Screening of the Xylanase-producing Trichoderma Strain and the Optimization of its Enzyme Production Conditions

Screening of the Xylanase-producing Trichoderma Strain and the Optimization of its Enzyme Production Conditions | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Screening of the Xylanase-producing Trichoderma Strain and the Optimization of its Enzyme Production Conditions Lili Fan, Kehe Fu, Jiameng Hu, Xin Liu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7863122/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 16 Mar, 2026 Read the published version in Biotechnology Letters → Version 1 posted 5 You are reading this latest preprint version Abstract Purpose Xylanases have attracted considerable attention due to their excellent potential industrial uses. Results In this study, a xylanase producing strain was isolated from soil and identified as Trichoderma semiorbis Tsejk8, and the conditions for xylanase production were optimized. Additionally, two xylanase-related genes were cloned, and their functions were analyzed. The results indicated that the optimal conditions for xylanase production included maltose as the carbon source, peptone as the nitrogen source, an optimal pH of 6.0, and an incubation time of 120 h, yielding an enzyme activity of 40.7 U/mL. Following the purification of the protein via ammonium sulfate precipitation and ion exchange chromatography, four distinct protein bands were observed. Mass spectrometry analysis of these bands identified 14 associated proteins. Bioinformatics analysis revealed that two of these proteins belongs to GH3 (Glycoside Hydrolase family 3) beta- xylosidase. Conclusions In summary, the newly isolated strain Tasjk8 exhibits xylanase activity, which offers an effective and eco-friendly means of converting biomass into raw materials for industrial applications. Trichoderma semiorbis Xylanase Single-factor optimization Protein sequencing Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Xylan is a complex polysaccharide predominantly found in the cell walls of plants, constituting a major component of hemicellulose. Hemicellulose is an abundant natural resource, contributing approximately 35% to the dry weight of plants, and is extensively present in agricultural by-products, with its abundance in nature being second only to cellulose (Bhardwaj et al 2019). Xylanase is a complex ensemble of enzymes primarily responsible for the breakdown of xylan; it is not a single enzyme but a combination of various components, including endo-xylanases, β-xylosidases, and branching enzymes (such as α-glucuronidase, α-L-arabinofuranosidase, feruloyl esterase, and acetylxylan esterase), that collaboratively work to effectively decompose xylan (Chaudhary et al 2023). By employing enzymatic methods, xylan can be efficiently degraded into xylooligosaccharides and xylose, thereby enhancing the development and utilization of xylan. Numerous organisms are known to produce xylanase. Recent years have seen the documentation of various bacteria, fungi, plants, and animals capable of xylanase production both domestically and internationally (Abena and Simachew 2024). The xylanase produced by fungi exhibits high activity and is primarily extracellular (Paloheimo et al 2007), facilitating easier isolation and purification. Notable xylanase-producing fungi include Aspergillus spp., Penicillium spp., and Trichoderma spp. (Haltrich et al 1996). Trichoderma are filamentous fungi capable of synthesizing a variety of enzymes, with xylanase being one of the most significant (He et al 2009). Compared to other organisms, Trichoderma exhibit a faster reproduction rate and enhanced capabilities to absorb and utilize soil nutrients, playing an integral role in soil bioremediation and promoting crop biomass, as well as providing biological control against plant diseases and pests (Druzhinina et al 2011). The application of highly active xylanase produced by Trichoderma can effectively diminish chemical pollutants in the papermaking process. This study employs soil samples from Nanchang City, Jiangxi Province, to isolate and purify fungi, specifically targeting strains capable of xylanase production. The research focuses on optimizing the conditions for enzyme production and obtaining purified xylanase through ammonium sulfate precipitation, dialysis, and ion-exchange chromatography. Additionally, the study performs protein sequencing and gene analysis to gain deeper insights into the enzymatic characteristics. Ultimately, this research aims to provide high-quality microbial resources for future investigations, and the findings are expected to have significant practical applications. Materials and methods Culture media PDA medium (g/L) contained peeled potatoes 200, glucose 20, and agar 15. Xylanase fermentation basic medium (g/L) contained xylan 5, NaNO 3 3, K 2 HPO 4 1, MgSO 4 ·7H 2 O 0.5, KCl 0.5, and FeSO 4 ·7H 2 O 0.01, at pH 7.0. Screening medium (g/L) contained xylan 5, K 2 HPO 4 1, MgSO 4 ·7H 2 O 0.5, KCl 0.5, FeSO 4 ·7H 2 O 0.01, and yeast 2, at pH 7.0. SNA (synthetic nutrient-poor agar) (g/L) contained KH 2 PO 4 1.0, KCl 0.5, KNO 3 1.0, MgSO 4 ·7H 2 O 0.5, glucose 0.2, sucrose 0.2, agar powder 14. Identification of Strain The strain was transferred to PDA and SNA plates and colony diameters were measured every 12 h at five different points to generate a growth curve. Once conidia developed, morphological characteristics of conidiophores and conidia were observed under an optical microscope. Genomic DNA from the target strain was extracted using the CTAB method. Primers were designed to amplify translation elongation factor 1-alpha (tef1) (Zhu and Zhuang 2015), as follows: tef1F: CATCGAGAAGTTCGAGAAGG, tef1R: AACTTGCAGGCAATGTGG PCR amplification was conducted, and the products were analyzed using 0.1% agarose gel electrophoresis. Following purification, the samples were submitted to Shanghai Bio-engineering Company for sequencing. A phylogenetic tree was constructed using the neighbor-joining (NJ) method by MEGA7 software (Kumar et al 2016). Screening of Xylanase-producing Strains The strain was inoculated onto potato dextrose agar (PDA) plates and incubated at 28°C for 36 hours in an inverted position. Following this, agar discs, measuring 0.5 cm in diameter, were obtained using a punch, and three discs were transferred to a 250 ml Erlenmeyer flask containing 50 mL of culture medium. The flask was then incubated at 28°C with shaking at 200 rpm for 5 days. Subsequently, the culture was vacuum filtered to collect the broth, which was further filtered through a 0.22 µm-micron filter and stored at -20°C for future enzyme activity assays. Optimization of Xylanase Production Conditions Five distinct carbon sources—1% glucose, maltose, xylan, sucrose, and soluble starch—were assessed for their ability to support xylanase production. Fermentation was carried out at 28°C and 200 rpm for 5 days. Subsequently, five nitrogen sources—0.5% potassium nitrate, sodium nitrate, ammonium sulfate, tryptone, and yeast extract—were evaluated under identical fermentation conditions to determine the optimal nitrogen source. Using the optimal carbon and nitrogen sources, the initial pH of the medium was adjusted to 4.0, 5.0, 6.0, 7.0, and 8.0 to identify the best pH for enzyme production. Finally, the optimized conditions (carbon source, nitrogen source, and pH) were applied to evaluate the effect of fermentation time by conducting experiments over 2, 3, 4, 5, and 6 days. All experiments were performed in triplicate. Determination of Xylanase Activity (DNS assay) The culture solution was prepared and centrifuged at 4,000 rpm for 15 min at 4°C to collect the supernatant. This supernatant was then filtered through a 0.22 µm filter to obtain the crude enzyme solution. 1 mL crude enzyme solution was mixed with 1 mL of 0.1% xylan solution at room temperature. The mixture was incubated at 37°C for 30 min to allow the xylanase to act on the xylan. The reaction was terminated by boiling for 5 min, after which the mixture was rapidly cooled in cold water for 5 min, followed by the addition of 3 mL of DNS solution and thorough mixing. The mixture was placed in a boiling water bath for 5 min to sustain the reaction for the determination of reducing sugars, after which it was cooled in cold water for 5 min. The absorbance of the prepared control and experimental samples was measured at a wavelength (λ) of 540 nm. The amount of enzyme required to catalyze the production of 1 µg of reducing sugars per min is defined as one unit of enzyme activity (U). The calculation is shown as follow: U = W×N×1000∕(T×V) where U is the xylanase activity per mL, W is the glucose concentration obtained from the control glucose standard curve, N is the reaction volume in mL, T is the reaction time in min, 1000 converts mg to µg, and V is the volume of the crude enzyme solution in mL. Xylanase Purification Ammonium sulfate was progressively added to the crude enzyme solution while stirring at low speed at 4°C until a final concentration of 60% was reached, and stand at 4°C for 1 h. The mixture was then centrifuged at 8,000 rpm for 30 min at 4°C, discarding the supernatant and retaining the precipitate. The precipitate was dissolved in 0.2 mol/L phosphate buffer (pH 7.0). The resulting solution was transferred into a dialysis bag with a molecular weight cutoff of 3,500 Da, which was placed in a container filled with xylan buffer for dialysis at 4°C, with the buffer being replaced every 6 h for a total of six exchanges, until all ammonium sulfate was removed. The treated DEAE-cellulose was packed into a glass adsorption column, and an equal volume of 0.2 mol/L phosphate buffer (pH 7.0) was added to wash the column, designated as the loading solution. Subsequently, 2 