Sodium Taurocholate Promotes Liver Regeneration after Portal Vein Ligation in Rats

Sodium Taurocholate Promotes Liver Regeneration after Portal Vein Ligation in Rats | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Sodium Taurocholate Promotes Liver Regeneration after Portal Vein Ligation in Rats Xinlan Ge, Yue Zhang, Yongsheng Zhao, Ke Pan, Yuan Zhang, Chonghui Li, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7588701/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 26 Nov, 2025 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract Objective To investigate the mechanism of oral sodium taurocholate on liver regeneration after portal vein ligation. Methods A rat model of 70% portal vein ligation (PVL) was established. The rats were randomly divided into a sodium taurocholate intervention group (PVL treatment, PVLT) and a normal diet control group (PVL control, PVLC). Liver regeneration capacity was evaluated by measuring the ratio of non-ligated liver lobe weight to total liver weight and the expression of Ki67 protein. Liver function was assessed by measuring serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin (TBil), total bile acids (TBA), and hepatic TBA levels. Transcriptome analysis was performed using bulk RNA sequencing, combined with qPCR validation of gene expression related to bile acid metabolism. Results Ki67 expression peaked on the second day after surgery in both groups, with more significant liver regeneration observed in the PVLT group. Sodium taurocholate administration led to bile acid accumulation and concomitant liver function injury. Transcriptome analysis revealed that differentially expressed genes were significantly enriched in the bile acid secretion pathway, and Gene Set Enrichment Analysis (GSEA) suggested activation of the Hippo signaling pathway. Conclusion Sodium taurocholate promotes liver regeneration after portal vein ligation by regulating bile acid metabolism and the Hippo signaling pathway. Biological sciences/Biochemistry Health sciences/Diseases Health sciences/Gastroenterology Biological sciences/Molecular biology Liver regeneration Portal vein ligation Sodium taurocholate Bile acid metabolism Hippo signaling pathway Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction The standard treatment for liver tumors remains surgical resection [ 1 ]. However, in cases requiring extensive resection, an insufficient future liver remnant (FLR) may lead to postoperative liver failure [ 2 ]. Currently, preoperative portal vein embolization (PVE) or associating liver partition and portal vein ligation for staged hepatectomy (ALPPS) are primarily used in clinical practice to promote FLR hypertrophy [ 1 , 3 , 4 ]. PVE has limitations such as a long waiting period (2–8 weeks) and limited resection rates (approximately 70%), and it may potentially accelerate hepatocellular carcinoma progression due to compensatory increase in hepatic arterial flow secondary to reduced portal venous flow [ 5 , 6 , 7 ]. ALPPS can significantly increase future liver remnant (FLR) volume by 70%-80% within a short period [ 4 ], yet it remains controversial. The incidence of postoperative complications ranges from 3% to 66.7%, with a 90-day mortality rate as high as 2.8%-28.7% [ 8 – 12 ]. Its indications are limited, as it is not suitable for patients with cirrhosis, those over 60 years of age with colorectal cancer liver metastases, or those requiring massive blood transfusion/prolonged surgery[ 13 ]. Furthermore, although preliminary studies suggest favorable short-term outcomes of ALPPS in patients with colorectal cancer liver metastases [ 14 , 15 ], evidence regarding long-term prognosis remains insufficient and requires validation through large-sample studies. Studies have demonstrated that bile acids (BAs) play a crucial role in regulating liver regeneration and cellular proliferation. Animal experiments [ 16 ] revealed that feeding wild-type mice with 0.2% cholic acid for 5 days resulted in approximately 30% increase in liver weight and enhanced DNA synthesis activity, confirming that appropriate BA supplementation can directly stimulate hepatocyte proliferation. In hepatectomy models, the regeneration rate and number of BrdU-positive cells were higher in the cholic acid group compared to the cholestyramine group (an anion exchange resin), where reduced BA absorption inhibited regeneration [ 16 ]. This finding was further validated in clinical studies, where patients without biliary drainage after hemihepatectomy showed higher serum BA levels and significantly greater regenerative volume than the drainage group (with BA loss), indicating a positive correlation between serum BA levels and regeneration extent [ 17 ]. BAs not only stimulate hepatocyte proliferation but also promote hepatocyte polarization, thereby accelerating the restoration of structural and functional polarity in the liver [ 18 , 19 ]. They can stimulate the formation of bile canaliculi networks and promote hepatocyte polarization through the cAMP-Epac-MEK-LKB1-AMPK signaling pathway, facilitating liver injury repair [ 19 , 20 ]. Our previous study demonstrated that compared to portal vein ligation alone, combined portal vein and bile duct ligation rapidly elevated BA concentrations and significantly improved survival rates in rats undergoing 90% hepatectomy. This mechanism may be associated with increased intrahepatic bile salt concentration resulting from biliary obstruction [ 18 , 21 ]. Sodium taurocholate (NaTC), as the primary component of the BA pool in rats, regulates BA metabolism, inflammatory responses, and proliferative pathways through FXR and TGR5 receptors, thereby influencing liver regeneration [ 22 , 23 , 24 ]. We hypothesize that combined administration of bile salts with portal vein ligation may accelerate the hypertrophy of the future liver remnant and reduce the waiting period. This study investigates the promotive effects of oral NaTC intervention following PVL on liver regeneration, with particular focus on elucidating its underlying molecular mechanisms. 1. Methods Animal model Male Wistar rats weighing 230–270 grams were used for this study, provided by Beijing Vital River Laboratory Animal Technology Co., Ltd. The experimental protocol was approved by the Animal Experiment Ethics Committee of the Chinese PLA General Hospital (Approval No. : 2017-X13-65) and strictly adhered to the National Institutes of Health Guide for the Care and Use of Laboratory Animals. All rats were fasted for 12 hours before the experiment and then randomly divided into two groups: the portal vein ligation control group (PVLC, n = 40), which underwent 70% portal vein ligation (ligating the left and median hepatic lobe portal vein branches) and was fed a standard diet; and the portal vein ligation treatment group (PVLT, n = 40), which underwent the same surgical procedure and was fed a diet containing 0.5% sodium taurocholate (by mass). Both groups were observed at five time points (1, 2, 3, 5, and 7 days post-surgery), with 8 rats per time point. Sample collection Rats were anesthetized with 1.5% isoflurane, and their body weight was measured after anesthesia. A midline incision was made to open the abdominal cavity. Blood was collected from the inferior vena cava using a 5 ml syringe, centrifuged at 3000 rpm for 10 minutes, and the serum was aliquoted and stored at -80°C. The liver tissues from both the non-ligated and ligated sides of the rats were weighed. One portion of the liver tissue was rapidly frozen in liquid nitrogen and transferred to a -80°C freezer for storage, while another portion was fixed in 10% buffered formalin and embedded in paraffin blocks for storage at room temperature. Finally, the rats were euthanized by exsanguination. Transcriptome sequencing and bioinformatics analysis Frozen liver tissue samples from sodium taurocholate-treated and control rats at 2 days post-operation were collected and sent to Guangzhou Gidio Biotechnology Co., Ltd. (China) for Bulk RNA-seq sequencing. Raw sequencing data underwent quality control (Q30 > 90%), alignment (reference genome: Rnor_6.0), and gene quantification (FPKM). Differential expression analysis was performed using DESeq2 software (v1.30.1) with screening thresholds set at |log2FoldChange| >1 and FDR-adjusted P < 0.05. Significantly differentially expressed genes (DEGs) were subjected to functional annotation analysis: Gene Ontology (GO) enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses were conducted using the ClusterProfiler R package (v4.0.5), with significance thresholds set at P < 0.05 and false discovery rate (FDR) < 0.05. Enrichment results were visualized using ggplot2 (v3.3.5). Hepatic and serum BA, Serum biochemical Test, and Liver regeneration rate Hepatic BAs were extracted as described[ 16 ]. Liver BA levels and serum parameters were measured using a biochemical analyzer (Chemray 800, Rayto, China). Body weight was measured after anesthesia, and total liver weight was estimated based on body weight. The liver regeneration rate was calculated as the ratio of the non-ligated liver lobe weight to the total liver weight. Immunohistochemical Staining Liver tissues fixed in 10% neutral formalin were paraffin-embedded and sectioned into 5-µm thick slices. Immunohistochemical staining was performed on the tissue sections using mouse monoclonal antibody KI67 (1:50, BD Pharmingen, USA) and a two-step detection kit (Cat.#PV9002, ZSGB-BIO, China). Ten random fields of view (400x magnification) were selected for each sample, and the KI67 labeling index was calculated as the percentage of KI67-positive hepatocytes relative to the total number of hepatocytes. Real-time fluorescence quantitative PCR analysis Total RNA was isolated from 70 mg of frozen liver tissue with the RNA Simple Total RNA Kit (Cat. #DP419, Tiangen Biotech, China) according to the manufacturer's instructions. Then, 4 µg of RNA was reverse transcribed using the RevertAid First Strand cDNA Synthesis Kit (Cat. #K1622, Thermo Scientific, Lithuania) as per the provided protocol. Quantitative real-time PCR was performed on the StepOnePlus Real-Time PCR System (Applied Biosystems, CA, USA) using the TB Green Premix Ex Taq™ (Tli RNaseH Plus) Kit (Cat. #RR420A, TaKaRa Bio Inc., Japan) in accordance with the manufacturer's procedures. Relative gene expression levels were normalized to GAPDH expression and calculated using the 2^(–ΔΔCT) method [ 25 ], expressed as fold changes relative to the control group. Gene primer sequences are listed in Table 1 . Table 1 Primer sequences for quantitative real-time PCR gene amplification Gene Forward Primer 5'-3' Reverse Primer 5'-3' GAPDH ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA FXR GTGACAAAGAAGCCGCGAAT GCAGGTGAGCGCGTTGTAAT CYP7A1 GCTTTACAGAGTGCTGGCCAA CTGTCTAGTACCGGCAGGTCATT BSEP CACTGGGTACATGTGGTGTCTCAT ATGGCCAATATTCATAGCTGCTAAT NTCP CGTTGCCGGAATGTTTGTCT TGCCCTTCTGTCTCAGTTCATG OSTβ TATTCCATCCTGGTTCTGGCAGT CGTTGTCTTGTGGCTGCTTCTT SHP CCTCTTCAACCCAGATGTGCC AAGCCATGAGGAGGATTCGG Statistical analysis This study utilized GraphPad Prism 8 and SPSS software (version 25.0) for statistical analysis, with all numerical data expressed as mean ± standard deviation. Differences between the taurocholic acid treatment group and the control group were compared using the t-test, with a significance level set at P < 0.05. This study is reported in accordance with the ARRIVE guidelines. 2. Results Effect of Sodium Taurocholate on Liver Regeneration in Portal Vein-Ligated Rats The ratio of non-ligated liver weight to total liver weight (Fig. 1 A) indicated that the liver regeneration rate in both the PVLT and PVLC groups increased gradually over time at various postoperative time points. On postoperative days 2, 3, 5, and 7, the liver regeneration rate in the sodium taurocholate group was significantly higher than that in the control group (P < 0.05). Immunohistochemical staining results of the cell proliferation marker Ki67 (Figs. 1 B and 1 C) revealed that the expression of Ki67 protein in the non-ligated liver tissue gradually increased on postoperative days 1 and 2, peaked on day 2, and then gradually decreased on days 3, 5, and 7. Compared to the PVLC group, the expression level of Ki67 in the sodium taurocholate group was significantly higher on postoperative days 1, 2, 3, 5, and 7 (P < 0.05). Taken together, these results indicate that sodium taurocholate promotes the regeneration of the non-ligated liver in rats following PVL. Effects of Sodium Taurocholate on BA Metabolism and Liver Function As shown in Fig. 2 , one day after portal vein ligation, the levels of BAs (TBA) in the PVLT group were significantly elevated. The serum TBA concentration was 174.8 ± 22.4µmol/L, the TBA concentration in the ligated liver tissue was 217 ± 15.31µmol/L, and the TBA concentration in the non-ligated liver tissue was as high as 445 ± 44.02 µmol/L. The serum and liver TBA levels in the PVLT group were significantly higher than those in the PVLC group (P < 0.05). In both PVLC and PVLT groups, ALT levels peaked on the second day after surgery, AST levels peaked on the first day after surgery, and TBil levels peaked on the third day after surgery. Over the seven days following surgery, the ALT, AST, and TBil levels in the PVLT group were significantly higher than those in the PVLC group (P < 0.05). In summary, sodium taurocholate treatment increased BA levels in rats with PVL, accompanied by a sustained elevation