \u003cem\u003eP\u003c/em\u003e. \u003cem\u003egracilis\u003c/em\u003e and \u003cem\u003ePeltogaster\u003c/em\u003e sp., on hermit crabs from two distinct regions of Japan: \u003cem\u003ePagurus lanuginosus\u003c/em\u003e from Asari Town (Hokkaido, Japan) on the Sea of Japan coast and \u003cem\u003ePagurus filholi\u003c/em\u003e from Chikura Town (Chiba, Japan) on the Pacific coast. We compared the occurrence frequency of the second pleopod and cheliped length between unparasitized (without externa) and parasitized male hermit crabs. Then, we assessed the magnitude of parasitic effect on the morphological change in the two host species for each parasite to elucidate the impacts of these parasites on their hosts.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003eSample collection\u003c/h2\u003e\n \u003cp\u003eUnparasitized (externa-free) \u003cem\u003ePagurus lanuginosus\u003c/em\u003e were collected in September 2024 (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ea, b). Specimens of \u003cem\u003eP\u003c/em\u003e. \u003cem\u003elanuginosus\u003c/em\u003e parasitized by peltogasterellids or peltogastrids were also collected from the shore at Asari, Otaru City, Hokkaido, Japan (43.176\u0026deg;N, 141.068\u0026deg;E) (Figs. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ec and \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ed). Collections were conducted in November 2017, monthly from June to October 2018, and in June, July, September, and November 2019, June, September, and November 2020, September and October 2022, and September 2024. Unparasitized \u003cem\u003ePagurus filholii\u003c/em\u003e wer\u003cem\u003ee\u003c/em\u003e collected in June and October 2024 (Figs. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ee and \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ef). Specimens of \u003cem\u003eP\u003c/em\u003e. \u003cem\u003efilholi\u003c/em\u003e parasitized by peltogasterellids or peltogastrids were collected from the coastal area near Chikura, Minamiboso City, Chiba, Japan (34.924◦N, 139.942◦E) in March 2023, as well as in June and October 2024 (Figs. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eg and \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eh). All specimens were preserved in absolute ethanol for subsequent analysis.\u003c/p\u003e\n\u003c/div\u003e\n\u003ch3\u003eSpecies identification based on morphological characteristics and cytochrome c oxidase subunit 1 (COI) sequencing\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003eSpecies identification based on morphological characteristics and cytochrome c oxidase subunit 1 (COI) sequencing\u003c/div\u003e\n\u003cp\u003eTo identify rhizocephalan species, we first observed the morphology of the externae. Peltogasterellids have colonial, elongated externae, with colors ranging from white to yellowish [\u003cspan class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e4\u003c/span\u003e]. In contrast, peltogastrids have oval-shaped externae, with colors transitioning from red (immature) to olive and green (mature) [\u003cspan class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e39\u003c/span\u003e].\u003c/p\u003e\n\u003cp\u003eSubsequently, a portion of the externae from peltogasterellids (n\u0026thinsp;=\u0026thinsp;4 from Asari, n\u0026thinsp;=\u0026thinsp;4 from Chikura) and peltogastrids (n\u0026thinsp;=\u0026thinsp;4 from Asari, n\u0026thinsp;=\u0026thinsp;4 from Chikura) was excised for DNA extraction. The samples were taken from randomly selected parasitized hermit crabs preserved in absolute ethanol at room temperature. Genomic DNA was extracted from the tissue samples using a DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer\u0026rsquo;s protocol. For rhizocephalan species identification, the mitochondrial COI gene regions were amplified by PCR using a primer pair; crust-cox1f (ACTAATCACAAR GAYATTGG) [\u003cspan class=\"CitationRef\"\u003e40\u003c/span\u003e] and HCO2198 (TAAACTTCAGGGTGACCAAAAAATCA) [\u003cspan class=\"CitationRef\"\u003e41\u003c/span\u003e], under the following conditions: 94\u0026deg;C for 7 min followed by 35 cycles at 94\u0026deg;C for 30 s, 45\u0026deg;C for 30 s, and 72\u0026deg;C for 2 min, with a final extension at 72\u0026deg;C for 7 min. TaKaRa Ex Taq or TaKaRa Ex Taq Hot Start Version (Takara, Shiga, Japan) was used for PCR reactions at 50 \u0026micro;L volume. PCR products were treated with a QIAquick PCR Purification Kit (Qiagen, Hilden, Germany). The sequence of the PCR product was verified by DNA sequencing using the Eurofins sequencing service (Eurofins Genomics, Tokyo, Japan). The eight sequences of peltogasterellids and the eight sequences of peltogastrids obtained were deposited in the DNA Data Bank of Japan (DDBJ) under the accession numbers LC865649\u0026ndash;LC865664.\u003c/p\u003e\n\u003ch3\u003eMeasurements of morphological traits\u003c/h3\u003e\n\u003cp\u003eThe sex of all hermit crabs was determined by observing the presence of female gonopores under a stereoscopic dissecting microscope. To evaluate the effect of rhizocephalan parasitism on hermit crab morphology, shield length (Figs.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ea and \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ee), and right large cheliped length (Figs.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ea and \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ee) were measured using a digital caliper. Additionally, the presence of a second pleopod was confirmed under a stereoscopic dissecting microscope.\u003c/p\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\n \u003ch2\u003eStatistical analysis\u003c/h2\u003e\n \u003cp\u003eTo investigate the effect of rhizocephalan infection on the morphological feminization of male hermit crabs, the frequency of a second pleopod was compared between unparasitized and parasitized males in the Asari and Chikura populations using Fisher\u0026rsquo;s exact test.\u003c/p\u003e\n \u003cp\u003eCheliped length, a secondary sexual characteristic, was used as an indicator of rhizocephalan infection. To assess the effect of parasitism on relative cheliped length in the Asari and Chikura populations, the equality of regression slopes was tested using shield length as a covariate. Statistical analyses were conducted using SAS version 9.4 (SAS Institute Inc., Cary, NC, USA). The following groups were included in the analysis: unparasitized males with or without a second pleopod, unparasitized females, parasitized males with or without a second pleopod, and parasitized females. If no significant interaction between factors was detected, analysis of covariance (ANCOVA) was performed with shield length as a covariate.