mL of enzyme solution was added and allowed to adsorb for 30 min, followed by washing with 5 mL of buffer, designated as the post-loading liquid. Elution was performed using 10 mL of buffer containing 0.5 mol/L NaCl, with the eluted liquid collected. All solutions were stored at 4°C. The protein content was measured using the Coomassie Brilliant Blue method, and enzyme proteins were identified through SDS-PAGE analysis. After SDS-PAGE, the target band was excised and sequence by Sangon Biotech (Shanghai). Analysis of the Enzymatic Properties of Xylanase The purified enzyme was incubated at 20, 30, 40, 50, 60, 70, and 80°C for 30 min, and the remaining xylanase activity was measured under optimal reaction conditions to analyze the thermal stability of the enzyme. Various pH values (4.0, 5.0, 6.0, 7.0, and 8.0) were also tested to evaluate its acid-base stability. Phylogenetic tree analysis The phylogenetic tree was constructed using the Neighbor-Joining method in MEGA 7.0 software, employing bootstrap analysis with 1000 repetitions. The full-length amino acid sequences of the selected genes were used to construct this tree. Statistical Analysis All data were analyzed using a one-way analysis of variance (ANOVA) in the R programming language (R version 4.3.1). Result and discussion Strain Screening Results of High-Xylanase Producing Trichoderma Strains A total of 117 Trichoderma strains were isolated and purified. The screening process was carried out using shake-flask fermentation, and the results are illustrated in Fig. 1 . Among the tested strains, strain JK8 demonstrated the highest xylanase activity, thereby designating it as a high-xylanase-producing strain for subsequent experiments. Identification of Xylanase-producing Strains As illustrated in Fig. 2 a, strain Tsejk8 exhibited rapid growth on PDA medium, characterized by initial white mycelium. After 4 days, it began spore production, and the aerial mycelium became well-developed. In contrast, Fig. 2 b shows slower growth on SNA medium, with initial white mycelium and spore production commencing after 5 days, accompanied by less developed aerial mycelium. Observations under a light microscope, depicted in Fig. 2 c, revealed that the mycelium was white or light-colored, slender, septate, and highly branched. Conidiophores were organized into dense, hemispherical to cushion-like structures, typically displaying extensive branching at acute or nearly right angles, in whorls of 2 to 4, with conidial areas exhibiting various shades of green or gray. As indicated in Fig. 2 d, the conidia were unicellular, spherical, and green. The strain showed rapid growth; as shown in Fig. 2 e, it reached a diameter of 6.33 cm after 60 h of incubation at 28°C on PDA medium, while on SNA medium, it attained a diameter of 5.5 cm under the same conditions. The limited nutritional components of the SNA medium compared to PDA suggest that nutritional factors minimally impact the growth of this strain. Preliminary identification confirmed JK8 as Trichoderma semiorbis. Phylogenetic analysis revealed that this strain shares the highest homology with Trichoderma semiorbis isolate HZA10 (OR046019.1), as depicted in Fig. 2 f, where the strain is positioned in the same branch. Combining molecular biological and morphological identification, the strain was ultimately confirmed as Trichoderma semiorbis and designated as Tsejk8. Figure 1 Screening of Trichoderma strains producing xylanase Figure 2 Growth characteristics of strain Tsejk8. (a) Morphology on PDA medium. (b) Morphology of SNA medium. (c) Characteristics of conidiophores (scale: 10 µm). (d) Characteristics of conidia (scale of 10 µm). (e) Strain growth rate. (f) phylogenetic tree of Tef1 gene cloned from Tsejk8 The Optimal Culture Conditions for the Production of Xylanase Enzyme In order to improve laccase production, the fermentation conditions including carbon source, nitrogen source, initial pH and incubation time were optimized (Fig. 3 ). Figure 3 a illustrates that when xylan served as the carbon source in the culture medium, enzyme activity in the fermentation broth's supernatant was significantly elevated. In contrast, the use of sucrose, glucose, or maltose as carbon sources resulted in lower enzyme activity, suggesting that polysaccharides such as starch and xylan are more effective than monosaccharides or disaccharides in promoting xylanase production by the strain. Dhaver (Dhaver et al 2022) optimized the culture conditions and medium components for xylanase production by T. harzianum , discovering that the incorporation of xylan-rich materials, such as wheat bran, significantly improved xylanase yield. Figure 3 Optimization of enzyme production conditions of Tsejk8. (a) Carbon sources. (b) Nitrogen sources. (c) Initial pH. (d) Fermentation time. Statistical analysis was conducted using ANOVA in R. Different letters indicate statistically significant differences (p < 0.05), whereas identical letters denote no significant difference. With xylan established as the carbon source, potassium nitrate yielded the lowest enzyme activity in the fermentation broth's supernatant. Conversely, sodium nitrate, ammonium sulfate, peptone, and yeast extract all produced higher enzyme activity, with peptone yielding the highest enzyme activity in the fermentation broth (Fig. 3 b). Organic nitrogen sources, such as tryptone, yeast extract, peptone, and soy meal, have a significant impact on the enhancement of xylanase production. Aspergillus sp. IN5 is reported to be highly productive in the presence of soybean residue (Boondaeng et al 2024), corn step liquor for T. reesi (Lappalainen et al 2000) and peptone for Pichia kudriavzevii . Although no significant differences in enzyme activity were observed among the four nitrogen sources—sodium nitrate, ammonium sulfate, peptone, and yeast extract. In consideration of prior research findings, we selected peptone as the optimal nitrogen source for strain Tsejk8. Figure 3 c illustrates that when xylan and peptone were employed as the carbon and nitrogen sources, respectively, pH values of 4 and 8 resulted in high enzyme activity in the fermentation broth. Raghukumar (Raghukumar et al 2004) also observed that the A. niger strain isolated from mangrove detritus exhibited maximum activity at pH 3.5, with an additional peak at pH 8.5. Additionally, pH 8 is more conducive to the growth of Trichoderma . therefore, it was selected as the optimal pH. Thus, a pH of 8 is concluded to be the optimal pH for xylanase production by strain Tsejk8. Figure 3 d indicates that when xylan was used as the carbon source, peptone as the nitrogen source, and a pH of 8 was maintained, a cultivation time of 120 h resulted in elevated enzyme activity in the fermentation broth. Although no significant differences in enzyme activity were observed among the 48h, 96h, 120h, and 144h time points, 120h was chosen as the optimal cultivation time based on previous research findings and the growth characteristics of Trichoderma . Following optimization, the enzyme activity of Tsejk8 reached 40.7 U/mL, indicating a 35.6% increase compared to the levels recorded before optimization. Purification of Xylanase from Tsejk8 As presented in Table 1 , the initial crude enzyme solution had a total volume of 80 mL, exhibiting a total activity 2,075.491 U/mg. Following the ammonium sulfate precipitation treatment, a clarified enzyme solution with a total volume of 8.2 mL was collected, at which point the total activity increased to 2,530.92 U/mg. Compared to the initial crude enzyme solution, the purification fold reached 1.2, and the enzyme activity recovery rate was 24.4%. Subsequently, after further purification using a DEAE-cellulose ion exchange column, the xylanase solution's total activity exhibited a remarkable increase to 25,625.82 U/mg. In comparison to the initial crude enzyme solution, the purification fold significantly increased to 12.3, and the enzyme activity recovery rate improved to 35.6%. Table 1 Purification of Xylanase Purification Step Total Volume (mL) Total Activity (U) Total Protein (mg) Specific Activity (U/g) Recovery Rate (%) Purification Fold Crude Enzyme Solution 80 ± 4.50 1516.3 ± 107.45 0.73 ± 0.065 2.08 ± 0.041 100 1 Ammonium Sulfate Precipitation and Dialysis 8.2 ± 0.75 369.64 ± 39.65 0.15 ± 0.016 2.53 ± 0.012 24.4 ± 0.89 1.2 ± 0.029 Anion Exchange Chromatography 13 ± 0.60 539.40 ± 39.9 0.02 ± 0.004 25.63 ± 2.625 35.6 ± 2.11 12.3 ± 1.019 Table 1 Purification of Xylanase Enzymatic Characterization The fermentation broth of strain Tsejk8 was filtered using a 0.22 µm membrane to obtain a crude enzyme solution (corresponding to lane 1 in Fig. 4 a), which initially removed large molecular impurities from the fermentation broth, establishing a foundation for the subsequent purification process. The crude enzyme solution was then processed through ammonium sulfate precipitation. This method leveraged the differences in protein solubility at varying salt concentrations to achieve preliminary enrichment of the target protein, with the resulting precipitate corresponding to lane 2 in Fig. 4 a. The ammonium sulfate-precipitated sample then underwent further purification via DEAE-cellulose ion exchange chromatography. Utilizing the principle of ion exchange, the target xylanase was separated from other impurities based on the charge properties and quantities of the proteins. The treated sample post this step is presented in lane 3 of Fig. 4 a. SDS-PAGE electrophoresis was performed on samples at each stage, indicate that as the purification process advances, the number of protein bands progressively decreases, ultimately revealing five principal bands with molecular weights ranging from 35 to 100 kDa. Effect of Temperature and pH on Xylanase