LcWRKY18 negatively regulates anthocyanin biosynthesis and is associated with high temperature-induced regreening in Loropetalum chinense var. rubrum

LcWRKY18 negatively regulates anthocyanin biosynthesis and is associated with high temperature-induced regreening in Loropetalum chinense var. rubrum | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article LcWRKY18 negatively regulates anthocyanin biosynthesis and is associated with high temperature-induced regreening in Loropetalum chinense var. rubrum Anqi Huang, Mingtong Ren, Lili Xiang, Yang Liu, Jiaxuan Li, Zhenkun Liao, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9482561/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 6 You are reading this latest preprint version Abstract Loropetalum chinense var. rubrum is an important ornamental foliage shrub whose leaf coloration is highly sensitive to high temperature, often exhibiting high temperature-induced color fading due to reduced anthocyanin accumulation. However, the transcriptional mechanisms underlying this process remain poorly understood. In this study, we identified LcWRKY18 as a transcription factor affected by high temperature and associated with color fading, based on the reference genomic data of Loropetalum chinense var. rubrum and the transcriptomic data under heat stress. Functional analyses showed that LcWRKY18 negatively regulates anthocyanin accumulation, as its overexpression reduced anthocyanin accumulation, whereas its suppression promoted anthocyanin accumulation. Further multi-omics analyses revealed that LcWRKY18 overexpression broadly suppressed the expression of structural genes in the phenylpropanoid and flavonoid biosynthetic pathways, leading to decreased levels of major anthocyanin metabolites, particularly cyanidin- and delphinidin-derived compounds. Consistently, dual-luciferase assays demonstrated that LcWRKY18 directly inhibits the promoter activities of LcPAL , LcANS and LcUFGT . These results suggest that LcWRKY18 acts as a negative regulator of anthocyanin biosynthesis that mediates high temperature-induced leaves color fading in L. chinense var. rubrum. This study provides new insight into the molecular basis of high-temperature-induced leaf color fading and offers a useful candidate gene for breeding ornamental germplasm with improved color stability under high temperature stress. anthocyanin biosynthesis high temperature Loropetalum chinense var. rubrum ornamental foliage shrub WRKY transcription factor Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Highlights • Identified LcWRKY18 as a high temperature-responsive transcription factor associated with leaf color fading. • LcWRKY18 negatively regulates anthocyanin accumulation in L. chinense var. rubrum • Integrated transcriptomic and metabolomic analyses revealed that LcWRKY18 regulates anthocyanin metabolism by modulating the phenylpropanoid and flavonoid pathway. • LcWRKY18 suppresses anthocyanin biosynthesis by directly repressing key structural genes in the phenylpropanoid and flavonoid pathways, including. 1. Introduction Colored-leaf plants are widely valued in landscape greening due to their distinctive foliage coloration, which greatly enhances ornamental appeal. However, increasing frequency of extreme weather events, particularly prolonged high-temperature conditions associated with global warming, has imposed significant abiotic stress on plants [1]. High temperature is a critical environmental factor affecting leaf pigmentation in colored-leaf species, often leading to color fading and a decline in ornamental quality, thereby limiting their landscape application [2]. Loropetalum chinense var. rubrum , a natural variant of Loropetalum in the Hamamelidaceae family [3], is a representative ornamental colored-leaf shrub. Its characteristic red foliage is primarily attributed to the accumulation of anthocyanins [4]. Previous studies have shown that leaves coloration in this species is mainly determined by anthocyanins derived from pelargonidin, cyanidin, and delphinidin [5,6]. Notably, high temperature induces a typical regreening phenotype in L. chinense var. rubrum, in which red leaves gradually lose pigmentation and turn green [5]. which is largely associated with a decline in anthocyanin accumulation[7–9]. These findings indicate that high temperature plays a pivotal role in regulating anthocyanin accumulation and leaf coloration in L. chinense var. rubrum . However, the molecular mechanisms underlying high temperature-induced anthocyanin reduction and leaf color fading remain largely unclear. Anthocyanins are natural water-soluble pigments belonging to the flavonoid branch of polyphenolic compounds [10]. In addition to conferring attractive colors to flowers and fruits, they play important roles in stress adaptation by enhancing tolerance to adverse environments [11–16]. Anthocyanin biosynthesis originates from the phenylpropanoid pathway and involves a series of structural genes. Early biosynthetic genes (EBGs), including CHS, CHI, F3H, F3'H and F3'5'H, catalyze the formation of dihydroflavonols, whereas late biosynthetic genes (LBGs), including DFR, ANS/LDOX and UFGT, further convert these intermediates into anthocyanins [17]. In addition, anthocyanins can be modified by glycosylation, methylation and acylation and are transported into vacuoles for storage with the involvement of transport-related proteins such as GST [18,19]. Anthocyanin biosynthesis genes are largely controlled by the MYB-bHLH-WDR (MBW) transcriptional complex [20]. which regulates the expression of key structural genes and is evolutionarily conserved across plant species [21–25]. In addition to endogenous transcriptional regulation, anthocyanin accumulation is strongly influenced by environmental factors, including light, temperature, and water status. Among these, temperature is considered a critical determinant of anthocyanin stability and accumulation, with high temperature often leading to reduced anthocyanin content and color fading in plants. Environmental cues are known to modulate anthocyanin biosynthesis primarily by affecting the expression of structural genes and core regulatory factors such as MYB proteins. In addition to MYB factors, other transcription factors NAC, MADS-box, bZIP, WRKY and SPL also participate in anthocyanin regulation under environmental stimuli. For example, NAC and bZIP transcription factors can regulate anthocyanin accumulation by interacting with MYB proteins or integrating environmental signals, as exemplified by MdNAC42 and HY5-mediated regulatory pathways [26,27]. In recent years, Several WRKY proteins have been reported to either promote or repress anthocyanin accumulation in different species, suggesting their potential roles in linking environmental signals with secondary metabolites biosynthesis [28,29]. WRKY transcription factors are a large plant-specific family characterized by a conserved WRKYGQK motif and their ability to bind W-box cis-elements in target gene promoters, thereby regulating downstream gene expression [30,31]. Accumulating evidence indicates that WRKY proteins play important roles in plant responses to abiotic stresses, including drought, salinity, and temperature extremes, by modulating stress-responsive signaling pathways [32–39] . In addition to their roles in stress responses, several WRKY transcription factors have been reported to participate in the regulation of anthocyanin biosynthesis in different plant species, including MdWRKY40 [40], MdWRKY71-L [41], MdWRKY1 [42], PpWRKY44 [43] ,LhWRKY44 [44],AtWRKY41 [21], These findings suggest that WRKY proteins may function as integrators of environmental signals and pigment metabolism. However, their specific roles in mediating anthocyanin biosynthesis under high temperature stress remain largely unclear. In our previous work, 79 WRKY genes were identified and characterized in L. chinense var. rubrum and renamed LcWRKY1 - LcWRKY79 according to their chromosomal positions [45]. To clarify the regulatory role of WRKY genes in anthocyanin biosynthesis under high temperature stress, the expression patterns of 79 LcWRKY genes were systematically analyzed based on previous transcriptome data from high temperature-treated plants. And then a differentially expressed genes named LcWRKY18 was screened as a candidate gene potentially involved in high temperature-induced anthocyanin reduction. In this study, LcWRKY18 was functionally characterized through gene overexpression and silencing approaches, combined with transcriptomic-metabolomic analysis and molecular assays. Our results aim to clarify the role of LcWRKY18 in regulating anthocyanin biosynthesis under high temperature stress and to provide new insights into the molecular mechanisms underlying leaf color variation in ornamental plants. 2. Materials and methods 2.1. Plant materials Three Loropetalum cultivars, ‘Xiangnong Nishang’, ‘Xiangnong Fendai’ and ‘Hei Zhenzhu’ used in this study were obtained from the Engineering Research Center for Breeding and Utilization of Mid-subtropical Quality Ornamental Plants, Hunan Agricultural University. Nicotiana benthamiana plants for transient expression assays were cultivated in a growth chamber under controlled conditions: a temperature range of 22–25℃, a photoperiod of 16 h light / 8 h dark, LED light sources, and a relative humidity maintained between 55–65%. These conditions were implemented to ensure robust plant growth and stability of the transient expression system. 2.2Heat stress treatment conditions For transcriptome sequencing in the previous stage of this study, three potted plants each of ‘Hei Zhenzhu’, ‘Xiangnong Fendai’ and ‘Xiangnong Xiangyun’ were subjected to high temperature in a growth chamber. Day/night temperatures were set at 40/33 C, with a 14-h light / 10-h dark photoperiod. LED lighting was used, the photosynthetic photon flux density was set at 30,000 lx, and relative humidity was maintained at 90%. 2.3Transcriptome data analysis Raw read-count data obtained from transcriptome sequencing were normalized using the DESeq2 package in R. Size factors were calculated to correct sequencing-depth differences among samples and generate normalized count values. Differential expression analysis was then conducted with DESeq2 for T0 vs T1, T0 vs T3, T0 vs T5, T0 vs T7, pCAMBIA1305-GFP vs pCAMBIA1305- LcWRKY18 , and pTRV2-GFP vs LcWRKY18 comparisons. Genes with |log2 fold change| >= 1 and false discovery rate (FDR) < 0.05 were considered differentially expressed. 2.4. RNA extraction and qRT-PCR analysis Total RNA was extracted from roots, stems and leaves of ‘Hei Zhenzhu’, as well as from K599-transformed roots, using the FastPure Universal Plant Total RNA Isolation Kit (Vazyme) according to the manufacturer's instructions. High-quality RNA was reverse-transcribed into first-strand cDNA using the Vazyme reverse transcription kit and stored at -20℃ for subsequent cloning and expression analyses. Primers were designed using Primer3Plus and experimentally validated before use (Table 1 ). Loropetalum beta-actin was used as the internal reference gene. Each assay included three biological replicates and three technical replicates. Quantitative PCR was performed with the SYBR Green Pro Taq HS premix (Accurate Biology, AG11701), and relative expression levels of LcWRKY18 and anthocyanin biosynthetic genes were calculated using the 2 −∆∆CT method. 2.5. Bioinformatic analysis of LcWRKY18 Candidate LcWRKY genes were first examined by qRT-PCR using cDNA from five high temperature time points as templates. Relative expression was calculated using the 2 −∆∆CT method with the T0 sample as the calibrator. The physicochemical properties of LcWRKY18 , including molecular weight and isoelectric point, were predicted using ExPASy ProtParam. Signal peptides were predicted with SignalP 4.1, transmembrane domains with TMHMM 2.0, and subcellular localization with WoLF PSORT. Secondary structure was predicted with SOPMA, and the protein structure was modeled using AlphaFold3. Homologous proteins of LcWRKY18 were searched using NCBI BLASTP. Sequences showing more than 50% similarity were aligned in DANMAN. A phylogenetic tree was constructed in MEGA7 using the neighbor-joining method with reported high temperature and anthocyanin-related WRKY proteins from other species. Cis-regulatory elements in the − 2kb promoter regions upstream of LcWRKY genes were analyzed using PlantCARE and visualized with TBtools [46]. 2.6. Cloning of LcWRKY18 The coding sequence of LcWRKY18 was retrieved from the L. chinense var. rubrum genome database. Gene-specific cloning primers (Table 1 ) were designed in Primer3Plus and synthesized by Tsingke Biotechnology (Beijing, China). Using cDNA from leaves of ‘Xiangnong Nishang’ as the template, the full-length coding sequence of LcWRKY18 was amplified with a high-fidelity polymerase. The ligation products were transformed into Escherichia coli DH5a competent cells, and plasmids from positive colonies were extracted after sequence confirmation. 2.7. Subcellular localization of LcWRKY18 The pBI121-GFP vector was used for subcellular localization. The full-length CDS of LcWRKY18 was amplified from pEASY-T1- LcWRKY18 and inserted into pBI121 by homologous recombination after BamHI digestion. The resulting pBI121- LcWRKY18 construct and the empty vector were introduced into Agrobacterium tumefaciens GV3101. Positive Agrobacterium clones were cultured in medium containing 50 mg/L kanamycin and 50 mg/L rifampicin until OD 600 reached 1.0. Cells were harvested, washed and resuspended in infiltration buffer (10 mM MES, 10 mM MgCl 2 , 0.2 mM acetosyringone, pH 5.6) to an OD 600 of 0.8, and then incubated in darkness for 3 h. The suspensions were infiltrated into the abaxial side of healthy N. benthamiana leaves with a 1-mL syringe. After 48 h of dark incubation, fluorescent signals around the infiltration sites were observed and photographed under a laser confocal microscope. 2.8. Transcriptional activation assay To test self-activation activity and toxicity, the coding region of LcWRKY18 was inserted into the BD vector through EcoRI and BamHI restriction sites. The resulting BD- LcWRKY18 construct, the negative control (pGADT7-T + pGBKT7-Lam), and the positive control (pGADT7-T + pGBKT7-p53) were transformed into yeast strain Y2HGold and analyzed on selective media. 2.9. Vector construction and Agrobacterium rhizogenes-mediated root transformation For overexpression, the verified pEASY-T1- LcWRKY18 plasmid was used as a template, and seamless-cloning primers were designed according to the pCAMBIA1305-GFP vector map and LcWRKY18 sequence. The vector was linearized with BamHI, and homologous recombination, transformation and colony screening were performed as described above. For gene interference, a 300-bp fragment of LcWRKY18 was selected using the VIGS tool in Sol Genomics Network, and primers containing SamI sites were designed according to the pTRV2 vector. Homologous recombination and bacterial transformation were performed as for the overexpression vector. K599 A. rhizogenes competent cells stored at -80 ℃ were thawed and transformed with pCAMBIA1305- LcWRKY18 , pTRV2- LcWRKY18 , pTRV1, pTRV2 and pCAMBIA1305-GFP. Transformed cells were plated on selective medium and incubated at 28 ℃ for 2–3 d. Positive colonies were identified by PCR and cultured in TY medium supplemented with 50 mg/L kanamycin and 50 mg/L streptomycin to OD 600 = 0.4. One-year-old cuttings of ‘Hei Zhenzhu’ were used for root transformation. Lateral roots and fibrous roots were removed, leaving approximately 1 cm of the main root. Seedlings were immersed for 30 min in suspensions of pCAMBIA1305-GFP, pCAMBIA1305- LcWRKY18 , pTRV2 or pTRV2- LcWRKY18 ; for VIGS treatment, pTRV2-derived cultures were mixed 1:1 with pTRV1 cultures. After inoculation, seedlings were planted in soil and 2 mL of the corresponding bacterial suspension was applied to the base of the stem. Plants were then maintained in a growth chamber. Genomic DNA was extracted using the SteadyPure Plant Genomic DNA Extraction Kit (CTAB method, Accurate Biology, AG2106). PCR-based identification of transformed roots was carried out using primers specific for the rolB gene in the T-DNA region of K599, the GFP marker on pCAMBIA1305 or pTRV2, and LcWRKY18 -specific fragments (Table 1 ). The expression levels of LcWRKY18 in positive lines were further examined by qRT-PCR. Root coloration was recorded photographically. Fresh, normally pigmented roots were washed with distilled water, mounted as temporary water slides using the potato-clamp method, and observed under a light microscope. Anthocyanin content was determined using the pH differential method. 2.10. Metabolomic sample preparation Twelve root samples stored at -80℃ were freeze-dried and ground into powder. Powdered material was weighed and extracted with 0.5 mL of 50% methanol aqueous solution containing 0.1% HCl. Samples were vortexed for 5 min, ultrasonicated for 5 min, and centrifuged at 12,000 rpm for 3 min at 4 ℃. The extraction was repeated once, the supernatants were combined and filtered, and the resulting solutions were used for LC-MS/MS analysis of anthocyanin compounds. Anthocyanin metabolites were analyzed using an ExionLC AD ultra-performance liquid chromatography system coupled with a QTRAP 6500 + tandem mass spectrometer (SCIEX, China). 2.11. Molecular docking analysis Based on the amino acid sequence of LcWRKY18 and the core promoter sequences of LcUFGT, LcPAL and LcANS, three-dimensional structures were predicted with AlphaFold3. Models with high pLDDT values were selected for docking analysis. Protein-DNA interactions were predicted using the local version of HDOCKlite v1.1, and the interfaces of the resulting complexes were further analyzed using PLIP [47]. Relevant interaction details were visualized in PyMOL. 2.12. Dual-luciferase assay LcWRKY18 and the cloned promoter fragments of LcUFGT, LcPAL and LcANS were used as templates for In-Fusion cloning into pGreenII 0800-LUC-based reporter vectors and corresponding effector constructs. Recombinant plasmids were transformed into Agrobacterium and co-infiltrated into tobacco leaves. Firefly luciferase and Renilla luciferase signals were measured according to the standard dual-luciferase procedure, and promoter activity was expressed as the LUC/REN ratio. 