\u003c/p\u003e\n \u003cp\u003eFor comparisons of the magnitude of parasitic effect on morphological feminization between parasite species for each host species, Hedges\u0026rsquo;\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:g\\)\u003c/span\u003e\u003c/span\u003e was calculated as a measure of effect size [\u003cspan class=\"CitationRef\"\u003e42\u003c/span\u003e]. We calculated the effect sizes as the difference between the mean cheliped/shield length of the parasitized male and unparasitized hermit crabs. We used unparasitized male and female as the baseline for parasitic effects and calculated the effect size for each as follows:\u003c/p\u003e\n \u003cdiv id=\"Equa\" class=\"Equation\"\u003e\n \u003cdiv class=\"mathdisplay\" id=\"FileID_Equa\" name=\"EquationSource\"\u003e$$\\:g=\\frac{{X}_{parasitized}-{X}_{unparasitized}}{S}j$$\u003c/div\u003e\n \u003c/div\u003e,\u003cp\u003ewhere \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:S\\)\u003c/span\u003e\u003c/span\u003e is the pooled standard deviation and calculated as\u003c/p\u003e\n \u003cdiv id=\"Equb\" class=\"Equation\"\u003e\n \u003cdiv class=\"mathdisplay\" id=\"FileID_Equb\" name=\"EquationSource\"\u003e$$\\:S=\\sqrt{\\frac{{(N}_{parasitized}-1)\\:{S}_{parasitized}^{2}+{(N}_{unparasitized}-1)\\:{S}_{unparasitized}^{2}}{{N}_{parasitized}+{N}_{unparasitized}}}$$\u003c/div\u003e\n \u003c/div\u003e.\u003cp\u003eHere, \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:{S}_{parasitized}\\)\u003c/span\u003e\u003c/span\u003eand \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:{S}_{unparasitized}\\)\u003c/span\u003e\u003c/span\u003e are the standard deviations of cheliped/shield length in parasitized and unparasitized groups, respectively. \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:j\\)\u003c/span\u003e\u003c/span\u003e is a weighting factor based on the number of individuals (\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:N\\)\u003c/span\u003e\u003c/span\u003e) in each case, for the two groups, and is calculated as follows:\u003c/p\u003e\n \u003cdiv id=\"Equc\" class=\"Equation\"\u003e\n \u003cdiv class=\"mathdisplay\" id=\"FileID_Equc\" name=\"EquationSource\"\u003e$$\\:j=1-\\frac{3}{{4(N}_{parasitized}+{N}_{unparasitized}-2)-1}$$\u003c/div\u003e\u003c/div\u003e.\u003cp\u003eThe 95% confidence interval (CI) was generated using bootstrapping procedures with 2,000 iterations [\u003cspan class=\"CitationRef\"\u003e43\u003c/span\u003e]. Negative values of the effect size in x-axis and y-axis denote smaller cheliped/shield length compared to unparasitized male and female and positive values denote larger cheliped/shield length, vice versa. When a CI does not include zero, it indicates a statistically significant effect size. We conducted the analyses for effect size using R (version 4.2.2; R Core Team, 2022) and the following R packages: \u0026apos;ggplot2\u0026apos; (version 3.4.4) for data visualization, \u0026apos;dplyr\u0026apos; (version 1.1.3) for data manipulation, and \u0026apos;BootES\u0026apos; (version 1.3.0) for bootstrapping procedures.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eOccurrence of hermit crabs with peltogasterellids or peltogastrids\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn the Asari population, 65 males and 88 females were unparasitized (externa-free), while 171 males and 207 females were infected with peltogasterellids, and eleven males and twelve females with peltogastrids. In the Chikura population, 30 males and 41 females were unparasitized, while 42 males and 32 females were parasitized by peltogasterellids, and 47 males and 45 females by peltogastrids.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRhizocephalan species identification\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCOI sequencing identified all eight peltogasterellids as \u003cem\u003ePeltogasterella gracilis\u003c/em\u003e based on their morphology and sequence similarity (98.44–100%) with reference data (accession numbers: MK604154, OR481992). Among the peltogastrids, those from Asari showed 98.95–100% identity with \u003cem\u003ePeltogaster\u0026nbsp;\u003c/em\u003esp. (accession numbers: OR481986, OR481989), while those from Chikura included three individuals matching \u003cem\u003ePeltogaster postica\u003c/em\u003e (99.67–99.84%, MK604147) and one matching \u003cem\u003ePeltogaster lineata\u003c/em\u003e (99.01%, MK604142). Due to the lack of prior studies on Peltogaster sp. parasitizing hermit crabs in Asari and Chikura, its identification was limited to the genus level.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePresence of the second pleopod in parasitized male hermit crabs\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe elongated second pleopod is a female-specific morphological characteristic of \u003cem\u003eP\u003c/em\u003e. \u003cem\u003elanuginosus\u003c/em\u003e and \u003cem\u003eP\u003c/em\u003e. \u003cem\u003efilholi\u003c/em\u003e (Figs. 1k and 1n), typically present only as a vestigial structure in unparasitized \u003cem\u003eP\u003c/em\u003e. \u003cem\u003elanuginosus\u003c/em\u003e males and \u003cem\u003eP\u003c/em\u003e. \u003cem\u003efilholi\u003c/em\u003e males (Figs. 1i and 1l). However, a second pleopod was observed in \u003cem\u003eP\u003c/em\u003e. \u003cem\u003elanuginosus\u003c/em\u003e and \u003cem\u003eP\u003c/em\u003e. \u003cem\u003efilholi\u003c/em\u003e males parasitized by\u003cem\u003e\u0026nbsp;P\u003c/em\u003e. \u003cem\u003egracilis\u003c/em\u003e or \u003cem\u003ePeltogaster\u003c/em\u003e sp. in this study (Figs. j and 1m). Among male \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;lanuginosus\u003c/em\u003e, individuals parasitized by \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;gracilis\u003c/em\u003e exhibited a significantly higher frequency of a second pleopod compared to unparasitized individuals (Table 1; Fisher’s exact test, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01). Conversely, males parasitized by\u003cem\u003e\u0026nbsp;Peltogaster\u003c/em\u003e sp. had a significantly lower frequency of a second pleopod compared to those parasitized by \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;gracilis\u003c/em\u003e (Table 1; Fisher’s exact test,\u003cem\u003e\u0026nbsp;p\u003c/em\u003e \u0026lt; 0.01).