Activity The enzyme activity was measured across six different temperatures. As shown in Fig. 4 B, within the temperature range of 20 to 30°C, enzyme activity gradually increased with rising temperature. The xylanase activity for strain Tsejk8 peaked at 30°C after a 30-min reaction. Although elevated temperatures from 30 to 40°C also resulted in high enzyme activity after 30 min, the activity was lower compared to that observed at 30°C. Beyond 50°C, enzyme activity rapidly declined. Therefore, the optimal reaction temperature for strain Tsejk8 is approximately 30°C. Figure 4 C illustrates that within a pH range of 3.0 to 4.0, enzyme activity increased with increasing pH, peaking at pH 4.0. However, in the pH range of 4.0 to 8.0, enzyme activity significantly decreased as pH continued to rise, suggesting that xylanase produced by strain Tsejk8 is an acidophilic enzyme, with an optimal pH of 4.0. Figure 4 Properties of xylanase. Effect of temperature and pH on xylanase activity. (a) SDS-PAGE electropherogram. M, marker. Lane1, crude fermentation broth. Lane2, ammonium sulfate precipitation. Lane3, DEAE-cellulose ion-exchange chromatography. (b) Effect of temperature on xylanase activity. (c) Effect of pH on xylanase activity. Analysis of Xylanase-related Proteins Upon excising the protein bands and conducting sequencing, we identified 14 proteins with molecular weights ranging from 41.6 to 98.9 kDa. Domain analysis revealed that two of these proteins (Tsebxl01 and Tsebxl02) belong to the PLN03080 superfamily (Fig. 5 ). Clustering analysis indicated that Tsebxl01 has the highest homology with the BXL1 protein of T. guizhouense , while Tsebxl02 exhibits the highest homology with the BXL1 protein of T. simmonsii , both of which are classified within the xylanase family. Xylanolytic enzymes are classified as glycoside hydrolases (GH) based on homologies in structural elements and hydrophobic clusters, and they are organized into several families, namely 5, 7, 8, 9, 10, 11, 12, 16, 26, 30, 43, 44, 51, and 62. These enzymes are capable of hydrolyzing the β-1,4-glycosidic linkages in xylosides (Nguyen et al 2018). In this study, we cloned two β-xylosidases, Tasbxl01 and Tasbxl02, which belong to the GH3 family. Table 2 Analysis of Proteins Table 2 Analysis of Proteins Accession Sore Sequest MW (kDa) Calc.pI Size of mRNA(bp) Note Tsejk801 2.49 61.9 6.23 1731 Isoamyl alcohol oxidase Tsejk802 13.27 69 5.6 1989 Xyloglucanase Tsejk803 2.35 77.2 7.23 2205 GH3 beta-glucosidase Tsebxl01 35.1 86.7 5.55 2388 GH3 beta-xylosidase Tsejk805 12.38 80.4 6.98 2283 Glucan endo-1,3-beta-glucosidase Tsejk806 2.87 67.5 5.29 1902 GH15 glucamylase Tsebxl02 10.24 81 5.45 2295 GH3 beta-xylosidase Tsejk808 8.93 62.5 7.01 1731 Amidase Tsejk809 82.71 83 7.4 2328 GH55 exo-1 3-beta-glucanase Tsejk810 43.36 61.5 6.07 1728 GH71, alpha-1,3-glucanase Tsejk811 24.46 53.9 5.47 1464 Glutaminase A Tsejk812 2.41 41.6 5.69 1128 Actin Tsejk813 2.33 98.9 5.74 2673 Exo-beta-D-glucosaminidase Tsejk814 2.41 92.6 6.9 2637 Subtilisin-like protease PPRC1 Notes: Score Sequest: The sum of peptide scores reflects the overall confidence in protein identification; a higher score indicates greater reliability. Figure 5 Analysis of the xylanase proteins. (a) Domain of the 16 proteins; (b) phylogenetic tree of two xylanase proteins Conclusions This study provides the inaugural report on the production and characterization of xylanase activity from T. semiorbis . The properties of the xylanase preparation derived from strain Tsejk8 indicate its potential application in industrial processes that require high stability and optimal activity at acidic pH, such as in animal feed. Furthermore, the identification of two xylanase genes will facilitate investigations into the molecular mechanisms governing xylanase production by this strain, thereby establishing a theoretical foundation for genetically modifying the strain to enhance xylanase production at the molecular level. Declarations Conflict of interest The authors declare that they have no conflict of interest. Ethical standards This study focused on the analysis of fungi. The work does not describe any studies involving human participants or animals. Our manuscript complies with the Ethical Rules applicable. Funding This work was supported by National Natural Science Foundation of China 31660020, Science and Technology Project Founded by the Education Department of Jiangxi Province GJJ151252, GJJ161233. Author contribution statement Hu performed the cultivation. Liu performed DNA extraction. Fu designed the experiments, and contributed to the writing of the manuscript. Fan supervised the project and reviewed the manuscript, provided computational support and contributed to the writing of the manuscript. All authors read and approved the final manuscript. References Abena T, Simachew A (2024). A review on xylanase sources, classification, mode of action, fermentation processes, and applications as a promising biocatalyst. Biotechnologia 105, 273–285. http://doi.org/10.5114/bta.2024.141806 Bhardwaj N, Kumar B, Verma P (2019). A detailed overview of xylanases: an emerging biomolecule for current and future prospective. Bioresources and Bioprocessing 6. http://doi.org/10.1186/s40643-019-0276-2 Boondaeng A, Keabpimai J, Trakunjae C, Vaithanomsat P, Srichola P, Niyomvong N (2024). Cellulase production under solid-state fermentation by Aspergillus sp. IN5: Parameter optimization and application. Heliyon 10. http://doi.org/10.1016/j.heliyon.2024.e26601 Chaudhary R, Kuthiala T, Singh G, Rarotra S Kaur A, Arya S K, Kumar P (2023). Current status of xylanase for biofuel production: a review on classification and characterization. Biomass Conversion and Biorefinery 13, 8773–8791. http://doi.org/10.1007/s13399-021-01948-2 Dhaver P, Pletschke B, Sithole B, Govinden R (2022). Optimization, purification, and characterization of xylanase production by a newly isolated Trichoderma harzianum strain by a two-step statistical experimental design strategy. Scientific reports 12, 17791. https://doi.org/10.1038/s41598-022-22723-x Druzhinina I S, Seidl-Seiboth V, Herrera-Estrella A, Horwitz B A, Kenerley C M, Monte E, Mukherjee P K, Zeilinger S, Grigoriev I V, Kubicek C P (2011). Trichoderma : the genomics of opportunistic success. Nature Reviews Microbiology 9, 749–759. https://doi.org/10.1038/nrmicro2637 Haltrich D, Nidetzky B, Kulbe K D, Steiner W, Zupancic S (1996). Production of fungal xylanases. Bioresource Technology 58, 137–161. https://doi.org/10.1016/s0960-8524(96)00094-6 He J, Yu B, Zhang K, Ding X, Chen D (2009). Expression of endo-1, 4-beta-xylanase from Trichoderma reesei in Pichia pastorisand functional characterization of the produced enzyme. BMC Biotechnology 9. https://doi.org/10.1186/1472-6750-9-56 Kumar S, Stecher G, Tamura K J M b (2016). MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. 33, 1870–1874. https://doi.org/10.1093/molbev/msw054 Lappalainen A, Siika-Aho M, Kalkkinen N, Fagerstrom R, Tenkanen M J B, biochemistry a (2000). Endoxylanase II from Trichoderma reesei has several isoforms with different isoelectric points. 31, 61–68. https://doi.org/10.1042/BA19990066 Nguyen S T, Freund H L, Kasanjian J, Berlemont R (2018). Function, distribution, and annotation of characterized cellulases, xylanases, and chitinases from CAZy. Applied microbiology biotechnology 102, 1629–1637. https://doi.org/10.1007/s00253-018-8778-y Paloheimo M, Mantyla A, Kallio J, Puranen T, Suominen P (2007). Increased Production of Xylanase by Expression of a Truncated Version of the xyn11A Gene from Nonomuraea flexuosa in Trichoderma reesei . Applied and Environmental Microbiology 73, 3215–3224. https://doi.org/10.1128/aem.02967-06 Raghukumar C, Muraleedharan U, Gaud V, Mishra R (2004). Xylanases of marine fungi of potential use for biobleaching of paper pulp. Journal of Industrial Microbiology Biotechnology 31, 433–441. https://doi.org/10.1007/s10295-004-0165-2 Zhu, Z., and Zhuang, W. J. M. (2015). Three new species of Trichoderma with hyaline ascospores from China. Mycologia 107, 328–345. https://doi.org/10.3852/14-141 Cite Share Download PDF Status: Published Journal Publication published 16 Mar, 2026 Read the published version in Biotechnology Letters → Version 1 posted Reviewers agreed at journal 02 Nov, 2025 Reviewers invited by journal 30 Oct, 2025 Editor assigned by journal 18 Oct, 2025 First submitted to journal 17 Oct, 2025 Editorial decision: Major revisions 17 Oct, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7863122","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":537705463,"identity":"a2296a06-6535-4849-933f-278aac5a3bda","order_by":0,"name":"Lili Fan","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAArUlEQVRIiWNgGAWjYBACPnbGBwwMPyTk2NjbDxCnhY2Z2YCBscfCmI/nTAIJWhjYKhLnSTgYEK2F8XMBj0R6mwRDAsOPim1EaWGWnmEhkdsm3XiAsefMbWK08B+Q5uEBapE5kMDM2EaUFmbm3zxsEulsEgkGRGthkwZqSSBNizVvj4RhGzCQDxLlF372ZubbPD/q5OXb2w8++FFBhBYUcIBE9aNgFIyCUTAKcAEAiH0s6QKs8fIAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0001-8411-8249","institution":"NanChang Normal University","correspondingAuthor":true,"prefix":"","firstName":"Lili","middleName":"","lastName":"Fan","suffix":""},{"id":537705464,"identity":"9c3bff8c-d4aa-4780-921b-09dd094b5ba7","order_by":1,"name":"Kehe Fu","email":"","orcid":"","institution":"NanChang Normal University","correspondingAuthor":false,"prefix":"","firstName":"Kehe","middleName":"","lastName":"Fu","suffix":""},{"id":537705465,"identity":"d40c5198-3285-44e3-8699-ca868766d34e","order_by":2,"name":"Jiameng Hu","email":"","orcid":"","institution":"NanChang Normal University","correspondingAuthor":false,"prefix":"","firstName":"Jiameng","middleName":"","lastName":"Hu","suffix":""},{"id":537705466,"identity":"a68d9c8e-b2f7-4f8f-8d67-6165d1e8a2f3","order_by":3,"name":"Xin