2.13. Statistical analysis All analyses were conducted using at least three biological replicates. Data processing was performed in Excel 2007. Figures were prepared using GraphPad Prism 9.5 and Adobe Photoshop 2023. Significant differences among treatments were evaluated using Student's t-test and one-way analysis of variance, and different lowercase letters indicate significant differences at P < 0.05. Table 1 Primer sequences used in this study Primer name Primer sequence (5'-3') Assay LcWRKY18-QP-F TGGATGCAGCGTTTAGGGTT Quantitative Real-time PCR LcWRKY18-QP-R CTCTCGTGGTTGTGGACTCC Quantitative Real-time PCR β-actin-F CCACAAGGCTTATTGATAGAAT Quantitative Real-time PCR β-actin-R CAATGGTTGAACCTGAATACT Quantitative Real-time PCR LcCHS-F ATGATTAAGAAGCGTTACA Quantitative Real-time PCR LcCHS-R GTCTAGCATCCAATGAAG Quantitative Real-time PCR LcCHI-F CATTAACGATTGGCTTCT Quantitative Real-time PCR LcCHI-R CCTATGATTGACTCCAGTA Quantitative Real-time PCR LcPAL-F CTGAAGGGGAGTCATTTGGAAG Quantitative Real-time PCR LcPAL-R TCCATCACCCACTCACTACTC Quantitative Real-time PCR LcDFR-F TGCTAAGACATCGGCTGAGAAA Quantitative Real-time PCR LcDFR-R TCAACGCTGGGAGTCCTGAA Quantitative Real-time PCR LcANS-F CTATACTGAGGCAACAAG Quantitative Real-time PCR LcANS-R GTCTTCCTTCTTCTAAGC Quantitative Real-time PCR LcUFGT-F AAGCAAGCGGTGTAACAT Quantitative Real-time PCR LcUFGT-R CAAGGCACTACCATTCCAT Quantitative Real-time PCR LcWRKY18-F ATGGTCTCCACTGAAAATTTTGG Gene clone LcWRKY18-R TTAAGAAGAAGAAGAGCGAGAGGG Gene clone pBI121-LcWRKY18-F GGACTCTAGAGGATCCATGGTCTCCACTGAAAATTTTGGCT Subcellular localization pBI121-LcWRKY18-R GACCACCCGGGGATCCAGAAGAAGAAGAGCGAGAGGGAG Subcellular localization pCAMBIA-1305-LcWRKY18-F CACGGGGGACGGATCCATGGTCTCCACTGAAAATTTTGGCT Overpression pCAMBIA-1305-LcWRKY18-R CTTTGTAGTCGGATCCAGAAGAAGAAGAGCGAGAGGGAG Overpression pTRV2-LcWRKY18-F TCCCCATGGAGGCCTATGGTCTCCACTGAAAATTTTGGC Gene silencing pTRV2-LcWRKY18-R AAGGTTACCGAATTCTCTAACTCCGATTTCGTTCTAAATGC Gene silencing rolB-F GCCAGCATTTTTGGTGAACT detection rolB-R GGCACTGAACTTGCCGTTAT detection GFP-F CTGGTCGAGCTGGACGG detection GFP-R CTGGGTGCTCAGGTAGTGG detection BD-LcWRKY18-F CATGGAGGCCGAATTCATGGTCTCCACTGAAAATTTTGGCT verification BD-LcWRKY18-R GCAGGTCGACGGATCCTTAAGAAGAAGAAGAGCGAGAGGGAGC verification pCAMBIA-1300-LcWRKY18-F CCAAATCGACTCTAGAATGGTCTCCACTGAAAATTTTGGC Overpression pCAMBIA-1300-LcWRKY18-R GCAGAAGCTTTCTAGAAGAAGAAGAAGAGCGAGAGGG Overpression pGreenII 0800-F-48540A CGGTATCGATAAGCTggccaatgacaccaaatcct Dual-luciferase assay pGreenII 0800-R-48540A TAGAACTAGTGGATCtaacctaaaatacctacgatgtcataacaaattca Dual-luciferase assay pGreenII 0800-F-48540B CGGTATCGATAAGCTttacaaacctacaagtgagcctattcacg Dual-luciferase assay pGreenII 0800-R-48540B TAGAACTAGTGGATCgggacgtgacaacccccag Dual-luciferase assay pGreenII 0800-F-12653 CGGTATCGATAAGCTtatttaactagtcgccgccctgg Dual-luciferase assay pGreenII 0800-R-12653 TAGAACTAGTGGATCacttctactctccctcttcttatttatgttttatttttttagttaaaaaa Dual-luciferase assay pGreenII 0800-F-44833 CGGTATCGATAAGCTtagtgcatagttatcagaaccgaacgg Dual-luciferase assay pGreenII 0800-R-44833 TAGAACTAGTGGATCtattggttgattgaccttctttattttaagaaaaggatcgt Dual-luciferase assay Note: lowercase letters indicate gene-specific lowercase bases where applicable. 3. Results 3.1. Expression profiles of anthocyanin pathway genes and LcWRKY family members in different cultivars under high temperature Based on transcriptome count data, differential expression analyses were performed for samples collected at different high temperature stages. In ‘Hei Zhenzhu’, a large number of LcWRKY genes were differentially expressed during the middle stage of high temperature (T1, T3 and T5), whereas a different response pattern was observed in ‘Xiangnong Fendai’ (Fig. S1 A,B). Using the differential-expression results together with transcript abundance data, high temperature maps were constructed to visualize the expression patterns of LcWRKY genes in ‘Hei Zhenzhu’ and‘Xiangnong Fendai’under high temperature. In ‘Hei Zhenzhu’, LcWRKY18 displayed a highly characteristic expression profile and was strongly associated with the high temperature regreening phenotype (Fig. 1 A,B). Nine genes, namely LcWRKY13 , LcWRKY18 , LcWRKY21 , LcWRKY30 , LcWRKY36 , LcWRKY39 , LcWRKY46 , LcWRKY49 and LcWRKY74 , were preliminarily selected based on differential-expression and expression-pattern analyses. qRT-PCR verification showed that the expression trend of LcWRKY18 was highly consistent with the transcriptome data, supporting its selection as the major candidate gene for further study(Fig. 2 A,B). 3.2. Bioinformatic analysis of LcWRKY18 The coding sequence of LcWRKY18 was 534 bp in length according to the Loropetalum genome database. Using cDNA from leaves of ‘Xiangnong Nishang’ as the template, the full-length CDS was successfully amplified, and agarose gel electrophoresis showed a single clear band of the expected size(Fig. S2 ). Comprehensive bioinformatic analysis showed that the LcWRKY18 protein consists of 177 amino acids and has the typical features of a WRKY transcription factor. Prediction using ProtParam indicated a theoretical molecular mass and isoelectric point consistent with a small regulatory protein. SignalP predicted that LcWRKY18 lacks a signal peptide, indicating that it is not a secreted protein. TMHMM analysis further showed that it has no transmembrane domain(Fig. S3 A,B). Secondary-structure prediction indicated that LcWRKY18 is mainly composed of random coils, together with a small proportion of alpha-helices and extended strands. Structural modeling supported the presence of a typical WRKY DNA-binding domain(Fig. S3 C,D). Phylogenetic analysis revealed that LcWRKY18 clustered with several reported WRKY proteins involved in stress responses and anthocyanin regulation in other species, including MdWRKY40 [40], PpWRKY44 [43], LhWRKY44 [44], AtWRKY41 [21]and ZjWRKY18 [48] (Fig. 3 A). Multiple sequence alignment indicated that LcWRKY18 contained the conserved WRKYGQK motif and a typical C2H2-type zinc-finger structure, consistent with the defining features of WRKY transcription factors [30,31] (Fig. 3 B). Using cDNA from leaves, stems and roots of the cultivars ‘Hei Zhenzhu’ and ‘Xiangnong Xiangyun’, qRT-PCR showed that LcWRKY18 was expressed in all tested tissues but exhibited clear tissue specificity and cultivar-dependent variation. The relatively high expression in pigmented tissues suggested a close relationship with pigment metabolism and stress responses(Fig. S4 ). 3.3. Subcellular localization and transcriptional activation of LcWRKY18 To determine the intracellular localization of LcWRKY18 , the pBI121- LcWRKY18 fusion vector was transiently expressed in tobacco leaves. Confocal microscopy showed that the GFP signal of the fusion protein was distributed in both the nucleus and cytoplasm, whereas the control showed ubiquitous fluorescence, indicating that LcWRKY18 is a nucleocytoplasmic protein(Fig. 4 ). In yeast, pGBKT7- LcWRKY18 grew normally on SD/-Trp/-Leu medium, suggesting that the bait construct was not toxic. The transformed yeast strains were then transferred to highly selective media to evaluate self-activation. The results indicated that LcWRKY18 did not show obvious self-activation activity under the tested conditions(Fig. S5 ). 3.4. Functional verification of LcWRKY18 by transient overexpression and interference K599-mediated transformation successfully generated transgenic roots in ‘Hei Zhenzhu’. PCR analysis revealed the presence of the rolB, gfp, and LcWRKY18 genes in the transgenic roots (with no signals detected in the water and WT controls) (Fig. 5 A,B). qRT-PCR assays demonstrated that the vector pCAMBIA1305- LcWRKY18 upregulated the expression of the target gene in ‘Heizhenzhu’ by 4.17-fold compared to the empty vector, while the vector pTRV2- LcWRKY18 downregulated its expression to 0.21-fold of the empty vector(Fig. 5 C,D). Collectively, the results from PCR and qRT-PCR verified the successful establishment of the target gene overexpression and interference systems. Phenotypic observations showed that in the ‘Hei Zhenzhu’ cultivar, the roots of LcWRKY18 overexpression lines had significantly reduced anthocyanin content, which was decreased to 0.56-fold of that in the wild-type (WT) and empty vector controls. In contrast, RNA interference-mediated silencing of LcWRKY18 did not result in a significant fading phenotype; instead, it promoted pigment accumulation, with the anthocyanin content increased to 2.24-fold of the WT level(Fig. 5 E,F,G).The expression levels of structural genes involved in the anthocyanin biosynthesis pathway in the roots of transgenic plants were analyzed. The results showed that, compared with the control roots transformed with the empty pCAMBIA1305 vector, the expression levels of the anthocyanin biosynthetic structural genes PAL, CHS, CHI, DFR, ANS, and UFGT in the roots of the pCAMBIA1305- LcWRKY18 overexpression line decreased to 0.52-fold, 0.53-fold, 0.83-fold, 0.42-fold, 0.34-fold, and 0.60-fold of the control levels, respectively. In contrast, compared with the control roots transformed with the empty pTRV2-GFP vector, the expression levels of the same genes in the roots of the pTRV2- LcWRKY18 silencing line increased to 1.64-fold, 3.81-fold, 3.53-fold, 6.53-fold, 4.99-fold, and 2.12-fold of the control levels, respectively(Fig. 5 H,I). These results suggest that LcWRKY18 acts as a negative regulator of anthocyanin biosynthesis, functioning to repress the accumulation of anthocyanins. 3.5. Transcriptomic and metabolomic analyses of LcWRKY18 transgenic materials To further investigate how LcWRKY18 regulates color change in L. chinense var. rubrum , transcriptome sequencing was performed on 15 transgenic samples. Principal component analysis showed clear separation among the different groups, indicating good repeatability and distinct transcriptional states among overexpression, interference and control samples(Fig. 6 A). Based on time-series analysis, the gene expression profiles of WT, pCAMBIA1305-GFP, pCAMBIA1305-LcWRKY18, pTRV2-GFP, and pTRV2-LcWRKY18 were clustered into 10 modules. Significant differences in expression levels were observed among different sample groups within these modules, suggesting that LcWRKY18 may exert its biological functions by regulating gene expression(Fig. 6 B). Differential expression analysis was performed for four comparison groups: WT vs pCAMBIA1305-LcWRKY18, pCAMBIA1305-GFP vs pCAMBIA1305-LcWRKY18, WT vs pTRV2-LcWRKY18, and pTRV2-GFP vs pTRV2-LcWRKY18. The results revealed that the WT vs pCAMBIA1305-LcWRKY18 comparison contained 10,042 differentially expressed genes (DEGs), including 6,796 up-regulated and 3,246 down-regulated genes; the pCAMBIA1305-GFP vs pCAMBIA1305-LcWRKY18 comparison contained 5,076 DEGs, including 1,624 up-regulated and 3,452 down-regulated genes; the WT vs pTRV2-LcWRKY18 comparison contained 9,560 DEGs, including 5,959 up-regulated and 3,601 down-regulated genes; and the pTRV2-GFP vs pTRV2-LcWRKY18 comparison contained 4,103 DEGs, including 3,783 up-regulated and 320 down-regulated genes(Fig. 6 C). GO enrichment analysis indicated that differentially expressed genes were mainly enriched in phenylpropanoid metabolic process, phenylpropanoid biosynthetic process, lignin metabolic process, lignin biosynthetic process and response to chitin, among others(Fig. 6 D). KEGG enrichment further showed significant enrichment in flavonoid biosynthesis, monoterpenoid biosynthesis, phenylpropanoid biosynthesis, starch and sucrose metabolism, and phenylalanine metabolism. These results suggested that LcWRKY18 broadly affects secondary-metabolism-related pathways(Fig. 6 E). Transcriptome data further showed that overexpression or interference of LcWRKY18 significantly altered the expression of multiple genes involved in the phenylpropanoid and flavonoid pathways, including key structural genes associated with anthocyanin biosynthesis. To investigate the role of LcWRKY18 in flavonoid metabolism more deeply, LC-MS/MS-based metabolomic profiling was performed on overexpression and interference materials. The results showed that LcWRKY18 markedly affected the accumulation of various anthocyanin metabolites. In particular, overexpression of LcWRKY18 significantly inhibited the accumulation of cyanidin- and delphinidin-related compounds, whereas interference lines showed the opposite trend(Fig. 7 ). The heat map of anthocyanin metabolites clearly illustrated the differential accumulation pattern among the transgenic materials. 3.6. LcWRKY18 represses the promoter activities of LcUFGT , LcPAL and LcANS Based on the Loropetalum chinense var. rubrum genome database, the − 2000 bp DNA sequences upstream of the ATG start codon for six genes— LcPAL , LcCHS , LcCHI , LcDFR , LcANS , and LcUFGT —were retrieved as candidate promoter regions. These promoter sequences were subsequently submitted to the PlantCARE online analysis tool for cis-acting element prediction and analysis. Notably, multiple WRKY transcription factor binding sites (W-box elements) were identified in the promoters of LcPAL , LcANS , and LcUFGT , suggesting that these genes may be regulated by WRKY family transcription factors. Results from overexpression and VIGS/interference experiments indicated that LcWRKY18 may regulate structural genes involved in anthocyanin biosynthesis. Therefore, promoter regions of LcUFGT , LcPAL and LcANS were cloned from ‘Xiangnong Nishang’, and cis-element analysis revealed the presence of W-box motifs in these promoter fragments(Fig. 8 A). To further determine whether LcWRKY18 directly regulates the expression of LcUFGT , LcPAL , and LcANS genes, we performed a LUC transient expression assay in Nicotiana benthamiana. The pCAMBIA1300 vector harboring the LcWRKY18 gene was used as the effector vector, while the pGreenII0800 LUC vector carrying the promoter sequences of LcUFGT , LcPAL , and LcANS was used as the reporter vector(Fig. 8 B). Dual-luciferase assays showed that co-expression of LcWRKY18 significantly reduced the activities of the LcUFGT , LcPAL and LcANS promoters relative to controls. These results support the conclusion that LcWRKY18 functions as a transcriptional repressor of key structural genes in the anthocyanin biosynthetic pathway(Fig. 8 C). Based on the amino acid sequence of LcWRKY18 and the promoter sequences of LcUFGT , LcPAL , and LcANS , structure prediction was performed using AlphaFold3. The top-ranked structure was selected as the experimental model based on the pLDDT score. The PLIP interaction analysis platform was employed to comprehensively describe and systematically analyze the binding interfaces(Fig. 8 D). 4. Discussion WRKY transcription factors participate extensively in plant development, stress adaptation and specialized metabolism. Since the first WRKY protein SPF1 was cloned from sweet potato [49], large numbers of WRKY genes have been identified in Arabidopsis [50], rice [51] and maize [52]. Accumulating evidence shows that WRKY proteins function in seed dormancy and germination [53,54], root development [55–57], pollen development [58], floral morphogenesis [59], and responses to diverse biotic and abiotic stresses, including high temperature [34,36,60,61]. Previous studies have identified a total of 79 LcWRKY genes in the Loropetalum chinense var. rubrum genome[45], which is approximately the same as the 74 members found in the model plant Arabidopsis thaliana [62]. Previous research has shown that Arabidopsis thaliana has undergone at least two whole-genome duplication events, which have contributed to the rapid expansion of its gene families[63,64].In the present study, LcWRKY18 was identified from high temperature transcriptome datasets of L. chinense var. rubrum as a candidate gene associated with anthocyanin metabolism and regreening, and its functional analysis suggested that it acts as a negative regulator of anthocyanin accumulation under high temperature. WRKY family members exhibit significant differential responses to heat stress among different plant species. For instance, in Lilium longiflorum , 62 LdWRKY genes were identified to be differentially expressed under heat stress, with 51 genes up-regulated and 11 genes down-regulated[65]; in contrast, in Phoenix dactylifera , 7 PdWRKY genes were up-regulated while 10 genes showed down-regulation[66].Through heat stress treatment of two Loropetalum chinense var. rubrum varieties, ‘Hei Zhenzhu’ and ‘Xiangnong Fendai’, it was observed that the number of differentially expressed members of the LcWRKY family and their temporal distribution exhibited obvious temporal dynamics. In ‘Hei Zhenzhu’, the largest number of differentially expressed genes was identified at the T0 vs T3 stage, whereas no differentially expressed genes were found at the T0 vs T7 stage. In ‘Xiangnong Fendai’, the number of differentially expressed genes gradually increased with the duration of heat stress, reaching 4 at the T0 vs T7 stage.In potato ( Solanum tuberosum ), the expression level of StWRKY75 shows a significant difference between the heat-sensitive variety ‘Atlantic’ and the heat-tolerant variety ‘Desiree’, and this difference is directly related to the thermotolerance of the varieties[67].Meanwhile, the co-responsive genes of the two varieties were mainly concentrated at the T0vsT3 and T0vsT5 stages, indicating that 3–5 days after heat stress constitutes the critical phase for the LcWRKY gene family to exert its regulatory functions. The differences in the LcWRKY expression patterns between the two varieties are highly correlated with the stability of their leaf colors, suggesting that individual LcWRKY members may play important roles in the color stability of Loropetalum chinense var. rubrum under heat stress by regulating the anthocyanin metabolic pathway. Cis-acting elements form the structural basis for transcription factors to respond to upstream signals and regulate downstream target genes. In the study of the WRKY gene family in Phoenix dactylifera , the promoter regions are rich in a variety of cis-elements related to abiotic stress responses, such as ABRE [66].Analysis of the promoter regions of LcWRKY genes in Loropetalum chinense var. rubrum revealed that all members contain elements related to heat stress responses, primarily including the Antioxidant Response Element (ARE), G-box element and Abscisic Acid Response Element (ABRE)[68,69] (Fig. 2 E). Sequence alignment and phylogenetic analysis confirmed that LcWRKY18 contains the conserved WRKY domain and belongs to the canonical WRKY family [30,31]. The close relationship between LcWRKY18 and reported anthocyanin-related WRKY proteins from other species suggests partial functional conservation. In addition, qRT-PCR showed that LcWRKY18 exhibited clear tissue specificity in different cultivars.As key regulatory hubs in the secondary metabolic network, WRKY transcription factors are involved in the regulation of biosynthesis for secondary metabolites such as flavonoids and terpenoids.In jujube, ZjWRKY18 positively regulates triterpenoid accumulation and enhances salt tolerance [48]. These observations support the view that LcWRKY18 genes may participate in both secondary metabolism and stress adaptation in different plant species. The Agrobacterium rhizogenes-mediated hairy-root system provided an effective platform for rapid functional verification in L. chinense var. rubrum. Overexpression of LcWRKY18 caused obvious fading of root color and a marked reduction in anthocyanin content, whereas interference of LcWRKY18 had the opposite effect. The regulatory mechanisms underlying the role of WRKY transcription factors in anthocyanin biosynthesis are complex and diverse.In pear, PyWRKY26 regulates the synthesis and transport of anthocyanins by targeting the promoter of PyMYB114 [70]; in kiwifruit, AcWRKY44 interacts with MYBC1 to be involved in the regulation of the proanthocyanidin and anthocyanin biosynthetic pathways[71]. However, some WRKY members have been confirmed to possess transcriptional repression activity. In Arabidopsis thaliana, AtWRKY31 has been identified as a transcriptional repressor [72]; AtWRKY61 also exhibits transcriptional repression activity, where it binds to the W-box in the promoter of ALMT1 to inhibit its expression[73]. In lily, although LhWRKY44 has been confirmed to positively regulate anthocyanin biosynthesis, the same regulatory network also contains LhHB4 , an HD-Zip transcription factor containing an EAR repression motif, which negatively regulates anthocyanin accumulation by suppressing the expression of LhWRKY44 and LhMYBSPLATTER [74].Subcellular localization showed that LcWRKY18 was distributed in both the nucleus and cytoplasm. This finding is inconsistent with the nuclear localization results of WRKY proteins reported in most studies. Such differences in localization may reflect the functional diversity of WRKY transcription factors. Studies have shown that WRKY transcription factors can sense signals in the cytoplasm and, in response to stimuli, be translocated into the nucleus to exert their regulatory functions.