in liver function indicators (ALT, AST, TBil). The increase in liver injury markers may partially be attributed to the accelerated atrophy of the ligated liver tissue. Effects of Sodium Taurocholate on the Gene Expression Profile in Rat Liver Transcriptome sequencing analysis was performed on liver tissues collected from the PVLT and PVLC groups two days after surgery. A total of 1,060 differentially expressed genes were identified between the two groups (Figs. 3 A and 3 B), among which 711 genes were up-regulated and 349 genes were down-regulated. A heatmap of the top 30 differentially expressed genes with the highest FDR values is shown in Fig. 3 C. These genes may play critical roles in the rat liver's response to sodium taurocholate treatment. Functional Enrichment Analysis of Differentially Expressed Genes Gene Ontology (GO) enrichment analysis of these differentially expressed genes revealed that the up-regulated genes in the liver tissues of the PVLT group were significantly enriched in several key biological pathways (Fig. 4 A). The most prominently enriched pathways included: cell differentiation, cellular development, and positive regulation of biological processes and cellular processes. These results suggest that sodium taurocholate may promote liver tissue regeneration and repair by modulating these critical biological processes. KEGG pathway enrichment analysis identified the bile secretion pathway as the most significantly enriched pathway among the up-regulated genes (Fig. 4 B). This pathway involved 13 significantly up-regulated genes, including Atp1b1, Atp1a2, Abcc3, Abcb11 (BSEP, Bile Salt Export Pump), Abcb1b, Abcb4, Slc4a4, Slc4a5, Slc51b (OSTβ, Organic Solute Transporter β-subunit), Ephx1, and Nr0b2 (SHP, Small Heterodimer Partner), comprehensively promoting BA transport and secretion. Given that KEGG enrichment analysis highlighted the bile secretion pathway as the most significantly enriched, we further quantified the expression levels of BA metabolism-related genes in the non-ligated liver tissue using real-time quantitative PCR. These genes included farnesoid X receptor (FXR), cytochrome P450 family 7 subfamily A member 1 (Cyp7a1), Small Heterodimer Partner (SHP), Na(+)-bile acid cotransporter (NTCP), bile salt export pump (BSEP), and organic solute transporter beta (OSTβ). After sodium taurocholate intervention, the PVLT group exhibited significant activation of the BA metabolic pathway. Specifically, as shown in Fig. 5 , compared to the PVLC group, the expression levels of FXR and Cyp7a1 were significantly reduced at all postoperative time points in the PVLT group (P < 0.05), while the expression levels of SHP were markedly up-regulated (P < 0.05). These findings demonstrate that elevated BA levels activate FXR, which subsequently induces the expression of its downstream target gene SHP. The upregulation of SHP inhibits Cyp7a1 transcription, consistent with the fact that the classical BA synthesis pathway is subject to negative feedback regulation. Notably, the gene expression levels of the BA efflux transporters BSEP and OSTβ were significantly up-regulated in the experimental group (P < 0.05), while the sodium-taurocholate co-transporting polypeptide (NTCP) was significantly down-regulated (P < 0.05). These patterns indicate that sodium taurocholate may activate the FXR signaling pathway, thereby inhibiting Cyp7a1-mediated BA synthesis while enhancing BSEP/OSTβ-mediated BA efflux mechanisms, ultimately forming a positive regulatory network that promotes BA metabolism. Regulatory Effects of Sodium Taurocholate on the Hippo-YAP/TAZ Signaling Pathway Based on KEGG and GSEA analyses indicating significant enrichment of the Hippo pathway (Figs. 4 C, 4 D), we further investigated changes in its key molecules (Fig. 6 ). In the PVLT group, the expression of upstream kinases MST1 and LATS1/2 was significantly downregulated (P < 0.05), while the expression of regulatory factors SAV1, MOB1, and the transcription factor Tead2 was significantly upregulated (P 0.05), their downstream target genes Cyclin D1, CYR61, and CTGF were significantly highly expressed (P < 0.05). These results suggest that sodium taurocholate may inhibit MST1/LATS1/2 kinase activity, coordinately upregulate the SAV1-MOB1 complex and Tead2, and promote the transcription of YAP/TAZ downstream target genes, indicating activation of the Hippo pathway. The functional activation of YAP/TAZ may be related to post-translational modifications or nuclear translocation rather than changes in total protein levels. Furthermore, we found that after sodium taurocholate treatment, the expression level of the liver-specific transcription factor HNF4α was significantly increased (Fig. 6 ), suggesting that hepatocytes may have entered an active proliferation phase 48 hours after surgery. In summary, this study reveals a novel mechanism by which sodium taurocholate promotes liver regeneration through a dual regulatory network: on one hand, it regulates BA metabolic homeostasis to reduce intrahepatic toxic injury; on the other hand, it activates the Hippo signaling pathway to drive cell proliferation and tissue repair programs. These two pathways form a synergistic model of metabolic clearance and regeneration activation, highlighting the biological characteristics of BA metabolites in multi-dimensional regulation of liver self-repair and providing new therapeutic targets for impaired liver regeneration. 3. Discussion This study found that the combination of 70% PVL and oral sodium taurocholate significantly promoted the liver regeneration process, as evidenced by a markedly increased regeneration rate in the non-ligated liver lobe, enhanced Ki67 protein expression, and a substantial expansion of the future liver remnant volume. Ki67 protein expression in the non-ligated liver tissue peaked at 48 hours post-surgery, which was therefore selected as the time point for Bulk-RNA sequencing analysis. Functional annotation analysis of the differentially expressed genes (GO, KEGG, and GSEA) revealed that the up-regulated genes were primarily involved in biological processes such as the regulation of BA secretion and the Hippo signaling pathway. The Hippo signaling pathway is a critical regulator of organ size and tissue homeostasis. Its upstream components are mediated by MST1/2 and LATS1/2 kinases. When this pathway is inactivated, the effector molecules YAP/TAZ undergo dephosphorylation and translocate into the nucleus, where they bind to transcription factors such as TEAD, thereby activating the transcription of downstream target genes [ 26 ]. Our experimental data demonstrated that oral sodium taurocholate after PVL significantly downregulated the expression of LATS1/2 and MST1, while upregulating the expression levels of SAV1 and MOB1, indicating effective activation of the Hippo-YAP/TAZ signaling pathway. Furthermore, this study confirmed that oral sodium taurocholate after PVL significantly upregulated the expression of classical downstream target genes of the Hippo-YAP/TAZ pathway, including CTGF (CCN2) and CYR61 (CCN1). The promoter/enhancer regions of these genes contain multiple TEAD binding sites, and their transcriptional activity is directly regulated by Hippo-YAP/TAZ [ 27 ]. CTGF is involved in extracellular matrix remodeling, while CYR61, a secreted matricellular protein, plays a crucial role in angiogenesis and tissue repair [ 28 , 29 ]. Additionally, the expression level of CCND1, a key regulator of the cell cycle, was significantly upregulated in the sodium taurocholate treatment group, further illustrating the activating effect of sodium taurocholate on downstream transcription factors of the Hippo-YAP/TAZ pathway [ 30 ]. These findings suggest that oral sodium taurocholate may promote hepatocyte proliferation after PVL by activating the Hippo-YAP/TAZ signaling pathway, thereby positively influencing the expansion of the future liver remnant volume. KEGG pathway enrichment analysis revealed that the p53 signaling pathway was significantly enriched (ranked 5th) in the PVLT group. This finding suggests that while promoting liver regeneration, the body may activate a tumor suppressor gene network to maintain the proliferation-inhibition balance, thereby preventing the risk of carcinogenesis caused by abnormal proliferation [ 31 ]. This sophisticated regulatory mechanism not only meets the demands of tissue repair but also maintains genomic stability, reflecting the precise regulation of the regeneration process by the organism. The farnesoid X receptor (FXR), a central nuclear receptor in BA metabolism, plays a pivotal role in the synthesis, excretion, and transport of BAs [ 32 , 33 ]. The activation of FXR primarily depends on free BAs and regulates BA metabolism in a tissue-specific manner [ 34 ]. In hepatocytes, FXR negatively regulates BA synthesis by inducing the expression of SHP, which suppresses the transcription of Cyp7a1, the rate-limiting enzyme in the classical BA synthesis pathway. This prevents excessive BA synthesis from exacerbating liver injury [ 28 , 35 , 36 ]. This study found that oral sodium taurocholate after PVL significantly downregulated the mRNA levels of FXR and Cyp7a1 in rat liver tissue while upregulating the expression of SHP. This finding confirms the central role of the FXR-SHP signaling axis in the inhibition of BA synthesis. Hepatocyte polarization is the structural basis for maintaining the directional transport of BAs and hepatic homeostasis. This study reveals the differential regulatory mechanism of BAs on key transporters in polarized hepatocytes. In the non-ligated liver tissue, BAs induce the expression of the apical membrane bile salt export pump (BSEP/ABCB11) and the basolateral membrane organic solute transporters OSTα/OSTβ through the FXR signaling pathway, while simultaneously suppressing the transcription of the sinusoidal sodium taurocholate cotransporting polypeptide (NTCP/SLC10A1). This polarized regulatory pattern reflects a dual protective strategy of hepatocytes in response to BA load: on one hand, promoting BA secretion into the bile canaliculi through BSEP, and on the other hand, enhancing basolateral efflux capacity through OSTα/OSTβ, while the downregulation of NTCP reduces the reuptake of BAs from the sinusoidal side. This regulatory pattern may represent a protective mechanism of the body in response to elevated BA concentrations, and its molecular mechanism may involve FXR-mediated activation of the SHP-dependent pathway (inhibiting NTCP) and direct transcriptional induction of OSTα/OSTβ [ 37 , 38 , 39 , 40 ]. We introduced oral administration of sodium taurocholate after 70% PVL, aiming to accelerate FLR hypertrophy, thereby shortening the waiting time after PVL while avoiding the adverse effects associated with ALPPS and the complex procedure of portal vein and bile duct ligation. Sodium taurocholate is a conjugated BA formed by the amide bond linkage between cholic acid and taurine, and it possesses various important physiological functions in the body. As one of the main components of bile, it not only participates in fat digestion and absorption and the regulation of cholesterol metabolism but also plays a key role in cell signaling, modulating inflammatory responses, and promoting liver regeneration processes [ 16 , 41 , 42 ]. Multiple studies have confirmed that BAs and their derivatives can alleviate inflammatory responses after partial hepatectomy or chemical liver injury by downregulating the expression levels of pro-inflammatory cytokines (such as TNF-α, IL-6, etc.) [ 43 , 44 , 45 , 46 ]. Sodium taurocholate can activate the FXR-mediated BA metabolic pathway and promote liver regeneration after portal vein ligation by regulating the Hippo-YAP/TAZ signaling pathway. These findings provide potential strategies for functional recovery after liver resection or liver transplantation. Furthermore, its synergistic activation with the p53 network suggests that this regulatory mechanism may offer dual safety advantages by promoting liver regeneration while inhibiting carcinogenesis, indicating significant clinical translation potential. This study has several limitations that warrant consideration. First, the species-specific BA composition poses a challenge, as taurocholic acid—a major component in the rat BA pool—is not predominant in humans, indicating that its clinical applicability and drug development require further and thorough evaluation. Second, potential hepatotoxicity was observed, evidenced by elevated transaminase levels in the PVLT group, suggesting a risk of liver injury and highlighting the need for future molecular modifications or structural optimizations of this compound. It is worth noting that although alternative agents such as obeticholic acid (OCA), a potent FXR activator with 100-fold greater efficacy than chenodeoxycholic acid, have been shown to promote liver regeneration in rat models of partial hepatectomy and portal vein embolization, studies in obstructive cholestasis models indicated that OCA exacerbated biliary injury despite enhancing hepatocyte proliferation. Third, fundamental anatomical and regenerative differences between rat and human livers considerably affect the translational relevance of the findings: the rat liver has five independent lobes with limited inter-lobar portal collateral circulation, leading to pronounced hemodynamic redistribution and robust regeneration after PVL, whereas the human liver, divided into Couinaud segments with abundant intersegmental anastomoses, exhibits rapid collateral flow redistribution after PVL, resulting in attenuated hemodynamic stimulation and limited regenerative capacity (typically only 20–30% volume increase). Consequently, modulating the BA pool may exhibit more pronounced efficacy in humans than observed in rat models. Declarations Competing interests All authors declare no conflicts of interest. Funding Authors received no specific funding for this work. Author Contribution X.L.G.: Methodology, Investigation, Writing Original Draft；Y. Z.: Data collection, Analysis and interpretation of results; Y.S.Z: Formal Analysis, Validation, Investigation; K.P.: Investigation; Yuan Zhang: Investigation, Validation; C.H.L.: Writing Review & Editing; W.Z.R.: Supervision, Funding acquisition, Writing Review & Editing. All authors discussed the results and commented on the manuscript. Data Availability The datasets generated and/or analyzed during the current study are available in the SRA repository under accession number PRJNA1328989. These data can be accessed via the following link: https://www.ncbi.nlm.nih.gov/sra/PRJNA1328989. References Zhou, J. et al. Guidelines for the Diagnosis and Treatment of Primary Liver Cancer (2022 Edition). Liver Cancer . 