Liu","email":"","orcid":"","institution":"NanChang Normal University","correspondingAuthor":false,"prefix":"","firstName":"Xin","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2025-10-15 03:10:30","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7863122/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7863122/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s10529-026-03718-4","type":"published","date":"2026-03-16T15:58:24+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":95657273,"identity":"0ec9735a-2424-4530-9639-42ce199dcd02","added_by":"auto","created_at":"2025-11-11 16:20:27","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1876117,"visible":true,"origin":"","legend":"","description":"","filename":"Figures.docx","url":"https://assets-eu.researchsquare.com/files/rs-7863122/v1/cc9f1ac0d3c29477c87cd553.docx"},{"id":95617123,"identity":"aadbab19-0548-4672-afc0-c4e2db772804","added_by":"auto","created_at":"2025-11-11 09:04:16","extension":"rar","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":66104,"visible":true,"origin":"","legend":"","description":"","filename":"Data.rar","url":"https://assets-eu.researchsquare.com/files/rs-7863122/v1/7e0dd4dcdcd1318c94d0db52.rar"},{"id":95617121,"identity":"f1b266a9-91b4-41f9-9a90-b4827745872a","added_by":"auto","created_at":"2025-11-11 09:04:16","extension":"doc","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":32768,"visible":true,"origin":"","legend":"","description":"","filename":"Table1.doc","url":"https://assets-eu.researchsquare.com/files/rs-7863122/v1/3104572741671cafadbdbe10.doc"},{"id":95657591,"identity":"5f653165-2580-44be-9094-04ecbcb525ea","added_by":"auto","created_at":"2025-11-11 16:21:18","extension":"doc","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":37376,"visible":true,"origin":"","legend":"","description":"","filename":"Table2.doc","url":"https://assets-eu.researchsquare.com/files/rs-7863122/v1/c8ce0121bcf6972b9093ece0.doc"},{"id":95617126,"identity":"48376ae4-5430-48df-a056-06c95bbe13e3","added_by":"auto","created_at":"2025-11-11 09:04:16","extension":"xml","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9755,"visible":true,"origin":"","legend":"","description":"","filename":"bileBILED2500600.xml","url":"https://assets-eu.researchsquare.com/files/rs-7863122/v1/e7b454559869fa8355cf545f.xml"},{"id":95658107,"identity":"f1f74a70-8915-4b0c-915f-f0002ed4c42e","added_by":"auto","created_at":"2025-11-11 16:22:55","extension":"xml","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1082,"visible":true,"origin":"","legend":"","description":"","filename":"BILED250060020533.go.xml","url":"https://assets-eu.researchsquare.com/files/rs-7863122/v1/8a980203990cc8e0ca100e54.xml"},{"id":95617132,"identity":"9c2234d0-fee8-4649-982f-28903635778a","added_by":"auto","created_at":"2025-11-11 09:04:16","extension":"xml","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":887,"visible":true,"origin":"","legend":"","description":"","filename":"BILED2500600Import.xml","url":"https://assets-eu.researchsquare.com/files/rs-7863122/v1/cea3c272381ae971fd757b69.xml"},{"id":95617133,"identity":"41616484-5412-4f93-b622-985dcf5b7b18","added_by":"auto","created_at":"2025-11-11 09:04:16","extension":"xml","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":57159,"visible":true,"origin":"","legend":"","description":"","filename":"BILED25006001enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7863122/v1/a7c23afb9ab64e804cd7ef2c.xml"},{"id":95617134,"identity":"cfaea662-31c0-42df-8259-6179894d234e","added_by":"auto","created_at":"2025-11-11 09:04:16","extension":"jpeg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":183058,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7863122/v1/a4a13e21a589c9bd4ab0ff87.jpeg"},{"id":95617140,"identity":"1ce870da-974a-4df9-9da3-eb23458ba0f7","added_by":"auto","created_at":"2025-11-11 09:04:16","extension":"jpeg","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":338856,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7863122/v1/2a55c188fb3291f03d594d91.jpeg"},{"id":95617143,"identity":"e6578958-1b2e-452c-8499-2254e52350dd","added_by":"auto","created_at":"2025-11-11 09:04:16","extension":"jpeg","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":481850,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7863122/v1/050b39ada52354a5aad7f8fa.jpeg"},{"id":95617138,"identity":"70562b6e-6acf-4147-9762-e48f98f2f3f2","added_by":"auto","created_at":"2025-11-11 09:04:16","extension":"jpeg","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":388192,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7863122/v1/56fec5e9a5f23948761b2eaf.jpeg"},{"id":95656463,"identity":"fa82914b-3674-4019-be92-974a769cc50a","added_by":"auto","created_at":"2025-11-11 16:18:43","extension":"jpeg","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":467518,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7863122/v1/21f57969fcab41e5078c43f3.jpeg"},{"id":95657668,"identity":"7eb20165-e8a4-45f7-83a3-9fc3ad42139f","added_by":"auto","created_at":"2025-11-11 16:21:34","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":22359,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7863122/v1/e3f38d33d239365b93332c2f.png"},{"id":95617136,"identity":"eb78ce9d-f896-4274-88d7-f11d4cf0fb46","added_by":"auto","created_at":"2025-11-11 09:04:16","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":168441,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7863122/v1/5bb165fc5aa2385446e8d4b4.png"},{"id":95657619,"identity":"d7d63a11-07e5-4f09-8769-a067cfbdc6df","added_by":"auto","created_at":"2025-11-11 16:21:24","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":46998,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7863122/v1/f935992aaba91c7c52849060.png"},{"id":95617144,"identity":"2bd1356b-ea21-4d61-a81e-7ec530617d23","added_by":"auto","created_at":"2025-11-11 09:04:16","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":45055,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7863122/v1/a67aa662073a8a2398663a9c.png"},{"id":95617145,"identity":"a829dbe0-22f4-4bb0-9f3b-9bbb56a694fc","added_by":"auto","created_at":"2025-11-11 09:04:16","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":80288,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7863122/v1/5db0acb7398615f1bcc48251.png"},{"id":95617139,"identity":"ab9ec4c4-2887-4765-9972-f9a0bc7a96d7","added_by":"auto","created_at":"2025-11-11 09:04:16","extension":"xml","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":55887,"visible":true,"origin":"","legend":"","description":"","filename":"BILED25006001structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7863122/v1/47c759f36326f5ffc5dd1dfe.xml"},{"id":95656407,"identity":"1e0275fd-7218-481d-9a7d-aa5d76a19ce1","added_by":"auto","created_at":"2025-11-11 16:18:37","extension":"html","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":62082,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7863122/v1/f366967d095351b45384170b.html"},{"id":95617120,"identity":"2388a455-d739-4179-945b-b0597bb29b85","added_by":"auto","created_at":"2025-11-11 09:04:16","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":71050,"visible":true,"origin":"","legend":"\u003cp\u003eScreening of \u003cem\u003eTrichoderma\u003c/em\u003e strains producing xylanase\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7863122/v1/f67fca4d85ff00e1963274e8.png"},{"id":95657743,"identity":"d6c0d4ca-ab6d-45e2-9d5b-83dc204c8331","added_by":"auto","created_at":"2025-11-11 16:21:45","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":960377,"visible":true,"origin":"","legend":"\u003cp\u003eGrowth characteristics of strain Tsejk8. (a) Morphology on PDA medium. (b) Morphology of SNA medium. (c) Characteristics of conidiophores (scale: 10 μm). (d) Characteristics of conidia (scale of 10 μm). (e) Strain growth rate. (f) phylogenetic tree of Tef1 gene cloned from Tsejk8\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7863122/v1/5d72b12def0db298417f2043.png"},{"id":95656787,"identity":"dd520985-9870-48ff-aa22-c25567a0f503","added_by":"auto","created_at":"2025-11-11 16:19:32","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":100671,"visible":true,"origin":"","legend":"\u003cp\u003eOptimization of enzyme production conditions of Tsejk8. (a) Carbon sources. (b) Nitrogen sources. (c) Initial pH. (d) Fermentation time. Statistical analysis was conducted using ANOVA in R. Different letters indicate statistically significant differences (p \u0026lt; 0.05), whereas identical letters denote no significant difference.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7863122/v1/bd975f9c4603edb6fe4a9d99.png"},{"id":95617125,"identity":"2e4051ad-5d68-4dfb-b52b-1724a2ce5585","added_by":"auto","created_at":"2025-11-11 09:04:16","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":276844,"visible":true,"origin":"","legend":"\u003cp\u003eProperties of xylanase. Effect of temperature and pH on xylanase activity. (a) SDS-PAGE electropherogram. M, marker. Lane1, crude fermentation broth. Lane2, ammonium sulfate precipitation. Lane3, DEAE-cellulose ion-exchange chromatography. (b) Effect of temperature on xylanase activity. (c) Effect of pH on xylanase activity.