[75]. As plant-specific regulators, WRKY transcription factors play complex regulatory roles in the flavonoid metabolic network. Previous studies have demonstrated that WRKY transcription factors are involved in the regulation of anthocyanin and proanthocyanidin accumulation by directly targeting key structural enzyme genes in the flavonoid biosynthetic pathway [76]. Meanwhile, WRKYs act as regulatory hubs to integrate multiple developmental and environmental signals, exerting multi-layered regulatory effects on various secondary metabolic pathways including flavonoids [77]. Metabolomic analysis of transgenic Loropetalum chinense var. rubrum materials in this study revealed that in the anthocyanin metabolites, overexpression of LcWRKY18 significantly reduced the contents of various anthocyanins such as cyanidin and delphinidin, while interference significantly increased the contents of peonidin and its derivatives. In proanthocyanidin metabolites, overexpression suppressed their accumulation, whereas interference promoted accumulation. These results reveal that LcWRKY18 may exhibit differential regulatory functions on different branch pathways of flavonoids. Collectively, LcWRKY18 likely exerts differential regulatory effects on anthocyanin and proanthocyanidin biosynthesis in Loropetalum chinense var. rubrum . Promoter analysis showed that LcPAL , LcANS and LcUFGT contain W-box-related cis-elements, and dual-luciferase assays demonstrated that LcWRKY18 significantly repressed the activities of these promoters. Together with the observed down-regulation of anthocyanin structural genes in transgenic materials, these results indicate that LcWRKY18 may repress anthocyanin biosynthesis by acting upstream of key pathway genes. This inference is consistent with the well-established ability of WRKY proteins to bind W-box elements and regulate downstream transcription[36], although direct physical binding still requires further confirmation. Abbreviations ANS anthocyanidin synthase CHS chalcone synthase DFR dihydroflavonol 4-reductase GSA Genome Sequence Archive qRT-PCR quantitative real-time PCR RNA-seq RNA sequencing UFGT UDP-glucose: flavonoid 3-O-glucosyltransferase VIGS virus-induced gene silencing WRKY WRKY transcription factor. Declarations Funding This work was supported by the Natural Science Foundation of Hunan Province (2024JJ5178), the Natural Science Foundation of Changsha, Hunan Province (kq2402112), the Hunan Provincial Forestry Bureau (XLK202437), the Scientific Research Project of the Hunan Provincial Department of Education (24C1372), the Hunan Provincial Graduate Innovation Project (CX20240643 and CX20251094), the National Innovation and Entrepreneurship Training Program for College Students of China (S202310537005), the Yuelushan Laboratory Talent Program (2025RC3004), the Furong High-Level Talent Program (2025RC4005), and Hunan Agricultural University (25KJ021). Author contributions Anqi Huang, Mingtong Ren, and Lili Xiang contributed equally to this work. Anqi Huang, Mingtong Ren, Lili Xiang, Nan Ma, Xiaoying Yu, and Yanlin Li designed the study. Anqi Huang, Mingtong Ren, Lili Xiang, Yang Liu, Jiaxuan Li, Zhenkun Liao, and Lu Xu performed the experiments and collected the data. Anqi Huang, Mingtong Ren, Lili Xiang, and Donglin Zhang analyzed the data and interpreted the results. Nan Ma, Xiaoying Yu, and Yanlin Li supervised the research and acquired funding. Anqi Huang drafted the manuscript. All authors revised the manuscript and approved the final version. Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Ethics approval and consent to participate Experimental research on plants, including the collection of plant materials, complied with relevant institutional, national and international guidelines and legislation. No specific permits were required for the cultivated plant materials used in this study. Consent for publication Not applicable. Data availability The RNA-seq datasets generated and analysed during the current study have been deposited in the Genome Sequence Archive (GSA) of the National Genomics Data Center, China National Center for Bioinformation. The heat-stress transcriptome datasets of Loropetalum chinense var. rubrum leaves have been submitted under BioProject accession number PRJCA063709 and GSA submission number subCRA069695. The transcriptome datasets of LcWRKY18 transgenic hairy roots have been submitted under BioProject accession number PRJCA063659 and GSA submission number subCRA069621. These datasets are currently under confidential status and will be released upon publication. The final GSA accession numbers will be updated after database processing and assignment. Acknowledgements The authors thank the Molecular Biology Technology Platform of Yuelushan Laboratory and the Hunan Mid-subtropical Quality Plant Breeding and Utilization Engineering Technology Research Center for technical support. Graphical abstract text Under high temperature, LcWRKY18 is induced in red-leaved Loropetalum chinense var. rubrum . Elevated LcWRKY18 suppresses the expression of key anthocyanin biosynthetic genes, including LcPAL, LcANS, and LcUFGT, leading to reduced anthocyanin accumulation and accelerated leaf regreening. Functional analyses using hairy root transformation, transcriptomics, metabolomics, and promoter activity assays support the role of LcWRKY18 as a negative regulator of anthocyanin biosynthesis during high temperature. References The reference list from the original manuscript is retained below. Existing English entries are preserved, while Chinese entries are kept in their original form for accuracy. Haque M, Tanjima U, Sushmoy D, et al. Heat stress alters chlorophyll fluorescence, photosynthesis and antioxidative enzyme activities in wheat cultivars[J]. Fundamental and Applied Agriculture, 2019(0): 1. Liu Y, Lin L, Liu Y, et al. Genome-wide analysis of the bHLH gene family in loropetalum chinense var. rubrum: Identification, classification, evolution, and diversity of expression patterns under cultivation[J]. Plants, 2023, 12(19): 3392. Liu Y, Lin L, Liu Y, et al. Genome-wide analysis of the bHLH gene family in loropetalum chinense var. rubrum : Identification, classification, evolution, and diversity of expression patterns under cultivation[J]. Plants, 2023, 12(19): 3392. Zhang Y, Liu Y, Ling L, et al. Phenotypic, physiological, and molecular response of loropetalum chinense var. rubrum under different light quality treatments based on leaf color changes.[J]. Plants, 2023, 12(11): 2169. Cai W, Zhang D, Zhang X, et al. Leaf color change and photosystem function evaluation under heat treatment revealed the stress resistance variation between loropetalum chinense and L. chinense var. rubrum.[J]. PeerJ, 2023, 11: e14834. Kong J M, Chia L S, Goh N K, et al. Analysis and biological activities of anthocyanins[J]. Phytochemistry, 2003, 64(5): 923-933. Winkel-Shirley B. Flavonoid biosynthesis. A colorful model for genetics, biochemistry, cell biology, and biotechnology[J]. Plant Physiology, 2001, 126(2): 485-493. Cipollini M L, Levey D J. Secondary metabolites of fleshy vertebrate-dispersed fruits: Adaptive hypotheses and implications for seed dispersal[J]. American Naturalist, 1997, 150(3): 346-372. Impact of low-temperature stress on general phenylpropanoid and anthocyanin pathways: enhancement of transcript abundance and anthocyanin pigmentation in maize seedlings | planta | springer nature link[EB/OL]. [2026-03-26]. https://link.springer.com/article/10.1007/BF00714468. De Rosas I, Deis L, Baldo Y, et al. High temperature alters anthocyanin concentration and composition in grape berries of malbec, merlot, and pinot noir in a cultivar-dependent manner[J]. Plants, 2022, 11(7): 926. Lo Piero A R, Puglisi I, Rapisarda P, et al. Anthocyanins accumulation and related gene expression in red orange fruit induced by low temperature storage[J]. Journal of Agricultural and Food Chemistry, 2005, 53(23): 9083-9088. Treutter D. Significance of flavonoids in plant resistance and enhancement of their biosynthesis[J]. Plant Biology (Stuttgart, Germany), 2005, 7(6): 581-591. Guo N, Cheng F, Wu J, et al. Anthocyanin biosynthetic genes in brassica rapa[J]. BMC Genomics, 2014, 15(1): 426. Chen L, Hu B, Qin Y, et al. Advance of the negative regulation of anthocyanin biosynthesis by MYB transcription factors[J]. Plant Physiology and Biochemistry, 2019, 136: 178-187. Tsuda T. Dietary anthocyanin-rich plants: Biochemical basis and recent progress in health benefits studies[J]. Molecular Nutrition & Food Research, 2012, 56(1): 159-170. Transcriptomic and metabolomic analyses reveal that MYB transcription factors regulate anthocyanin synthesis and accumulation in the disc florets of the anemone form of chrysanthemum morifolium - ScienceDirect[EB/OL]. [2026-03-26]. https://www.sciencedirect.com/science/article/pii/S0304423821009547. Gonzalez A, Zhao M, Leavitt J M, et al. Regulation of the anthocyanin biosynthetic pathway by the TTG1/bHLH/myb transcriptional complex in arabidopsis seedlings[J]. Plant Journal, 2008, 53(5): 814-827. MdMYB114 regulates anthocyanin biosynthesis and functions downstream of MdbZIP4-like in Apple fruit - ScienceDirect[EB/OL]. [2026-03-26]. https://www.sciencedirect.com/science/article/pii/S0176161720302431. Zhou B, Wang Y, Zhan Y, et al. Chalcone synthase family genes have redundant roles in anthocyanin biosynthesis and in response to blue/UV-a light in turnip (brassica rapa; brassicaceae)[J]. American Journal of Botany, 2013, 100(12): 2458-2467. Heppel S C, Jaffé F W, Takos A M, et al. Identification of key amino acids for the evolution of promoter target specificity of anthocyanin and proanthocyanidin regulating MYB factors[J]. Plant Molecular Biology, 2013, 82(4-5): 457-471. Duan S, Wang J, Gao C, et al. Functional characterization of a heterologously expressed brassica napus WRKY41-1 transcription factor in regulating anthocyanin biosynthesis in arabidopsis thaliana[J]. Plant Science, 2018, 268: 47-53. Mao Z, Jiang H, Wang S, et al. The MdHY5-MdWRKY41-MdMYB transcription factor cascade regulates the anthocyanin and proanthocyanidin biosynthesis in red-fleshed apple[J]. Plant Science: An International Journal of Experimental Plant Biology, 2021, 306: 110848. Apple NAC transcription factor MdNAC52 regulates biosynthesis of anthocyanin and proanthocyanidin through MdMYB9 and MdMYB11 - ScienceDirect[EB/OL]. [2026-03-26]. https://www.sciencedirect.com/science/article/abs/pii/S0168945219308295. Zhang S, Chen Y, Zhao L, et al. A novel NAC transcription factor, MdNAC42, regulates anthocyanin accumulation in red-fleshed apple by interacting with MdMYB10[J]. Tree Physiology, 2020, 40(3): 413-423. Sun C, Wang C, Zhang W, et al. The R2R3-type MYB transcription factor MdMYB90-like is responsible for the enhanced skin color of an apple bud sport mutant[J]. Horticulture Research, 2021, 8(1): 156. Sun C, Deng L, Du M, et al. A transcriptional network promotes anthocyanin biosynthesis in tomato flesh[J]. Molecular Plant, 2020, 13(1): 42-58. Takos A M, Jaffé F W, Jacob S R, et al. Light-induced expression of a MYB gene regulates anthocyanin biosynthesis in red apples[J]. Plant Physiology, 2006, 142(3): 1216-1232. Tao R, Bai S, Ni J, et al. The blue light signal transduction pathway is involved in anthocyanin accumulation in “red zaosu” pear[J]. Planta, 2018, 248(1): 37-48. Bai S, Tao R, Tang Y, et al. BBX16, a B-box protein, positively regulates light-induced anthocyanin accumulation by activating MYB10 in red pear[J]. Plant Biotechnology Journal, 2019, 17(10): 1985-1997. Eulgem T, Rushton P J, Robatzek S, et al. The WRKY superfamily of plant transcription factors[J]. Trends in Plant Science, 2000, 5(5): 199-206. Chen F, Hu Y, Vannozzi A, et al. The WRKY transcription factor family in model plants and crops[J]. Critical Reviews in Plant Sciences, 2017, 36(5-6): 311-335. Sun Y, Yu D. Activated expression of AtWRKY53 negatively regulates drought tolerance by mediating stomatal movement[J]. Plant Cell Reports, 2015, 34(8): 1295-1306. Krishnamurthy P, Vishal B, Ho W J, et al. Regulation of a cytochrome P450 gene CYP94B1 by WRKY33 transcription factor controls apoplastic barrier formation in roots to confer salt tolerance.[J]. Plant Physiology, 2020, 184(4): 2199-2215. Li S, Fu Q, Chen L, et al. Arabidopsis thaliana WRKY25, WRKY26, and WRKY33 coordinate induction of plant thermotolerance.[J]. Planta, 2011, 233(6): 1237-1252. Zou C, Jiang W, Yu D. Male gametophyte-specific WRKY34 transcription factor mediates cold sensitivity of mature pollen in Arabidopsis.[J]. Journal of Experimental Botany, 2010, 61(14): 3901-3914. Han M, Kim C Y, Lee J, et al. OsWRKY42 represses OsMT1d and induces reactive oxygen species and leaf senescence in rice.[J]. Molecules and Cells, 2014, 37(7): 532-539. Zhang M, Zhao R, Huang K, et al. The OsWRKY63-OsWRKY76-OsDREB1B module regulates chilling tolerance in rice.[J]. Plant Journal, 2022, 112(2): 383-398. Cai R, Dai W, Zhang C, et al. The maize WRKY transcription factor ZmWRKY17 negatively regulates salt stress tolerance in transgenic arabidopsis plants.[J]. Planta, 2017, 246(6): 1215-1231. Zhang L, Cheng J, Sun X, et al. Overexpression of VaWRKY14 increases drought tolerance in arabidopsis by modulating the expression of stress-related genes.[J]. Plant Cell Reports, 2018, 37(8): 1159-1172. Xu P yue, Xu L, Xu H feng, et al. MdWRKY40is directly promotes anthocyanin accumulation and blocks MdMYB15L, the repressor of MdCBF2, which improves cold tolerance in apple[J]. Journal of Integrative Agriculture, 2023, 22(6): 1704-1719. Su M, Wang S, Li C, et al. Ultraviolet-B-induced MdWRKY71-L expression regulates anthocyanin synthesis in apple[J]. Environmental and Experimental Botany, 2022, 201: 105000. Ma H, Yang T, Li Y, et al. The long noncoding RNA MdLNC499 bridges MdWRKY1 and MdERF109 function to regulate early-stage light-induced anthocyanin accumulation in apple fruit[J]. The Plant Cell, 2021, 33(10): 3309-3330. Alabd A, Ahmad M, Zhang X, et al. Light-responsive transcription factor PpWRKY44 induces anthocyanin accumulation by regulating PpMYB10 expression in pear[J]. Horticulture Research, 2022, 9: uhac199. Bi M, Liang R, Wang J, et al. Multifaceted roles of LhWRKY44 in promoting anthocyanin accumulation in asiatic hybrid lilies (lilium spp.)[J]. Horticulture Research, 2023, 10(9): uhad167. Liu Y, Zhang Y, Liu Y, et al. Genome-wide identification and characterization of WRKY transcription factors and their expression profile in loropetalum chinense var. rubrum.[J]. Plants, 2023, 12(11): 2131. Chen C, Chen H, Zhang Y, et al. TBtools: An integrative toolkit developed for interactive analyses of big biological data[J]. Molecular Plant, 2020, 13(8): 1194-1202. Adasme M F, Linnemann K L, Bolz S N, et al. PLIP 2021: Expanding the scope of the protein-ligand interaction profiler to DNA and RNA[J]. Nucleic Acids Research, 2021, 49(W1): W530-W534. Wen C, Zhang Z, Shi Q, et al. Methyl jasmonate- and salicylic acid-induced transcription factor ZjWRKY18 regulates triterpenoid accumulation and salt stress tolerance in jujube[J]. International Journal of Molecular Sciences, 2023, 24(4). Ishiguro S, Nakamura K. Characterization of a cDNA encoding a novel DNA-binding protein, SPF1, that recognizes SP8 sequences in the 5’ upstream regions of genes coding for sporamin and beta-amylase from sweet potato[J]. Molecular & general genetics: MGG, 1994, 244(6): 563-571. Ulker B, Somssich I E. WRKY transcription factors: From DNA binding towards biological function[J]. Current Opinion in Plant Biology, 2004, 7(5): 491-498. Ross C A, Liu Y, Shen Q J. The WRKY gene family in rice ( oryza sativa )[J]. Journal of Integrative Plant Biology, 2007, 49(6): 827-842. Wei K F, Chen J, Chen Y F, et al. Molecular phylogenetic and expression analysis of the complete WRKY transcription factor family in maize.[J]. DNA Research, 2012, 19(2): 153-164. Zhou C, Lin Q, Lan J, et al. WRKY transcription factor OsWRKY29 represses seed dormancy in rice by weakening abscisic acid response[J]. Frontiers in Plant Science, 2020, 11: 691. Jiang W, Yu D. Arabidopsis WRKY2 transcription factor mediates seed germination and postgermination arrest of development by abscisic acid[J]. BMC Plant Biology, 2009, 9(1): 96. Hu Z, Wang R, Zheng M, et al. TaWRKY51 promotes lateral root formation through negative regulation of ethylene biosynthesis in wheat (triticum aestivum L.)[J]. The Plant Journal: For Cell and Molecular Biology, 2018, 96(2): 372-388. Grunewald W, De Smet I, Lewis D R, et al. Transcription factor WRKY23 assists auxin distribution patterns during arabidopsis root development through local control on flavonol biosynthesis[J]. Proceedings of the National Academy of Sciences, 2012, 109(5): 1554-1559. Wang P, Xu X, Tang Z, et al. OsWRKY28 regulates phosphate and arsenate accumulation, root system architecture and fertility in rice[J]. Frontiers in Plant Science, 2018, 9: 1330. Lei R, Li X, Ma Z, et al. Arabidopsis WRKY2 and WRKY34 transcription factors interact with VQ20 protein to modulate pollen development and function[J]. The Plant Journal: For Cell and Molecular Biology, 2017, 91(6): 962-976. Li W, Wang H, Yu D. Arabidopsis WRKY transcription factors WRKY12 and WRKY13 oppositely regulate flowering under short-day conditions[J]. Molecular Plant, 2016, 9(11): 1492-1503. Cheng Z, Luan Y, Meng J, et al. WRKY transcription factor response to high-temperature stress[J]. Plants (Basel, Switzerland), 2021, 10(10): 2211. Zhang Y, Wang L. The WRKY transcription factor superfamily: Its origin in eukaryotes and expansion in plants[J]. BMC Evolutionary Biology, 2005, 5: 1. Berri S, Abbruscato P, Faivre-Rampant O, et al. Characterization of WRKYco-regulatory networks in rice and Arabidopsis[J]. BMC Plant Biology, 2009, 9(1): 120. Blanc G, Hokamp K, Wolfe K H. A recent polyploidy superimposed on older large-scale duplications in the arabidopsis genome[J]. Genome Research, 2003, 13(2): 137-144. Wu K L, Guo Z J, Wang H H, et al. The WRKY family of transcription factors in rice and arabidopsis and their origins[J]. DNA research: an international journal for rapid publication of reports on genes and genomes, 2005, 12(1): 9-26. Xu S, Feng H, Li T, et al. Genome-wide analysis of the WRKY gene family in lily and functional characterization of LdWRKY87 in response to heat stress[J]. New Crops, 2026, 3: 100084. Khan I, Lubna, Bilal S, et al. Genome-wide and transcriptome analysis of PdWRKY transcription factors in date palm (Phoenix dactylifera) revealing insights into heat and drought stress tolerance[J]. BMC Genomics, 2025, 26(1): 589. Zhu X, Duan X, Majeed Y, et al. Functional analysis of StWRKY75 gene in response to heat stress in potato (solanum tuberosum L.)