\u003c/p\u003e\n\u003cp\u003eSimilarly, among male \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;filholi\u003c/em\u003e, the frequency of a second pleopod was significantly higher in individuals parasitized by \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;gracilis\u003c/em\u003e compared to unparasitized individuals (Table 1; Fisher’s exact test, \u003cem\u003ep\u0026nbsp;\u003c/em\u003e\u0026lt; 0.01). Moreover, males parasitized by \u003cem\u003ePeltogaster\u0026nbsp;\u003c/em\u003esp. exhibited a substantially lower frequency of a second pleopod compared to those parasitized by \u003cem\u003eP\u003c/em\u003e. \u003cem\u003egracilis\u003c/em\u003e (Table 1; Fisher’s exact test, \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAllometric variation in cheliped length between unparasitized and parasitized hermit crabs\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn both host species, \u003cem\u003eP\u003c/em\u003e. \u003cem\u003elanuginosus\u003c/em\u003e and \u003cem\u003eP\u003c/em\u003e. \u003cem\u003efilholi\u003c/em\u003e, the right cheliped length of individuals parasitized by \u003cem\u003eP\u003c/em\u003e. \u003cem\u003egracilis\u0026nbsp;\u003c/em\u003eor \u003cem\u003ePeltogaster\u003c/em\u003e sp. was significantly smaller than that of unparasitized ones and more similar to that of females (Fig. 2, 3). Distinct differences were observed in the relationship between shield length and right cheliped length in unparasitized male and female \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;lanuginosus\u003c/em\u003e (Table 2a; Fig. 2A). For the regression lines of unparasitized males with a second pleopod, no significant differences were detected compared to those of unparasitized males and females (Table 2b; Fig. 2A). Similarly, cheliped length of males\u0026nbsp;parasitized by \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;gracilis\u003c/em\u003e,without or with a second pleopod,were obsereved clear difference \u0026nbsp;compared to those of \u0026nbsp; unparasitized males (Table 2c, d; Fig. 2B). The regression lines of males parasitized by \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;gracilis\u003c/em\u003e closely resembled those of unparasitized females, particulary for parasitized males with a second pleopod, whose regression lines overlapped with those of unparasitized females (Fig. 2B). In contrast, in males parasitized by \u003cem\u003ePeltogaster\u003c/em\u003e sp. regardless of the presence of a second pleopod, showed no significant differences in cheliped length compared to unparasitized males, although the small sample sizes limited statistical power (Table 2e, f; Fig. 2C). Among \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;lanuginosus\u003c/em\u003e females, no significant differences in cheliped length were detected between unparasitized individuals and those parasitized by either \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;gracilis\u003c/em\u003e or \u003cem\u003ePeltogaster\u0026nbsp;\u003c/em\u003esp., with their regression lines overlapping (Table 2g, h; Fig. 2D).\u003c/p\u003e\n\u003cp\u003eIn \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;filholi\u003c/em\u003e, a significant difference was observed in the slopes of regression lines for cheliped length between unparasitized males and females (Table 3a; Fig. 3A). For unparasitized males with a second pleopod, significant differences in cheliped length were found compared to both unparasitized males and females, with their regression line being closer to that of the females (Table 3b; Fig. 3A). Clear differences in cheliped length were also observed between \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;filholi\u003c/em\u003e males parasitized by \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;gracilis\u003c/em\u003e and unparasitized individuals, with the regression line of parasitized males approaching that of females (Table 3c; Fig. 3B). For males parasitized by \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;gracilis\u003c/em\u003e with a second pleopod, the slope of the regression line differed significantly from that of unparasitized males (Table 3d; Fig. 3B). Additionally, significant differences in cheliped length were observed compared to unparasitized females, although no differences were detected when compared to males parasitized by \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;gracilis\u003c/em\u003e without a second pleopod (Table 3d; Fig. 3B). Cheliped length in males parasitized by \u003cem\u003ePeltogaster\u003c/em\u003e sp. also differed significantly from that of unparasitized males (Table 3e; Fig. 3C). The slope of the regression line for males parasitized by \u003cem\u003ePeltogaster\u0026nbsp;\u003c/em\u003esp. differed significantly from that of unparasitized females (Table 3e; Fig. 3C). Although the small sample size hindered precise analysis of \u003cem\u003eP\u003c/em\u003e. \u003cem\u003efilholi\u003c/em\u003e males parasitized by \u003cem\u003ePeltogaster\u0026nbsp;\u003c/em\u003esp. with a second pleopod, their cheliped length overlapped with that of females parasitized by \u003cem\u003ePeltogaster\u003c/em\u003e sp. (Fig. 3C). For \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;filholi\u003c/em\u003e parasitized by either \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;gracilis\u003c/em\u003e or \u003cem\u003ePeltogaster\u0026nbsp;\u003c/em\u003esp., the regression lines were parallel to those of unparasitized females, with significant differences in cheliped length observed between these groups (Table 3f, g; Fig. 3D).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eComparison of the parasitic effect on\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003emorphological feminization between parasite species for\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003e\u003cem\u003eP\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e. \u003cem\u003elanuginosus\u003c/em\u003e and \u003cem\u003eP\u003c/em\u003e. \u003cem\u003efilholi\u0026nbsp;\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAlthough the cheliped/shield length ratios of males parasitized by \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;gracilis\u003c/em\u003e or \u003cem\u003ePeltogaster\u003c/em\u003e sp. were significantly smaller than those of unparasitized males (x-axis) in both hermit crab species, \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;lanuginosus\u003c/em\u003e and \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;filholi\u003c/em\u003e, the effect size of morphological feminization (negative value on the x-axis, deviation from 0 on the y-axis) varied among parasite species depending on host species (Fig. 4). The magnitude of the negative parasitic effect on the cheliped/shield length ratio was more pronounced in \u003cem\u003eP\u003c/em\u003e. \u003cem\u003efilholi\u003c/em\u003e compared to \u003cem\u003eP\u003c/em\u003e. \u003cem\u003elanuginosus\u003c/em\u003e when compared to unparasitized males (x-axis), while the cheliped/shield length ratio was more similar to that of unparasitized females (y-axis) in \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;lanuginosus\u003c/em\u003e than in \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;filholi\u003c/em\u003e. Among parasite species, the negative effect on cheliped/shield length ratios relative to unparasitized males was greater in \u003cem\u003ePeltogaster\u003c/em\u003e sp. than in \u003cem\u003eP\u003c/em\u003e. \u003cem\u003egracilis\u003c/em\u003e for \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;lanuginosus\u003c/em\u003e, but was similar between the two parasites for \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;filholi\u003c/em\u003e. In comparison to unparasite females, the cheliped/shield length ratios in \u003cem\u003ePeltogaster\u003c/em\u003e sp. were more similar to those of unparasitized females (y = 0) than in \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;gracilis\u0026nbsp;\u003c/em\u003efor \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;lanuginosus\u003c/em\u003e, however, a contrasting pattern was observed in\u003cem\u003e\u0026nbsp;P\u003c/em\u003e.