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7863122/v1/ea93893fb6cb834c090e4745.png"},{"id":95617128,"identity":"0a27a181-dc20-47e5-8cf9-ab7b908f39d8","added_by":"auto","created_at":"2025-11-11 09:04:16","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":388524,"visible":true,"origin":"","legend":"\u003cp\u003eAnalysis of the xylanase proteins. (a) Domain of the 16 proteins; (b) phylogenetic tree of two xylanase proteins\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-7863122/v1/8db4ae722416e69a82281cee.png"},{"id":105223305,"identity":"a33477bd-4cf1-4951-9b50-976cd4338148","added_by":"auto","created_at":"2026-03-23 16:03:18","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2448084,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7863122/v1/41354550-b0ec-4ffa-b2bf-6394295bd042.pdf"}],"financialInterests":"","formattedTitle":"Screening of the Xylanase-producing Trichoderma Strain and the Optimization of its Enzyme Production Conditions","fulltext":[{"header":"Introduction","content":"\u003cp\u003eXylan is a complex polysaccharide predominantly found in the cell walls of plants, constituting a major component of hemicellulose. Hemicellulose is an abundant natural resource, contributing approximately 35% to the dry weight of plants, and is extensively present in agricultural by-products, with its abundance in nature being second only to cellulose (Bhardwaj \u003cem\u003eet al\u003c/em\u003e 2019). Xylanase is a complex ensemble of enzymes primarily responsible for the breakdown of xylan; it is not a single enzyme but a combination of various components, including endo-xylanases, β-xylosidases, and branching enzymes (such as α-glucuronidase, α-L-arabinofuranosidase, feruloyl esterase, and acetylxylan esterase), that collaboratively work to effectively decompose xylan (Chaudhary \u003cem\u003eet al\u003c/em\u003e 2023). By employing enzymatic methods, xylan can be efficiently degraded into xylooligosaccharides and xylose, thereby enhancing the development and utilization of xylan.\u003c/p\u003e\u003cp\u003eNumerous organisms are known to produce xylanase. Recent years have seen the documentation of various bacteria, fungi, plants, and animals capable of xylanase production both domestically and internationally (Abena and Simachew 2024). The xylanase produced by fungi exhibits high activity and is primarily extracellular (Paloheimo \u003cem\u003eet al\u003c/em\u003e 2007), facilitating easier isolation and purification. Notable xylanase-producing fungi include Aspergillus spp., Penicillium spp., and Trichoderma spp. (Haltrich \u003cem\u003eet al\u003c/em\u003e 1996). Trichoderma are filamentous fungi capable of synthesizing a variety of enzymes, with xylanase being one of the most significant (He \u003cem\u003eet al\u003c/em\u003e 2009). Compared to other organisms, Trichoderma exhibit a faster reproduction rate and enhanced capabilities to absorb and utilize soil nutrients, playing an integral role in soil bioremediation and promoting crop biomass, as well as providing biological control against plant diseases and pests (Druzhinina \u003cem\u003eet al\u003c/em\u003e 2011). The application of highly active xylanase produced by Trichoderma can effectively diminish chemical pollutants in the papermaking process.\u003c/p\u003e\u003cp\u003eThis study employs soil samples from Nanchang City, Jiangxi Province, to isolate and purify fungi, specifically targeting strains capable of xylanase production. The research focuses on optimizing the conditions for enzyme production and obtaining purified xylanase through ammonium sulfate precipitation, dialysis, and ion-exchange chromatography. Additionally, the study performs protein sequencing and gene analysis to gain deeper insights into the enzymatic characteristics. Ultimately, this research aims to provide high-quality microbial resources for future investigations, and the findings are expected to have significant practical applications.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003eCulture media\u003c/p\u003e\u003cp\u003ePDA medium (g/L) contained peeled potatoes 200, glucose 20, and agar 15.\u003c/p\u003e\u003cp\u003eXylanase fermentation basic medium (g/L) contained xylan 5, NaNO\u003csub\u003e3\u003c/sub\u003e 3, K\u003csub\u003e2\u003c/sub\u003eHPO\u003csub\u003e4\u003c/sub\u003e 1, MgSO\u003csub\u003e4\u003c/sub\u003e\u0026middot;7H\u003csub\u003e2\u003c/sub\u003eO 0.5, KCl 0.5, and FeSO\u003csub\u003e4\u003c/sub\u003e\u0026middot;7H\u003csub\u003e2\u003c/sub\u003eO 0.01, at pH 7.0.\u003c/p\u003e\u003cp\u003eScreening medium (g/L) contained xylan 5, K\u003csub\u003e2\u003c/sub\u003eHPO\u003csub\u003e4\u003c/sub\u003e 1, MgSO\u003csub\u003e4\u003c/sub\u003e\u0026middot;7H\u003csub\u003e2\u003c/sub\u003eO 0.5, KCl 0.5, FeSO\u003csub\u003e4\u003c/sub\u003e\u0026middot;7H\u003csub\u003e2\u003c/sub\u003eO 0.01, and yeast 2, at pH 7.0.\u003c/p\u003e\u003cp\u003eSNA (synthetic nutrient-poor agar) (g/L) contained KH\u003csub\u003e2\u003c/sub\u003ePO\u003csub\u003e4\u003c/sub\u003e 1.0, KCl 0.5, KNO\u003csub\u003e3\u003c/sub\u003e 1.0, MgSO\u003csub\u003e4\u003c/sub\u003e\u0026middot;7H\u003csub\u003e2\u003c/sub\u003eO 0.5, glucose 0.2, sucrose 0.2, agar powder 14.\u003c/p\u003e\u003cp\u003eIdentification of Strain\u003c/p\u003e\u003cp\u003eThe strain was transferred to PDA and SNA plates and colony diameters were measured every 12 h at five different points to generate a growth curve. Once conidia developed, morphological characteristics of conidiophores and conidia were observed under an optical microscope.\u003c/p\u003e\u003cp\u003eGenomic DNA from the target strain was extracted using the CTAB method. Primers were designed to amplify translation elongation factor 1-alpha (tef1) (Zhu and Zhuang 2015), as follows:\u003c/p\u003e\u003cp\u003etef1F: CATCGAGAAGTTCGAGAAGG,\u003c/p\u003e\u003cp\u003etef1R: AACTTGCAGGCAATGTGG\u003c/p\u003e\u003cp\u003ePCR amplification was conducted, and the products were analyzed using 0.1% agarose gel electrophoresis. Following purification, the samples were submitted to Shanghai Bio-engineering Company for sequencing. A phylogenetic tree was constructed using the neighbor-joining (NJ) method by MEGA7 software (Kumar \u003cem\u003eet al\u003c/em\u003e 2016).\u003c/p\u003e\u003cp\u003eScreening of Xylanase-producing Strains\u003c/p\u003e\u003cp\u003eThe strain was inoculated onto potato dextrose agar (PDA) plates and incubated at 28\u0026deg;C for 36 hours in an inverted position. Following this, agar discs, measuring 0.5 cm in diameter, were obtained using a punch, and three discs were transferred to a 250 ml Erlenmeyer flask containing 50 mL of culture medium. The flask was then incubated at 28\u0026deg;C with shaking at 200 rpm for 5 days. Subsequently, the culture was vacuum filtered to collect the broth, which was further filtered through a 0.22 \u0026micro;m-micron filter and stored at -20\u0026deg;C for future enzyme activity assays.\u003c/p\u003e\u003cp\u003eOptimization of Xylanase Production Conditions\u003c/p\u003e\u003cp\u003eFive distinct carbon sources\u0026mdash;1% glucose, maltose, xylan, sucrose, and soluble starch\u0026mdash;were assessed for their ability to support xylanase production. Fermentation was carried out at 28\u0026deg;C and 200 rpm for 5 days. Subsequently, five nitrogen sources\u0026mdash;0.5% potassium nitrate, sodium nitrate, ammonium sulfate, tryptone, and yeast extract\u0026mdash;were evaluated under identical fermentation conditions to determine the optimal nitrogen source. Using the optimal carbon and nitrogen sources, the initial pH of the medium was adjusted to 4.0, 5.0, 6.0, 7.0, and 8.0 to identify the best pH for enzyme production. Finally, the optimized conditions (carbon source, nitrogen source, and pH) were applied to evaluate the effect of fermentation time by conducting experiments over 2, 3, 4, 5, and 6 days. All experiments were performed in triplicate.\u003c/p\u003e\u003cp\u003eDetermination of Xylanase Activity (DNS assay)\u003c/p\u003e\u003cp\u003eThe culture solution was prepared and centrifuged at 4,000 rpm for 15 min at 4\u0026deg;C to collect the supernatant. This supernatant was then filtered through a 0.22 \u0026micro;m filter to obtain the crude enzyme solution. 1 mL crude enzyme solution was mixed with 1 mL of 0.1% xylan solution at room temperature. The mixture was incubated at 37\u0026deg;C for 30 min to allow the xylanase to act on the xylan. The reaction was terminated by boiling for 5 min, after which the mixture was rapidly cooled in cold water for 5 min, followed by the addition of 3 mL of DNS solution and thorough mixing. The mixture was placed in a boiling water bath for 5 min to sustain the reaction for the determination of reducing sugars, after which it was cooled in cold water for 5 min. The absorbance of the prepared control and experimental samples was measured at a wavelength (λ) of 540 nm. The amount of enzyme required to catalyze the production of 1 \u0026micro;g of reducing sugars per min is defined as one unit of enzyme activity (U). The calculation is shown as follow:\u003c/p\u003e\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eU\u0026thinsp;=\u0026thinsp;W\u0026times;N\u0026times;1000∕(T\u0026times;V)\u003c/h2\u003e\u003cp\u003ewhere U is the xylanase activity per mL, W is the glucose concentration obtained from the control glucose standard curve, N is the reaction volume in mL, T is the reaction time in min, 1000 converts mg to \u0026micro;g, and V is the volume of the crude enzyme solution in mL.\u003c/p\u003e\u003cp\u003eXylanase Purification\u003c/p\u003e\u003cp\u003eAmmonium sulfate was progressively added to the crude enzyme solution while stirring at low speed at 4\u0026deg;C until a final concentration of 60% was reached, and stand at 4\u0026deg;C for 1 h. The mixture was then centrifuged at 8,000 rpm for 30 min at 4\u0026deg;C, discarding the supernatant and retaining the precipitate. The precipitate was dissolved in 0.2 mol/L phosphate buffer (pH 7.0). The resulting solution was transferred into a dialysis bag with a molecular weight cutoff of 3,500 Da, which was placed in a container filled with xylan buffer for dialysis at 4\u0026deg;C, with the buffer being replaced every 6 h for a total of six exchanges, until all ammonium sulfate was removed. The treated DEAE-cellulose was packed into a glass adsorption column, and an equal volume of 0.2 mol/L phosphate buffer (pH 7.0) was added to wash the column, designated as the loading solution. Subsequently, 2 mL of enzyme solution was added and allowed to adsorb for 30 min, followed by washing with 5 mL of buffer, designated as the post-loading liquid. Elution was performed using 10 mL of buffer containing 0.5 mol/L NaCl, with the eluted liquid collected. All solutions were stored at 4\u0026deg;C. The protein content was measured using the Coomassie Brilliant Blue method, and enzyme proteins were identified through SDS-PAGE analysis. After SDS-PAGE, the target band was excised and sequence by Sangon Biotech (Shanghai).