[J]. Frontiers in Plant Science, 2025, 16. Nakashima K, Yamaguchi-Shinozaki K, Shinozaki K. The transcriptional regulatory network in the drought response and its crosstalk in abiotic stress responses including drought, cold, and heat[J]. Frontiers in Plant Science, 2014, 5. Wang J, Zhang X, Wang G. Transcriptomic analysis of heat-responsive genes in maize seedlings[J]. Maize Genomics and Genetics, 2025, 16(0). Li C, Wu J, Hu K D, et al. PyWRKY26 and PybHLH3 cotargeted the PyMYB114 promoter to regulate anthocyanin biosynthesis and transport in red-skinned pears[J]. Horticulture Research, 2020, 7: 37. Peng Y, Thrimawithana A H, Cooney J M, et al. The proanthocyanin-related transcription factors MYBC1 and WRKY44 regulate branch points in the kiwifruit anthocyanin pathway[J]. Scientific Reports, 2020, 10(1): 14161. Wang Y qiao, Zhao X jie, Niu F fang, et al. Analysis of transcriptional activity and interaction proteins of WRKY31 transcription factor in arabidopsis thaliana[J]. Biotechnology Bulletin, 2018, 34(5): 101. Ma A, Li J, Liu S, et al. WRKY61 negatively regulates aluminum resistance by inhibiting the expression of ALMT1 in arabidopsis thaliana[J]. Plants, 2025, 14(21). Bi M, Xu L, Wang J, et al. Three transcription factors form an activation-inhibition module to regulate anthocyanin accumulation in asiatic hybrid lilies[J]. Plant Physiology, 2025, 198(2): kiaf203. Tak H, Negi S, Ganapathi T R. The 5’-upstream region of WRKY18 transcription factor from banana is a stress-inducible promoter with strong expression in guard cells[J]. Physiologia Plantarum, 2021, 173(4): 1335-1350. Chen L, Cheng Y, Hong G. Molecular insights into the regulation of flavonoid biosynthesis in fruits[J]. Horticulture Research, 2026, 13(2): uhaf306. Li Y, Li Z, Xu C, et al. WRKYs as regulatory hubs of secondary metabolic networks: Diverse inducers and distinct responses[J]. Plant Communications, 2025, 6(9): 101438. Additional Declarations No competing interests reported. Supplementary Files SupplementaryFig1.jpg Supplementary Fig. 1. Expression profiles of LcWRKY family genes under high temperature. (A) Differentially expressed LcWRKY genes in ‘Hei Zhenzhu’. (B) Differentially expressed LcWRKY genes in ‘Xiangnong Fendai’. SupplementaryFig2.jpg Supplementary Fig. 2. PCR amplification of the cloned LcWRKY18 coding sequence. M indicates DNA marker. SupplementaryFig3.jpg Supplementary Fig. 3. Bioinformatic characterization of LcWRKY18 . (A) Signal peptide prediction. (B) Transmembrane-domain prediction. (C) Secondary-structure prediction. (D) Protein-structure model. SupplementaryFig4.jpg Supplementary Fig. 4. Tissue expression pattern of LcWRKY18 in L. chinense var. rubrum. ‘HZZ’refers to the variety ‘Hei Zhenzhu’, and ‘XNXY’ refers to the variety ‘Xiangnong Xiangyun’. SupplementaryFig5.jpg Supplementary Fig. 5. Verification of self-activation and toxicity of LcWRKY18 in yeast. Fulllengthoriginalgelimages.pdf Cite Share Download PDF Status: Under Review Version 1 posted Reviewers agreed at journal 14 May, 2026 Reviewers invited by journal 07 May, 2026 Editor assigned by journal 07 May, 2026 Editor invited by journal 07 May, 2026 Submission checks completed at journal 06 May, 2026 First submitted to journal 06 May, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9482561","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":640175315,"identity":"12184b10-e2bb-4ff2-b684-ee610b8d20c6","order_by":0,"name":"Anqi Huang","email":"","orcid":"","institution":"Hunan Agricultural Universit","correspondingAuthor":false,"prefix":"","firstName":"Anqi","middleName":"","lastName":"Huang","suffix":""},{"id":640175316,"identity":"634efe75-e5cf-490a-96fa-17520464d9ad","order_by":1,"name":"Mingtong Ren","email":"","orcid":"","institution":"Hunan Agricultural Universit","correspondingAuthor":false,"prefix":"","firstName":"Mingtong","middleName":"","lastName":"Ren","suffix":""},{"id":640175317,"identity":"e7c0241b-1c60-433e-9f8d-3afba16d0297","order_by":2,"name":"Lili Xiang","email":"","orcid":"","institution":"Hunan Agricultural Universit","correspondingAuthor":false,"prefix":"","firstName":"Lili","middleName":"","lastName":"Xiang","suffix":""},{"id":640175318,"identity":"e73fec31-b4b8-4321-9790-536f2539186d","order_by":3,"name":"Yang Liu","email":"","orcid":"","institution":"Hunan Agricultural Universit","correspondingAuthor":false,"prefix":"","firstName":"Yang","middleName":"","lastName":"Liu","suffix":""},{"id":640175319,"identity":"78d77f5f-5793-4b3e-a6cc-1ab99142e323","order_by":4,"name":"Jiaxuan Li","email":"","orcid":"","institution":"Hunan Agricultural Universit","correspondingAuthor":false,"prefix":"","firstName":"Jiaxuan","middleName":"","lastName":"Li","suffix":""},{"id":640175320,"identity":"1d0c8fb1-9dea-498d-8357-b9226444eb44","order_by":5,"name":"Zhenkun Liao","email":"","orcid":"","institution":"Hunan Agricultural Universit","correspondingAuthor":false,"prefix":"","firstName":"Zhenkun","middleName":"","lastName":"Liao","suffix":""},{"id":640175321,"identity":"af717c71-4c83-4c11-af5f-fd47f02abc1c","order_by":6,"name":"Lu Xu","email":"","orcid":"","institution":"Hunan Agricultural Universit","correspondingAuthor":false,"prefix":"","firstName":"Lu","middleName":"","lastName":"Xu","suffix":""},{"id":640175322,"identity":"2fad9f61-9aec-4116-8942-c586da103655","order_by":7,"name":"Donglin Zhang","email":"","orcid":"","institution":"University of Georgia","correspondingAuthor":false,"prefix":"","firstName":"Donglin","middleName":"","lastName":"Zhang","suffix":""},{"id":640175323,"identity":"16a10393-1f9d-4bf3-bf9a-f05e47a3932f","order_by":8,"name":"Nan Ma","email":"","orcid":"","institution":"Hunan Agricultural Universit","correspondingAuthor":false,"prefix":"","firstName":"Nan","middleName":"","lastName":"Ma","suffix":""},{"id":640175324,"identity":"638f317d-9df0-460b-a55d-3b11b5189ca3","order_by":9,"name":"Xiaoying Yu","email":"","orcid":"","institution":"Hunan Agricultural Universit","correspondingAuthor":false,"prefix":"","firstName":"Xiaoying","middleName":"","lastName":"Yu","suffix":""},{"id":640175325,"identity":"980bb43c-1b5d-4d1e-bcbb-5d406b4d788c","order_by":10,"name":"Yanlin Li","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA5UlEQVRIiWNgGAWjYBACPmYQWSDBwC8BF0vAr4UNrMVAgkFyBtFawKQBEN0gWgs7j+HnAgOLPOPbPYafC9tsGPjZcwwYfu7A5zAeY+kZBhLFZnfOGEvPbEtjkOx5Y8DYewavFgNpHgOJxG03cgykedsOA12YY8DM2Ibflt8gLZtn5Bj/5m37z2BPhBYzsC0bJHLMgLYcAIYeQS1sZdYgLTNupAEZ55J5JM48KzjYi0cLP//hzbd5KuoS+2ckAxlldnL87ckbH/zEo4WBgcMAhcsDIg7g08DAwP4Av/woGAWjYBSMAgDksUF0HP5ZWgAAAABJRU5ErkJggg==","orcid":"","institution":"Hunan Agricultural Universit","correspondingAuthor":true,"prefix":"","firstName":"Yanlin","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2026-04-21 10:11:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9482561/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9482561/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":109406124,"identity":"051c56d1-39eb-4aad-9107-997bb926cf28","added_by":"auto","created_at":"2026-05-17 13:25:05","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":6477621,"visible":true,"origin":"","legend":"\u003cp\u003eExpression profiles of \u003cem\u003eLcWRKY\u003c/em\u003e family genes under high temperature. (A) High temperature showing the expression pattern of \u003cem\u003eLcWRKY\u003c/em\u003egenes in ‘Hei Zhenzhu’. (B) High temperature showing the expression pattern of \u003cem\u003eLcWRKY\u003c/em\u003e genes in ‘Xiangnong Fendai’.(C) Distribution of high temperature response elements in \u003cem\u003eLcWRKY\u003c/em\u003e\u003c/p\u003e","description":"","filename":"Fig1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9482561/v1/25f75cdb713ea97c8d8e741d.jpg"},{"id":109405923,"identity":"5624a562-36cf-418e-97f8-7ce5de5dc505","added_by":"auto","created_at":"2026-05-17 13:22:31","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1658436,"visible":true,"origin":"","legend":"\u003cp\u003eqRT-PCR validation of candidate high temperature \u003cem\u003eLcWRKY\u003c/em\u003e genes. (A) Expression patterns in ‘Hei Zhenzhu’. (B) Expression patterns in ‘Xiangnong Fendai’. Data are presented as mean +- SD of three biological replicates.\u003c/p\u003e","description":"","filename":"Fig2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9482561/v1/d3cba7445f0ac61388345623.jpg"},{"id":109405905,"identity":"c9782958-5716-4dfa-a066-9840be0796b1","added_by":"auto","created_at":"2026-05-17 13:22:11","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1461462,"visible":true,"origin":"","legend":"\u003cp\u003eBioinformatic analysis of \u003cem\u003eLcWRKY18\u003c/em\u003e. (A) Phylogenetic relationship between \u003cem\u003eLcWRKY18\u003c/em\u003e and representative WRKY proteins from other plant species. (B) Multiple sequence alignment of \u003cem\u003eLcWRKY18\u003c/em\u003e and FvWRKY50.\u003c/p\u003e","description":"","filename":"Fig3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9482561/v1/9f476e492cd4361f246232ee.jpg"},{"id":109406090,"identity":"9d35f100-7a13-41d0-aa03-0552affda47c","added_by":"auto","created_at":"2026-05-17 13:24:35","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1076635,"visible":true,"origin":"","legend":"\u003cp\u003eSubcellular localization of \u003cem\u003eLcWRKY18\u003c/em\u003e in Nicotiana benthamiana epidermal cells.\u003c/p\u003e","description":"","filename":"Fig4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9482561/v1/d18861cf9c4feb43d7be9d5d.jpg"},{"id":109406069,"identity":"a7b420d5-f2e3-42f1-9329-98f5ad8dc809","added_by":"auto","created_at":"2026-05-17 13:24:21","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1970523,"visible":true,"origin":"","legend":"\u003cp\u003eMolecular identification of transgenic hairy roots in \u003cem\u003eLoropetalum chinense\u003c/em\u003e var. \u003cem\u003erubrum\u003c/em\u003e. (A) PCR verification of pCAMBIA1305-\u003cem\u003eLcWRKY18\u003c/em\u003e transgenic roots in ‘Hei Zhenzhu’. (B) PCR verification of pTRV2-\u003cem\u003eLcWRKY18\u003c/em\u003e transgenic roots in ‘Hei Zhenzhu’. (C) Relative expression levels of \u003cem\u003eLcWRKY18\u003c/em\u003ein overexpression and interference lines. (D) Phenotypes of transgenic roots. (E) Microscopic observation of root pigmentation. (F) Anthocyanin content of different root lines. Different lowercase letters indicate significant differences at P \u0026lt; 0.05.（H）Expression Levels of Anthocyanin Biosynthetic Structural Genes in Roots Transformed with pCAMBIA1305-\u003cem\u003eLcWRKY18\u003c/em\u003e. (I) Expression Levels of Anthocyanin Biosynthetic Structural Genes in Roots Transformed with pTRV2-\u003cem\u003eLcWRKY18\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"Fig5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9482561/v1/656be513282ae855b5905632.jpg"},{"id":109405909,"identity":"d4e9171c-b30a-4af9-9df9-add1876d4e73","added_by":"auto","created_at":"2026-05-17 13:22:16","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":6543425,"visible":true,"origin":"","legend":"\u003cp\u003eTranscriptomic analysis of \u003cem\u003eLcWRKY18\u003c/em\u003e transgenic materials. (A) Principal component analysis of different sample groups. (B) Trend analysis of differentially expressed genes. (C) Volcano plots of differentially expressed genes among comparisons. (D) GO enrichment analysis of differentially expressed genes. (E) KEGG enrichment analysis of differentially expressed genes.\u003c/p\u003e","description":"","filename":"Fig6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9482561/v1/3b58d895e5d0e08333292ddb.jpg"},{"id":109406073,"identity":"480112c1-44f4-49e7-b20f-c0730579a9dc","added_by":"auto","created_at":"2026-05-17 13:24:23","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":1845184,"visible":true,"origin":"","legend":"\u003cp\u003eHeat map of anthocyanin metabolites detected in different transgenic root materials.\u003c/p\u003e","description":"","filename":"Fig7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9482561/v1/fe19532b1bb5ec270e4cd871.jpg"},{"id":109406561,"identity":"6d00a4a6-e2d9-47e1-9e0b-f2c1b98605f0","added_by":"auto","created_at":"2026-05-17 13:28:44","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":325426,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eLcWRKY18\u003c/em\u003e represses the promoter activities of key anthocyanin biosynthetic genes. (A) Schematic diagrams of the promoters of \u003cem\u003eLcUFGT\u003c/em\u003e, \u003cem\u003eLcPAL\u003c/em\u003e and \u003cem\u003eLcANS\u003c/em\u003e. (B-D) Dual-luciferase assay results showing the effects of \u003cem\u003eLcWRKY18\u003c/em\u003e on the activities of the three promoters. Different lowercase letters indicate significant differences at P \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-9482561/v1/16161b3f4b91421f3a3e2a30.png"},{"id":109340844,"identity":"ab3c93e2-5705-403e-88b4-2c3f35ae6066","added_by":"auto","created_at":"2026-05-15 18:48:29","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":371259,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9482561/v1/60a67f72-2046-4123-b143-e5d87ba268f9.pdf"},{"id":109405922,"identity":"a7ac5f5c-01c2-45c2-88f6-e100b56c2f07","added_by":"auto","created_at":"2026-05-17 13:22:30","extension":"jpg","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":3486454,"visible":true,"origin":"","legend":"\u003cp\u003eSupplementary Fig. 1. Expression profiles of \u003cem\u003eLcWRKY\u003c/em\u003e family genes under high temperature. (A) Differentially expressed \u003cem\u003eLcWRKY\u003c/em\u003e genes in ‘Hei Zhenzhu’. (B) Differentially expressed \u003cem\u003eLcWRKY\u003c/em\u003egenes in ‘Xiangnong Fendai’.\u003c/p\u003e","description":"","filename":"SupplementaryFig1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9482561/v1/e2e6013734387ecc58f84d44.jpg"},{"id":109405913,"identity":"c4eefdff-8a46-410e-8466-5834d243026f","added_by":"auto","created_at":"2026-05-17 13:22:19","extension":"jpg","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":143759,"visible":true,"origin":"","legend":"\u003cp\u003eSupplementary Fig. 2. PCR amplification of the cloned\u003cem\u003eLcWRKY18\u003c/em\u003e coding sequence. M indicates DNA marker.\u003c/p\u003e","description":"","filename":"SupplementaryFig2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9482561/v1/9e563ff95b7d1ea379931c51.jpg"},{"id":109405921,"identity":"3ba206ee-1428-453c-9828-0d1e6a9c11e0","added_by":"auto","created_at":"2026-05-17 13:22:30","extension":"jpg","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":2416928,"visible":true,"origin":"","legend":"\u003cp\u003eSupplementary Fig. 3. Bioinformatic characterization of \u003cem\u003eLcWRKY18\u003c/em\u003e. (A) Signal peptide prediction. (B) Transmembrane-domain prediction. (C) Secondary-structure prediction. (D) Protein-structure model.\u003c/p\u003e","description":"","filename":"SupplementaryFig3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9482561/v1/4330ac3edd82c1944f87cded.jpg"},{"id":109406118,"identity":"02dce1a7-b6d6-4467-93b5-d10464dc1289","added_by":"auto","created_at":"2026-05-17 13:24:56","extension":"jpg","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":150104,"visible":true,"origin":"","legend":"\u003cp\u003eSupplementary Fig. 4. Tissue expression pattern of \u003cem\u003eLcWRKY18\u003c/em\u003e in L. chinense var. rubrum. ‘HZZ’refers to the variety ‘Hei Zhenzhu’, and ‘XNXY’ refers to the variety ‘Xiangnong Xiangyun’.\u003c/p\u003e","description":"","filename":"SupplementaryFig4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9482561/v1/8a1366223eeeb8edd89ac8fd.jpg"},{"id":109405904,"identity":"670140c1-df47-4825-8bf7-d53d408e374d","added_by":"auto","created_at":"2026-05-17 13:22:11","extension":"jpg","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":640757,"visible":true,"origin":"","legend":"\u003cp\u003eSupplementary Fig. 5. Verification of self-activation and toxicity of \u003cem\u003eLcWRKY18\u003c/em\u003e in yeast.\u003c/p\u003e","description":"","filename":"SupplementaryFig5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9482561/v1/08f4865af12dcdfd25973b74.jpg"},{"id":109406109,"identity":"b81dbe0b-06c0-4df5-9bce-f6c0ee97b998","added_by":"auto","created_at":"2026-05-17 13:24:51","extension":"pdf","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":205876,"visible":true,"origin":"","legend":"","description":"","filename":"Fulllengthoriginalgelimages.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9482561/v1/81108d189f29a1c8155d7d18.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"LcWRKY18 negatively regulates anthocyanin biosynthesis and is associated with high temperature-induced regreening in Loropetalum chinense var. rubrum","fulltext":[{"header":"Highlights","content":"\u003cp\u003e\u0026bull;\u0026nbsp;Identified \u003cem\u003eLcWRKY18\u0026nbsp;\u003c/em\u003eas a\u0026nbsp;high temperature-responsive\u0026nbsp;transcription factor associated with leaf color fading.\u003c/p\u003e\n\u003cp\u003e\u0026bull;\u0026nbsp;\u003cem\u003eLcWRKY18\u0026nbsp;\u003c/em\u003enegatively regulates anthocyanin accumulation in \u003cem\u003eL. chinense\u0026nbsp;\u003c/em\u003evar. \u003cem\u003erubrum\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u0026bull; Integrated transcriptomic and metabolomic analyses revealed that \u003cem\u003eLcWRKY18\u003c/em\u003e regulates anthocyanin metabolism by modulating the phenylpropanoid and flavonoid pathway.\u003c/p\u003e\n\u003cp\u003e\u0026bull; \u003cem\u003eLcWRKY18\u003c/em\u003e suppresses anthocyanin biosynthesis by directly repressing key structural genes in the phenylpropanoid and flavonoid pathways, including.\u003c/p\u003e"},{"header":"1. Introduction","content":"\u003cp\u003eColored-leaf plants are widely valued in landscape greening due to their distinctive foliage coloration, which greatly enhances ornamental appeal. However, increasing frequency of extreme weather events, particularly prolonged high-temperature conditions associated with global warming, has imposed significant abiotic stress on plants [1]. High temperature is a critical environmental factor affecting leaf pigmentation in colored-leaf species, often leading to color fading and a decline in ornamental quality, thereby limiting their landscape application [2].\u003c/p\u003e \u003cp\u003e \u003cem\u003eLoropetalum chinense\u003c/em\u003e var. \u003cem\u003erubrum\u003c/em\u003e, a natural variant of Loropetalum in the Hamamelidaceae family [3], is a representative ornamental colored-leaf shrub. Its characteristic red foliage is primarily attributed to the accumulation of anthocyanins [4]. Previous studies have shown that leaves coloration in this species is mainly determined by anthocyanins derived from pelargonidin, cyanidin, and delphinidin [5,6]. Notably, high temperature induces a typical regreening phenotype in L. chinense var. rubrum, in which red leaves gradually lose pigmentation and turn green [5]. which is largely associated with a decline in anthocyanin accumulation[7\u0026ndash;9]. These findings indicate that high temperature plays a pivotal role in regulating anthocyanin accumulation and leaf coloration in \u003cem\u003eL. chinense\u003c/em\u003e var. \u003cem\u003erubrum\u003c/em\u003e. However, the molecular mechanisms underlying high temperature-induced anthocyanin reduction and leaf color fading remain largely unclear.\u003c/p\u003e \u003cp\u003eAnthocyanins are natural water-soluble pigments belonging to the flavonoid branch of polyphenolic compounds [10]. In addition to conferring attractive colors to flowers and fruits, they play important roles in stress adaptation by enhancing tolerance to adverse environments [11\u0026ndash;16]. Anthocyanin biosynthesis originates from the phenylpropanoid pathway and involves a series of structural genes. Early biosynthetic genes (EBGs), including CHS, CHI, F3H, F3'H and F3'5'H, catalyze the formation of dihydroflavonols, whereas late biosynthetic genes (LBGs), including DFR, ANS/LDOX and UFGT, further convert these intermediates into anthocyanins [17]. In addition, anthocyanins can be modified by glycosylation, methylation and acylation and are transported into vacuoles for storage with the involvement of transport-related proteins such as GST [18,19]. Anthocyanin biosynthesis genes are largely controlled by the MYB-bHLH-WDR (MBW) transcriptional complex [20]. which regulates the expression of key structural genes and is evolutionarily conserved across plant species [21\u0026ndash;25].