\u003cem\u003e\u0026nbsp;filholi\u003c/em\u003e (Fig. 4).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003e\u003cstrong\u003ePresence of a second pleopod in males parasitized by \u003cem\u003eP\u003c/em\u003e. \u003cem\u003egracilis\u003c/em\u003e or \u003cem\u003ePeltogaster\u003c/em\u003e sp.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe presence of the second pleopod, absent in unparasitized males, was observed in males of both \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;lanuginosus\u003c/em\u003e and \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;filholi\u003c/em\u003e, indicating that parasitized males exhibit morphological changes resembling female-specific characteristics. This observation is consistent with previous reports by Shiino 1931 [31], Oguro 1955 [32], and Nielsen 1970 [33]. The transformation of pleopod composition suggests that parasitized males develop structures resembling the egg-carrying appendages of females, likely to protect and support rhizocephalan externae. The frequency of second pleopod appearance in males parasitized by \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;gracilis\u003c/em\u003e was consistently higher than in those parasitized by \u003cem\u003ePeltogaster\u003c/em\u003e sp., indicating that the extent of parasitic influence varies among the rhizocephalan genus. One distinguishing feature between these parasites is the number and morphology of externae: \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;gracilis\u003c/em\u003e typically exhibits multiple, elongate externae, whereas \u003cem\u003ePeltogaster\u003c/em\u003e sp. possesses a single, oval-shaped externa [3, 4], a pattern also observed in this study.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eGrooming behavior by hosts is critical for maintaining rhizocephalan externae, as undergroomed externae can become fouled and necrotic [44]. In \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;gracilis\u003c/em\u003e, which produces multiple externae, the presence of a second pleopod in male hosts may facilitate grooming. However, second pleopods were also observed in some unparasitized males. In the hermit crab genera \u003cem\u003ePaguristes\u003c/em\u003e and \u003cem\u003ePseudopaguristes\u003c/em\u003e, which have no reported cases of rhizocephalan parasitism, the absence of the second pleopod in males has been observed [45, 46]. The presence of a second pleopod in some males without externae may indicate previous rhizocephalan infection. These individuals may have lost their externae or could be in the early stages of infection, where the interna is developing before the formation of the externae. To confirm the actual prevalence of parasitism, dissections of host abdomens and DNA barcoding analysis of rhizocephalan interna are necessary.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eReduction of cheliped length in males parasitized by \u003cem\u003eP\u003c/em\u003e. \u003cem\u003egracilis\u003c/em\u003e or \u003cem\u003ePeltogaster\u003c/em\u003e sp.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIn males parasitized by\u003cem\u003e\u0026nbsp;P\u003c/em\u003e. \u003cem\u003egracilis\u003c/em\u003e, cheliped lengths were significantly reduced compared to unparasitized individuals, regardless of the presence of a second pleopod. This indicates a clear morphological feminization effect, consistent with previous findings [32]. In contrast, males parasitized by\u003cem\u003e\u0026nbsp;Peltogaster\u0026nbsp;\u003c/em\u003esp. showed no reduction in cheliped length in \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;lanuginosus\u003c/em\u003e, although reductions were observed in \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;filholi\u003c/em\u003e. Furthermore, \u003cem\u003eP\u003c/em\u003e. \u003cem\u003efilholi\u003c/em\u003e parasitized by\u003cem\u003e\u0026nbsp;P\u003c/em\u003e. \u003cem\u003egracilis\u003c/em\u003e had a significantly smaller cheliped length compared to \u003cem\u003eP\u003c/em\u003e. \u003cem\u003elanuginosus\u0026nbsp;\u003c/em\u003eparasitized by\u003cem\u003e\u0026nbsp;P\u003c/em\u003e. \u003cem\u003egracilis\u003c/em\u003e; the parasitic effect size differed between host species. On the other hand, no such apparent difference in terms of cheliped size reduction was observed between \u003cem\u003eP\u003c/em\u003e. \u003cem\u003elanuginosus\u003c/em\u003e and \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;filholi\u003c/em\u003e parasitized by\u003cem\u003e\u0026nbsp;Peltogaster\u003c/em\u003e sp.; the parasitic effect sizes were similar in both host species. These findings highlight the genus-specific impact of rhizocephalan on their hosts. Notably, Different parasite genera induced varying degrees of host modification, even within the same host species. Similarly, the level of feminization caused by a single parasite genus differed between host species, and some rhizocephalan species, such as \u003cem\u003eP\u003c/em\u003e. gracilis in this study, exhibited differences in the parasitic effect size on the host. Nielsen 1970 [33] also noted that the extent of morphological changes varies among rhizocephalan species and that the same parasite species may exert different effects depending on the host species. However, in interspecific analysis of the host species, the cheliped length of parasitized \u003cem\u003eP\u003c/em\u003e. \u003cem\u003elanuginosus\u003c/em\u003e was closer to that of females than that of parasitized \u003cem\u003eP\u003c/em\u003e. \u003cem\u003efilholi\u003c/em\u003e,\u003cem\u003e\u0026nbsp;\u003c/em\u003eregardless of the parasite species. The difference may be attributed to the smaller male-to-female ratio of cheliped/shield length in \u003cem\u003eP\u003c/em\u003e. \u003cem\u003elanuginosus\u003c/em\u003e compared to \u003cem\u003eP\u003c/em\u003e. \u003cem\u003efilholi\u003c/em\u003e, an inherent species-specific characteristic of the hermit crabs.\u003c/p\u003e\n\u003cp\u003eThe parasitic effect size of rhizocephalans is likely to be determined by the amount of energy that they extract from the host since the parasite ensures its reproduction success by castrating or sterilizing the host to absorb the host\u0026rsquo;s reproductive energy [47]. Parasitic castrations often induce changes in the host\u0026apos;s behavior and metabolism [47, 48] Energy extraction by rhizocephalans is thought to depend on the number of eggs, egg size, number of breeding events per externa, and number of reproductive externae [19].