\u003c/p\u003e\u003cp\u003eAnalysis of the Enzymatic Properties of Xylanase\u003c/p\u003e\u003cp\u003eThe purified enzyme was incubated at 20, 30, 40, 50, 60, 70, and 80\u0026deg;C for 30 min, and the remaining xylanase activity was measured under optimal reaction conditions to analyze the thermal stability of the enzyme. Various pH values (4.0, 5.0, 6.0, 7.0, and 8.0) were also tested to evaluate its acid-base stability.\u003c/p\u003e\u003cp\u003ePhylogenetic tree analysis\u003c/p\u003e\u003cp\u003eThe phylogenetic tree was constructed using the Neighbor-Joining method in MEGA 7.0 software, employing bootstrap analysis with 1000 repetitions. The full-length amino acid sequences of the selected genes were used to construct this tree.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003eStatistical Analysis\u003c/h2\u003e\u003cp\u003eAll data were analyzed using a one-way analysis of variance (ANOVA) in the R programming language (R version 4.3.1).\u003c/p\u003e\u003c/div\u003e"},{"header":"Result and discussion","content":"\u003cp\u003eStrain Screening Results of High-Xylanase Producing Trichoderma Strains\u003c/p\u003e\u003cp\u003eA total of 117 \u003cem\u003eTrichoderma\u003c/em\u003e strains were isolated and purified. The screening process was carried out using shake-flask fermentation, and the results are illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Among the tested strains, strain JK8 demonstrated the highest xylanase activity, thereby designating it as a high-xylanase-producing strain for subsequent experiments.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eIdentification of Xylanase-producing Strains\u003c/p\u003e\u003cp\u003eAs illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea, strain Tsejk8 exhibited rapid growth on PDA medium, characterized by initial white mycelium. After 4 days, it began spore production, and the aerial mycelium became well-developed. In contrast, Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb shows slower growth on SNA medium, with initial white mycelium and spore production commencing after 5 days, accompanied by less developed aerial mycelium.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eObservations under a light microscope, depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec, revealed that the mycelium was white or light-colored, slender, septate, and highly branched. Conidiophores were organized into dense, hemispherical to cushion-like structures, typically displaying extensive branching at acute or nearly right angles, in whorls of 2 to 4, with conidial areas exhibiting various shades of green or gray. As indicated in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed, the conidia were unicellular, spherical, and green. The strain showed rapid growth; as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ee, it reached a diameter of 6.33 cm after 60 h of incubation at 28\u0026deg;C on PDA medium, while on SNA medium, it attained a diameter of 5.5 cm under the same conditions. The limited nutritional components of the SNA medium compared to PDA suggest that nutritional factors minimally impact the growth of this strain. Preliminary identification confirmed JK8 as Trichoderma semiorbis.\u003c/p\u003e\u003cp\u003ePhylogenetic analysis revealed that this strain shares the highest homology with Trichoderma semiorbis isolate HZA10 (OR046019.1), as depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ef, where the strain is positioned in the same branch. Combining molecular biological and morphological identification, the strain was ultimately confirmed as \u003cem\u003eTrichoderma semiorbis\u003c/em\u003e and designated as Tsejk8.\u003c/p\u003e\u003cp\u003eFigure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e Screening of \u003cem\u003eTrichoderma\u003c/em\u003e strains producing xylanase\u003c/p\u003e\u003cp\u003eFigure\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e Growth characteristics of strain Tsejk8. (a) Morphology on PDA medium. (b) Morphology of SNA medium. (c) Characteristics of conidiophores (scale: 10 \u0026micro;m). (d) Characteristics of conidia (scale of 10 \u0026micro;m). (e) Strain growth rate. (f) phylogenetic tree of Tef1 gene cloned from Tsejk8\u003c/p\u003e\u003cp\u003eThe Optimal Culture Conditions for the Production of Xylanase Enzyme\u003c/p\u003e\u003cp\u003eIn order to improve laccase production, the fermentation conditions including carbon source, nitrogen source, initial pH and incubation time were optimized (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Figure\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea illustrates that when xylan served as the carbon source in the culture medium, enzyme activity in the fermentation broth's supernatant was significantly elevated. In contrast, the use of sucrose, glucose, or maltose as carbon sources resulted in lower enzyme activity, suggesting that polysaccharides such as starch and xylan are more effective than monosaccharides or disaccharides in promoting xylanase production by the strain. Dhaver (Dhaver \u003cem\u003eet al\u003c/em\u003e 2022) optimized the culture conditions and medium components for xylanase production by \u003cem\u003eT. harzianum\u003c/em\u003e, discovering that the incorporation of xylan-rich materials, such as wheat bran, significantly improved xylanase yield.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eFigure\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e Optimization of enzyme production conditions of Tsejk8. (a) Carbon sources. (b) Nitrogen sources. (c) Initial pH. (d) Fermentation time. Statistical analysis was conducted using ANOVA in R. Different letters indicate statistically significant differences (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), whereas identical letters denote no significant difference.\u003c/p\u003e\u003cp\u003eWith xylan established as the carbon source, potassium nitrate yielded the lowest enzyme activity in the fermentation broth's supernatant. Conversely, sodium nitrate, ammonium sulfate, peptone, and yeast extract all produced higher enzyme activity, with peptone yielding the highest enzyme activity in the fermentation broth (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb). Organic nitrogen sources, such as tryptone, yeast extract, peptone, and soy meal, have a significant impact on the enhancement of xylanase production. \u003cem\u003eAspergillus\u003c/em\u003e sp. IN5 is reported to be highly productive in the presence of soybean residue (Boondaeng \u003cem\u003eet al\u003c/em\u003e 2024), corn step liquor for \u003cem\u003eT. reesi\u003c/em\u003e (Lappalainen \u003cem\u003eet al\u003c/em\u003e 2000) and peptone for \u003cem\u003ePichia kudriavzevii\u003c/em\u003e. Although no significant differences in enzyme activity were observed among the four nitrogen sources\u0026mdash;sodium nitrate, ammonium sulfate, peptone, and yeast extract. In consideration of prior research findings, we selected peptone as the optimal nitrogen source for strain Tsejk8.\u003c/p\u003e\u003cp\u003eFigure\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec illustrates that when xylan and peptone were employed as the carbon and nitrogen sources, respectively, pH values of 4 and 8 resulted in high enzyme activity in the fermentation broth. Raghukumar (Raghukumar \u003cem\u003eet al\u003c/em\u003e 2004) also observed that the \u003cem\u003eA. niger\u003c/em\u003e strain isolated from mangrove detritus exhibited maximum activity at pH 3.5, with an additional peak at pH 8.5. Additionally, pH 8 is more conducive to the growth of \u003cem\u003eTrichoderma\u003c/em\u003e. therefore, it was selected as the optimal pH. Thus, a pH of 8 is concluded to be the optimal pH for xylanase production by strain Tsejk8.\u003c/p\u003e\u003cp\u003eFigure\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed indicates that when xylan was used as the carbon source, peptone as the nitrogen source, and a pH of 8 was maintained, a cultivation time of 120 h resulted in elevated enzyme activity in the fermentation broth. Although no significant differences in enzyme activity were observed among the 48h, 96h, 120h, and 144h time points, 120h was chosen as the optimal cultivation time based on previous research findings and the growth characteristics of \u003cem\u003eTrichoderma\u003c/em\u003e. Following optimization, the enzyme activity of Tsejk8 reached 40.7 U/mL, indicating a 35.6% increase compared to the levels recorded before optimization.\u003c/p\u003e\u003cp\u003ePurification of Xylanase from Tsejk8\u003c/p\u003e\u003cp\u003eAs presented in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, the initial crude enzyme solution had a total volume of 80 mL, exhibiting a total activity 2,075.491 U/mg. Following the ammonium sulfate precipitation treatment, a clarified enzyme solution with a total volume of 8.2 mL was collected, at which point the total activity increased to 2,530.92 U/mg. Compared to the initial crude enzyme solution, the purification fold reached 1.2, and the enzyme activity recovery rate was 24.4%. Subsequently, after further purification using a DEAE-cellulose ion exchange column, the xylanase solution's total activity exhibited a remarkable increase to 25,625.82 U/mg. In comparison to the initial crude enzyme solution, the purification fold significantly increased to 12.3, and the enzyme activity recovery rate improved to 35.6%.