12 (5), 405–444. 10.1159/000530495 (2023). Published 2023 Apr 5. Søreide, J. A. & Deshpande, R. Post hepatectomy liver failure (PHLF) - Recent advances in prevention and clinical management. Eur. J. Surg. Oncol. 47 (2), 216–224. 10.1016/j.ejso.2020.09.001 (2021). Huang, Y. et al. Preoperative Portal Vein Embolization for Liver Resection: An updated meta-analysis. J. Cancer . 12 (6), 1770–1778. 10.7150/jca.50371 (2021). Published 2021 Jan 21. Schnitzbauer, A. A. et al. Right portal vein ligation combined with in situ splitting induces rapid left lateral liver lobe hypertrophy enabling 2-staged extended right hepatic resection in small-for-size settings. Ann. Surg. 255 (3), 405–414. 10.1097/SLA.0b013e31824856f5 (2012). Abulkhir, A. et al. Preoperative portal vein embolization for major liver resection: a meta-analysis. Ann. Surg. 247 (1), 49–57. 10.1097/SLA.0b013e31815f6e5b (2008). Liu, H. & Zhu, S. Present status and future perspectives of preoperative portal vein embolization. Am. J. Surg. 197 (5), 686–690. 10.1016/j.amjsurg.2008.04.022 (2009). Knoefel, W. T. et al. In situ liver transection with portal vein ligation for rapid growth of the future liver remnant in two-stage liver resection. Br. J. Surg. 100 (3), 388–394. 10.1002/bjs.8955 (2013). Torres, O. J. et al. Associating liver partition and portal vein ligation for staged hepatectomy (ALPPS): the Brazilian experience. Arq. Bras. Cir. Dig. 26 (1), 40–43. 10.1590/s0102-67202013000100009 (2013). Nadalin, S. et al. Indications and limits for associating liver partition and portal vein ligation for staged hepatectomy (ALPPS). Lessons Learned from 15 cases at a single centre. Z. Gastroenterol. 52 (1), 35–42. 10.1055/s-0033-1356364 (2014). Røsok, B. I. et al. Scandinavian multicenter study on the safety and feasibility of the associating liver partition and portal vein ligation for staged hepatectomy procedure. Surgery 159 (5), 1279–1286. 10.1016/j.surg.2015.10.004 (2016). Linecker, M. et al. Risk Adjustment in ALPPS Is Associated With a Dramatic Decrease in Early Mortality and Morbidity. Ann. Surg. 266 (5), 779–786. 10.1097/SLA.0000000000002446 (2017). Wanis, K. N. et al. Variation in complications and mortality following ALPPS at early-adopting centers. HPB (Oxford) . 23 (1), 46–55. 10.1016/j.hpb.2020.04.009 (2021). Truant, S. et al. Associating liver partition and portal vein ligation for staged hepatectomy (ALPPS): impact of the inter-stages course on morbi-mortality and implications for management. Eur. J. Surg. Oncol. 41 (5), 674–682. 10.1016/j.ejso.2015.01.004 (2015). Björnsson, B. et al. Associating liver partition and portal vein ligation for staged hepatectomy in patients with colorectal liver metastases–Intermediate oncological results. Eur. J. Surg. Oncol. 4 (4), 531–537. 10.1016/j.ejso.2015.12.013 (2016). Wanis, K. N. et al. Intermediate-term survival and quality of life outcomes in patients with advanced colorectal liver metastases undergoing associating liver partition and portal vein ligation for staged hepatectomy. Surgery 163 (4), 691–697. 10.1016/j.surg.2017.09.044 (2018). Huang, W. et al. Nuclear receptor-dependent bile acid signaling is required for normal liver regeneration. Science 312 (5771), 233–236. 10.1126/science.1121435 (2006). Otao, R. et al. External biliary drainage and liver regeneration after major hepatectomy. Br. J. Surg. 99 (11), 1569–1574. 10.1002/bjs.8906 (2012). Ren, W. et al. Simultaneous bile duct and portal vein ligation induces faster atrophy/hypertrophy complex than portal vein ligation: role of bile acids. Sci. Rep. 5 , 8455. 10.1038/srep08455 (2015). Published 2015 Feb 13. Fu, D., Wakabayashi, Y., Lippincott-Schwartz, J. & Arias, I. M. Bile acid stimulates hepatocyte polarization through a cAMP-Epac-MEK-LKB1-AMPK pathway. Proc. Natl. Acad. Sci. U S A . 108 (4), 1403–1408. 10.1073/pnas.1018376108 (2011). Ikebuchi, Y. et al. Ursodeoxycholic acid stimulates the formation of the bile canalicular network. Biochem. Pharmacol. 84 (7), 925–935. 10.1016/j.bcp.2012.07.008 (2012). Ge, X. L. et al. Bile Acid Overload Induced by Bile Duct and Portal Vein Ligation Improves Survival after Staged Hepatectomy in Rats. Curr. Med. Sci. 43 (5), 1013–1022. 10.1007/s11596-023-2779-5 (2023). Zhang, L. et al. Promotion of liver regeneration/repair by farnesoid X receptor in both liver and intestine in mice. Hepatology 56 (6), 2336–2343. 10.1002/hep.25905 (2012). Keitel, V., Donner, M., Winandy, S., Kubitz, R. & Häussinger, D. Expression and function of the bile acid receptor TGR5 in Kupffer cells. Biochem. Biophys. Res. Commun. 372 (1), 78–84. 10.1016/j.bbrc.2008.04.171 (2008). Merlen, G. et al. Bile acids and their receptors during liver regeneration: Dangerous protectors. Mol. Aspects Med. 56 , 25–33. 10.1016/j.mam.2017.03.002 (2017). Livak, K. J. & Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25 (4), 402–408. 10.1006/meth.2001.1262 (2001). Russell, J. O. & Camargo, F. D. Hippo signalling in the liver: role in development, regeneration and disease. Nat. Rev. Gastroenterol. Hepatol. 19 (5), 297–312. 10.1038/s41575-021-00571-w (2022). Lai, D., Ho, K. C., Hao, Y. & Yang, X. Taxol resistance in breast cancer cells is mediated by the hippo pathway component TAZ and its downstream transcriptional targets Cyr61 and CTGF. Cancer Res. 71 (7), 2728–2738. 10.1158/0008-5472.CAN-10-2711 (2011). Xiao, L., Sun, L., Liu, F. Y., Peng, Y. M. & Duan, S. B. Connective tissue growth factor knockdown attenuated matrix protein production and vascular endothelial growth factor expression induced by transforming growth factor-beta1 in cultured human peritoneal mesothelial cells. Ther. Apher Dial . 14 (1), 27–34. 10.1111/j.1744-9987.2009.00701.x (2010). Jun, J. I. & Lau, L. F. Taking aim at the extracellular matrix: CCN proteins as emerging therapeutic targets. Nat. Rev. Drug Discov . 10 (12), 945–963. 10.1038/nrd3599 (2011). Published 2011 Dec 1. Lu, L. et al. Hippo signaling is a potent in vivo growth and tumor suppressor pathway in the mammalian liver. Proc. Natl. Acad. Sci. U S A . 107 (4), 1437–1442. 10.1073/pnas.0911427107 (2010). Liu, M. & Chen, P. Proliferation–inhibiting pathways in liver regeneration (Review). Mol. Med. Rep. 16 (1), 23–35. 10.3892/mmr.2017.6613 (2017). Chiang, J. Y. Bile acid regulation of gene expression: roles of nuclear hormone receptors. Endocr. Rev. 23 (4), 443–463. 10.1210/er.2000-0035 (2002). Chiang, J. Y. Regulation of bile acid synthesis: pathways, nuclear receptors, and mechanisms. J. Hepatol. 40 (3), 539–551. 10.1016/j.jhep.2003.11.006 (2004). Chen, T. et al. Sphingosine-1 phosphate promotes intestinal epithelial cell proliferation via S1PR2. Front. Biosci. (Landmark Ed) . 22 (4), 596–608. 10.2741/4505 (2017). Published 2017 Jan 1. Xue, R. et al. Bile Acid Receptors and the Gut-Liver Axis in Nonalcoholic Fatty Liver Disease. Cells. ;10(11):2806. Published 2021 Oct 20. (2021). 10.3390/cells10112806 (33)Russell DW. The enzymes, regulation, and genetics of bile acid synthesis. Annu. Rev. Biochem. 72 , 137–174. 10.1146/annurev.biochem.72.121801.161712 (2003). Denson, L. A. et al. The orphan nuclear receptor, shp, mediates bile acid-induced inhibition of the rat bile acid transporter, ntcp. Gastroenterology 121 (1), 140–147. 10.1053/gast.2001.25503 (2001). Ballatori, N., Fang, F., Christian, W. V., Li, N. & Hammond, C. L. Ostalpha-Ostbeta is required for bile acid and conjugated steroid disposition in the intestine, kidney, and liver. Am. J. Physiol. Gastrointest. Liver Physiol. 295 (1), G179–G186. 10.1152/ajpgi.90319.2008 (2008). Frankenberg, T. et al. Regulation of the mouse organic solute transporter alpha-beta, Ostalpha-Ostbeta, by bile acids. Am. J. Physiol. Gastrointest. Liver Physiol. 290 (5), G912–G922. 10.1152/aj gi.00479.2005 (2006). Boyer, J. L. et al. Upregulation of a basolateral FXR-dependent bile acid efflux transporter OSTalpha-OSTbeta in cholestasis in humans and rodents. Am. J. Physiol. Gastrointest. Liver Physiol. 290 (6), G1124–G1130. 10.1152/ajpgi.00539.2005 (2006). Ma, H. & Patti, M. E. Bile acids, obesity, and the metabolic syndrome. Best Pract. Res. Clin. Gastroenterol. 28 (4), 573–583. 10.1016/j.bpg.2014.07.004 (2014). Kren, B. T., Rodrigues, C. M., Setchell, K. D. & Steer, C. J. Modulation of steady-state messenger RNA levels in the regenerating rat liver with bile acid feeding. Liver Transpl. 7 (4), 321–334. 10.1053/jlts.2001.23062 (2001). Chang, S. et al. Taurodeoxycholate Increases the Number of Myeloid-Derived Suppressor Cells That Ameliorate Sepsis in Mice. Front. Immunol. 9 10.3389/fimmu.2018.01984 (2018). Published 2018 Sep 18:1984. Sewnath, M. E., van der Poll, T., van Noorden, C. J., ten Kate, F. J. & Gouma, D. J. Cholestatic interleukin-6-deficient mice succumb to endotoxin-induced liver injury and pulmonary inflammation. Am. J. Respir Crit. Care Med. 169 (3), 413–420. 10.1164/rccm.200303-311OC (2004). Ezure, T. et al. The development and compensation of biliary cirrhosis in interleukin-6-deficient mice. Am. J. Pathol. 156 (5), 1627–1639. 10.1016/S0002-9440(10)65034-1 (2000). Greve, J. W., Gouma, D. J. & Buurman, W. A. Bile acids inhibit endotoxin-induced release of tumor necrosis factor by monocytes: an in vitro study. Hepatology 10 , 454–458. 10.1002/hep.1840100409 (1989). Olthof, P. B. et al. Effect of obeticholic acid on liver regeneration following portal vein embolization in an experimental model. Br. J. Surg. 104 (5), 590–599. 10.1002/bjs.10466 (2017). Van Golen, R. F. et al. FXR agonist obeticholic acid induces liver growth but exacerbates biliary injury in rats with obstructive cholestasis. Sci. Rep. 8 (1), 16529. 10.1038/s41598-018-33070-1 (2018). Published 2018 Nov 8. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 26 Nov, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 08 Oct, 2025 Reviews received at journal 07 Oct, 2025 Reviewers agreed at journal 01 Oct, 2025 Reviews received at journal 26 Sep, 2025 Reviewers agreed at journal 25 Sep, 2025 Reviewers invited by journal 25 Sep, 2025 Editor assigned by journal 25 Sep, 2025 Editor invited by journal 22 Sep, 2025 Submission checks completed at journal 21 Sep, 2025 First submitted to journal 21 Sep, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7588701","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":526072404,"identity":"c6080fad-e2d1-4062-925c-8ea175662870","order_by":0,"name":"Xinlan Ge","email":"","orcid":"","institution":"Chinese PLA General Hospital, Institute of Hepatobiliary Surgery of Chinese PLA","correspondingAuthor":false,"prefix":"","firstName":"Xinlan","middleName":"","lastName":"Ge","suffix":""},{"id":526072406,"identity":"601a76da-75db-4589-aaf5-4fa3661cf1a2","order_by":1,"name":"Yue Zhang","email":"","orcid":"","institution":"Chinese PLA medical school","correspondingAuthor":false,"prefix":"","firstName":"Yue","middleName":"","lastName":"Zhang","suffix":""},{"id":526072408,"identity":"e39dbfa8-f53e-4c97-8170-d9b8587b5780","order_by":2,"name":"Yongsheng Zhao","email":"","orcid":"","institution":"Faculty of Hepato-Pancreato-Biliary Surgery, First Medical Center, Chinese PLA General Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yongsheng","middleName":"","lastName":"Zhao","suffix":""},{"id":526072413,"identity":"53f44e01-6672-4b9d-88ab-992a743abab6","order_by":3,"name":"Ke Pan","email":"","orcid":"","institution":"Chinese PLA General Hospital, Institute of Hepatobiliary Surgery of Chinese PLA","correspondingAuthor":false,"prefix":"","firstName":"Ke","middleName":"","lastName":"Pan","suffix":""},{"id":526072414,"identity":"5efeef44-c753-4562-983b-2120d71a02f8","order_by":4,"name":"Yuan Zhang","email":"","orcid":"","institution":"Chinese PLA General Hospital, Institute of Hepatobiliary Surgery of Chinese PLA","correspondingAuthor":false,"prefix":"","firstName":"Yuan","middleName":"","lastName":"Zhang","suffix":""},{"id":526072416,"identity":"dad532ea-0640-4999-b03b-07c96dd99f2e","order_by":5,"name":"Chonghui Li","email":"","orcid":"","institution":"Chinese PLA General Hospital, Institute of Hepatobiliary Surgery of Chinese PLA","correspondingAuthor":false,"prefix":"","firstName":"Chonghui","middleName":"","lastName":"Li","suffix":""},{"id":526072419,"identity":"20dc2982-dacc-411b-953d-bd25a09a5f75","order_by":6,"name":"Weizheng