\u0026nbsp;However, these factors have not been well-documented for \u003cem\u003eP\u003c/em\u003e. \u003cem\u003egracilis\u003c/em\u003e, \u003cem\u003eP\u003c/em\u003e. \u003cem\u003epostica\u003c/em\u003e, and \u003cem\u003eP\u003c/em\u003e. \u003cem\u003elineata\u003c/em\u003e. The different peltogastrid species \u003cem\u003ePeltogaster paguri\u003c/em\u003e, which typically possesses one oval-shape externa, undergoes 3\u0026ndash;5 breeding events [49], with each event producing between several hundred and 28,000 eggs [49, 50].\u0026nbsp;Comparable numbers of eggs and breeding events per externae are anticipated for\u003cem\u003e\u0026nbsp;P\u003c/em\u003e. \u003cem\u003epostica\u003c/em\u003e and \u003cem\u003eP\u003c/em\u003e. \u003cem\u003elineata\u003c/em\u003e used in this study. In contrast, the breeding potential per externa remains unclear in peltogasterellids, which possess one or more externae. However, all the externae possess reproductive potential, each capable of at least two breeding events [36]. Therefore, the amount of energy extracted by rhizocephalans from the host may vary between species, leading to differences in parasitic effect sizes on the host.\u0026nbsp;To investigate the relationship between the energy extracted through castration and molting suppression and the parasitic effect on the host, it is crucial to clarify the number of breeding events, number of eggs, egg size, and number of reproductive externae in peltogasterellids and Peltogasterids through long-term rearing experiments. Although Nagler et al. 2017\u0026nbsp;[19] suggest that host utilization varies among rhizocephalan species, few studies have compared parasitic effect sizes across multiple rhizocephalan and host species.\u0026nbsp;This study is the first to compare not only the effects of two rhizocephalan parasites, \u003cem\u003eP\u003c/em\u003e. \u003cem\u003egracilis\u003c/em\u003e and \u003cem\u003ePeltogaster\u003c/em\u003e sp., on their host hermit crabs in two geographically distinct populations but also the parasitic effect size between two host species, \u003cem\u003eP\u003c/em\u003e. \u003cem\u003elanuginosus\u003c/em\u003e and \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;filholi\u003c/em\u003e, parasitized by either \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;gracilis\u003c/em\u003e or \u003cem\u003ePeltogaster\u003c/em\u003e sp.\u003c/p\u003e\n\u003cp\u003eHowever, the lack of species-level identification of \u003cem\u003ePelrtogaster\u003c/em\u003e sp. in this study limits the interpretation of these dynamics. Rhizocephalans have highly simplified external morphology, lacking distinct diagnostic characteristics, which has led to the reliance on histological surveys for species identification [39].\u0026nbsp;Additionally, unidentified \u003cem\u003ePeltogaster\u003c/em\u003e sp., which cannot be distinguished based on external morphology and COI data, further complicates species identification in this study.\u0026nbsp;To gain a more comprehensive understanding of the impacts of rhizocephalans on their host species, future studies should compare host\u0026ndash;parasite relationships not only among Paguridae, \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;gracilis\u003c/em\u003e, and\u003cem\u003e\u0026nbsp;Peltogaster\u003c/em\u003e sp., but also across other hermit crab hosts and rhizocephalan species.\u003c/p\u003e\n\u003cp\u003eMorphological feminization in hermit crabs caused by rhizocephalans has been documented for species such as \u003cem\u003ePeltogaster paguri\u0026nbsp;\u003c/em\u003e(family Peltogastridae) and \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;gracilis\u003c/em\u003e (family Peltogasterellidae), which parasitize various Paguridae hosts, including\u003cem\u003e\u0026nbsp;Pagurus pubescens\u003c/em\u003e, \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;ochotensis\u003c/em\u003e, and \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;pectinatus\u0026nbsp;\u003c/em\u003e[51]. A recent transcriptome study [52] suggests that rhizocephalan parasites\u003cem\u003e\u0026nbsp;\u003c/em\u003emay alter neurotransmitter secretion in the eyestalk and thoracic ganglia, leading to feminized morphology and behavior in male hosts. However, the molecular mechanisms underlying morphological feminization remain unclear. Future research should employ comparative transcriptomics of parasitized and unparasitized hosts, along with neurobiological analyses, including neuronal activity tracking and immunohistochemical labeling, to elucidate the mechanisms driving rhizocephalan\u0026ndash;induced morphological feminization in hermit crabs.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eRhizocephalans are significant parasites of decapods, including hermit crabs, crabs, and shrimps. This study is the first to compare the effects of the rhizocephalan parasites \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;gracilis\u003c/em\u003e and \u003cem\u003ePeltogaster\u003c/em\u003e sp. on their host hermit crabs,\u003cem\u003e\u0026nbsp;P\u003c/em\u003e. \u003cem\u003elanuginosus\u003c/em\u003e and \u003cem\u003eP\u003c/em\u003e. \u003cem\u003efilholi\u003c/em\u003e, from two geographically distinct populations (Asari Town, Hokkaido, and Chikura Town, Chiba, Japan). The frequency of second pleopod appearance was consistently higher in males parasitized by \u003cem\u003eP\u003c/em\u003e. \u003cem\u003egracilis\u003c/em\u003e than in those parasitized by \u003cem\u003ePeltogaster\u0026nbsp;\u003c/em\u003esp. Furthermore, cheliped length was significantly reduced in males parasitized by \u003cem\u003eP\u003c/em\u003e. \u003cem\u003egracilis\u003c/em\u003e compared to unparasitized individuals, whereas males parasitized by\u003cem\u003e\u0026nbsp;Peltogaster\u003c/em\u003e sp. exhibited no reduction in cheliped length in \u003cem\u003eP\u003c/em\u003e. \u003cem\u003elanuginosus\u003c/em\u003e, although reductions were observed in \u003cem\u003eP\u003c/em\u003e. \u003cem\u003efilholi\u003c/em\u003e. This study demonstrates that \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;gracilis\u003c/em\u003e and \u003cem\u003ePeltogaster\u003c/em\u003e sp. induce morphological feminization in their host. Additionally, parasitic effects were significantly different between\u003cem\u003e\u0026nbsp;P\u003c/em\u003e. \u003cem\u003elanuginosus\u003c/em\u003e and \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e\u0026nbsp;filholi\u003c/em\u003e parasitized by \u003cem\u003eP\u003c/em\u003e. \u003cem\u003egracilis\u003c/em\u003e, whereas similar parasitic effects were observed between the two host species parasitized by \u003cem\u003ePeltogaster\u003c/em\u003e sp. These findings indicate that the impact of rhizocephalan infection on host morphology varies by rhizocephalan and host species. Future research should compare host\u0026ndash;parasite relationships across other hermit crab hosts and rhizocephalan species to better understand the mechanisms underlying these host\u0026ndash;parasite interactions.