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePurification of Xylanase\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"7\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\"\u0026plusmn;\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePurification Step\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTotal Volume (mL)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTotal Activity (U)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eTotal Protein (mg)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eSpecific Activity (U/g)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eRecovery Rate (%)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c7\"\u003e\u003cp\u003ePurification Fold\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCrude Enzyme Solution\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e80\u0026thinsp;\u0026plusmn;\u0026thinsp;4.50\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e1516.3\u003c/p\u003e\u003cp\u003e\u0026plusmn;\u0026thinsp;107.45\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.73\u003c/p\u003e\u003cp\u003e\u0026plusmn;\u0026thinsp;0.065\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e2.08\u003c/p\u003e\u003cp\u003e\u0026plusmn;\u0026thinsp;0.041\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e100\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAmmonium Sulfate Precipitation and Dialysis\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e8.2\u0026thinsp;\u0026plusmn;\u0026thinsp;0.75\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e369.64\u003c/p\u003e\u003cp\u003e\u0026plusmn;\u0026thinsp;39.65\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.15\u003c/p\u003e\u003cp\u003e\u0026plusmn;\u0026thinsp;0.016\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e2.53\u003c/p\u003e\u003cp\u003e\u0026plusmn;\u0026thinsp;0.012\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e24.4\u003c/p\u003e\u003cp\u003e\u0026plusmn;\u0026thinsp;0.89\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e1.2\u003c/p\u003e\u003cp\u003e\u0026plusmn;\u0026thinsp;0.029\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAnion Exchange Chromatography\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\"\u0026plusmn;\" colname=\"c2\"\u003e\u003cp\u003e13\u0026thinsp;\u0026plusmn;\u0026thinsp;0.60\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e539.40\u003c/p\u003e\u003cp\u003e\u0026plusmn;\u0026thinsp;39.9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e0.02\u003c/p\u003e\u003cp\u003e\u0026plusmn;\u0026thinsp;0.004\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e25.63\u003c/p\u003e\u003cp\u003e\u0026plusmn;\u0026thinsp;2.625\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e35.6\u003c/p\u003e\u003cp\u003e\u0026plusmn;\u0026thinsp;2.11\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e12.3\u003c/p\u003e\u003cp\u003e\u0026plusmn;\u0026thinsp;1.019\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e Purification of Xylanase\u003c/p\u003e\u003cp\u003eEnzymatic Characterization\u003c/p\u003e\u003cp\u003eThe fermentation broth of strain Tsejk8 was filtered using a 0.22 \u0026micro;m membrane to obtain a crude enzyme solution (corresponding to lane 1 in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea), which initially removed large molecular impurities from the fermentation broth, establishing a foundation for the subsequent purification process. The crude enzyme solution was then processed through ammonium sulfate precipitation. This method leveraged the differences in protein solubility at varying salt concentrations to achieve preliminary enrichment of the target protein, with the resulting precipitate corresponding to lane 2 in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea. The ammonium sulfate-precipitated sample then underwent further purification via DEAE-cellulose ion exchange chromatography. Utilizing the principle of ion exchange, the target xylanase was separated from other impurities based on the charge properties and quantities of the proteins. The treated sample post this step is presented in lane 3 of Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea. SDS-PAGE electrophoresis was performed on samples at each stage, indicate that as the purification process advances, the number of protein bands progressively decreases, ultimately revealing five principal bands with molecular weights ranging from 35 to 100 kDa.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eEffect of Temperature and pH on Xylanase Activity\u003c/p\u003e\u003cp\u003eThe enzyme activity was measured across six different temperatures. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB, within the temperature range of 20 to 30\u0026deg;C, enzyme activity gradually increased with rising temperature. The xylanase activity for strain Tsejk8 peaked at 30\u0026deg;C after a 30-min reaction. Although elevated temperatures from 30 to 40\u0026deg;C also resulted in high enzyme activity after 30 min, the activity was lower compared to that observed at 30\u0026deg;C. Beyond 50\u0026deg;C, enzyme activity rapidly declined. Therefore, the optimal reaction temperature for strain Tsejk8 is approximately 30\u0026deg;C. Figure\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC illustrates that within a pH range of 3.0 to 4.0, enzyme activity increased with increasing pH, peaking at pH 4.0. However, in the pH range of 4.0 to 8.0, enzyme activity significantly decreased as pH continued to rise, suggesting that xylanase produced by strain Tsejk8 is an acidophilic enzyme, with an optimal pH of 4.0.\u003c/p\u003e\u003cp\u003eFigure\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e Properties of xylanase. Effect of temperature and pH on xylanase activity. (a) SDS-PAGE electropherogram. M, marker. Lane1, crude fermentation broth. Lane2, ammonium sulfate precipitation. Lane3, DEAE-cellulose ion-exchange chromatography. (b) Effect of temperature on xylanase activity. (c) Effect of pH on xylanase activity.\u003c/p\u003e\u003cp\u003eAnalysis of Xylanase-related Proteins\u003c/p\u003e\u003cp\u003eUpon excising the protein bands and conducting sequencing, we identified 14 proteins with molecular weights ranging from 41.6 to 98.9 kDa. Domain analysis revealed that two of these proteins (Tsebxl01 and Tsebxl02) belong to the PLN03080 superfamily (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). Clustering analysis indicated that Tsebxl01 has the highest homology with the BXL1 protein of \u003cem\u003eT. guizhouense\u003c/em\u003e, while Tsebxl02 exhibits the highest homology with the BXL1 protein of \u003cem\u003eT. simmonsii\u003c/em\u003e, both of which are classified within the xylanase family. Xylanolytic enzymes are classified as glycoside hydrolases (GH) based on homologies in structural elements and hydrophobic clusters, and they are organized into several families, namely 5, 7, 8, 9, 10, 11, 12, 16, 26, 30, 43, 44, 51, and 62. These enzymes are capable of hydrolyzing the β-1,4-glycosidic linkages in xylosides (Nguyen \u003cem\u003eet al\u003c/em\u003e 2018). In this study, we cloned two β-xylosidases, Tasbxl01 and Tasbxl02, which belong to the GH3 family.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e Analysis of Proteins\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eAnalysis of Proteins\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"6\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eAccession\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSore Sequest\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eMW (kDa)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCalc.pI\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eSize of mRNA(bp)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eNote\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTsejk801\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e2.49\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e61.9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e6.23\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e1731\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eIsoamyl alcohol oxidase\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTsejk802\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e13.27\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e69\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e5.6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e1989\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eXyloglucanase\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTsejk803\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e2.35\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e77.2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e7.23\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e2205\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eGH3 beta-glucosidase\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTsebxl01\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e35.