\u003c/p\u003e \u003cp\u003eIn addition to endogenous transcriptional regulation, anthocyanin accumulation is strongly influenced by environmental factors, including light, temperature, and water status. Among these, temperature is considered a critical determinant of anthocyanin stability and accumulation, with high temperature often leading to reduced anthocyanin content and color fading in plants. Environmental cues are known to modulate anthocyanin biosynthesis primarily by affecting the expression of structural genes and core regulatory factors such as MYB proteins. In addition to MYB factors, other transcription factors NAC, MADS-box, bZIP, WRKY and SPL also participate in anthocyanin regulation under environmental stimuli. For example, NAC and bZIP transcription factors can regulate anthocyanin accumulation by interacting with MYB proteins or integrating environmental signals, as exemplified by MdNAC42 and HY5-mediated regulatory pathways [26,27]. In recent years, Several WRKY proteins have been reported to either promote or repress anthocyanin accumulation in different species, suggesting their potential roles in linking environmental signals with secondary metabolites biosynthesis [28,29].\u003c/p\u003e \u003cp\u003eWRKY transcription factors are a large plant-specific family characterized by a conserved WRKYGQK motif and their ability to bind W-box cis-elements in target gene promoters, thereby regulating downstream gene expression [30,31]. Accumulating evidence indicates that WRKY proteins play important roles in plant responses to abiotic stresses, including drought, salinity, and temperature extremes, by modulating stress-responsive signaling pathways \u003csup\u003e[32\u0026ndash;39]\u003c/sup\u003e. In addition to their roles in stress responses, several WRKY transcription factors have been reported to participate in the regulation of anthocyanin biosynthesis in different plant species, including MdWRKY40 [40], MdWRKY71-L [41], MdWRKY1 [42], PpWRKY44 [43] ,LhWRKY44 [44],AtWRKY41 [21], These findings suggest that WRKY proteins may function as integrators of environmental signals and pigment metabolism. However, their specific roles in mediating anthocyanin biosynthesis under high temperature stress remain largely unclear.\u003c/p\u003e \u003cp\u003eIn our previous work, 79 WRKY genes were identified and characterized in L. chinense var. rubrum and renamed \u003cem\u003eLcWRKY1\u003c/em\u003e-\u003cem\u003eLcWRKY79\u003c/em\u003e according to their chromosomal positions [45]. To clarify the regulatory role of WRKY genes in anthocyanin biosynthesis under high temperature stress, the expression patterns of 79 \u003cem\u003eLcWRKY\u003c/em\u003e genes were systematically analyzed based on previous transcriptome data from high temperature-treated plants. And then a differentially expressed genes named \u003cem\u003eLcWRKY18\u003c/em\u003e was screened as a candidate gene potentially involved in high temperature-induced anthocyanin reduction. In this study, \u003cem\u003eLcWRKY18\u003c/em\u003e was functionally characterized through gene overexpression and silencing approaches, combined with transcriptomic-metabolomic analysis and molecular assays. Our results aim to clarify the role of \u003cem\u003eLcWRKY18\u003c/em\u003e in regulating anthocyanin biosynthesis under high temperature stress and to provide new insights into the molecular mechanisms underlying leaf color variation in ornamental plants.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Plant materials\u003c/h2\u003e \u003cp\u003eThree Loropetalum cultivars, \u0026lsquo;Xiangnong Nishang\u0026rsquo;, \u0026lsquo;Xiangnong Fendai\u0026rsquo; and \u0026lsquo;Hei Zhenzhu\u0026rsquo; used in this study were obtained from the Engineering Research Center for Breeding and Utilization of Mid-subtropical Quality Ornamental Plants, Hunan Agricultural University. Nicotiana benthamiana plants for transient expression assays were cultivated in a growth chamber under controlled conditions: a temperature range of 22\u0026ndash;25℃, a photoperiod of 16 h light / 8 h dark, LED light sources, and a relative humidity maintained between 55\u0026ndash;65%. These conditions were implemented to ensure robust plant growth and stability of the transient expression system.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2Heat stress treatment conditions\u003c/h2\u003e \u003cp\u003eFor transcriptome sequencing in the previous stage of this study, three potted plants each of \u0026lsquo;Hei Zhenzhu\u0026rsquo;, \u0026lsquo;Xiangnong Fendai\u0026rsquo; and \u0026lsquo;Xiangnong Xiangyun\u0026rsquo; were subjected to high temperature in a growth chamber. Day/night temperatures were set at 40/33 C, with a 14-h light / 10-h dark photoperiod. LED lighting was used, the photosynthetic photon flux density was set at 30,000 lx, and relative humidity was maintained at 90%.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3Transcriptome data analysis\u003c/h2\u003e \u003cp\u003eRaw read-count data obtained from transcriptome sequencing were normalized using the DESeq2 package in R. Size factors were calculated to correct sequencing-depth differences among samples and generate normalized count values. Differential expression analysis was then conducted with DESeq2 for T0 vs T1, T0 vs T3, T0 vs T5, T0 vs T7, pCAMBIA1305-GFP vs pCAMBIA1305-\u003cem\u003eLcWRKY18\u003c/em\u003e, and pTRV2-GFP vs \u003cem\u003eLcWRKY18\u003c/em\u003e comparisons. Genes with |log2 fold change| \u0026gt;= 1 and false discovery rate (FDR)\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered differentially expressed.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. RNA extraction and qRT-PCR analysis\u003c/h2\u003e \u003cp\u003e Total RNA was extracted from roots, stems and leaves of \u0026lsquo;Hei Zhenzhu\u0026rsquo;, as well as from K599-transformed roots, using the FastPure Universal Plant Total RNA Isolation Kit (Vazyme) according to the manufacturer's instructions. High-quality RNA was reverse-transcribed into first-strand cDNA using the Vazyme reverse transcription kit and stored at -20℃ for subsequent cloning and expression analyses.\u003c/p\u003e \u003cp\u003ePrimers were designed using Primer3Plus and experimentally validated before use (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Loropetalum beta-actin was used as the internal reference gene. Each assay included three biological replicates and three technical replicates. Quantitative PCR was performed with the SYBR Green Pro Taq HS premix (Accurate Biology, AG11701), and relative expression levels of \u003cem\u003eLcWRKY18\u003c/em\u003e and anthocyanin biosynthetic genes were calculated using the 2\u003csup\u003e\u0026minus;∆∆CT\u003c/sup\u003e method.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Bioinformatic analysis of \u003cem\u003eLcWRKY18\u003c/em\u003e\u003c/h2\u003e \u003cp\u003eCandidate \u003cem\u003eLcWRKY\u003c/em\u003e genes were first examined by qRT-PCR using cDNA from five high temperature time points as templates. Relative expression was calculated using the 2\u003csup\u003e\u0026minus;∆∆CT\u003c/sup\u003e method with the T0 sample as the calibrator.\u003c/p\u003e \u003cp\u003eThe physicochemical properties of \u003cem\u003eLcWRKY18\u003c/em\u003e, including molecular weight and isoelectric point, were predicted using ExPASy ProtParam. Signal peptides were predicted with SignalP 4.1, transmembrane domains with TMHMM 2.0, and subcellular localization with WoLF PSORT. Secondary structure was predicted with SOPMA, and the protein structure was modeled using AlphaFold3.\u003c/p\u003e \u003cp\u003eHomologous proteins of \u003cem\u003eLcWRKY18\u003c/em\u003e were searched using NCBI BLASTP. Sequences showing more than 50% similarity were aligned in DANMAN. A phylogenetic tree was constructed in MEGA7 using the neighbor-joining method with reported high temperature and anthocyanin-related WRKY proteins from other species. Cis-regulatory elements in the \u0026minus;\u0026thinsp;2kb promoter regions upstream of \u003cem\u003eLcWRKY\u003c/em\u003e genes were analyzed using PlantCARE and visualized with TBtools [46].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Cloning of \u003cem\u003eLcWRKY18\u003c/em\u003e\u003c/h2\u003e \u003cp\u003eThe coding sequence of \u003cem\u003eLcWRKY18\u003c/em\u003e was retrieved from the L. chinense var. rubrum genome database. Gene-specific cloning primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) were designed in Primer3Plus and synthesized by Tsingke Biotechnology (Beijing, China). Using cDNA from leaves of \u0026lsquo;Xiangnong Nishang\u0026rsquo; as the template, the full-length coding sequence of \u003cem\u003eLcWRKY18\u003c/em\u003e was amplified with a high-fidelity polymerase. The ligation products were transformed into Escherichia coli DH5a competent cells, and plasmids from positive colonies were extracted after sequence confirmation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Subcellular localization of \u003cem\u003eLcWRKY18\u003c/em\u003e\u003c/h2\u003e \u003cp\u003eThe pBI121-GFP vector was used for subcellular localization. The full-length CDS of \u003cem\u003eLcWRKY18\u003c/em\u003e was amplified from pEASY-T1-\u003cem\u003eLcWRKY18\u003c/em\u003e and inserted into pBI121 by homologous recombination after BamHI digestion. The resulting pBI121-\u003cem\u003eLcWRKY18\u003c/em\u003e construct and the empty vector were introduced into Agrobacterium tumefaciens GV3101.\u003c/p\u003e \u003cp\u003ePositive Agrobacterium clones were cultured in medium containing 50 mg/L kanamycin and 50 mg/L rifampicin until OD\u003csub\u003e600\u003c/sub\u003e reached 1.0. Cells were harvested, washed and resuspended in infiltration buffer (10 mM MES, 10 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 0.2 mM acetosyringone, pH 5.6) to an OD\u003csub\u003e600\u003c/sub\u003e of 0.8, and then incubated in darkness for 3 h. The suspensions were infiltrated into the abaxial side of healthy N. benthamiana leaves with a 1-mL syringe. After 48 h of dark incubation, fluorescent signals around the infiltration sites were observed and photographed under a laser confocal microscope.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8. Transcriptional activation assay\u003c/h2\u003e \u003cp\u003eTo test self-activation activity and toxicity, the coding region of \u003cem\u003eLcWRKY18\u003c/em\u003e was inserted into the BD vector through EcoRI and BamHI restriction sites. The resulting BD-\u003cem\u003eLcWRKY18\u003c/em\u003e construct, the negative control (pGADT7-T\u0026thinsp;+\u0026thinsp;pGBKT7-Lam), and the positive control (pGADT7-T\u0026thinsp;+\u0026thinsp;pGBKT7-p53) were transformed into yeast strain Y2HGold and analyzed on selective media.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9. Vector construction and Agrobacterium rhizogenes-mediated root transformation\u003c/h2\u003e \u003cp\u003eFor overexpression, the verified pEASY-T1-\u003cem\u003eLcWRKY18\u003c/em\u003e plasmid was used as a template, and seamless-cloning primers were designed according to the pCAMBIA1305-GFP vector map and \u003cem\u003eLcWRKY18\u003c/em\u003e sequence. The vector was linearized with BamHI, and homologous recombination, transformation and colony screening were performed as described above.\u003c/p\u003e \u003cp\u003eFor gene interference, a 300-bp fragment of \u003cem\u003eLcWRKY18\u003c/em\u003e was selected using the VIGS tool in Sol Genomics Network, and primers containing SamI sites were designed according to the pTRV2 vector. Homologous recombination and bacterial transformation were performed as for the overexpression vector.\u003c/p\u003e \u003cp\u003eK599 A. rhizogenes competent cells stored at -80 ℃ were thawed and transformed with pCAMBIA1305-\u003cem\u003eLcWRKY18\u003c/em\u003e, pTRV2-\u003cem\u003eLcWRKY18\u003c/em\u003e, pTRV1, pTRV2 and pCAMBIA1305-GFP. Transformed cells were plated on selective medium and incubated at 28 ℃ for 2\u0026ndash;3 d. Positive colonies were identified by PCR and cultured in TY medium supplemented with 50 mg/L kanamycin and 50 mg/L streptomycin to OD\u003csub\u003e600\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;0.4.\u003c/p\u003e \u003cp\u003eOne-year-old cuttings of \u0026lsquo;Hei Zhenzhu\u0026rsquo; were used for root transformation. Lateral roots and fibrous roots were removed, leaving approximately 1 cm of the main root. Seedlings were immersed for 30 min in suspensions of pCAMBIA1305-GFP, pCAMBIA1305-\u003cem\u003eLcWRKY18\u003c/em\u003e, pTRV2 or pTRV2-\u003cem\u003eLcWRKY18\u003c/em\u003e; for VIGS treatment, pTRV2-derived cultures were mixed 1:1 with pTRV1 cultures. After inoculation, seedlings were planted in soil and 2 mL of the corresponding bacterial suspension was applied to the base of the stem. Plants were then maintained in a growth chamber.\u003c/p\u003e \u003cp\u003eGenomic DNA was extracted using the SteadyPure Plant Genomic DNA Extraction Kit (CTAB method, Accurate Biology, AG2106). PCR-based identification of transformed roots was carried out using primers specific for the rolB gene in the T-DNA region of K599, the GFP marker on pCAMBIA1305 or pTRV2, and \u003cem\u003eLcWRKY18\u003c/em\u003e-specific fragments (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The expression levels of \u003cem\u003eLcWRKY18\u003c/em\u003e in positive lines were further examined by qRT-PCR.\u003c/p\u003e \u003cp\u003eRoot coloration was recorded photographically. Fresh, normally pigmented roots were washed with distilled water, mounted as temporary water slides using the potato-clamp method, and observed under a light microscope. Anthocyanin content was determined using the pH differential method.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10. Metabolomic sample preparation\u003c/h2\u003e \u003cp\u003eTwelve root samples stored at -80℃ were freeze-dried and ground into powder. Powdered material was weighed and extracted with 0.5 mL of 50% methanol aqueous solution containing 0.1% HCl. Samples were vortexed for 5 min, ultrasonicated for 5 min, and centrifuged at 12,000 rpm for 3 min at 4 ℃. The extraction was repeated once, the supernatants were combined and filtered, and the resulting solutions were used for LC-MS/MS analysis of anthocyanin compounds.\u003c/p\u003e \u003cp\u003eAnthocyanin metabolites were analyzed using an ExionLC AD ultra-performance liquid chromatography system coupled with a QTRAP 6500\u0026thinsp;+\u0026thinsp;tandem mass spectrometer (SCIEX, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11. Molecular docking analysis\u003c/h2\u003e \u003cp\u003eBased on the amino acid sequence of \u003cem\u003eLcWRKY18\u003c/em\u003e and the core promoter sequences of LcUFGT, LcPAL and LcANS, three-dimensional structures were predicted with AlphaFold3. Models with high pLDDT values were selected for docking analysis. Protein-DNA interactions were predicted using the local version of HDOCKlite v1.1, and the interfaces of the resulting complexes were further analyzed using PLIP [47]. Relevant interaction details were visualized in PyMOL.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.12. Dual-luciferase assay\u003c/h2\u003e \u003cp\u003e \u003cem\u003eLcWRKY18\u003c/em\u003e and the cloned promoter fragments of LcUFGT, LcPAL and LcANS were used as templates for In-Fusion cloning into pGreenII 0800-LUC-based reporter vectors and corresponding effector constructs. Recombinant plasmids were transformed into Agrobacterium and co-infiltrated into tobacco leaves. Firefly luciferase and Renilla luciferase signals were measured according to the standard dual-luciferase procedure, and promoter activity was expressed as the LUC/REN ratio.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.13. Statistical analysis\u003c/h2\u003e \u003cp\u003eAll analyses were conducted using at least three biological replicates. Data processing was performed in Excel 2007. Figures were prepared using GraphPad Prism 9.5 and Adobe Photoshop 2023. Significant differences among treatments were evaluated using Student's t-test and one-way analysis of variance, and different lowercase letters indicate significant differences at P\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences used in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequence (5'-3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAssay\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLcWRKY18-QP-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGATGCAGCGTTTAGGGTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eQuantitative Real-time PCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLcWRKY18-QP-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTCTCGTGGTTGTGGACTCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eQuantitative Real-time PCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCACAAGGCTTATTGATAGAAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eQuantitative Real-time PCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eβ-actin-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAATGGTTGAACCTGAATACT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eQuantitative Real-time PCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLcCHS-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGATTAAGAAGCGTTACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eQuantitative Real-time PCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLcCHS-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTCTAGCATCCAATGAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eQuantitative Real-time PCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLcCHI-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATTAACGATTGGCTTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eQuantitative Real-time PCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLcCHI-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCTATGATTGACTCCAGTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eQuantitative Real-time PCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLcPAL-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGAAGGGGAGTCATTTGGAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eQuantitative Real-time PCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLcPAL-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCCATCACCCACTCACTACTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eQuantitative Real-time PCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLcDFR-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGCTAAGACATCGGCTGAGAAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eQuantitative Real-time PCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLcDFR-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCAACGCTGGGAGTCCTGAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eQuantitative Real-time PCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLcANS-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTATACTGAGGCAACAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eQuantitative Real-time PCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLcANS-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTCTTCCTTCTTCTAAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eQuantitative Real-time PCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLcUFGT-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAGCAAGCGGTGTAACAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eQuantitative Real-time PCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLcUFGT-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAAGGCACTACCATTCCAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eQuantitative Real-time PCR\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLcWRKY18-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGGTCTCCACTGAAAATTTTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGene clone\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLcWRKY18-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTAAGAAGAAGAAGAGCGAGAGGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGene clone\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epBI121-LcWRKY18-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGACTCTAGAGGATCCATGGTCTCCACTGAAAATTTTGGCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSubcellular localization\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epBI121-LcWRKY18-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGACCACCCGGGGATCCAGAAGAAGAAGAGCGAGAGGGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSubcellular localization\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epCAMBIA-1305-LcWRKY18-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCACGGGGGACGGATCCATGGTCTCCACTGAAAATTTTGGCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eOverpression\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epCAMBIA-1305-LcWRKY18-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTTTGTAGTCGGATCCAGAAGAAGAAGAGCGAGAGGGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eOverpression\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epTRV2-LcWRKY18-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCCCCATGGAGGCCTATGGTCTCCACTGAAAATTTTGGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGene silencing\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epTRV2-LcWRKY18-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAGGTTACCGAATTCTCTAACTCCGATTTCGTTCTAAATGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGene silencing\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003erolB-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCCAGCATTTTTGGTGAACT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003edetection\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003erolB-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGCACTGAACTTGCCGTTAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003edetection\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGFP-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGGTCGAGCTGGACGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003edetection\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGFP-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGGGTGCTCAGGTAGTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003edetection\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBD-LcWRKY18-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCATGGAGGCCGAATTCATGGTCTCCACTGAAAATTTTGGCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003everification\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBD-LcWRKY18-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCAGGTCGACGGATCCTTAAGAAGAAGAAGAGCGAGAGGGAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003everification\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epCAMBIA-1300-LcWRKY18-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCAAATCGACTCTAGAATGGTCTCCACTGAAAATTTTGGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eOverpression\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epCAMBIA-1300-LcWRKY18-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCAGAAGCTTTCTAGAAGAAGAAGAAGAGCGAGAGGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eOverpression\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epGreenII 0800-F-48540A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGGTATCGATAAGCTggccaatgacaccaaatcct\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDual-luciferase assay\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epGreenII 0800-R-48540A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTAGAACTAGTGGATCtaacctaaaatacctacgatgtcataacaaattca\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDual-luciferase assay\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epGreenII 0800-F-48540B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGGTATCGATAAGCTttacaaacctacaagtgagcctattcacg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDual-luciferase assay\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epGreenII 0800-R-48540B\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTAGAACTAGTGGATCgggacgtgacaacccccag\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDual-luciferase assay\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epGreenII 0800-F-12653\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGGTATCGATAAGCTtatttaactagtcgccgccctgg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDual-luciferase assay\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epGreenII 0800-R-12653\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTAGAACTAGTGGATCacttctactctccctcttcttatttatgttttatttttttagttaaaaaa\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDual-luciferase assay\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epGreenII 0800-F-44833\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGGTATCGATAAGCTtagtgcatagttatcagaaccgaacgg\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDual-luciferase assay\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epGreenII 0800-R-44833\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTAGAACTAGTGGATCtattggttgattgaccttctttattttaagaaaaggatcgt\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eDual-luciferase assay\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"3\"\u003e\u003cem\u003eNote: lowercase letters indicate gene-specific lowercase bases where applicable.\u003c/em\u003e\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cp\u003e \u003cb\u003e3.1. Expression profiles of anthocyanin pathway genes and\u003c/b\u003e \u003cb\u003eLcWRKY\u003c/b\u003e \u003cb\u003efamily members in different cultivars under high temperature\u003c/b\u003e\u003c/p\u003e \u003cp\u003eBased on transcriptome count data, differential expression analyses were performed for samples collected at different high temperature stages. In \u0026lsquo;Hei Zhenzhu\u0026rsquo;, a large number of \u003cem\u003eLcWRKY\u003c/em\u003e genes were differentially expressed during the middle stage of high temperature (T1, T3 and T5), whereas a different response pattern was observed in \u0026lsquo;Xiangnong Fendai\u0026rsquo; (Fig.\u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA,B).\u003c/p\u003e \u003cp\u003eUsing the differential-expression results together with transcript abundance data, high temperature maps were constructed to visualize the expression patterns of \u003cem\u003eLcWRKY\u003c/em\u003e genes in \u0026lsquo;Hei Zhenzhu\u0026rsquo; and\u0026lsquo;Xiangnong Fendai\u0026rsquo;under high temperature. In \u0026lsquo;Hei Zhenzhu\u0026rsquo;, \u003cem\u003eLcWRKY18\u003c/em\u003e displayed a highly characteristic expression profile and was strongly associated with the high temperature regreening phenotype (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA,B).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eNine genes, namely \u003cem\u003eLcWRKY13\u003c/em\u003e, \u003cem\u003eLcWRKY18\u003c/em\u003e, \u003cem\u003eLcWRKY21\u003c/em\u003e, \u003cem\u003eLcWRKY30\u003c/em\u003e, \u003cem\u003eLcWRKY36\u003c/em\u003e, \u003cem\u003eLcWRKY39\u003c/em\u003e, \u003cem\u003eLcWRKY46\u003c/em\u003e, \u003cem\u003eLcWRKY49\u003c/em\u003e and \u003cem\u003eLcWRKY74\u003c/em\u003e, were preliminarily selected based on differential-expression and expression-pattern analyses. qRT-PCR verification showed that the expression trend of \u003cem\u003eLcWRKY18\u003c/em\u003e was highly consistent with the transcriptome data, supporting its selection as the major candidate gene for further study(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA,B).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.2. Bioinformatic analysis of \u003cem\u003eLcWRKY18\u003c/em\u003e\u003c/h2\u003e \u003cp\u003eThe coding sequence of \u003cem\u003eLcWRKY18\u003c/em\u003e was 534 bp in length according to the Loropetalum genome database. Using cDNA from leaves of \u0026lsquo;Xiangnong Nishang\u0026rsquo; as the template, the full-length CDS was successfully amplified, and agarose gel electrophoresis showed a single clear band of the expected size(Fig.\u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eComprehensive bioinformatic analysis showed that the \u003cem\u003eLcWRKY18\u003c/em\u003e protein consists of 177 amino acids and has the typical features of a WRKY transcription factor. Prediction using ProtParam indicated a theoretical molecular mass and isoelectric point consistent with a small regulatory protein. SignalP predicted that \u003cem\u003eLcWRKY18\u003c/em\u003e lacks a signal peptide, indicating that it is not a secreted protein. TMHMM analysis further showed that it has no transmembrane domain(Fig.\u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003eA,B).\u003c/p\u003e \u003cp\u003eSecondary-structure prediction indicated that \u003cem\u003eLcWRKY18\u003c/em\u003e is mainly composed of random coils, together with a small proportion of alpha-helices and extended strands. Structural modeling supported the presence of a typical WRKY DNA-binding domain(Fig.\u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003eC,D).\u003c/p\u003e \u003cp\u003ePhylogenetic analysis revealed that \u003cem\u003eLcWRKY18\u003c/em\u003e clustered with several reported WRKY proteins involved in stress responses and anthocyanin regulation in other species, including \u003cem\u003eMdWRKY40\u003c/em\u003e [40], \u003cem\u003ePpWRKY44\u003c/em\u003e [43], \u003cem\u003eLhWRKY44\u003c/em\u003e [44], \u003cem\u003eAtWRKY41\u003c/em\u003e [21]and \u003cem\u003eZjWRKY18\u003c/em\u003e [48] (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Multiple sequence alignment indicated that \u003cem\u003eLcWRKY18\u003c/em\u003e contained the conserved WRKYGQK motif and a typical C2H2-type zinc-finger structure, consistent with the defining features of WRKY transcription factors [30,31] (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eUsing cDNA from leaves, stems and roots of the cultivars \u0026lsquo;Hei Zhenzhu\u0026rsquo; and \u0026lsquo;Xiangnong Xiangyun\u0026rsquo;, qRT-PCR showed that LcWRKY18 was expressed in all tested tissues but exhibited clear tissue specificity and cultivar-dependent variation. The relatively high expression in pigmented tissues suggested a close relationship with pigment metabolism and stress responses(Fig.\u003cspan refid=\"MOESM4\" class=\"InternalRef\"\u003eS4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.3. Subcellular localization and transcriptional activation of \u003cem\u003eLcWRKY18\u003c/em\u003e\u003c/h2\u003e \u003cp\u003eTo determine the intracellular localization of \u003cem\u003eLcWRKY18\u003c/em\u003e, the pBI121-\u003cem\u003eLcWRKY18\u003c/em\u003e fusion vector was transiently expressed in tobacco leaves. Confocal microscopy showed that the GFP signal of the fusion protein was distributed in both the nucleus and cytoplasm, whereas the control showed ubiquitous fluorescence, indicating that \u003cem\u003eLcWRKY18\u003c/em\u003e is a nucleocytoplasmic protein(Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn yeast, pGBKT7-\u003cem\u003eLcWRKY18\u003c/em\u003e grew normally on SD/-Trp/-Leu medium, suggesting that the bait construct was not toxic. The transformed yeast strains were then transferred to highly selective media to evaluate self-activation. The results indicated that \u003cem\u003eLcWRKY18\u003c/em\u003e did not show obvious self-activation activity under the tested conditions(Fig.\u003cspan refid=\"MOESM5\" class=\"InternalRef\"\u003eS5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.4. Functional verification of \u003cem\u003eLcWRKY18\u003c/em\u003e by transient overexpression and interference\u003c/h2\u003e \u003cp\u003eK599-mediated transformation successfully generated transgenic roots in \u0026lsquo;Hei Zhenzhu\u0026rsquo;. PCR analysis revealed the presence of the rolB, gfp, and \u003cem\u003eLcWRKY18\u003c/em\u003e genes in the transgenic roots (with no signals detected in the water and WT controls) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA,B). qRT-PCR assays demonstrated that the vector pCAMBIA1305-\u003cem\u003eLcWRKY18\u003c/em\u003e upregulated the expression of the target gene in \u0026lsquo;Heizhenzhu\u0026rsquo; by 4.17-fold compared to the empty vector, while the vector pTRV2-\u003cem\u003eLcWRKY18\u003c/em\u003e downregulated its expression to 0.21-fold of the empty vector(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC,D). Collectively, the results from PCR and qRT-PCR verified the successful establishment of the target gene overexpression and interference systems.\u003c/p\u003e \u003cp\u003ePhenotypic observations showed that in the \u0026lsquo;Hei Zhenzhu\u0026rsquo; cultivar, the roots of \u003cem\u003eLcWRKY18\u003c/em\u003e overexpression lines had significantly reduced anthocyanin content, which was decreased to 0.56-fold of that in the wild-type (WT) and empty vector controls. In contrast, RNA interference-mediated silencing of \u003cem\u003eLcWRKY18\u003c/em\u003e did not result in a significant fading phenotype; instead, it promoted pigment accumulation, with the anthocyanin content increased to 2.24-fold of the WT level(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE,F,G).The expression levels of structural genes involved in the anthocyanin biosynthesis pathway in the roots of transgenic plants were analyzed. The results showed that, compared with the control roots transformed with the empty pCAMBIA1305 vector, the expression levels of the anthocyanin biosynthetic structural genes PAL, CHS, CHI, DFR, ANS, and UFGT in the roots of the pCAMBIA1305-\u003cem\u003eLcWRKY18\u003c/em\u003e overexpression line decreased to 0.52-fold, 0.53-fold, 0.83-fold, 0.42-fold, 0.34-fold, and 0.60-fold of the control levels, respectively. In contrast, compared with the control roots transformed with the empty pTRV2-GFP vector, the expression levels of the same genes in the roots of the pTRV2-\u003cem\u003eLcWRKY18\u003c/em\u003e silencing line increased to 1.64-fold, 3.81-fold, 3.53-fold, 6.53-fold, 4.99-fold, and 2.12-fold of the control levels, respectively(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eH,I).\u003c/p\u003e \u003cp\u003eThese results suggest that \u003cem\u003eLcWRKY18\u003c/em\u003e acts as a negative regulator of anthocyanin biosynthesis, functioning to repress the accumulation of anthocyanins.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.5. Transcriptomic and metabolomic analyses of \u003cem\u003eLcWRKY18\u003c/em\u003e transgenic materials\u003c/h2\u003e \u003cp\u003eTo further investigate how \u003cem\u003eLcWRKY18\u003c/em\u003e regulates color change in \u003cem\u003eL. chinense\u003c/em\u003e var. \u003cem\u003erubrum\u003c/em\u003e, transcriptome sequencing was performed on 15 transgenic samples. Principal component analysis showed clear separation among the different groups, indicating good repeatability and distinct transcriptional states among overexpression, interference and control samples(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003eBased on time-series analysis, the gene expression profiles of WT, pCAMBIA1305-GFP, pCAMBIA1305-LcWRKY18, pTRV2-GFP, and pTRV2-LcWRKY18 were clustered into 10 modules. Significant differences in expression levels were observed among different sample groups within these modules, suggesting that LcWRKY18 may exert its biological functions by regulating gene expression(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). Differential expression analysis was performed for four comparison groups: WT vs pCAMBIA1305-LcWRKY18, pCAMBIA1305-GFP vs pCAMBIA1305-LcWRKY18, WT vs pTRV2-LcWRKY18, and pTRV2-GFP vs pTRV2-LcWRKY18. The results revealed that the WT vs pCAMBIA1305-LcWRKY18 comparison contained 10,042 differentially expressed genes (DEGs), including 6,796 up-regulated and 3,246 down-regulated genes; the pCAMBIA1305-GFP vs pCAMBIA1305-LcWRKY18 comparison contained 5,076 DEGs, including 1,624 up-regulated and 3,452 down-regulated genes; the WT vs pTRV2-LcWRKY18 comparison contained 9,560 DEGs, including 5,959 up-regulated and 3,601 down-regulated genes; and the pTRV2-GFP vs pTRV2-LcWRKY18 comparison contained 4,103 DEGs, including 3,783 up-regulated and 320 down-regulated genes(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eGO enrichment analysis indicated that differentially expressed genes were mainly enriched in phenylpropanoid metabolic process, phenylpropanoid biosynthetic process, lignin metabolic process, lignin biosynthetic process and response to chitin, among others(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD). KEGG enrichment further showed significant enrichment in flavonoid biosynthesis, monoterpenoid biosynthesis, phenylpropanoid biosynthesis, starch and sucrose metabolism, and phenylalanine metabolism. These results suggested that \u003cem\u003eLcWRKY18\u003c/em\u003e broadly affects secondary-metabolism-related pathways(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003eTranscriptome data further showed that overexpression or interference of \u003cem\u003eLcWRKY18\u003c/em\u003e significantly altered the expression of multiple genes involved in the phenylpropanoid and flavonoid pathways, including key structural genes associated with anthocyanin biosynthesis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo investigate the role of \u003cem\u003eLcWRKY18\u003c/em\u003e in flavonoid metabolism more deeply, LC-MS/MS-based metabolomic profiling was performed on overexpression and interference materials. The results showed that \u003cem\u003eLcWRKY18\u003c/em\u003e markedly affected the accumulation of various anthocyanin metabolites. In particular, overexpression of \u003cem\u003eLcWRKY18\u003c/em\u003e significantly inhibited the accumulation of cyanidin- and delphinidin-related compounds, whereas interference lines showed the opposite trend(Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). The heat map of anthocyanin metabolites clearly illustrated the differential accumulation pattern among the transgenic materials.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.6. \u003cem\u003eLcWRKY18\u003c/em\u003e represses the promoter activities of \u003cem\u003eLcUFGT\u003c/em\u003e, \u003cem\u003eLcPAL\u003c/em\u003e and \u003cem\u003eLcANS\u003c/em\u003e\u003c/h2\u003e \u003cp\u003eBased on the \u003cem\u003eLoropetalum chinense\u003c/em\u003e var. \u003cem\u003erubrum\u003c/em\u003e genome database, the \u0026minus;\u0026thinsp;2000 bp DNA sequences upstream of the ATG start codon for six genes\u0026mdash;\u003cem\u003eLcPAL\u003c/em\u003e, \u003cem\u003eLcCHS\u003c/em\u003e, \u003cem\u003eLcCHI\u003c/em\u003e, \u003cem\u003eLcDFR\u003c/em\u003e, \u003cem\u003eLcANS\u003c/em\u003e, and \u003cem\u003eLcUFGT\u003c/em\u003e\u0026mdash;were retrieved as candidate promoter regions. These promoter sequences were subsequently submitted to the PlantCARE online analysis tool for cis-acting element prediction and analysis. Notably, multiple WRKY transcription factor binding sites (W-box elements) were identified in the promoters of \u003cem\u003eLcPAL\u003c/em\u003e, \u003cem\u003eLcANS\u003c/em\u003e, and \u003cem\u003eLcUFGT\u003c/em\u003e, suggesting that these genes may be regulated by WRKY family transcription factors.\u003c/p\u003e \u003cp\u003eResults from overexpression and VIGS/interference experiments indicated that \u003cem\u003eLcWRKY18\u003c/em\u003e may regulate structural genes involved in anthocyanin biosynthesis. Therefore, promoter regions of \u003cem\u003eLcUFGT\u003c/em\u003e, \u003cem\u003eLcPAL\u003c/em\u003e and \u003cem\u003eLcANS\u003c/em\u003e were cloned from \u0026lsquo;Xiangnong Nishang\u0026rsquo;, and cis-element analysis revealed the presence of W-box motifs in these promoter fragments(Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA).\u003c/p\u003e \u003cp\u003eTo further determine whether LcWRKY18 directly regulates the expression of \u003cem\u003eLcUFGT\u003c/em\u003e, \u003cem\u003eLcPAL\u003c/em\u003e, and \u003cem\u003eLcANS\u003c/em\u003e genes, we performed a LUC transient expression assay in Nicotiana benthamiana. The pCAMBIA1300 vector harboring the \u003cem\u003eLcWRKY18\u003c/em\u003e gene was used as the effector vector, while the pGreenII0800 LUC vector carrying the promoter sequences of \u003cem\u003eLcUFGT\u003c/em\u003e, \u003cem\u003eLcPAL\u003c/em\u003e, and \u003cem\u003eLcANS\u003c/em\u003e was used as the reporter vector(Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003eDual-luciferase assays showed that co-expression of \u003cem\u003eLcWRKY18\u003c/em\u003e significantly reduced the activities of the \u003cem\u003eLcUFGT\u003c/em\u003e, \u003cem\u003eLcPAL\u003c/em\u003e and \u003cem\u003eLcANS\u003c/em\u003e promoters relative to controls. These results support the conclusion that \u003cem\u003eLcWRKY18\u003c/em\u003e functions as a transcriptional repressor of key structural genes in the anthocyanin biosynthetic pathway(Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eBased on the amino acid sequence of \u003cem\u003eLcWRKY18\u003c/em\u003e and the promoter sequences of \u003cem\u003eLcUFGT\u003c/em\u003e, \u003cem\u003eLcPAL\u003c/em\u003e, and \u003cem\u003eLcANS\u003c/em\u003e, structure prediction was performed using AlphaFold3. The top-ranked structure was selected as the experimental model based on the pLDDT score. The PLIP interaction analysis platform was employed to comprehensively describe and systematically analyze the binding interfaces(Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eWRKY transcription factors participate extensively in plant development, stress adaptation and specialized metabolism. Since the first WRKY protein SPF1 was cloned from sweet potato [49], large numbers of WRKY genes have been identified in Arabidopsis [50], rice [51] and maize [52]. Accumulating evidence shows that WRKY proteins function in seed dormancy and germination [53,54], root development [55\u0026ndash;57], pollen development [58], floral morphogenesis [59], and responses to diverse biotic and abiotic stresses, including high temperature [34,36,60,61]. Previous studies have identified a total of 79 \u003cem\u003eLcWRKY\u003c/em\u003e genes in the \u003cem\u003eLoropetalum chinense\u003c/em\u003e var. \u003cem\u003erubrum\u003c/em\u003e genome[45], which is approximately the same as the 74 members found in the model plant \u003cem\u003eArabidopsis thaliana\u003c/em\u003e[62]. Previous research has shown that \u003cem\u003eArabidopsis thaliana\u003c/em\u003e has undergone at least two whole-genome duplication events, which have contributed to the rapid expansion of its gene families[63,64].In the present study, \u003cem\u003eLcWRKY18\u003c/em\u003e was identified from high temperature transcriptome datasets of \u003cem\u003eL. chinense\u003c/em\u003e var. \u003cem\u003erubrum\u003c/em\u003e as a candidate gene associated with anthocyanin metabolism and regreening, and its functional analysis suggested that it acts as a negative regulator of anthocyanin accumulation under high temperature.\u003c/p\u003e \u003cp\u003eWRKY family members exhibit significant differential responses to heat stress among different plant species. For instance, in \u003cem\u003eLilium longiflorum\u003c/em\u003e, 62 \u003cem\u003eLdWRKY\u003c/em\u003e genes were identified to be differentially expressed under heat stress, with 51 genes up-regulated and 11 genes down-regulated[65]; in contrast, in \u003cem\u003ePhoenix dactylifera\u003c/em\u003e, 7 \u003cem\u003ePdWRKY\u003c/em\u003e genes were up-regulated while 10 genes showed down-regulation[66].Through heat stress treatment of two \u003cem\u003eLoropetalum chinense\u003c/em\u003e var. \u003cem\u003erubrum\u003c/em\u003e varieties, \u0026lsquo;Hei Zhenzhu\u0026rsquo; and \u0026lsquo;Xiangnong Fendai\u0026rsquo;, it was observed that the number of differentially expressed members of the \u003cem\u003eLcWRKY\u003c/em\u003e family and their temporal distribution exhibited obvious temporal dynamics. In \u0026lsquo;Hei Zhenzhu\u0026rsquo;, the largest number of differentially expressed genes was identified at the T0 vs T3 stage, whereas no differentially expressed genes were found at the T0 vs T7 stage. In \u0026lsquo;Xiangnong Fendai\u0026rsquo;, the number of differentially expressed genes gradually increased with the duration of heat stress, reaching 4 at the T0 vs T7 stage.In potato (\u003cem\u003eSolanum tuberosum\u003c/em\u003e), the expression level of \u003cem\u003eStWRKY75\u003c/em\u003e shows a significant difference between the heat-sensitive variety \u0026lsquo;Atlantic\u0026rsquo; and the heat-tolerant variety \u0026lsquo;Desiree\u0026rsquo;, and this difference is directly related to the thermotolerance of the varieties[67].Meanwhile, the co-responsive genes of the two varieties were mainly concentrated at the T0vsT3 and T0vsT5 stages, indicating that 3\u0026ndash;5 days after heat stress constitutes the critical phase for the \u003cem\u003eLcWRKY\u003c/em\u003e gene family to exert its regulatory functions. The differences in the \u003cem\u003eLcWRKY\u003c/em\u003e expression patterns between the two varieties are highly correlated with the stability of their leaf colors, suggesting that individual \u003cem\u003eLcWRKY\u003c/em\u003e members may play important roles in the color stability of \u003cem\u003eLoropetalum chinense\u003c/em\u003e var. \u003cem\u003erubrum\u003c/em\u003e under heat stress by regulating the anthocyanin metabolic pathway.\u003c/p\u003e \u003cp\u003eCis-acting elements form the structural basis for transcription factors to respond to upstream signals and regulate downstream target genes. In the study of the WRKY gene family in \u003cem\u003ePhoenix dactylifera\u003c/em\u003e, the promoter regions are rich in a variety of cis-elements related to abiotic stress responses, such as ABRE [66].Analysis of the promoter regions of \u003cem\u003eLcWRKY\u003c/em\u003e genes in \u003cem\u003eLoropetalum chinense\u003c/em\u003e var. \u003cem\u003erubrum\u003c/em\u003e revealed that all members contain elements related to heat stress responses, primarily including the Antioxidant Response Element (ARE), G-box element and Abscisic Acid Response Element (ABRE)[68,69] (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003eSequence alignment and phylogenetic analysis confirmed that \u003cem\u003eLcWRKY18\u003c/em\u003e contains the conserved WRKY domain and belongs to the canonical WRKY family [30,31]. The close relationship between \u003cem\u003eLcWRKY18\u003c/em\u003e and reported anthocyanin-related WRKY proteins from other species suggests partial functional conservation. In addition, qRT-PCR showed that \u003cem\u003eLcWRKY18\u003c/em\u003e exhibited clear tissue specificity in different cultivars.As key regulatory hubs in the secondary metabolic network, WRKY transcription factors are involved in the regulation of biosynthesis for secondary metabolites such as flavonoids and terpenoids.In jujube, \u003cem\u003eZjWRKY18\u003c/em\u003e positively regulates triterpenoid accumulation and enhances salt tolerance [48]. These observations support the view that \u003cem\u003eLcWRKY18\u003c/em\u003e genes may participate in both secondary metabolism and stress adaptation in different plant species.\u003c/p\u003e \u003cp\u003eThe Agrobacterium rhizogenes-mediated hairy-root system provided an effective platform for rapid functional verification in L. chinense var. rubrum. Overexpression of \u003cem\u003eLcWRKY18\u003c/em\u003e caused obvious fading of root color and a marked reduction in anthocyanin content, whereas interference of \u003cem\u003eLcWRKY18\u003c/em\u003e had the opposite effect. The regulatory mechanisms underlying the role of WRKY transcription factors in anthocyanin biosynthesis are complex and diverse.In pear, \u003cem\u003ePyWRKY26\u003c/em\u003e regulates the synthesis and transport of anthocyanins by targeting the promoter of \u003cem\u003ePyMYB114\u003c/em\u003e[70]; in kiwifruit, \u003cem\u003eAcWRKY44\u003c/em\u003e interacts with \u003cem\u003eMYBC1\u003c/em\u003e to be involved in the regulation of the proanthocyanidin and anthocyanin biosynthetic pathways[71]. However, some WRKY members have been confirmed to possess transcriptional repression activity. In Arabidopsis thaliana, \u003cem\u003eAtWRKY31\u003c/em\u003e has been identified as a transcriptional repressor [72]; \u003cem\u003eAtWRKY61\u003c/em\u003e also exhibits transcriptional repression activity, where it binds to the W-box in the promoter of \u003cem\u003eALMT1\u003c/em\u003e to inhibit its expression[73]. In lily, although \u003cem\u003eLhWRKY44\u003c/em\u003e has been confirmed to positively regulate anthocyanin biosynthesis, the same regulatory network also contains \u003cem\u003eLhHB4\u003c/em\u003e, an HD-Zip transcription factor containing an EAR repression motif, which negatively regulates anthocyanin accumulation by suppressing the expression of \u003cem\u003eLhWRKY44\u003c/em\u003e and \u003cem\u003eLhMYBSPLATTER\u003c/em\u003e [74].Subcellular localization showed that \u003cem\u003eLcWRKY18\u003c/em\u003e was distributed in both the nucleus and cytoplasm. This finding is inconsistent with the nuclear localization results of WRKY proteins reported in most studies. Such differences in localization may reflect the functional diversity of WRKY transcription factors. Studies have shown that WRKY transcription factors can sense signals in the cytoplasm and, in response to stimuli, be translocated into the nucleus to exert their regulatory functions.[75].\u003c/p\u003e \u003cp\u003eAs plant-specific regulators, WRKY transcription factors play complex regulatory roles in the flavonoid metabolic network. Previous studies have demonstrated that WRKY transcription factors are involved in the regulation of anthocyanin and proanthocyanidin accumulation by directly targeting key structural enzyme genes in the flavonoid biosynthetic pathway [76]. Meanwhile, WRKYs act as regulatory hubs to integrate multiple developmental and environmental signals, exerting multi-layered regulatory effects on various secondary metabolic pathways including flavonoids [77]. Metabolomic analysis of transgenic \u003cem\u003eLoropetalum chinense\u003c/em\u003e var. \u003cem\u003erubrum\u003c/em\u003e materials in this study revealed that in the anthocyanin metabolites, overexpression of \u003cem\u003eLcWRKY18\u003c/em\u003e significantly reduced the contents of various anthocyanins such as cyanidin and delphinidin, while interference significantly increased the contents of peonidin and its derivatives. In proanthocyanidin metabolites, overexpression suppressed their accumulation, whereas interference promoted accumulation. These results reveal that \u003cem\u003eLcWRKY18\u003c/em\u003e may exhibit differential regulatory functions on different branch pathways of flavonoids. Collectively, \u003cem\u003eLcWRKY18\u003c/em\u003e likely exerts differential regulatory effects on anthocyanin and proanthocyanidin biosynthesis in \u003cem\u003eLoropetalum chinense\u003c/em\u003e var. \u003cem\u003erubrum\u003c/em\u003e.\u003c/p\u003e \u003cp\u003ePromoter analysis showed that \u003cem\u003eLcPAL\u003c/em\u003e, \u003cem\u003eLcANS\u003c/em\u003e and \u003cem\u003eLcUFGT\u003c/em\u003e contain W-box-related cis-elements, and dual-luciferase assays demonstrated that \u003cem\u003eLcWRKY18\u003c/em\u003e significantly repressed the activities of these promoters. Together with the observed down-regulation of anthocyanin structural genes in transgenic materials, these results indicate that \u003cem\u003eLcWRKY18\u003c/em\u003e may repress anthocyanin biosynthesis by acting upstream of key pathway genes. This inference is consistent with the well-established ability of WRKY proteins to bind W-box elements and regulate downstream transcription[36], although direct physical binding still requires further confirmation.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eANS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eanthocyanidin synthase\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCHS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003echalcone synthase\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eDFR\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003edihydroflavonol 4-reductase\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eGSA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eGenome Sequence Archive\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eqRT-PCR\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003equantitative real-time PCR\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eRNA-seq\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eRNA sequencing\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eUFGT\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eUDP-glucose: flavonoid 3-O-glucosyltransferase\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eVIGS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003evirus-induced gene silencing\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eWRKY\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eWRKY transcription factor.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003ch2\u003eFunding\u003c/h2\u003e\n\u003cp\u003eThis work was supported by the Natural Science Foundation of Hunan Province (2024JJ5178), the Natural Science Foundation of Changsha, Hunan Province (kq2402112), the Hunan Provincial Forestry Bureau (XLK202437), the Scientific Research Project of the Hunan Provincial Department of Education (24C1372), the Hunan Provincial Graduate Innovation Project (CX20240643 and CX20251094), the National Innovation and Entrepreneurship Training Program for College Students of China (S202310537005), the Yuelushan Laboratory Talent Program (2025RC3004), the Furong High-Level Talent Program (2025RC4005), and Hunan Agricultural University (25KJ021).\u003c/p\u003e\n\u003ch2\u003eAuthor contributions\u003c/h2\u003e\n\u003cp\u003eAnqi Huang, Mingtong Ren, and Lili Xiang contributed equally to this work. Anqi Huang, Mingtong Ren, Lili Xiang, Nan Ma, Xiaoying Yu, and Yanlin Li designed the study. Anqi Huang, Mingtong Ren, Lili Xiang, Yang Liu,\u0026nbsp;Jiaxuan Li, Zhenkun Liao, and Lu Xu performed the experiments and collected the data. Anqi Huang, Mingtong Ren, Lili Xiang, and Donglin Zhang analyzed the data and interpreted the results. Nan Ma, Xiaoying Yu, and Yanlin Li supervised the research and acquired funding. Anqi Huang drafted the manuscript. All authors revised the manuscript and approved the final version.\u003c/p\u003e\n\u003ch2\u003eDeclaration of competing interest\u003c/h2\u003e\n\u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e\n\u003ch2\u003eEthics approval and consent to participate\u003c/h2\u003e\n\u003cp\u003eExperimental research on plants, including the collection of plant materials, complied with relevant institutional, national and international guidelines and legislation. No specific permits were required for the cultivated plant materials used in this study.\u003c/p\u003e\n\u003ch2\u003eConsent for publication\u003c/h2\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003ch2\u003eData availability\u003c/h2\u003e\n\u003cp\u003eThe RNA-seq datasets generated and analysed during the current study have been deposited in the Genome Sequence Archive (GSA) of the National Genomics Data Center, China National Center for Bioinformation. The heat-stress transcriptome datasets of \u003cem\u003eLoropetalum chinense\u003c/em\u003e var. \u003cem\u003erubrum\u003c/em\u003e leaves have been submitted under BioProject accession number PRJCA063709 and GSA submission number subCRA069695. The transcriptome datasets of LcWRKY18 transgenic hairy roots have been submitted under BioProject accession number PRJCA063659 and GSA submission number subCRA069621. These datasets are currently under confidential status and will be released upon publication. The final GSA accession numbers will be updated after database processing and assignment.\u003c/p\u003e\n\u003ch2\u003eAcknowledgements\u003c/h2\u003e\n\u003cp\u003eThe authors thank the Molecular Biology Technology Platform of Yuelushan Laboratory and the Hunan Mid-subtropical Quality Plant Breeding and Utilization Engineering Technology Research Center for technical support.\u003c/p\u003e\n\u003ch2\u003eGraphical abstract text\u003c/h2\u003e\n\u003cp\u003eUnder high temperature, \u003cem\u003eLcWRKY18\u003c/em\u003e is induced in red-leaved \u0026nbsp;\u003cem\u003eLoropetalum chinense\u003c/em\u003e var. \u003cem\u003erubrum\u003c/em\u003e. Elevated \u003cem\u003eLcWRKY18\u003c/em\u003e suppresses the expression of key anthocyanin biosynthetic genes, including LcPAL, LcANS, and LcUFGT, leading to reduced anthocyanin accumulation and accelerated leaf regreening. Functional analyses using hairy root transformation, transcriptomics, metabolomics, and promoter activity assays support the role of \u003cem\u003eLcWRKY18\u003c/em\u003e as a negative regulator of anthocyanin biosynthesis during high temperature.\u003c/p\u003e"},{"header":"References","content":"\u003cp\u003e\u003cem\u003eThe reference list from the original manuscript is retained below. Existing English entries are preserved, while Chinese entries are kept in their original form for accuracy.\u003c/em\u003e\u003c/p\u003e\n\u003col\u003e\n \u003cli\u003eHaque M, Tanjima U, Sushmoy D, et al. Heat stress alters chlorophyll fluorescence, photosynthesis and antioxidative enzyme activities in wheat cultivars[J]. Fundamental and Applied Agriculture, 2019(0): 1.\u003c/li\u003e\n \u003cli\u003eLiu Y, Lin L, Liu Y, et al. Genome-wide analysis of the bHLH gene family in loropetalum chinense var. rubrum: Identification, classification, evolution, and diversity of expression patterns under cultivation[J]. Plants, 2023, 12(19): 3392.\u003c/li\u003e\n \u003cli\u003eLiu Y, Lin L, Liu Y, et al. Genome-wide analysis of the bHLH gene family in loropetalum chinense var. rubrum : Identification, classification, evolution, and diversity of expression patterns under cultivation[J]. Plants, 2023, 12(19): 3392.\u003c/li\u003e\n \u003cli\u003eZhang Y, Liu Y, Ling L, et al. Phenotypic, physiological, and molecular response of loropetalum chinense var. rubrum under different light quality treatments based on leaf color changes.[J]. Plants, 2023, 12(11): 2169.\u003c/li\u003e\n \u003cli\u003eCai W, Zhang D, Zhang X, et al. Leaf color change and photosystem function evaluation under heat treatment revealed the stress resistance variation between loropetalum chinense and L. chinense var. rubrum.[J]. PeerJ, 2023, 11: e14834.\u003c/li\u003e\n \u003cli\u003eKong J M, Chia L S, Goh N K, et al. Analysis and biological activities of anthocyanins[J]. Phytochemistry, 2003, 64(5): 923-933.\u003c/li\u003e\n \u003cli\u003eWinkel-Shirley B. Flavonoid biosynthesis. A colorful model for genetics, biochemistry, cell biology, and biotechnology[J]. Plant Physiology, 2001, 126(2): 485-493.\u003c/li\u003e\n \u003cli\u003eCipollini M L, Levey D J. Secondary metabolites of fleshy vertebrate-dispersed fruits: Adaptive hypotheses and implications for seed dispersal[J]. American Naturalist, 1997, 150(3): 346-372.\u003c/li\u003e\n \u003cli\u003eImpact of low-temperature stress on general phenylpropanoid and anthocyanin pathways: enhancement of transcript abundance and anthocyanin pigmentation in maize seedlings | planta | springer nature link[EB/OL]. [2026-03-26]. https://link.springer.com/article/10.1007/BF00714468.\u003c/li\u003e\n \u003cli\u003eDe Rosas I, Deis L, Baldo Y, et al. High temperature alters anthocyanin concentration and composition in grape berries of malbec, merlot, and pinot noir in a cultivar-dependent manner[J]. Plants, 2022, 11(7): 926.\u003c/li\u003e\n \u003cli\u003eLo Piero A R, Puglisi I, Rapisarda P, et al. Anthocyanins accumulation and related gene expression in red orange fruit induced by low temperature storage[J]. Journal of Agricultural and Food Chemistry, 2005, 53(23): 9083-9088.