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe offer our deepest condolences to Prof. Toru Takahashi, Kumamoto Health Science University (retired), and Dr. Ryota Yoshida, Ochanomizu University, for their valuable comments on this manuscript. We express our gratitude to Prof. Yoichi Yusa, Nara Women\u0026rsquo;s University, and Mr. Kenji Kato, Shikoku Aquarium, for sampling. We thank all of the members of the Laboratory of Physiological Ecology, Hiroshima University, for their kind help.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAK prepared specimens. AK and KT designed this study, conducted measurements, and drafted the manuscript. AK, AI, and KT analyzed the data. AI and TO improved the manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Sasakawa Scientific Research Grant from The Japan Science Society to AK (2022-4015), Japan Science and Technology Agency fellowship to AK (JPMJFS2127), grant from Research Institute of Marine Invertebrates (KO2024-04) to AK, and JSPS KAKENHI grant to KT (24K09616).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets during the current study are available from the corresponding author on request.\u003c/p\u003e\n\u003cp\u003eEthics approval and consent to participate in rhizocephalan barnacles and Paguridae (invertebrates) were used for this study. No vertebrate or human individuals or tissues were used. The experimental design and procedures of this study adhered to the guidelines set by the Institutional Animal Care and Use Committee of Kanagawa University. All animal experiments complied with the ARRIVE guidelines [53].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor details\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e1\u003c/sup\u003e Department of Biological Sciences, Faculty of Science, Kanagawa University, 3-27-1, Rokkakubashi, Kanagawa-ku, Yokohama-city, Kanagawa, 221-8686, Japan. \u003csup\u003e2\u003c/sup\u003e Asamushi Research Center for Marine Biology, Graduate School of Life Sciences, Tohoku University, 9 Sakamoto, Asamushi, Aomori 039-3501, Japan. \u003csup\u003e3\u003c/sup\u003e Department of Biological Science and Technology, Faculty of Advanced Engineering, Tokyo University of Science, 6-3-1 Niijuku, Katsushika-ku, Tokyo 125-8585, Japan. \u003csup\u003e4\u003c/sup\u003e Department of Bioresource Science, Graduate School of Integrated Sciences for Life, Hiroshima University, 1-4-4, Kagamiyama, Higashihiroshima-shi, Hiroshima 739-8528, Japan.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eKuris AM. Trophic interactions: similarity of parasitic castrators to parasitoids. Q. Rev. Biol. 1974;49(2):129\u0026ndash;148.\u003c/li\u003e\n \u003cli\u003eKuris AM, Lafferty KD. Modelling crustacean fisheries: effects of parasites on management strategies. Can. J. Fish. Aquat. Sci. 1992;49(2):327\u0026ndash;336.\u003c/li\u003e\n \u003cli\u003eYoshida R, Hirose M, Hirose E. Hermit crab host prevalence by species of Peltogastridae (Cirripedia: Rhizocephala): hosts vary with locations on the Pacific coast in mainland Japan. J. Crustac. Biol. 2014;34(4):467\u0026ndash;480.\u003c/li\u003e\n \u003cli\u003eJung J, Yoshida R, Kim W. Diversity of parasitic peltogastrid barnacles (Crustacea: Cirripedia: Rhizocephala) on hermit crabs in Korea. Zool. Stud. 2019;58(33).\u003c/li\u003e\n \u003cli\u003eKajimoto A, H\u0026oslash;eg JT, Kato K, Yusa Y. Variations in life cycle and seasonal sex ratio in the rhizocephalan \u003cem\u003ePeltogasterella gracilis\u003c/em\u003e (Boschma, 1927)(Cirripedia: Rhizocephala: Peltogasterellidae). J. Crustac. Biol. 2022;42(4):ruac057.\u003c/li\u003e\n \u003cli\u003eL\u0026uuml;tzen J, Jensen KH, Glenner H. Life history of \u003cem\u003eSacculina carcini\u003c/em\u003e Thompson, 1836 (Cirripedia: Rhizocephala: Sacculinidae) and the intermoult cycle of its host, the shore crab \u003cem\u003eCarcinus maenas\u003c/em\u003e (Linnaeus, 1758)(Decapoda: Brachyura: Carcinidae). J. Crustac. Biol. 2018;38(4):413\u0026ndash;419.\u003c/li\u003e\n \u003cli\u003eToyota K, Ito T, Morishima K, Hanazaki R, Ohira T. Sacculina-Induced Morphological Feminization in the Grapsid Crab \u003cem\u003ePachygrapsus crassipes\u003c/em\u003e. Zool. Sci. 2023;40(5):367\u0026ndash;374.\u003c/li\u003e\n \u003cli\u003eL\u0026uuml;tzen J, Itani G, Jespersen \u0026Aring;, Hong JS, Rees D, Glenner H. On a new species of parasitic barnacle (Crustacea: Rhizocephala), \u003cem\u003eSacculina shiinoi\u003c/em\u003e sp. nov., parasitizing Japanese mud shrimps \u003cem\u003eUpogebia\u003c/em\u003e spp. (Decapoda: Thalassinidea: Upogebiidae), including a description of a novel morphological structure in the Rhizocephala. Zool. Sci. 2016;33(2):204\u0026ndash;212.\u003c/li\u003e\n \u003cli\u003eHines AH, Alvarez F, Reed SA. Introduced and native populations of a marine parasitic castrator: variation in prevalence of the rhizocephalan \u003cem\u003eLoxothylacus panopaei\u003c/em\u003e in xanthid crabs. Bull. Mar. Sci. 1997;61(2):197\u0026ndash;214.\u003c/li\u003e\n \u003cli\u003eH\u0026oslash;eg JT. The biology and life cycle of the Cirripedia Rhizocephala. J. Mar. Biol. Assoc. U.K. 1995;75: 517\u0026ndash;550.\u003c/li\u003e\n \u003cli\u003eH\u0026oslash;eg JT. Sex and the single cirripede: a phylogenetic perspective. In: Schram FR, H\u0026oslash;eg JT, editors. New frontiers in barnacle evolution. Crustacean Issues. Vol. 10. Rotterdam: A.A. Balkema; 1995. p. 195\u0026ndash;208.\u003c/li\u003e\n \u003cli\u003eH\u0026oslash;eg JT, L\u0026uuml;tzen J. Life cycle and reproduction in the Cirripedia Rhizocephala. Oceanogr Mar Biol Annu Rev. 1995;33:427\u0026ndash;485.\u003c/li\u003e\n \u003cli\u003eH\u0026oslash;eg JT, Rees DJ, Jensen PC, Glenner H. Unravelling the evolution of the Rhizocephala: a case study for molecular-based phylogeny in the parasitic Crustacea. In: Smit NJ, Bruce NKL, Hadfield KA, editors. Parasitic Crustacea: State of knowledge and future trends. Zool Monogr. Vol. 3. Feldhar H, Schmidt-Rhaesa A, series editors. Cham: Springer; 2019. p. 387\u0026ndash;419.\u003c/li\u003e\n \u003cli\u003eH\u0026oslash;eg JT, Noever C, Rees DA, Crandall KA, Glenner H. A new molecular phylogeny-based taxonomy of parasitic barnacles (Crustacea: Cirripedia: Rhizocephala). Zool. J. Linnean Soc. 2020;190(2):632\u0026ndash;653.\u003c/li\u003e\n \u003cli\u003eAlvarez F, Calderon J. Distribution of \u003cem\u003eLoxothylacus texanus\u003c/em\u003e (Cirripedia: Rhizocephala) parasitizing crabs of the genus Callinectes in the southwestern Gulf of Mexico. Gulf and Caribbean Research. 1996;9(3):205\u0026ndash;210.\u003c/li\u003e\n \u003cli\u003eKristensen T, Nielsen AI, J\u0026oslash;rgensen AI, Mouritsen KN, Glenner H, Christensen JT, L\u0026uuml;tzen J, H\u0026oslash;eg JT. The selective advantage of host feminization: a case study of the green crab \u003cem\u003eCarcinus maenas\u003c/em\u003e and the parasitic barnacle \u003cem\u003eSacculina carcini\u003c/em\u003e. Mar. Biol. 2012;159(9):2015\u0026ndash;2023.