Ren","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAq0lEQVRIiWNgGAWjYHAC5gcJBjY8/PwNxGthM/hQkCYjOeMACdZIzvhw2MagIYFI5eYz0h8Y8xic5zFgOMD44WMOEVpkbiQkPOYxuM1jztzALDlzGxFaJKQTDhiDtFg2HGBj5iVOS2KDNI/BOR6DAwlEa0kGet/gACla5J8BA9kgmUdyxsFmIv3Cc/zxg4Q/dvb8/M0HP3wkRgsSYGwgTf0oGAWjYBSMAtwAALlyMv6LV2n7AAAAAElFTkSuQmCC","orcid":"","institution":"Faculty of Hepato-Pancreato-Biliary Surgery, First Medical Center, Chinese PLA General Hospital","correspondingAuthor":true,"prefix":"","firstName":"Weizheng","middleName":"","lastName":"Ren","suffix":""}],"badges":[],"createdAt":"2025-09-11 07:08:25","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7588701/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7588701/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-29945-9","type":"published","date":"2025-11-26T15:58:43+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":93029651,"identity":"95f8d43e-40c1-4150-ba62-7f88762e00fb","added_by":"auto","created_at":"2025-10-08 09:59:48","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1053975,"visible":true,"origin":"","legend":"","description":"","filename":"manuscriptrevise2.docx","url":"https://assets-eu.researchsquare.com/files/rs-7588701/v1/6fb78ccb7ca0979420261ee1.docx"},{"id":93028168,"identity":"70080588-1e9e-4cf0-84a2-7788a2a8a92b","added_by":"auto","created_at":"2025-10-08 09:51:48","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8182,"visible":true,"origin":"","legend":"","description":"","filename":"456c7fd0d8da4369b9bb3dff3eaf0033.json","url":"https://assets-eu.researchsquare.com/files/rs-7588701/v1/40d9472b83b94edff5f9bea6.json"},{"id":93028171,"identity":"a74ee433-d0b1-4622-9f4e-5f34f7cecc5c","added_by":"auto","created_at":"2025-10-08 09:51:48","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":113926,"visible":true,"origin":"","legend":"","description":"","filename":"456c7fd0d8da4369b9bb3dff3eaf00331enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7588701/v1/969c23d2017d7b6dc2afe015.xml"},{"id":93028176,"identity":"4d6a442e-f49d-4a99-ada3-50b104e5aab0","added_by":"auto","created_at":"2025-10-08 09:51:48","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":100595,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7588701/v1/afdb4535e120f40ac802a998.jpeg"},{"id":93029652,"identity":"7f50455c-d46e-4b7c-b57c-cf663bb74580","added_by":"auto","created_at":"2025-10-08 09:59:48","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":122437,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7588701/v1/03d59110d3855cc42dcde3f8.png"},{"id":93028177,"identity":"fcdb406b-690e-412d-b9c1-fa7c1d228483","added_by":"auto","created_at":"2025-10-08 09:51:48","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":29608,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7588701/v1/75880c0ffef86183bc6bc19a.png"},{"id":93029660,"identity":"69d4e2eb-1d05-4e20-9d08-2d5499582da9","added_by":"auto","created_at":"2025-10-08 09:59:48","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":30304,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7588701/v1/eae106091017f6cbbcee57c4.png"},{"id":93028174,"identity":"ea26fdd9-1af1-4639-bc7c-e6cef3547972","added_by":"auto","created_at":"2025-10-08 09:51:48","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":51270,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7588701/v1/928abe95000b595ac690fd86.png"},{"id":93029662,"identity":"1c23167b-0374-4b12-b242-909620c39901","added_by":"auto","created_at":"2025-10-08 09:59:48","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":30992,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7588701/v1/0d4c69446a1ab39bf4ebcea5.png"},{"id":93028181,"identity":"74ea6f22-446d-4c13-921c-faa62c79cfd9","added_by":"auto","created_at":"2025-10-08 09:51:48","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":30571,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7588701/v1/90f4f5d5c76de6a0847e38e2.png"},{"id":93028182,"identity":"df8f9620-45c2-4bfb-bb49-9b6899b5ca2b","added_by":"auto","created_at":"2025-10-08 09:51:48","extension":"xml","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":111807,"visible":true,"origin":"","legend":"","description":"","filename":"456c7fd0d8da4369b9bb3dff3eaf00331structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7588701/v1/98b34b3399698d5d1e406f99.xml"},{"id":93029664,"identity":"57178337-a4e3-4e2f-9c04-cdfa11173fb8","added_by":"auto","created_at":"2025-10-08 09:59:48","extension":"html","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":124282,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7588701/v1/e24003ce68cc43d584a15553.html"},{"id":93028165,"identity":"81d3c4c0-6415-4b87-963b-4987be7c165c","added_by":"auto","created_at":"2025-10-08 09:51:48","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":258299,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of liver regeneration between the sodium taurocholate intervention group (PVLT) and the portal vein ligation group (PVLC) in rats. Liver regeneration was evaluated by the liver regeneration rate (A) and KI67 immunohistochemical staining (B, C) in the two groups. The data are presented as mean±SD, vs. PVLC group, ns P\u0026gt;0.05, *P\u0026lt;0.05； **P\u0026lt;0.01；***P\u0026lt;0.001, ****P\u0026lt;0.0001. bar:100um.\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7588701/v1/de6dbe12d9fd11548c39a5de.jpeg"},{"id":93028173,"identity":"0608914f-49aa-4a48-8c03-bb70d5c22fe1","added_by":"auto","created_at":"2025-10-08 09:51:48","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":147376,"visible":true,"origin":"","legend":"\u003cp\u003eComparison of dynamic changes in serum ALT, AST, TBil, TBA levels and hepatic TBA levels at different postoperative time points between the portal vein ligation with sodium taurocholate intervention group and the portal vein ligation alone group in rats. ALT: alanine aminotransferase; AST: aspartate aminotransferase; TBil: Total bilirubin; TBA: total biluric acid. The data are presented as mean±SD, vs. PVLC group, ns P\u0026gt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7588701/v1/2bee8b043ca8fe54c857515b.jpeg"},{"id":93029649,"identity":"695db3f4-6db5-40ec-8d87-3fd28d74e204","added_by":"auto","created_at":"2025-10-08 09:59:48","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":88326,"visible":true,"origin":"","legend":"\u003cp\u003eComparative analysis of differentially expressed genes in liver tissues between sodium taurocholate intervention group and control group rats. (A) Bar plot showing the number of differentially expressed genes between taurocholate-treated and control groups. (B) Volcano plot of differentially expressed genes from bulk RNA-seq analysis between taurocholate-treated and control groups. (C) Top 30 most significantly differentially expressed genes (ranked by FDR value) in liver tissues of taurocholate-treated versus control group rats.\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7588701/v1/0ad1db77025dfcbd936861b6.jpeg"},{"id":93029661,"identity":"dcb38a8d-bba7-4d3a-8d15-1730569ba6b2","added_by":"auto","created_at":"2025-10-08 09:59:48","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":197304,"visible":true,"origin":"","legend":"\u003cp\u003eGO functional analysis and KEGG enrichment analysis of differentially expressed genes in the liver of rats from the taurocholic acid intervention group and the control group. (A) GO enrichment analysis of upregulated genes in the two groups. (B) KEGG enrichment analysis of upregulated genes in the two groups. (C) GSEA analysis of differentially expressed genes in the two groups. (D) GSEA for the Hippo signaling pathway.\u003c/p\u003e","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7588701/v1/ade33b6b4b5ac0a2db711823.jpeg"},{"id":93029654,"identity":"8f2ee94a-7176-4ee1-85b3-0f91c1a9bf39","added_by":"auto","created_at":"2025-10-08 09:59:48","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":150053,"visible":true,"origin":"","legend":"\u003cp\u003eThe effect of sodium taurocholate on the expression of BA metabolism-related genes. The mRNA expression levels of FXR, CYP7A1, SHP, NTCP, OSTβ, and BSEP in the non-ligated liver of rats from the PVLT and PVLC groups were detected by qPCR. FXR: farnesoid X receptor; CYP7A1: Cytochrome P450 Family 7 Subfamily A Member 1; SHP: Small Heterodimer Partner; NTCP: normal tissue complication probability ; OSTβ: organic solute transporter beta; BSEP: Bile Salt Export Pump. The data are presented as mean ± SD, vs. PVLC group, ns P\u0026gt;0.05, *P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7588701/v1/55eab55ac96bf1ec17aacff8.jpeg"},{"id":93028169,"identity":"83b9cfd7-aa34-4993-9442-7dfcc82e28d1","added_by":"auto","created_at":"2025-10-08 09:51:48","extension":"jpeg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":141553,"visible":true,"origin":"","legend":"\u003cp\u003eSodium taurocholate modulates Hippo-YAP/TAZ signaling pathway gene expression. Comparative analysis of key Hippo signaling pathway gene expression differences between sodium taurocholate-treated and control groups at 2 days post-operation, based on transcriptome sequencing data. LATS1: Large Tumor Suppressor Kinase 1; LATS2: Large Tumor Suppressor Kinase 2; MST1: Macrophage Stimulating 1; Sav1: Salvador Homolog 1; Mob1a: Mps one binder kinase activator-like 1A; Tead2: Transcriptional Enhanced Associate Domain 2; CYR61: Cysteine-Rich Angiogenic Inducer 61; CTGF: Connective Tissue Growth Factor; Ccnd1: Cyclin D1; HNF4α: Hepatocyte Nuclear Factor 4 Alpha. The data are presented as mean ± SD, vs. PVLC group, *P\u0026lt;0.05, **P\u0026lt;0.01, ***P\u0026lt;0.001, ****P\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7588701/v1/97b0eca1091188afc3b87614.jpeg"},{"id":97179244,"identity":"e8b50fb9-86f5-4db9-843b-f945d5bb9ee7","added_by":"auto","created_at":"2025-12-01 16:14:21","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1844640,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7588701/v1/03714533-c653-437e-8060-83741e0608a9.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Sodium Taurocholate Promotes Liver Regeneration after Portal Vein Ligation in Rats","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe standard treatment for liver tumors remains surgical resection [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. However, in cases requiring extensive resection, an insufficient future liver remnant (FLR) may lead to postoperative liver failure [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Currently, preoperative portal vein embolization (PVE) or associating liver partition and portal vein ligation for staged hepatectomy (ALPPS) are primarily used in clinical practice to promote FLR hypertrophy [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. PVE has limitations such as a long waiting period (2–8 weeks) and limited resection rates (approximately 70%), and it may potentially accelerate hepatocellular carcinoma progression due to compensatory increase in hepatic arterial flow secondary to reduced portal venous flow [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eALPPS can significantly increase future liver remnant (FLR) volume by 70%-80% within a short period [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], yet it remains controversial. The incidence of postoperative complications ranges from 3% to 66.7%, with a 90-day mortality rate as high as 2.8%-28.7% [\u003cspan additionalcitationids=\"CR9 CR10 CR11\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e–\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Its indications are limited, as it is not suitable for patients with cirrhosis, those over 60 years of age with colorectal cancer liver metastases, or those requiring massive blood transfusion/prolonged surgery[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Furthermore, although preliminary studies suggest favorable short-term outcomes of ALPPS in patients with colorectal cancer liver metastases [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], evidence regarding long-term prognosis remains insufficient and requires validation through large-sample studies.