\u003c/li\u003e\n \u003cli\u003eTreutter D. Significance of flavonoids in plant resistance and enhancement of their biosynthesis[J]. Plant Biology (Stuttgart, Germany), 2005, 7(6): 581-591.\u003c/li\u003e\n \u003cli\u003eGuo N, Cheng F, Wu J, et al. Anthocyanin biosynthetic genes in brassica rapa[J]. BMC Genomics, 2014, 15(1): 426.\u003c/li\u003e\n \u003cli\u003eChen L, Hu B, Qin Y, et al. Advance of the negative regulation of anthocyanin biosynthesis by MYB transcription factors[J]. Plant Physiology and Biochemistry, 2019, 136: 178-187.\u003c/li\u003e\n \u003cli\u003eTsuda T. Dietary anthocyanin-rich plants: Biochemical basis and recent progress in health benefits studies[J]. Molecular Nutrition \u0026amp; Food Research, 2012, 56(1): 159-170.\u003c/li\u003e\n \u003cli\u003eTranscriptomic and metabolomic analyses reveal that MYB transcription factors regulate anthocyanin synthesis and accumulation in the disc florets of the anemone form of chrysanthemum morifolium - ScienceDirect[EB/OL]. [2026-03-26]. https://www.sciencedirect.com/science/article/pii/S0304423821009547.\u003c/li\u003e\n \u003cli\u003eGonzalez A, Zhao M, Leavitt J M, et al. Regulation of the anthocyanin biosynthetic pathway by the TTG1/bHLH/myb transcriptional complex in arabidopsis seedlings[J]. Plant Journal, 2008, 53(5): 814-827.\u003c/li\u003e\n \u003cli\u003eMdMYB114 regulates anthocyanin biosynthesis and functions downstream of MdbZIP4-like in Apple fruit - ScienceDirect[EB/OL]. [2026-03-26]. https://www.sciencedirect.com/science/article/pii/S0176161720302431.\u003c/li\u003e\n \u003cli\u003eZhou B, Wang Y, Zhan Y, et al. Chalcone synthase family genes have redundant roles in anthocyanin biosynthesis and in response to blue/UV-a light in turnip (brassica rapa; brassicaceae)[J]. American Journal of Botany, 2013, 100(12): 2458-2467.\u003c/li\u003e\n \u003cli\u003eHeppel S C, Jaff\u0026eacute; F W, Takos A M, et al. Identification of key amino acids for the evolution of promoter target specificity of anthocyanin and proanthocyanidin regulating MYB factors[J]. Plant Molecular Biology, 2013, 82(4-5): 457-471.\u003c/li\u003e\n \u003cli\u003eDuan S, Wang J, Gao C, et al. Functional characterization of a heterologously expressed brassica napus WRKY41-1 transcription factor in regulating anthocyanin biosynthesis in arabidopsis thaliana[J]. Plant Science, 2018, 268: 47-53.\u003c/li\u003e\n \u003cli\u003eMao Z, Jiang H, Wang S, et al. The MdHY5-MdWRKY41-MdMYB transcription factor cascade regulates the anthocyanin and proanthocyanidin biosynthesis in red-fleshed apple[J]. Plant Science: An International Journal of Experimental Plant Biology, 2021, 306: 110848.\u003c/li\u003e\n \u003cli\u003eApple NAC transcription factor MdNAC52 regulates biosynthesis of anthocyanin and proanthocyanidin through MdMYB9 and MdMYB11 - ScienceDirect[EB/OL]. [2026-03-26]. https://www.sciencedirect.com/science/article/abs/pii/S0168945219308295.\u003c/li\u003e\n \u003cli\u003eZhang S, Chen Y, Zhao L, et al. A novel NAC transcription factor, MdNAC42, regulates anthocyanin accumulation in red-fleshed apple by interacting with MdMYB10[J]. Tree Physiology, 2020, 40(3): 413-423.\u003c/li\u003e\n \u003cli\u003eSun C, Wang C, Zhang W, et al. The R2R3-type MYB transcription factor MdMYB90-like is responsible for the enhanced skin color of an apple bud sport mutant[J]. Horticulture Research, 2021, 8(1): 156.\u003c/li\u003e\n \u003cli\u003eSun C, Deng L, Du M, et al. A transcriptional network promotes anthocyanin biosynthesis in tomato flesh[J]. Molecular Plant, 2020, 13(1): 42-58.\u003c/li\u003e\n \u003cli\u003eTakos A M, Jaff\u0026eacute; F W, Jacob S R, et al. Light-induced expression of a MYB gene regulates anthocyanin biosynthesis in red apples[J]. Plant Physiology, 2006, 142(3): 1216-1232.\u003c/li\u003e\n \u003cli\u003eTao R, Bai S, Ni J, et al. The blue light signal transduction pathway is involved in anthocyanin accumulation in \u0026ldquo;red zaosu\u0026rdquo; pear[J]. Planta, 2018, 248(1): 37-48.\u003c/li\u003e\n \u003cli\u003eBai S, Tao R, Tang Y, et al. BBX16, a B-box protein, positively regulates light-induced anthocyanin accumulation by activating MYB10 in red pear[J]. Plant Biotechnology Journal, 2019, 17(10): 1985-1997.\u003c/li\u003e\n \u003cli\u003eEulgem T, Rushton P J, Robatzek S, et al. The WRKY superfamily of plant transcription factors[J]. Trends in Plant Science, 2000, 5(5): 199-206.\u003c/li\u003e\n \u003cli\u003eChen F, Hu Y, Vannozzi A, et al. The WRKY transcription factor family in model plants and crops[J]. Critical Reviews in Plant Sciences, 2017, 36(5-6): 311-335.\u003c/li\u003e\n \u003cli\u003eSun Y, Yu D. Activated expression of AtWRKY53 negatively regulates drought tolerance by mediating stomatal movement[J]. Plant Cell Reports, 2015, 34(8): 1295-1306.\u003c/li\u003e\n \u003cli\u003eKrishnamurthy P, Vishal B, Ho W J, et al. Regulation of a cytochrome P450 gene CYP94B1 by WRKY33 transcription factor controls apoplastic barrier formation in roots to confer salt tolerance.[J]. Plant Physiology, 2020, 184(4): 2199-2215.\u003c/li\u003e\n \u003cli\u003eLi S, Fu Q, Chen L, et al. Arabidopsis thaliana WRKY25, WRKY26, and WRKY33 coordinate induction of plant thermotolerance.[J]. Planta, 2011, 233(6): 1237-1252.\u003c/li\u003e\n \u003cli\u003eZou C, Jiang W, Yu D. Male gametophyte-specific WRKY34 transcription factor mediates cold sensitivity of mature pollen in Arabidopsis.[J]. Journal of Experimental Botany, 2010, 61(14): 3901-3914.\u003c/li\u003e\n \u003cli\u003eHan M, Kim C Y, Lee J, et al. OsWRKY42 represses OsMT1d and induces reactive oxygen species and leaf senescence in rice.[J]. Molecules and Cells, 2014, 37(7): 532-539.\u003c/li\u003e\n \u003cli\u003eZhang M, Zhao R, Huang K, et al. The OsWRKY63-OsWRKY76-OsDREB1B module regulates chilling tolerance in rice.[J]. Plant Journal, 2022, 112(2): 383-398.\u003c/li\u003e\n \u003cli\u003eCai R, Dai W, Zhang C, et al. The maize WRKY transcription factor ZmWRKY17 negatively regulates salt stress tolerance in transgenic arabidopsis plants.[J]. Planta, 2017, 246(6): 1215-1231.\u003c/li\u003e\n \u003cli\u003eZhang L, Cheng J, Sun X, et al. Overexpression of VaWRKY14 increases drought tolerance in arabidopsis by modulating the expression of stress-related genes.[J]. Plant Cell Reports, 2018, 37(8): 1159-1172.\u003c/li\u003e\n \u003cli\u003eXu P yue, Xu L, Xu H feng, et al. MdWRKY40is directly promotes anthocyanin accumulation and blocks MdMYB15L, the repressor of MdCBF2, which improves cold tolerance in apple[J]. Journal of Integrative Agriculture, 2023, 22(6): 1704-1719.\u003c/li\u003e\n \u003cli\u003eSu M, Wang S, Li C, et al. Ultraviolet-B-induced MdWRKY71-L expression regulates anthocyanin synthesis in apple[J]. Environmental and Experimental Botany, 2022, 201: 105000.\u003c/li\u003e\n \u003cli\u003eMa H, Yang T, Li Y, et al. The long noncoding RNA MdLNC499 bridges MdWRKY1 and MdERF109 function to regulate early-stage light-induced anthocyanin accumulation in apple fruit[J]. The Plant Cell, 2021, 33(10): 3309-3330.\u003c/li\u003e\n \u003cli\u003eAlabd A, Ahmad M, Zhang X, et al. Light-responsive transcription factor PpWRKY44 induces anthocyanin accumulation by regulating PpMYB10 expression in pear[J]. Horticulture Research, 2022, 9: uhac199.\u003c/li\u003e\n \u003cli\u003eBi M, Liang R, Wang J, et al. Multifaceted roles of LhWRKY44 in promoting anthocyanin accumulation in asiatic hybrid lilies (lilium spp.)[J]. Horticulture Research, 2023, 10(9): uhad167.\u003c/li\u003e\n \u003cli\u003eLiu Y, Zhang Y, Liu Y, et al. Genome-wide identification and characterization of WRKY transcription factors and their expression profile in loropetalum chinense var. rubrum.[J]. Plants, 2023, 12(11): 2131.\u003c/li\u003e\n \u003cli\u003eChen C, Chen H, Zhang Y, et al. TBtools: An integrative toolkit developed for interactive analyses of big biological data[J]. Molecular Plant, 2020, 13(8): 1194-1202.\u003c/li\u003e\n \u003cli\u003eAdasme M F, Linnemann K L, Bolz S N, et al. PLIP 2021: Expanding the scope of the protein-ligand interaction profiler to DNA and RNA[J]. Nucleic Acids Research, 2021, 49(W1): W530-W534.\u003c/li\u003e\n \u003cli\u003eWen C, Zhang Z, Shi Q, et al. Methyl jasmonate- and salicylic acid-induced transcription factor ZjWRKY18 regulates triterpenoid accumulation and salt stress tolerance in jujube[J]. International Journal of Molecular Sciences, 2023, 24(4).\u003c/li\u003e\n \u003cli\u003eIshiguro S, Nakamura K. Characterization of a cDNA encoding a novel DNA-binding protein, SPF1, that recognizes SP8 sequences in the 5\u0026rsquo; upstream regions of genes coding for sporamin and beta-amylase from sweet potato[J]. Molecular \u0026amp; general genetics: MGG, 1994, 244(6): 563-571.\u003c/li\u003e\n \u003cli\u003eUlker B, Somssich I E. WRKY transcription factors: From DNA binding towards biological function[J]. Current Opinion in Plant Biology, 2004, 7(5): 491-498.\u003c/li\u003e\n \u003cli\u003eRoss C A, Liu Y, Shen Q J. The WRKY gene family in rice ( oryza sativa )[J]. Journal of Integrative Plant Biology, 2007, 49(6): 827-842.\u003c/li\u003e\n \u003cli\u003eWei K F, Chen J, Chen Y F, et al. Molecular phylogenetic and expression analysis of the complete WRKY transcription factor family in maize.[J]. DNA Research, 2012, 19(2): 153-164.\u003c/li\u003e\n \u003cli\u003eZhou C, Lin Q, Lan J, et al. WRKY transcription factor OsWRKY29 represses seed dormancy in rice by weakening abscisic acid response[J]. Frontiers in Plant Science, 2020, 11: 691.\u003c/li\u003e\n \u003cli\u003eJiang W, Yu D. Arabidopsis WRKY2 transcription factor mediates seed germination and postgermination arrest of development by abscisic acid[J]. BMC Plant Biology, 2009, 9(1): 96.\u003c/li\u003e\n \u003cli\u003eHu Z, Wang R, Zheng M, et al. TaWRKY51 promotes lateral root formation through negative regulation of ethylene biosynthesis in wheat (triticum aestivum L.)[J]. The Plant Journal: For Cell and Molecular Biology, 2018, 96(2): 372-388.\u003c/li\u003e\n \u003cli\u003eGrunewald W, De Smet I, Lewis D R, et al. Transcription factor WRKY23 assists auxin distribution patterns during \u003cem\u003earabidopsis\u003c/em\u003e root development through local control on flavonol biosynthesis[J]. Proceedings of the National Academy of Sciences, 2012, 109(5): 1554-1559.\u003c/li\u003e\n \u003cli\u003eWang P, Xu X, Tang Z, et al. OsWRKY28 regulates phosphate and arsenate accumulation, root system architecture and fertility in rice[J]. Frontiers in Plant Science, 2018, 9: 1330.\u003c/li\u003e\n \u003cli\u003eLei R, Li X, Ma Z, et al. Arabidopsis WRKY2 and WRKY34 transcription factors interact with VQ20 protein to modulate pollen development and function[J]. The Plant Journal: For Cell and Molecular Biology, 2017, 91(6): 962-976.\u003c/li\u003e\n \u003cli\u003eLi W, Wang H, Yu D. Arabidopsis WRKY transcription factors WRKY12 and WRKY13 oppositely regulate flowering under short-day conditions[J]. Molecular Plant, 2016, 9(11): 1492-1503.\u003c/li\u003e\n \u003cli\u003eCheng Z, Luan Y, Meng J, et al. WRKY transcription factor response to high-temperature stress[J]. Plants (Basel, Switzerland), 2021, 10(10): 2211.\u003c/li\u003e\n \u003cli\u003eZhang Y, Wang L. The WRKY transcription factor superfamily: Its origin in eukaryotes and expansion in plants[J]. BMC Evolutionary Biology, 2005, 5: 1.\u003c/li\u003e\n \u003cli\u003eBerri S, Abbruscato P, Faivre-Rampant O, et al. Characterization of WRKYco-regulatory networks in rice and Arabidopsis[J]. BMC Plant Biology, 2009, 9(1): 120.\u003c/li\u003e\n \u003cli\u003eBlanc G, Hokamp K, Wolfe K H. A recent polyploidy superimposed on older large-scale duplications in the \u003cem\u003earabidopsis\u003c/em\u003e genome[J]. Genome Research, 2003, 13(2): 137-144.\u003c/li\u003e\n \u003cli\u003eWu K L, Guo Z J, Wang H H, et al. The WRKY family of transcription factors in rice and arabidopsis and their origins[J]. DNA research: an international journal for rapid publication of reports on genes and genomes, 2005, 12(1): 9-26.\u003c/li\u003e\n \u003cli\u003eXu S, Feng H, Li T, et al. Genome-wide analysis of the \u003cem\u003eWRKY\u003c/em\u003e gene family in lily and functional characterization of \u003cem\u003eLdWRKY87\u003c/em\u003e in response to heat stress[J]. New Crops, 2026, 3: 100084.\u003c/li\u003e\n \u003cli\u003eKhan I, Lubna, Bilal S, et al. Genome-wide and transcriptome analysis of PdWRKY transcription factors in date palm (Phoenix dactylifera) revealing insights into heat and drought stress tolerance[J]. BMC Genomics, 2025, 26(1): 589.\u003c/li\u003e\n \u003cli\u003eZhu X, Duan X, Majeed Y, et al. Functional analysis of StWRKY75 gene in response to heat stress in potato (solanum tuberosum L.)[J]. Frontiers in Plant Science, 2025, 16.\u003c/li\u003e\n \u003cli\u003eNakashima K, Yamaguchi-Shinozaki K, Shinozaki K. The transcriptional regulatory network in the drought response and its crosstalk in abiotic stress responses including drought, cold, and heat[J]. Frontiers in Plant Science, 2014, 5.\u003c/li\u003e\n \u003cli\u003eWang J, Zhang X, Wang G. Transcriptomic analysis of heat-responsive genes in maize seedlings[J]. Maize Genomics and Genetics, 2025, 16(0).\u003c/li\u003e\n \u003cli\u003eLi C, Wu J, Hu K D, et al. PyWRKY26 and PybHLH3 cotargeted the PyMYB114 promoter to regulate anthocyanin biosynthesis and transport in red-skinned pears[J]. Horticulture Research, 2020, 7: 37.\u003c/li\u003e\n \u003cli\u003ePeng Y, Thrimawithana A H, Cooney J M, et al. The proanthocyanin-related transcription factors MYBC1 and WRKY44 regulate branch points in the kiwifruit anthocyanin pathway[J]. Scientific Reports, 2020, 10(1): 14161.\u003c/li\u003e\n \u003cli\u003eWang Y qiao, Zhao X jie, Niu F fang, et al. Analysis of transcriptional activity and interaction proteins of WRKY31 transcription factor in arabidopsis thaliana[J]. Biotechnology Bulletin, 2018, 34(5): 101.\u003c/li\u003e\n \u003cli\u003eMa A, Li J, Liu S, et al. WRKY61 negatively regulates aluminum resistance by inhibiting the expression of ALMT1 in arabidopsis thaliana[J]. Plants, 2025, 14(21).\u003c/li\u003e\n \u003cli\u003eBi M, Xu L, Wang J, et al. Three transcription factors form an activation-inhibition module to regulate anthocyanin accumulation in asiatic hybrid lilies[J]. Plant Physiology, 2025, 198(2): kiaf203.\u003c/li\u003e\n \u003cli\u003eTak H, Negi S, Ganapathi T R. The 5\u0026rsquo;-upstream region of WRKY18 transcription factor from banana is a stress-inducible promoter with strong expression in guard cells[J]. Physiologia Plantarum, 2021, 173(4): 1335-1350.\u003c/li\u003e\n \u003cli\u003eChen L, Cheng Y, Hong G. Molecular insights into the regulation of flavonoid biosynthesis in fruits[J]. Horticulture Research, 2026, 13(2): uhaf306.\u003c/li\u003e\n \u003cli\u003eLi Y, Li Z, Xu C, et al. WRKYs as regulatory hubs of secondary metabolic networks: Diverse inducers and distinct responses[J]. Plant Communications, 2025, 6(9): 101438.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-plant-biology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pbio","sideBox":"Learn more about [BMC Plant Biology](http://bmcplantbiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/pbio/default.aspx","title":"BMC Plant Biology","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"anthocyanin biosynthesis, high temperature, Loropetalum chinense var. rubrum, ornamental foliage shrub, WRKY transcription factor","lastPublishedDoi":"10.21203/rs.3.rs-9482561/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9482561/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e \u003cem\u003eLoropetalum chinense\u003c/em\u003e var. \u003cem\u003erubrum\u003c/em\u003e is an important ornamental foliage shrub whose leaf coloration is highly sensitive to high temperature, often exhibiting high temperature-induced color fading due to reduced anthocyanin accumulation. However, the transcriptional mechanisms underlying this process remain poorly understood. In this study, we identified \u003cem\u003eLcWRKY18\u003c/em\u003e as a transcription factor affected by high temperature and associated with color fading, based on the reference genomic data of \u003cem\u003eLoropetalum chinense\u003c/em\u003e var. \u003cem\u003erubrum\u003c/em\u003e and the transcriptomic data under heat stress. Functional analyses showed that \u003cem\u003eLcWRKY18\u003c/em\u003e negatively regulates anthocyanin accumulation, as its overexpression reduced anthocyanin accumulation, whereas its suppression promoted anthocyanin accumulation. Further multi-omics analyses revealed that \u003cem\u003eLcWRKY18\u003c/em\u003e overexpression broadly suppressed the expression of structural genes in the phenylpropanoid and flavonoid biosynthetic pathways, leading to decreased levels of major anthocyanin metabolites, particularly cyanidin- and delphinidin-derived compounds. Consistently, dual-luciferase assays demonstrated that \u003cem\u003eLcWRKY18\u003c/em\u003e directly inhibits the promoter activities of \u003cem\u003eLcPAL\u003c/em\u003e, \u003cem\u003eLcANS\u003c/em\u003e and \u003cem\u003eLcUFGT\u003c/em\u003e. These results suggest that \u003cem\u003eLcWRKY18\u003c/em\u003e acts as a negative regulator of anthocyanin biosynthesis that mediates high temperature-induced leaves color fading in \u003cem\u003eL. chinense\u003c/em\u003e var. rubrum. This study provides new insight into the molecular basis of high-temperature-induced leaf color fading and offers a useful candidate gene for breeding ornamental germplasm with improved color stability under high temperature stress.\u003c/p\u003e","manuscriptTitle":"LcWRKY18 negatively regulates anthocyanin biosynthesis and is associated with high temperature-induced regreening in Loropetalum chinense var. rubrum","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-05-15 18:48:24","doi":"10.21203/rs.3.rs-9482561/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"54471109995310294039750628472349143240","date":"2026-05-14T08:27:07+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-05-07T08:44:00+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-05-07T08:36:17+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2026-05-07T07:40:42+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-05-06T19:02:07+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Plant Biology","date":"2026-05-06T13:41:56+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-plant-biology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pbio","sideBox":"Learn more about [BMC Plant Biology](http://bmcplantbiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/pbio/default.aspx","title":"BMC Plant Biology","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"175f51ac-0438-4f31-8f93-d454502dd56a","owner":[],"postedDate":"May 15th, 2026","published":true,"recentEditorialEvents":[{"type":"reviewerAgreed","content":"54471109995310294039750628472349143240","date":"2026-05-14T08:27:07+00:00","index":33,"fulltext":""},{"type":"reviewersInvited","content":"12","date":"2026-05-07T08:44:00+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-05-07T08:36:17+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2026-05-07T07:40:42+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-05-06T19:02:07+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Plant Biology","date":"2026-05-06T13:41:56+00:00","index":"","fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-15T18:48:25+00:00","versionOfRecord":[],"versionCreatedAt":"2026-05-15 18:48:24","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9482561","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9482561","identity":"rs-9482561","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}