\u003c/li\u003e\n \u003cli\u003eWaiho K, Fazhan H, Glenner H, Ikhwanuddin M. Infestation of parasitic rhizocephalan barnacles\u003cem\u003e\u0026nbsp;Sacculina beauforti\u003c/em\u003e (Cirripedia, Rhizocephala) in edible mud crab, \u003cem\u003eScylla olivacea\u003c/em\u003e. PeerJ. 2017;5:e3419.\u003c/li\u003e\n \u003cli\u003eRees D, Glenner H. Control region sequences indicate that multiple externae represent multiple infections by \u003cem\u003eSacculina carcini\u003c/em\u003e (Cirripedia: Rhizocephala). Ecol. Evol. 2014;4(16):3290\u0026ndash;3297.\u003c/li\u003e\n \u003cli\u003eNagler C, H\u0026ouml;rnig MK, Haug JT, Noever C, H\u0026oslash;eg JT, Glenner H. The bigger, the better? Volume measurements of parasites and hosts: Parasitic barnacles (Cirripedia, Rhizocephala) and their decapod hosts. PloS one. 2017;12(7):e0179958.\u003c/li\u003e\n \u003cli\u003eMouritsen KN, Geyti SN, L\u0026uuml;tzen J, H\u0026oslash;eg JT, Glenner H. Population dynamics and development of the rhizocephalan\u003cem\u003e\u0026nbsp;Sacculina carcini\u003c/em\u003e, parasitic on the shore crab \u003cem\u003eCarcinus maenas\u003c/em\u003e. Dis. Aquat. Org. 2018;131(3):199\u0026ndash;211.\u003c/li\u003e\n \u003cli\u003eTakahashi T, Iwashige A, Matsuura S. Behavioral manipulation of the shore crab, \u003cem\u003eHemigrapsus sanguineus\u003c/em\u003e by the rhizocephalan barnacle,\u003cem\u003e\u0026nbsp;Sacculina polygenea\u003c/em\u003e. Crustacean Res. 1997;26:153\u0026ndash;161.\u003c/li\u003e\n \u003cli\u003eHartnoll RG. Parasitic castration of\u003cem\u003e\u0026nbsp;Macropodia longirostris\u003c/em\u003e (Fabricius) by a sacculinid. Crustaceana.1962; 295\u0026ndash;300.\u003c/li\u003e\n \u003cli\u003eBeck JT. The effects of an isopod castrator, \u003cem\u003eProbopyrus pandalicola\u003c/em\u003e, on the sex characters of one of its caridean shrimp hosts, \u003cem\u003ePalaemonetes paludosus\u003c/em\u003e. Biol. Bull.\u003c/li\u003e\n \u003cli\u003e;158(1):1\u0026ndash;15.\u003c/li\u003e\n \u003cli\u003eO\u0026rsquo;Brien J, Wyk PV. Effects of crustacean parasitic castrators (epicaridean isopods and rhizocephalan barnacles) on growth of crustacean host. In: Wenner AM, editor. Crustacean Issues. Vol. 3. Rotterdam: A.A. Balkema; 1985. p. 191\u0026ndash;218.\u003c/li\u003e\n \u003cli\u003eWoods L, Chapman JW, Dumbauld BR. The effects of a blood-sucking parasite from castration to feminization. REU Summer Reports. 2006;1\u0026ndash;11. Newport: Oregon State University, Hatfield Marine Science Center.\u003c/li\u003e\n \u003cli\u003eInui N, Oguchi K, Shinji J, Okanishi M, Shimomura M, Miura T. Parasitism-induced intersexuality in a sexually dimorphic varunid crab, \u003cem\u003ePtychognathus ishii\u003c/em\u003e (Decapoda: Varunidae). Zool. Sci. 2021;38(5):416\u0026ndash;426.\u003c/li\u003e\n \u003cli\u003eCalado R, Vitorino A, Dinis MT. Bopyrid isopods do not castrate the simultaneously hermaphroditic shrimp \u003cem\u003eLysmata amboinensis\u003c/em\u003e (Decapoda: Hippolytidae). Dis. Aquat. Org. 2006;73(1):73\u0026ndash;76.\u003c/li\u003e\n \u003cli\u003eBoyko CB, Williams JD. Crustacean parasites as phylogenetic indicators in decapod evolution. In: Martin JW, Crandall KA, Felder DL, editors. Crustacean Issues. Boca Raton: CRC Press; 2009. p. 197\u0026ndash;220.\u003c/li\u003e\n \u003cli\u003ede Barros MS, da Silva Neto LS, Calado TC. First record of parasitism by \u003cem\u003eProbopyrus pandalicola\u003c/em\u003e (Isopoda, Bopyridae) on the freshwater prawn \u003cem\u003eMacrobrachium acanthurus\u003c/em\u003e (Decapoda, Palaemonidae) and ecological interactions. J. Parasit. Dis. 2021;45:273\u0026ndash;278.\u003c/li\u003e\n \u003cli\u003eCorral JM, Henmi Y, Itani G. Differences in the parasitic effects of a bopyrid isopod and rhizocephalan barnacle on the portunid crab, \u003cem\u003eCharybdis bimaculata\u003c/em\u003e. Parasitol. Int. 2021;81:102283.\u003c/li\u003e\n \u003cli\u003eShiino SM. Studies on the Modification of Sexual Characters in\u003cem\u003e\u0026nbsp;Eupagurus samuelis\u003c/em\u003e caused by a Rhizocephalan Parasite \u003cem\u003ePeltogaster\u003c/em\u003e sp. Mem. Coll. Sci. Kyoto Imp. Univ. Ser. B. 1931;7(2):63\u0026ndash;101.\u003c/li\u003e\n \u003cli\u003eOguro C. On the sacculinization of the hermit-crab,\u003cem\u003e\u0026nbsp;Eupagurus ochotensis\u003c/em\u003e (Brandt). Annot. Zool. Jpn. 1955;28(2):100\u0026ndash;105.\u003c/li\u003e\n \u003cli\u003eNielsen SO. The effects of the rhizocephalan parasites \u003cem\u003ePeltogaster paguri\u003c/em\u003e Rathke and \u003cem\u003eGemmosaccus sulcatus\u003c/em\u003e (Lilljeborg) on five species of paguridan hosts (Crustacea Decapoda). Sarsia, 1970;42(1):17\u0026ndash;32.\u003c/li\u003e\n \u003cli\u003eFaria F, Boyko C, Mantelatto F. Parasitization of the white spotwrist hermit crab, \u003cem\u003ePagurus criniticornis\u003c/em\u003e (Dana, 1852)(Decapoda, Anomura), by the rhizocephalan barnacle \u003cem\u003ePeltogasterella socialis\u003c/em\u003e (M\u0026uuml;ller, 1863)(Cirripedia, Rhizocephala) from southeastern Brazil. Anim. Biol. 2007;57(3):315\u0026ndash;327.\u003c/li\u003e\n \u003cli\u003eKajimoto A, Toyota K, Ohira T, Yusa Y. Transcriptomic analysis of sexually dimorphic cypris larvae of the rhizocephalan barnacle \u003cem\u003ePeltogasterella gracilis\u003c/em\u003e. Comp. Biochem. Physiol. D Genomics Proteomics. 2024;52:101342.\u003c/li\u003e\n \u003cli\u003eKajimoto A, Yanagimachi R, Takahashi T, Yusa Y. Sex Determination by a Univalent Chromosome in the Rhizocephalan \u003cem\u003ePeltogasterella gracilis\u003c/em\u003e (Cirripedia: Rhizocephala: Peltogasterellidae). Biol. Bull. 2024;246(2):000\u0026ndash;000.\u003c/li\u003e\n \u003cli\u003eHokkaido-san Kontorui no Seikatsu-shi, Tokuni Complemental Male no Seishoku Kinō ni Tsuite (Shinrigaku/Seitaigaku). Zool. Mag. 1956;65(3\u0026ndash;4):113.\u003c/li\u003e\n \u003cli\u003eTsuchida K, L\u0026uuml;tzen J, Nishida M. Sympatric three-species infection by \u003cem\u003eSacculina\u003c/em\u003e parasites (Cirripedia: Rhizocephala: Sacculinidae) of an intertidal grapsoid crab. J. Crustac. Biol. 2006;26(4):474\u0026ndash;479.\u003c/li\u003e\n \u003cli\u003eYoshida R, Osawa M, Hirose M, Hirose E. A new genus and two new species of Peltogastridae (Crustacea: Cirripedia: Rhizocephala) parasitizing hermit crabs from Okinawa Island (Ryukyu Archipelago, Japan), and their DNA-barcodes. Zool. Sci. 2011;28(11):853\u0026ndash;862.\u003c/li\u003e\n \u003cli\u003ePodsiadlowski L, Bartolomaeus T. Organization of the mitochondrial genome of mantis shrimp \u003cem\u003ePseudosquilla ciliata\u003c/em\u003e (Crustacea: Stomatopoda). Mar. Biotechnol. 2005;7:618\u0026ndash;624.\u003c/li\u003e\n \u003cli\u003eFolmer O, Black M, Hoeh W, Lutz R. Vrijenhoek R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 1994;3:294\u0026ndash;299.\u003c/li\u003e\n \u003cli\u003eHedges LV. Distribution theory for Glass\u0026rsquo;s estimator of effect size and related estimators. J. Educ. Stat. 1981(2);6:107\u0026ndash;128.