\u003c/p\u003e\u003cp\u003eStudies have demonstrated that bile acids (BAs) play a crucial role in regulating liver regeneration and cellular proliferation. Animal experiments [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e] revealed that feeding wild-type mice with 0.2% cholic acid for 5 days resulted in approximately 30% increase in liver weight and enhanced DNA synthesis activity, confirming that appropriate BA supplementation can directly stimulate hepatocyte proliferation. In hepatectomy models, the regeneration rate and number of BrdU-positive cells were higher in the cholic acid group compared to the cholestyramine group (an anion exchange resin), where reduced BA absorption inhibited regeneration [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. This finding was further validated in clinical studies, where patients without biliary drainage after hemihepatectomy showed higher serum BA levels and significantly greater regenerative volume than the drainage group (with BA loss), indicating a positive correlation between serum BA levels and regeneration extent [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eBAs not only stimulate hepatocyte proliferation but also promote hepatocyte polarization, thereby accelerating the restoration of structural and functional polarity in the liver [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. They can stimulate the formation of bile canaliculi networks and promote hepatocyte polarization through the cAMP-Epac-MEK-LKB1-AMPK signaling pathway, facilitating liver injury repair [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Our previous study demonstrated that compared to portal vein ligation alone, combined portal vein and bile duct ligation rapidly elevated BA concentrations and significantly improved survival rates in rats undergoing 90% hepatectomy. This mechanism may be associated with increased intrahepatic bile salt concentration resulting from biliary obstruction [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eSodium taurocholate (NaTC), as the primary component of the BA pool in rats, regulates BA metabolism, inflammatory responses, and proliferative pathways through FXR and TGR5 receptors, thereby influencing liver regeneration [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. We hypothesize that combined administration of bile salts with portal vein ligation may accelerate the hypertrophy of the future liver remnant and reduce the waiting period. This study investigates the promotive effects of oral NaTC intervention following PVL on liver regeneration, with particular focus on elucidating its underlying molecular mechanisms.\u003c/p\u003e"},{"header":"1. Methods","content":"\u003ch3\u003eAnimal model\u003c/h3\u003e\u003cp\u003eMale Wistar rats weighing 230–270 grams were used for this study, provided by Beijing Vital River Laboratory Animal Technology Co., Ltd. The experimental protocol was approved by the Animal Experiment Ethics Committee of the Chinese PLA General Hospital (Approval No. : 2017-X13-65) and strictly adhered to the National Institutes of Health Guide for the Care and Use of Laboratory Animals. All rats were fasted for 12 hours before the experiment and then randomly divided into two groups: the portal vein ligation control group (PVLC, n = 40), which underwent 70% portal vein ligation (ligating the left and median hepatic lobe portal vein branches) and was fed a standard diet; and the portal vein ligation treatment group (PVLT, n = 40), which underwent the same surgical procedure and was fed a diet containing 0.5% sodium taurocholate (by mass). Both groups were observed at five time points (1, 2, 3, 5, and 7 days post-surgery), with 8 rats per time point.\u003c/p\u003e\u003ch2\u003eSample collection\u003c/h2\u003e\u003cp\u003eRats were anesthetized with 1.5% isoflurane, and their body weight was measured after anesthesia. A midline incision was made to open the abdominal cavity. Blood was collected from the inferior vena cava using a 5 ml syringe, centrifuged at 3000 rpm for 10 minutes, and the serum was aliquoted and stored at -80°C. The liver tissues from both the non-ligated and ligated sides of the rats were weighed. One portion of the liver tissue was rapidly frozen in liquid nitrogen and transferred to a -80°C freezer for storage, while another portion was fixed in 10% buffered formalin and embedded in paraffin blocks for storage at room temperature. Finally, the rats were euthanized by exsanguination.\u003c/p\u003e\u003ch3\u003eTranscriptome sequencing and bioinformatics analysis\u003c/h3\u003e\u003cp\u003eFrozen liver tissue samples from sodium taurocholate-treated and control rats at 2 days post-operation were collected and sent to Guangzhou Gidio Biotechnology Co., Ltd. (China) for Bulk RNA-seq sequencing. Raw sequencing data underwent quality control (Q30 \u0026gt; 90%), alignment (reference genome: Rnor_6.0), and gene quantification (FPKM). Differential expression analysis was performed using DESeq2 software (v1.30.1) with screening thresholds set at |log2FoldChange| \u0026gt;1 and FDR-adjusted P \u0026lt; 0.05.\u003c/p\u003e\u003cp\u003eSignificantly differentially expressed genes (DEGs) were subjected to functional annotation analysis: Gene Ontology (GO) enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses were conducted using the ClusterProfiler R package (v4.0.5), with significance thresholds set at P \u0026lt; 0.05 and false discovery rate (FDR) \u0026lt; 0.05. Enrichment results were visualized using ggplot2 (v3.3.5).\u003c/p\u003e\u003ch3\u003eHepatic and serum BA, Serum biochemical Test, and Liver regeneration rate\u003c/h3\u003e\u003cp\u003eHepatic BAs were extracted as described[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Liver BA levels and serum parameters were measured using a biochemical analyzer (Chemray 800, Rayto, China). Body weight was measured after anesthesia, and total liver weight was estimated based on body weight. The liver regeneration rate was calculated as the ratio of the non-ligated liver lobe weight to the total liver weight.\u003c/p\u003e\u003ch3\u003eImmunohistochemical Staining\u003c/h3\u003e\u003cp\u003eLiver tissues fixed in 10% neutral formalin were paraffin-embedded and sectioned into 5-µm thick slices. Immunohistochemical staining was performed on the tissue sections using mouse monoclonal antibody KI67 (1:50, BD Pharmingen, USA) and a two-step detection kit (Cat.#PV9002, ZSGB-BIO, China). Ten random fields of view (400x magnification) were selected for each sample, and the KI67 labeling index was calculated as the percentage of KI67-positive hepatocytes relative to the total number of hepatocytes.\u003c/p\u003e\u003ch3\u003eReal-time fluorescence quantitative PCR analysis\u003c/h3\u003e\u003cp\u003eTotal RNA was isolated from 70 mg of frozen liver tissue with the RNA Simple Total RNA Kit (Cat. #DP419, Tiangen Biotech, China) according to the manufacturer's instructions. Then, 4 µg of RNA was reverse transcribed using the RevertAid First Strand cDNA Synthesis Kit (Cat. #K1622, Thermo Scientific, Lithuania) as per the provided protocol. Quantitative real-time PCR was performed on the StepOnePlus Real-Time PCR System (Applied Biosystems, CA, USA) using the TB Green Premix Ex Taq™ (Tli RNaseH Plus) Kit (Cat. #RR420A, TaKaRa Bio Inc., Japan) in accordance with the manufacturer's procedures. Relative gene expression levels were normalized to GAPDH expression and calculated using the 2^(–ΔΔCT) method [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], expressed as fold changes relative to the control group. Gene primer sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cdiv class=\"gridtable\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimer sequences for quantitative real-time PCR gene amplification\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"3\"\u003e\u003c/colgroup\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward Primer\u0026nbsp;5'-3'\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eReverse Primer 5'-3'\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGAPDH\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eACCACAGTCCATGCCATCAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTCCACCACCCTGTTGCTGTA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eFXR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGTGACAAAGAAGCCGCGAAT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eGCAGGTGAGCGCGTTGTAAT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCYP7A1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCTTTACAGAGTGCTGGCCAA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCTGTCTAGTACCGGCAGGTCATT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBSEP\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCACTGGGTACATGTGGTGTCTCAT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eATGGCCAATATTCATAGCTGCTAAT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eNTCP\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCGTTGCCGGAATGTTTGTCT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTGCCCTTCTGTCTCAGTTCATG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eOSTβ\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTATTCCATCCTGGTTCTGGCAGT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eCGTTGTCTTGTGGCTGCTTCTT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSHP\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCCTCTTCAACCCAGATGTGCC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAAGCCATGAGGAGGATTCGG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/table\u003e\u003c/div\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eThis study utilized GraphPad Prism 8 and SPSS software (version 25.0) for statistical analysis, with all numerical data expressed as mean ± standard deviation. Differences between the taurocholic acid treatment group and the control group were compared using the t-test, with a significance level set at P \u0026lt; 0.05.\u003c/p\u003e\u003cp\u003e\u003cb\u003eThis study is reported in accordance with the ARRIVE guidelines.\u003c/b\u003e\u003c/p\u003e"},{"header":"2. Results","content":"\u003ch3\u003eEffect of Sodium Taurocholate on Liver Regeneration in Portal Vein-Ligated Rats\u003c/h3\u003e\u003cp\u003eThe ratio of non-ligated liver weight to total liver weight (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA) indicated that the liver regeneration rate in both the PVLT and PVLC groups increased gradually over time at various postoperative time points. On postoperative days 2, 3, 5, and 7, the liver regeneration rate in the sodium taurocholate group was significantly higher than that in the control group (P \u0026lt; 0.05).\u003c/p\u003e\u003cp\u003eImmunohistochemical staining results of the cell proliferation marker Ki67 (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC) revealed that the expression of Ki67 protein in the non-ligated liver tissue gradually increased on postoperative days 1 and 2, peaked on day 2, and then gradually decreased on days 3, 5, and 7. Compared to the PVLC group, the expression level of Ki67 in the sodium taurocholate group was significantly higher on postoperative days 1, 2, 3, 5, and 7 (P \u0026lt; 0.05). Taken together, these results indicate that sodium taurocholate promotes the regeneration of the non-ligated liver in rats following PVL.\u003c/p\u003e\u003ch3\u003eEffects of Sodium Taurocholate on BA Metabolism and Liver Function\u003c/h3\u003e\u003cp\u003eAs shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, one day after portal vein ligation, the levels of BAs (TBA) in the PVLT group were significantly elevated. The serum TBA concentration was 174.8 ± 22.4µmol/L, the TBA concentration in the ligated liver tissue was 217 ± 15.31µmol/L, and the TBA concentration in the non-ligated liver tissue was as high as 445 ± 44.02 µmol/L. The serum and liver TBA levels in the PVLT group were significantly higher than those in the PVLC group (P \u0026lt; 0.05).\u003c/p\u003e\u003cp\u003eIn both PVLC and PVLT groups, ALT levels peaked on the second day after surgery, AST levels peaked on the first day after surgery, and TBil levels peaked on the third day after surgery. Over the seven days following surgery, the ALT, AST, and TBil levels in the PVLT group were significantly higher than those in the PVLC group (P \u0026lt; 0.05). In summary, sodium taurocholate treatment increased BA levels in rats with PVL, accompanied by a sustained elevation in liver function indicators (ALT, AST, TBil). The increase in liver injury markers may partially be attributed to the accelerated atrophy of the ligated liver tissue.\u003c/p\u003e\u003ch2\u003eEffects of Sodium Taurocholate on the Gene Expression Profile in Rat Liver\u003c/h2\u003e\u003cp\u003eTranscriptome sequencing analysis was performed on liver tissues collected from the PVLT and PVLC groups two days after surgery. A total of 1,060 differentially expressed genes were identified between the two groups (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB), among which 711 genes were up-regulated and 349 genes were down-regulated. A heatmap of the top 30 differentially expressed genes with the highest FDR values is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC. These genes may play critical roles in the rat liver's response to sodium taurocholate treatment.\u003c/p\u003e\u003ch2\u003eFunctional Enrichment Analysis of Differentially Expressed Genes\u003c/h2\u003e\u003cp\u003eGene Ontology (GO) enrichment analysis of these differentially expressed genes revealed that the up-regulated genes in the liver tissues of the PVLT group were significantly enriched in several key biological pathways (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). The most prominently enriched pathways included: cell differentiation, cellular development, and positive regulation of biological processes and cellular processes. These results suggest that sodium taurocholate may promote liver tissue regeneration and repair by modulating these critical biological processes.\u003c/p\u003e\u003cp\u003eKEGG pathway enrichment analysis identified the bile secretion pathway as the most significantly enriched pathway among the up-regulated genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). This pathway involved 13 significantly up-regulated genes, including Atp1b1, Atp1a2, Abcc3, Abcb11 (BSEP, Bile Salt Export Pump), Abcb1b, Abcb4, Slc4a4, Slc4a5, Slc51b (OSTβ, Organic Solute Transporter β-subunit), Ephx1, and Nr0b2 (SHP, Small Heterodimer Partner), comprehensively promoting BA transport and secretion.\u003c/p\u003e\u003cp\u003eGiven that KEGG enrichment analysis highlighted the bile secretion pathway as the most significantly enriched, we further quantified the expression levels of BA metabolism-related genes in the non-ligated liver tissue using real-time quantitative PCR. These genes included farnesoid X receptor (FXR), cytochrome P450 family 7 subfamily A member 1 (Cyp7a1), Small Heterodimer Partner (SHP), Na(+)-bile acid cotransporter (NTCP), bile salt export pump (BSEP), and organic solute transporter beta (OSTβ). After sodium taurocholate intervention, the PVLT group exhibited significant activation of the BA metabolic pathway. Specifically, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e, compared to the PVLC group, the expression levels of FXR and Cyp7a1 were significantly reduced at all postoperative time points in the PVLT group (P \u0026lt; 0.05), while the expression levels of SHP were markedly up-regulated (P \u0026lt; 0.05). These findings demonstrate that elevated BA levels activate FXR, which subsequently induces the expression of its downstream target gene SHP. The upregulation of SHP inhibits Cyp7a1 transcription, consistent with the fact that the classical BA synthesis pathway is subject to negative feedback regulation. Notably, the gene expression levels of the BA efflux transporters BSEP and OSTβ were significantly up-regulated in the experimental group (P \u0026lt; 0.05), while the sodium-taurocholate co-transporting polypeptide (NTCP) was significantly down-regulated (P \u0026lt; 0.05). These patterns indicate that sodium taurocholate may activate the FXR signaling pathway, thereby inhibiting Cyp7a1-mediated BA synthesis while enhancing BSEP/OSTβ-mediated BA efflux mechanisms, ultimately forming a positive regulatory network that promotes BA metabolism.\u003c/p\u003e\u003ch2\u003eRegulatory Effects of Sodium Taurocholate on the Hippo-YAP/TAZ Signaling Pathway\u003c/h2\u003e\u003cp\u003eBased on KEGG and GSEA analyses indicating significant enrichment of the Hippo pathway (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC, \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD), we further investigated changes in its key molecules (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). In the PVLT group, the expression of upstream kinases MST1 and LATS1/2 was significantly downregulated (P \u0026lt; 0.05), while the expression of regulatory factors SAV1, MOB1, and the transcription factor Tead2 was significantly upregulated (P \u0026lt; 0.05). Although the expression levels of YAP/TAZ showed no significant change (P \u0026gt; 0.05), their downstream target genes Cyclin D1, CYR61, and CTGF were significantly highly expressed (P \u0026lt; 0.05). These results suggest that sodium taurocholate may inhibit MST1/LATS1/2 kinase activity, coordinately upregulate the SAV1-MOB1 complex and Tead2, and promote the transcription of YAP/TAZ downstream target genes, indicating activation of the Hippo pathway. The functional activation of YAP/TAZ may be related to post-translational modifications or nuclear translocation rather than changes in total protein levels.\u003c/p\u003e\u003cp\u003eFurthermore, we found that after sodium taurocholate treatment, the expression level of the liver-specific transcription factor HNF4α was significantly increased (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e), suggesting that hepatocytes may have entered an active proliferation phase 48 hours after surgery.\u003c/p\u003e\u003cp\u003eIn summary, this study reveals a novel mechanism by which sodium taurocholate promotes liver regeneration through a dual regulatory network: on one hand, it regulates BA metabolic homeostasis to reduce intrahepatic toxic injury; on the other hand, it activates the Hippo signaling pathway to drive cell proliferation and tissue repair programs. These two pathways form a synergistic model of metabolic clearance and regeneration activation, highlighting the biological characteristics of BA metabolites in multi-dimensional regulation of liver self-repair and providing new therapeutic targets for impaired liver regeneration.\u003c/p\u003e"},{"header":"3. Discussion","content":"\u003cp\u003eThis study found that the combination of 70% PVL and oral sodium taurocholate significantly promoted the liver regeneration process, as evidenced by a markedly increased regeneration rate in the non-ligated liver lobe, enhanced Ki67 protein expression, and a substantial expansion of the future liver remnant volume. Ki67 protein expression in the non-ligated liver tissue peaked at 48 hours post-surgery, which was therefore selected as the time point for Bulk-RNA sequencing analysis. Functional annotation analysis of the differentially expressed genes (GO, KEGG, and GSEA) revealed that the up-regulated genes were primarily involved in biological processes such as the regulation of BA secretion and the Hippo signaling pathway.\u003c/p\u003e\u003cp\u003eThe Hippo signaling pathway is a critical regulator of organ size and tissue homeostasis. Its upstream components are mediated by MST1/2 and LATS1/2 kinases. When this pathway is inactivated, the effector molecules YAP/TAZ undergo dephosphorylation and translocate into the nucleus, where they bind to transcription factors such as TEAD, thereby activating the transcription of downstream target genes [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Our experimental data demonstrated that oral sodium taurocholate after PVL significantly downregulated the expression of LATS1/2 and MST1, while upregulating the expression levels of SAV1 and MOB1, indicating effective activation of the Hippo-YAP/TAZ signaling pathway. Furthermore, this study confirmed that oral sodium taurocholate after PVL significantly upregulated the expression of classical downstream target genes of the Hippo-YAP/TAZ pathway, including CTGF (CCN2) and CYR61 (CCN1). The promoter/enhancer regions of these genes contain multiple TEAD binding sites, and their transcriptional activity is directly regulated by Hippo-YAP/TAZ [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. CTGF is involved in extracellular matrix remodeling, while CYR61, a secreted matricellular protein, plays a crucial role in angiogenesis and tissue repair [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Additionally, the expression level of CCND1, a key regulator of the cell cycle, was significantly upregulated in the sodium taurocholate treatment group, further illustrating the activating effect of sodium taurocholate on downstream transcription factors of the Hippo-YAP/TAZ pathway [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. These findings suggest that oral sodium taurocholate may promote hepatocyte proliferation after PVL by activating the Hippo-YAP/TAZ signaling pathway, thereby positively influencing the expansion of the future liver remnant volume.\u003c/p\u003e\u003cp\u003eKEGG pathway enrichment analysis revealed that the p53 signaling pathway was significantly enriched (ranked 5th) in the PVLT group. This finding suggests that while promoting liver regeneration, the body may activate a tumor suppressor gene network to maintain the proliferation-inhibition balance, thereby preventing the risk of carcinogenesis caused by abnormal proliferation [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. This sophisticated regulatory mechanism not only meets the demands of tissue repair but also maintains genomic stability, reflecting the precise regulation of the regeneration process by the organism.\u003c/p\u003e\u003cp\u003eThe farnesoid X receptor (FXR), a central nuclear receptor in BA metabolism, plays a pivotal role in the synthesis, excretion, and transport of BAs [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. The activation of FXR primarily depends on free BAs and regulates BA metabolism in a tissue-specific manner [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. In hepatocytes, FXR negatively regulates BA synthesis by inducing the expression of SHP, which suppresses the transcription of Cyp7a1, the rate-limiting enzyme in the classical BA synthesis pathway. This prevents excessive BA synthesis from exacerbating liver injury [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. This study found that oral sodium taurocholate after PVL significantly downregulated the mRNA levels of FXR and Cyp7a1 in rat liver tissue while upregulating the expression of SHP. This finding confirms the central role of the FXR-SHP signaling axis in the inhibition of BA synthesis.\u003c/p\u003e\u003cp\u003eHepatocyte polarization is the structural basis for maintaining the directional transport of BAs and hepatic homeostasis. This study reveals the differential regulatory mechanism of BAs on key transporters in polarized hepatocytes. In the non-ligated liver tissue, BAs induce the expression of the apical membrane bile salt export pump (BSEP/ABCB11) and the basolateral membrane organic solute transporters OSTα/OSTβ through the FXR signaling pathway, while simultaneously suppressing the transcription of the sinusoidal sodium taurocholate cotransporting polypeptide (NTCP/SLC10A1). This polarized regulatory pattern reflects a dual protective strategy of hepatocytes in response to BA load: on one hand, promoting BA secretion into the bile canaliculi through BSEP, and on the other hand, enhancing basolateral efflux capacity through OSTα/OSTβ, while the downregulation of NTCP reduces the reuptake of BAs from the sinusoidal side. This regulatory pattern may represent a protective mechanism of the body in response to elevated BA concentrations, and its molecular mechanism may involve FXR-mediated activation of the SHP-dependent pathway (inhibiting NTCP) and direct transcriptional induction of OSTα/OSTβ [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eWe introduced oral administration of sodium taurocholate after 70% PVL, aiming to accelerate FLR hypertrophy, thereby shortening the waiting time after PVL while avoiding the adverse effects associated with ALPPS and the complex procedure of portal vein and bile duct ligation. Sodium taurocholate is a conjugated BA formed by the amide bond linkage between cholic acid and taurine, and it possesses various important physiological functions in the body. As one of the main components of bile, it not only participates in fat digestion and absorption and the regulation of cholesterol metabolism but also plays a key role in cell signaling, modulating inflammatory responses, and promoting liver regeneration processes [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Multiple studies have confirmed that BAs and their derivatives can alleviate inflammatory responses after partial hepatectomy or chemical liver injury by downregulating the expression levels of pro-inflammatory cytokines (such as TNF-α, IL-6, etc.) [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Sodium taurocholate can activate the FXR-mediated BA metabolic pathway and promote liver regeneration after portal vein ligation by regulating the Hippo-YAP/TAZ signaling pathway. These findings provide potential strategies for functional recovery after liver resection or liver transplantation. Furthermore, its synergistic activation with the p53 network suggests that this regulatory mechanism may offer dual safety advantages by promoting liver regeneration while inhibiting carcinogenesis, indicating significant clinical translation potential.\u003c/p\u003e\u003cp\u003eThis study has several limitations that warrant consideration. First, the species-specific BA composition poses a challenge, as taurocholic acid—a major component in the rat BA pool—is not predominant in humans, indicating that its clinical applicability and drug development require further and thorough evaluation. Second, potential hepatotoxicity was observed, evidenced by elevated transaminase levels in the PVLT group, suggesting a risk of liver injury and highlighting the need for future molecular modifications or structural optimizations of this compound. It is worth noting that although alternative agents such as obeticholic acid (OCA), a potent FXR activator with 100-fold greater efficacy than chenodeoxycholic acid, have been shown to promote liver regeneration in rat models of partial hepatectomy and portal vein embolization, studies in obstructive cholestasis models indicated that OCA exacerbated biliary injury despite enhancing hepatocyte proliferation. Third, fundamental anatomical and regenerative differences between rat and human livers considerably affect the translational relevance of the findings: the rat liver has five independent lobes with limited inter-lobar portal collateral circulation, leading to pronounced hemodynamic redistribution and robust regeneration after PVL, whereas the human liver, divided into Couinaud segments with abundant intersegmental anastomoses, exhibits rapid collateral flow redistribution after PVL, resulting in attenuated hemodynamic stimulation and limited regenerative capacity (typically only 20–30% volume increase). Consequently, modulating the BA pool may exhibit more pronounced efficacy in humans than observed in rat models.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003ch2\u003eCompeting interests\u003c/h2\u003e\u003cp\u003eAll authors declare no conflicts of interest.\u003c/p\u003e\u003c/p\u003e\u003cp\u003eFunding\u003c/p\u003e\n\u003cp\u003eAuthors received no specific funding for this work.