\u003c/li\u003e\n \u003cli\u003eKirby KN, Gerlanc D. Boot ES: An R package for bootstrap confidence intervals on effect sizes. Behav. Res. Methods. 2013;45:905\u0026ndash;927.\u003c/li\u003e\n \u003cli\u003eRitchie LE, H\u0026oslash;eg JT. The life history of\u003cem\u003e\u0026nbsp;Lernaeodiscus porcellanae\u003c/em\u003e (Cirripedia: Rhizocephala) and co-evolution with its porcellanid host. J. Crustac. Biol. 1981;1(3):334\u0026ndash;347.\u003c/li\u003e\n \u003cli\u003eMcLaughlin PA. A review of the hermit crab (Decapoda: Anomura: Paguridea) fauna of southern Thailand, with particular emphasis on the Andaman Sea, and descriptions of three new species. PMBC Special Publication. 2002;23(2):385\u0026ndash;460.\u003c/li\u003e\n \u003cli\u003eRahayu DL. Hermit crabs of Singapore (Crustacea: Decapoda: Anomura: Diogenidae, Paguridae), with description of two new species. Raffles Bull. Zool. 2022;1:70.\u003c/li\u003e\n \u003cli\u003eLafferty KD, Kuris AM. Parasitic castration: the evolution and ecology of body snatchers. Trends Parasitol. 2009;25(12):564\u0026ndash;572.\u003c/li\u003e\n \u003cli\u003eBaudoin M. Host castration as a parasitic strategy. Evolution. 1975;1:335\u0026ndash;352.\u003c/li\u003e\n \u003cli\u003eH\u0026oslash;eg JT, L\u0026uuml;tzen J. Crustacea Rhizocephala. In: Brattegard T, Christiansen M, Sneli J, eds. Marine Invertebrates of Scandinavia. Norwegian University Press; 1985. p. 92.\u003c/li\u003e\n \u003cli\u003eBarnes MA. Egg production in cirripedes. Oceanogr. Mar. Biol. 1989;27:91\u0026ndash;166.\u003c/li\u003e\n \u003cli\u003eMiroliubov A, Borisenko I, Nesterenko M, Lianguzova A, Ilyutkin S, Lapshin N, Dobrovolskij A. Specialized structures on the border between rhizocephalan parasites and their host\u0026rsquo;s nervous system reveal potential sites for host-parasite interactions. Sci. Rep. 2020;10(1):1128.\u003c/li\u003e\n \u003cli\u003eFeng C, Zhang J, Bao J, Luan D, Jiang N, Chen Q. Transcriptome analysis of germ cell changes in male Chinese mitten crabs (\u003cem\u003eEriocheir sinensis\u003c/em\u003e) induced by rhizocephalan parasite, \u003cem\u003ePolyascus gregaria\u003c/em\u003e. Front. Mar. Sci. 2023;10:1144448.\u003c/li\u003e\n \u003cli\u003ePercie du Sert N, Hurst V, Ahluwalia A, Alam S, Avey MT, Baker M, Browne WJ, Clark A, Cuthill IC, Dirnagl U, Emerson M. The ARRIVE guidelines 2.0: updated guidelines for reporting animal research. J. Cereb. Blood Flow Metab. 2020;40(9):1769\u0026ndash;1777.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTables 1 to 3 are available in the Supplementary Files section\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"zoological-letters","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"zlet","sideBox":"Learn more about [Zoological Letters](https://www.springer.com/journal/40851) ","snPcode":"40851","submissionUrl":"https://www.editorialmanager.com/zlet/default2.aspx","title":"Zoological Letters","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Host-parasite interaction, Feminization, Second pleopod, Cheliped length","lastPublishedDoi":"10.21203/rs.3.rs-5940335/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5940335/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eRhizocephalans (Thecostraca: Cirripedia) are parasitic crustaceans that infect a wide range of decapod hosts, including hermit crabs, crabs, and shrimps. These parasites exert profound effects on their hosts, inducing parasitic castration, suppressing the development of secondary sexual characteristics, feminizing male crabs, and altering male behavior that resembles that of females. In this study, we examined the secondary sexual characteristics of two hermit crabs–\u003cem\u003e Pagurus lanuginosus\u003c/em\u003e from Asari Town (Hokkaido, Japan) on the Sea of Japan coast and \u003cem\u003ePagurus filholi \u003c/em\u003efrom Chikura Town (Chiba, Japan) on the Pacific coast–both parasitized by \u003cem\u003ePeltogasterella gracilis\u003c/em\u003e and\u003cem\u003ePeltogaster\u003c/em\u003e sp., respectively. Specifically, we assessed the presence of secondary pleopods and the length of the right large cheliped. Our findings demonstrate that male \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e lanuginosus\u003c/em\u003e and\u003cem\u003e P\u003c/em\u003e.\u003cem\u003efilholi\u003c/em\u003e parasitized by \u003cem\u003eP\u003c/em\u003e.\u003cem\u003e gracilis\u003c/em\u003e and \u003cem\u003ePeltogaster\u003c/em\u003e sp. exhibit morphological changes and characteristics of females, confirming morphological feminization. Moreover, the magnitude of parasitic effect on morphological feminization varies between\u003cem\u003e \u003c/em\u003ethe two host species depending on the rhizocephalan genus. It indicates that the extent of feminization varied depending on the parasite genus. Notably, different parasite genera induced varying degrees of host modification, even within the same host species. Similarly, the level of feminization caused by a single parasite genus differed between host species. Our study highlights the importance to understand the characteristics of both the hermit crab host and rhizocephalan parasite to offer a crucial insights into the morphological feminization of the parasite within its host.\u003c/p\u003e","manuscriptTitle":"Morphological feminization in the hermit crabs (family Paguridae) induced by the rhizocephalan barnacles","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-25 07:11:40","doi":"10.21203/rs.3.rs-5940335/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2025-04-24T10:29:21+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-04-24T09:53:58+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-04-22T05:28:06+00:00","index":"","fulltext":""},{"type":"submitted","content":"Zoological Letters","date":"2025-04-21T02:41:41+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"zoological-letters","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"zlet","sideBox":"Learn more about [Zoological Letters](https://www.springer.com/journal/40851) ","snPcode":"40851","submissionUrl":"https://www.editorialmanager.com/zlet/default2.aspx","title":"Zoological Letters","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"944a8744-4862-4cb4-af8d-84a678a7ce67","owner":[],"postedDate":"April 25th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-06-09T15:59:14+00:00","versionOfRecord":{"articleIdentity":"rs-5940335","link":"https://doi.org/10.1186/s40851-025-00252-5","journal":{"identity":"zoological-letters","isVorOnly":false,"title":"Zoological Letters"},"publishedOn":"2025-06-05 15:57:03","publishedOnDateReadable":"June 5th, 2025"},"versionCreatedAt":"2025-04-25 07:11:40","video":"","vorDoi":"10.1186/s40851-025-00252-5","vorDoiUrl":"https://doi.org/10.1186/s40851-025-00252-5","workflowStages":[]},"version":"v1","identity":"rs-5940335","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5940335","identity":"rs-5940335","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-19T01:45:01.086888+00:00