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eX.L.G.: Methodology, Investigation, Writing Original Draft；Y. Z.: Data collection, Analysis and interpretation of results; Y.S.Z: Formal Analysis, Validation, Investigation; K.P.: Investigation; Yuan Zhang: Investigation, Validation; C.H.L.: Writing Review \u0026amp; Editing; W.Z.R.: Supervision, Funding acquisition, Writing Review \u0026amp; Editing. All authors discussed the results and commented on the manuscript.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe datasets generated and/or analyzed during the current study are available in the SRA repository under accession number PRJNA1328989. These data can be accessed via the following link: https://www.ncbi.nlm.nih.gov/sra/PRJNA1328989.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eZhou, J. et al. Guidelines for the Diagnosis and Treatment of Primary Liver Cancer (2022 Edition). \u003cem\u003eLiver Cancer\u003c/em\u003e. \u003cb\u003e12\u003c/b\u003e (5), 405\u0026ndash;444. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1159/000530495\u003c/span\u003e\u003cspan address=\"10.1159/000530495\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023). Published 2023 Apr 5.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eS\u0026oslash;reide, J. A. \u0026amp; Deshpande, R. Post hepatectomy liver failure (PHLF) - Recent advances in prevention and clinical management. \u003cem\u003eEur. J. Surg. Oncol.\u003c/em\u003e \u003cb\u003e47\u003c/b\u003e (2), 216\u0026ndash;224. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ejso.2020.09.001\u003c/span\u003e\u003cspan address=\"10.1016/j.ejso.2020.09.001\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHuang, Y. et al. Preoperative Portal Vein Embolization for Liver Resection: An updated meta-analysis. \u003cem\u003eJ. Cancer\u003c/em\u003e. \u003cb\u003e12\u003c/b\u003e (6), 1770\u0026ndash;1778. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.7150/jca.50371\u003c/span\u003e\u003cspan address=\"10.7150/jca.50371\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021). Published 2021 Jan 21.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSchnitzbauer, A. A. et al. Right portal vein ligation combined with in situ splitting induces rapid left lateral liver lobe hypertrophy enabling 2-staged extended right hepatic resection in small-for-size settings. \u003cem\u003eAnn. Surg.\u003c/em\u003e \u003cb\u003e255\u003c/b\u003e (3), 405\u0026ndash;414. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1097/SLA.0b013e31824856f5\u003c/span\u003e\u003cspan address=\"10.1097/SLA.0b013e31824856f5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2012).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAbulkhir, A. et al. Preoperative portal vein embolization for major liver resection: a meta-analysis. \u003cem\u003eAnn. Surg.\u003c/em\u003e \u003cb\u003e247\u003c/b\u003e (1), 49\u0026ndash;57. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1097/SLA.0b013e31815f6e5b\u003c/span\u003e\u003cspan address=\"10.1097/SLA.0b013e31815f6e5b\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2008).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu, H. \u0026amp; Zhu, S. Present status and future perspectives of preoperative portal vein embolization. \u003cem\u003eAm. J. Surg.\u003c/em\u003e \u003cb\u003e197\u003c/b\u003e (5), 686\u0026ndash;690. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.amjsurg.2008.04.022\u003c/span\u003e\u003cspan address=\"10.1016/j.amjsurg.2008.04.022\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2009).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKnoefel, W. T. et al. In situ liver transection with portal vein ligation for rapid growth of the future liver remnant in two-stage liver resection. \u003cem\u003eBr. J. Surg.\u003c/em\u003e \u003cb\u003e100\u003c/b\u003e (3), 388\u0026ndash;394. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/bjs.8955\u003c/span\u003e\u003cspan address=\"10.1002/bjs.8955\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTorres, O. J. et al. Associating liver partition and portal vein ligation for staged hepatectomy (ALPPS): the Brazilian experience. \u003cem\u003eArq. Bras. Cir. Dig.\u003c/em\u003e \u003cb\u003e26\u003c/b\u003e (1), 40\u0026ndash;43. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1590/s0102-67202013000100009\u003c/span\u003e\u003cspan address=\"10.1590/s0102-67202013000100009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2013).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNadalin, S. et al. Indications and limits for associating liver partition and portal vein ligation for staged hepatectomy (ALPPS). Lessons Learned from 15 cases at a single centre. \u003cem\u003eZ. Gastroenterol.\u003c/em\u003e \u003cb\u003e52\u003c/b\u003e (1), 35\u0026ndash;42. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1055/s-0033-1356364\u003c/span\u003e\u003cspan address=\"10.1055/s-0033-1356364\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eR\u0026oslash;sok, B. I. et al. Scandinavian multicenter study on the safety and feasibility of the associating liver partition and portal vein ligation for staged hepatectomy procedure. \u003cem\u003eSurgery\u003c/em\u003e \u003cb\u003e159\u003c/b\u003e (5), 1279\u0026ndash;1286. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.surg.2015.10.004\u003c/span\u003e\u003cspan address=\"10.1016/j.surg.2015.10.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLinecker, M. et al. Risk Adjustment in ALPPS Is Associated With a Dramatic Decrease in Early Mortality and Morbidity. \u003cem\u003eAnn. Surg.\u003c/em\u003e \u003cb\u003e266\u003c/b\u003e (5), 779\u0026ndash;786. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1097/SLA.0000000000002446\u003c/span\u003e\u003cspan address=\"10.1097/SLA.0000000000002446\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWanis, K. N. et al. Variation in complications and mortality following ALPPS at early-adopting centers. \u003cem\u003eHPB (Oxford)\u003c/em\u003e. \u003cb\u003e23\u003c/b\u003e (1), 46\u0026ndash;55. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.hpb.2020.04.009\u003c/span\u003e\u003cspan address=\"10.1016/j.hpb.2020.04.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2021).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTruant, S. et al. Associating liver partition and portal vein ligation for staged hepatectomy (ALPPS): impact of the inter-stages course on morbi-mortality and implications for management. \u003cem\u003eEur. J. Surg. Oncol.\u003c/em\u003e \u003cb\u003e41\u003c/b\u003e (5), 674\u0026ndash;682. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ejso.2015.01.004\u003c/span\u003e\u003cspan address=\"10.1016/j.ejso.2015.01.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2015).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBj\u0026ouml;rnsson, B. et al. Associating liver partition and portal vein ligation for staged hepatectomy in patients with colorectal liver metastases\u0026ndash;Intermediate oncological results. \u003cem\u003eEur. J. Surg. Oncol.\u003c/em\u003e \u003cb\u003e4\u003c/b\u003e (4), 531\u0026ndash;537. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.ejso.2015.12.013\u003c/span\u003e\u003cspan address=\"10.1016/j.ejso.2015.12.013\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2016).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWanis, K. N. et al. Intermediate-term survival and quality of life outcomes in patients with advanced colorectal liver metastases undergoing associating liver partition and portal vein ligation for staged hepatectomy. \u003cem\u003eSurgery\u003c/em\u003e \u003cb\u003e163\u003c/b\u003e (4), 691\u0026ndash;697. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.surg.2017.09.044\u003c/span\u003e\u003cspan address=\"10.1016/j.surg.2017.09.044\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHuang, W. et al. Nuclear receptor-dependent bile acid signaling is required for normal liver regeneration. \u003cem\u003eScience\u003c/em\u003e \u003cb\u003e312\u003c/b\u003e (5771), 233\u0026ndash;236. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1126/science.1121435\u003c/span\u003e\u003cspan address=\"10.1126/science.1121435\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2006).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOtao, R. et al. External biliary drainage and liver regeneration after major hepatectomy. \u003cem\u003eBr. J. Surg.\u003c/em\u003e \u003cb\u003e99\u003c/b\u003e (11), 1569\u0026ndash;1574. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/bjs.8906\u003c/span\u003e\u003cspan address=\"10.1002/bjs.8906\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2012).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRen, W. et al. Simultaneous bile duct and portal vein ligation induces faster atrophy/hypertrophy complex than portal vein ligation: role of bile acids. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cb\u003e5\u003c/b\u003e, 8455. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/srep08455\u003c/span\u003e\u003cspan address=\"10.1038/srep08455\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2015). Published 2015 Feb 13.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFu, D., Wakabayashi, Y., Lippincott-Schwartz, J. \u0026amp; Arias, I. M. Bile acid stimulates hepatocyte polarization through a cAMP-Epac-MEK-LKB1-AMPK pathway. \u003cem\u003eProc. Natl. Acad. Sci. U S A\u003c/em\u003e. \u003cb\u003e108\u003c/b\u003e (4), 1403\u0026ndash;1408. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1073/pnas.1018376108\u003c/span\u003e\u003cspan address=\"10.1073/pnas.1018376108\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2011).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eIkebuchi, Y. et al. Ursodeoxycholic acid stimulates the formation of the bile canalicular network. \u003cem\u003eBiochem. Pharmacol.\u003c/em\u003e \u003cb\u003e84\u003c/b\u003e (7), 925\u0026ndash;935. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bcp.2012.07.008\u003c/span\u003e\u003cspan address=\"10.1016/j.bcp.2012.07.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2012).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGe, X. L. et al. Bile Acid Overload Induced by Bile Duct and Portal Vein Ligation Improves Survival after Staged Hepatectomy in Rats. \u003cem\u003eCurr. Med. Sci.\u003c/em\u003e \u003cb\u003e43\u003c/b\u003e (5), 1013\u0026ndash;1022. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11596-023-2779-5\u003c/span\u003e\u003cspan address=\"10.1007/s11596-023-2779-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2023).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang, L. et al. Promotion of liver regeneration/repair by farnesoid X receptor in both liver and intestine in mice. \u003cem\u003eHepatology\u003c/em\u003e \u003cb\u003e56\u003c/b\u003e (6), 2336\u0026ndash;2343. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/hep.25905\u003c/span\u003e\u003cspan address=\"10.1002/hep.25905\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2012).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKeitel, V., Donner, M., Winandy, S., Kubitz, R. \u0026amp; H\u0026auml;ussinger, D. Expression and function of the bile acid receptor TGR5 in Kupffer cells. \u003cem\u003eBiochem. Biophys. Res. Commun.\u003c/em\u003e \u003cb\u003e372\u003c/b\u003e (1), 78\u0026ndash;84. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bbrc.2008.04.171\u003c/span\u003e\u003cspan address=\"10.1016/j.bbrc.2008.04.171\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2008).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMerlen, G. et al. Bile acids and their receptors during liver regeneration: Dangerous protectors. \u003cem\u003eMol. Aspects Med.\u003c/em\u003e \u003cb\u003e56\u003c/b\u003e, 25\u0026ndash;33. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.mam.2017.03.002\u003c/span\u003e\u003cspan address=\"10.1016/j.mam.2017.03.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLivak, K. J. \u0026amp; Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. \u003cem\u003eMethods\u003c/em\u003e \u003cb\u003e25\u003c/b\u003e (4), 402\u0026ndash;408. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1006/meth.2001.1262\u003c/span\u003e\u003cspan address=\"10.1006/meth.2001.1262\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2001).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRussell, J. O. \u0026amp; Camargo, F. D. Hippo signalling in the liver: role in development, regeneration and disease. \u003cem\u003eNat. Rev. Gastroenterol. Hepatol.\u003c/em\u003e \u003cb\u003e19\u003c/b\u003e (5), 297\u0026ndash;312. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41575-021-00571-w\u003c/span\u003e\u003cspan address=\"10.1038/s41575-021-00571-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2022).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLai, D., Ho, K. C., Hao, Y. \u0026amp; Yang, X. Taxol resistance in breast cancer cells is mediated by the hippo pathway component TAZ and its downstream transcriptional targets Cyr61 and CTGF. \u003cem\u003eCancer Res.\u003c/em\u003e \u003cb\u003e71\u003c/b\u003e (7), 2728\u0026ndash;2738. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1158/0008-5472.CAN-10-2711\u003c/span\u003e\u003cspan address=\"10.1158/0008-5472.CAN-10-2711\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2011).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXiao, L., Sun, L., Liu, F. Y., Peng, Y. M. \u0026amp; Duan, S. B. Connective tissue growth factor knockdown attenuated matrix protein production and vascular endothelial growth factor expression induced by transforming growth factor-beta1 in cultured human peritoneal mesothelial cells. \u003cem\u003eTher. Apher Dial\u003c/em\u003e. \u003cb\u003e14\u003c/b\u003e (1), 27\u0026ndash;34. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/j.1744-9987.2009.00701.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1744-9987.2009.00701.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2010).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJun, J. I. \u0026amp; Lau, L. F. Taking aim at the extracellular matrix: CCN proteins as emerging therapeutic targets. \u003cem\u003eNat. Rev. Drug Discov\u003c/em\u003e. \u003cb\u003e10\u003c/b\u003e (12), 945\u0026ndash;963. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nrd3599\u003c/span\u003e\u003cspan address=\"10.1038/nrd3599\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2011). Published 2011 Dec 1.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLu, L. et al. Hippo signaling is a potent in vivo growth and tumor suppressor pathway in the mammalian liver. \u003cem\u003eProc. Natl. Acad. Sci. U S A\u003c/em\u003e. \u003cb\u003e107\u003c/b\u003e (4), 1437\u0026ndash;1442. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1073/pnas.0911427107\u003c/span\u003e\u003cspan address=\"10.1073/pnas.0911427107\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2010).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu, M. \u0026amp; Chen, P. Proliferation\u0026ndash;inhibiting pathways in liver regeneration (Review). \u003cem\u003eMol. Med. Rep.\u003c/em\u003e \u003cb\u003e16\u003c/b\u003e (1), 23\u0026ndash;35. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3892/mmr.2017.6613\u003c/span\u003e\u003cspan address=\"10.3892/mmr.2017.6613\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChiang, J. Y. Bile acid regulation of gene expression: roles of nuclear hormone receptors. \u003cem\u003eEndocr. Rev.\u003c/em\u003e \u003cb\u003e23\u003c/b\u003e (4), 443\u0026ndash;463. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1210/er.2000-0035\u003c/span\u003e\u003cspan address=\"10.1210/er.2000-0035\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2002).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChiang, J. Y. Regulation of bile acid synthesis: pathways, nuclear receptors, and mechanisms. \u003cem\u003eJ. Hepatol.\u003c/em\u003e \u003cb\u003e40\u003c/b\u003e (3), 539\u0026ndash;551. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jhep.2003.11.006\u003c/span\u003e\u003cspan address=\"10.1016/j.jhep.2003.11.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2004).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen, T. et al. Sphingosine-1 phosphate promotes intestinal epithelial cell proliferation via S1PR2. \u003cem\u003eFront. Biosci. (Landmark Ed)\u003c/em\u003e. \u003cb\u003e22\u003c/b\u003e (4), 596\u0026ndash;608. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2741/4505\u003c/span\u003e\u003cspan address=\"10.2741/4505\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2017). Published 2017 Jan 1.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXue, R. et al. Bile Acid Receptors and the Gut-Liver Axis in Nonalcoholic Fatty Liver Disease. Cells. ;10(11):2806. Published 2021 Oct 20. (2021). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/cells10112806\u003c/span\u003e\u003cspan address=\"10.3390/cells10112806\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003e(33)Russell DW. The enzymes, regulation, and genetics of bile acid synthesis. \u003cem\u003eAnnu. Rev. Biochem.\u003c/em\u003e \u003cb\u003e72\u003c/b\u003e, 137\u0026ndash;174. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1146/annurev.biochem.72.121801.161712\u003c/span\u003e\u003cspan address=\"10.1146/annurev.biochem.72.121801.161712\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2003).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDenson, L. A. et al. The orphan nuclear receptor, shp, mediates bile acid-induced inhibition of the rat bile acid transporter, ntcp. \u003cem\u003eGastroenterology\u003c/em\u003e \u003cb\u003e121\u003c/b\u003e (1), 140\u0026ndash;147. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1053/gast.2001.25503\u003c/span\u003e\u003cspan address=\"10.1053/gast.2001.25503\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2001).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBallatori, N., Fang, F., Christian, W. V., Li, N. \u0026amp; Hammond, C. L. Ostalpha-Ostbeta is required for bile acid and conjugated steroid disposition in the intestine, kidney, and liver. \u003cem\u003eAm. J. Physiol. Gastrointest. Liver Physiol.\u003c/em\u003e \u003cb\u003e295\u003c/b\u003e (1), G179\u0026ndash;G186. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1152/ajpgi.90319.2008\u003c/span\u003e\u003cspan address=\"10.1152/ajpgi.90319.2008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2008).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFrankenberg, T. et al. Regulation of the mouse organic solute transporter alpha-beta, Ostalpha-Ostbeta, by bile acids. \u003cem\u003eAm. J. Physiol. Gastrointest. Liver Physiol.\u003c/em\u003e \u003cb\u003e290\u003c/b\u003e (5), G912\u0026ndash;G922. 10.1152/aj gi.00479.2005 (2006).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBoyer, J. L. et al. Upregulation of a basolateral FXR-dependent bile acid efflux transporter OSTalpha-OSTbeta in cholestasis in humans and rodents. \u003cem\u003eAm. J. Physiol. Gastrointest. Liver Physiol.\u003c/em\u003e \u003cb\u003e290\u003c/b\u003e (6), G1124\u0026ndash;G1130. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1152/ajpgi.00539.2005\u003c/span\u003e\u003cspan address=\"10.1152/ajpgi.00539.2005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2006).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMa, H. \u0026amp; Patti, M. E. Bile acids, obesity, and the metabolic syndrome. \u003cem\u003eBest Pract. Res. Clin. Gastroenterol.\u003c/em\u003e \u003cb\u003e28\u003c/b\u003e (4), 573\u0026ndash;583. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.bpg.2014.07.004\u003c/span\u003e\u003cspan address=\"10.1016/j.bpg.2014.07.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2014).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKren, B. T., Rodrigues, C. M., Setchell, K. D. \u0026amp; Steer, C. J. Modulation of steady-state messenger RNA levels in the regenerating rat liver with bile acid feeding. \u003cem\u003eLiver Transpl.\u003c/em\u003e \u003cb\u003e7\u003c/b\u003e (4), 321\u0026ndash;334. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1053/jlts.2001.23062\u003c/span\u003e\u003cspan address=\"10.1053/jlts.2001.23062\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2001).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChang, S. et al. Taurodeoxycholate Increases the Number of Myeloid-Derived Suppressor Cells That Ameliorate Sepsis in Mice. \u003cem\u003eFront. Immunol.\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fimmu.2018.01984\u003c/span\u003e\u003cspan address=\"10.3389/fimmu.2018.01984\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018). Published 2018 Sep 18:1984.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSewnath, M. E., van der Poll, T., van Noorden, C. J., ten Kate, F. J. \u0026amp; Gouma, D. J. Cholestatic interleukin-6-deficient mice succumb to endotoxin-induced liver injury and pulmonary inflammation. \u003cem\u003eAm. J. Respir Crit. Care Med.\u003c/em\u003e \u003cb\u003e169\u003c/b\u003e (3), 413\u0026ndash;420. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1164/rccm.200303-311OC\u003c/span\u003e\u003cspan address=\"10.1164/rccm.200303-311OC\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2004).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEzure, T. et al. The development and compensation of biliary cirrhosis in interleukin-6-deficient mice. \u003cem\u003eAm. J. Pathol.\u003c/em\u003e \u003cb\u003e156\u003c/b\u003e (5), 1627\u0026ndash;1639. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/S0002-9440(10)65034-1\u003c/span\u003e\u003cspan address=\"10.1016/S0002-9440(10)65034-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2000).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGreve, J. W., Gouma, D. J. \u0026amp; Buurman, W. A. Bile acids inhibit endotoxin-induced release of tumor necrosis factor by monocytes: an in vitro study. \u003cem\u003eHepatology\u003c/em\u003e \u003cb\u003e10\u003c/b\u003e, 454\u0026ndash;458. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/hep.1840100409\u003c/span\u003e\u003cspan address=\"10.1002/hep.1840100409\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (1989).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eOlthof, P. B. et al. Effect of obeticholic acid on liver regeneration following portal vein embolization in an experimental model. \u003cem\u003eBr. J. Surg.\u003c/em\u003e \u003cb\u003e104\u003c/b\u003e (5), 590\u0026ndash;599. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/bjs.10466\u003c/span\u003e\u003cspan address=\"10.1002/bjs.10466\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2017).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVan Golen, R. F. et al. FXR agonist obeticholic acid induces liver growth but exacerbates biliary injury in rats with obstructive cholestasis. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cb\u003e8\u003c/b\u003e (1), 16529. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41598-018-33070-1\u003c/span\u003e\u003cspan address=\"10.1038/s41598-018-33070-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e (2018). Published 2018 Nov 8.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Liver regeneration, Portal vein ligation, Sodium taurocholate, Bile acid metabolism, Hippo signaling pathway","lastPublishedDoi":"10.21203/rs.3.rs-7588701/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7588701/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eObjective\u003c/h2\u003e\u003cp\u003eTo investigate the mechanism of oral sodium taurocholate on liver regeneration after portal vein ligation.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e\u003cp\u003eA rat model of 70% portal vein ligation (PVL) was established. The rats were randomly divided into a sodium taurocholate intervention group (PVL treatment, PVLT) and a normal diet control group (PVL control, PVLC). Liver regeneration capacity was evaluated by measuring the ratio of non-ligated liver lobe weight to total liver weight and the expression of Ki67 protein. Liver function was assessed by measuring serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin (TBil), total bile acids (TBA), and hepatic TBA levels. Transcriptome analysis was performed using bulk RNA sequencing, combined with qPCR validation of gene expression related to bile acid metabolism.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eKi67 expression peaked on the second day after surgery in both groups, with more significant liver regeneration observed in the PVLT group. Sodium taurocholate administration led to bile acid accumulation and concomitant liver function injury. Transcriptome analysis revealed that differentially expressed genes were significantly enriched in the bile acid secretion pathway, and Gene Set Enrichment Analysis (GSEA) suggested activation of the Hippo signaling pathway.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e\u003cp\u003eSodium taurocholate promotes liver regeneration after portal vein ligation by regulating bile acid metabolism and the Hippo signaling pathway.\u003c/p\u003e","manuscriptTitle":"Sodium Taurocholate Promotes Liver Regeneration after Portal Vein Ligation in Rats","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-08 09:51:43","doi":"10.21203/rs.3.rs-7588701/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-10-08T09:50:23+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-10-07T12:29:43+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"227641162833305711065020148230559601132","date":"2025-10-01T23:40:52+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-26T15:18:06+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"232648743992788990886722343839984419447","date":"2025-09-25T15:12:03+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-09-25T14:58:06+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-09-25T14:51:16+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-09-22T15:58:18+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-09-22T01:40:15+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-09-22T01:37:14+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"0f36ac22-7144-4039-90b4-b8ec9a99ee92","owner":[],"postedDate":"October 8th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":55914367,"name":"Biological sciences/Biochemistry"},{"id":55914368,"name":"Health sciences/Diseases"},{"id":55914369,"name":"Health sciences/Gastroenterology"},{"id":55914370,"name":"Biological sciences/Molecular biology"}],"tags":[],"updatedAt":"2025-12-01T16:08:20+00:00","versionOfRecord":{"articleIdentity":"rs-7588701","link":"https://doi.org/10.1038/s41598-025-29945-9","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-11-26 15:58:43","publishedOnDateReadable":"November 26th, 2025"},"versionCreatedAt":"2025-10-08 09:51:43","video":"","vorDoi":"10.1038/s41598-025-29945-9","vorDoiUrl":"https://doi.org/10.1038/s41598-025-29945-9","workflowStages":[]},"version":"v1","identity":"rs-7588701","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7588701","identity":"rs-7588701","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}