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e86.7\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e5.55\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e2388\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eGH3 beta-xylosidase\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTsejk805\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e12.38\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e80.4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e6.98\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e2283\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eGlucan endo-1,3-beta-glucosidase\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTsejk806\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e2.87\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e67.5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e5.29\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e1902\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eGH15 glucamylase\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTsebxl02\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e10.24\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e81\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e5.45\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e2295\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eGH3 beta-xylosidase\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTsejk808\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e8.93\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e62.5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e7.01\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e1731\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eAmidase\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTsejk809\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e82.71\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e83\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e7.4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e2328\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eGH55 exo-1 3-beta-glucanase\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTsejk810\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e43.36\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e61.5\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e6.07\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e1728\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eGH71, alpha-1,3-glucanase\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTsejk811\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e24.46\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e53.9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e5.47\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e1464\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eGlutaminase A\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTsejk812\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e2.41\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e41.6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e5.69\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e1128\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eActin\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTsejk813\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e2.33\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e98.9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e5.74\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e2673\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eExo-beta-D-glucosaminidase\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTsejk814\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e2.41\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e92.6\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e6.9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e\u003cp\u003e2637\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003eSubtilisin-like protease PPRC1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"6\"\u003eNotes: Score Sequest: The sum of peptide scores reflects the overall confidence in protein identification; a higher score indicates greater reliability.\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eFigure\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e Analysis of the xylanase proteins. (a) Domain of the 16 proteins; (b) phylogenetic tree of two xylanase proteins\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eThis study provides the inaugural report on the production and characterization of xylanase activity from \u003cem\u003eT. semiorbis\u003c/em\u003e. The properties of the xylanase preparation derived from strain Tsejk8 indicate its potential application in industrial processes that require high stability and optimal activity at acidic pH, such as in animal feed. Furthermore, the identification of two xylanase genes will facilitate investigations into the molecular mechanisms governing xylanase production by this strain, thereby establishing a theoretical foundation for genetically modifying the strain to enhance xylanase production at the molecular level.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eConflict of interest\u003c/h2\u003e\n\u003cp\u003eThe authors declare that they have no conflict of interest.\u003c/p\u003e\n\u003ch2\u003eEthical standards\u003c/h2\u003e\n\u003cp\u003eThis study focused on the analysis of fungi. The work does not describe any studies involving human participants or animals. Our manuscript complies with the Ethical Rules applicable.\u003c/p\u003e\n\u003ch2\u003eFunding\u003c/h2\u003e\n\u003cp\u003eThis work was supported by National Natural Science Foundation of China 31660020, Science and Technology Project Founded by the Education Department of Jiangxi Province GJJ151252, GJJ161233.\u003c/p\u003e\n\u003ch2\u003eAuthor contribution statement\u003c/h2\u003e\u003cp\u003eHu performed the cultivation. Liu performed DNA extraction. Fu designed the experiments, and contributed to the writing of the manuscript. Fan supervised the project and reviewed the manuscript, provided computational support and contributed to the writing of the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAbena T, Simachew A (2024). A review on xylanase sources, classification, mode of action, fermentation processes, and applications as a promising biocatalyst. Biotechnologia 105, 273\u0026ndash;285. http://doi.org/10.5114/bta.2024.141806\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBhardwaj N, Kumar B, Verma P (2019). A detailed overview of xylanases: an emerging biomolecule for current and future prospective. Bioresources and Bioprocessing 6. http://doi.org/10.1186/s40643-019-0276-2\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBoondaeng A, Keabpimai J, Trakunjae C, Vaithanomsat P, Srichola P, Niyomvong N (2024). Cellulase production under solid-state fermentation by \u003cem\u003eAspergillus\u003c/em\u003e sp. IN5: Parameter optimization and application. Heliyon 10. http://doi.org/10.1016/j.heliyon.2024.e26601\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChaudhary R, Kuthiala T, Singh G, Rarotra S Kaur A, Arya S K, Kumar P (2023). Current status of xylanase for biofuel production: a review on classification and characterization. Biomass Conversion and Biorefinery 13, 8773\u0026ndash;8791. http://doi.org/10.1007/s13399-021-01948-2\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDhaver P, Pletschke B, Sithole B, Govinden R (2022). Optimization, purification, and characterization of xylanase production by a newly isolated \u003cem\u003eTrichoderma harzianum\u003c/em\u003e strain by a two-step statistical experimental design strategy. Scientific reports 12, 17791. https://doi.org/10.1038/s41598-022-22723-x\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDruzhinina I S, Seidl-Seiboth V, Herrera-Estrella A, Horwitz B A, Kenerley C M, Monte E, Mukherjee P K, Zeilinger S, Grigoriev I V, Kubicek C P (2011). \u003cem\u003eTrichoderma\u003c/em\u003e: the genomics of opportunistic success. Nature Reviews Microbiology 9, 749\u0026ndash;759. https://doi.org/10.1038/nrmicro2637\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHaltrich D, Nidetzky B, Kulbe K D, Steiner W, Zupancic S (1996). Production of fungal xylanases. Bioresource Technology 58, 137\u0026ndash;161. https://doi.org/10.1016/s0960-8524(96)00094-6\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHe J, Yu B, Zhang K, Ding X, Chen D (2009). Expression of endo-1, 4-beta-xylanase from \u003cem\u003eTrichoderma reesei\u003c/em\u003e in \u003cem\u003ePichia pastorisand\u003c/em\u003e functional characterization of the produced enzyme. BMC Biotechnology 9. https://doi.org/10.1186/1472-6750-9-56\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKumar S, Stecher G, Tamura K J M b (2016). MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. 33, 1870\u0026ndash;1874. https://doi.org/10.1093/molbev/msw054\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLappalainen A, Siika-Aho M, Kalkkinen N, Fagerstrom R, Tenkanen M J B, biochemistry a (2000). Endoxylanase II from \u003cem\u003eTrichoderma reesei\u003c/em\u003e has several isoforms with different isoelectric points. 31, 61\u0026ndash;68. https://doi.org/10.1042/BA19990066\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNguyen S T, Freund H L, Kasanjian J, Berlemont R (2018). Function, distribution, and annotation of characterized cellulases, xylanases, and chitinases from CAZy. Applied microbiology biotechnology 102, 1629\u0026ndash;1637. https://doi.org/10.1007/s00253-018-8778-y\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePaloheimo M, Mantyla A, Kallio J, Puranen T, Suominen P (2007). Increased Production of Xylanase by Expression of a Truncated Version of the \u003cem\u003exyn11A\u003c/em\u003e Gene from \u003cem\u003eNonomuraea flexuosa\u003c/em\u003e in \u003cem\u003eTrichoderma reesei\u003c/em\u003e. Applied and Environmental Microbiology 73, 3215\u0026ndash;3224. https://doi.org/10.1128/aem.02967-06\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRaghukumar C, Muraleedharan U, Gaud V, Mishra R (2004). Xylanases of marine fungi of potential use for biobleaching of paper pulp. Journal of Industrial Microbiology Biotechnology 31, 433\u0026ndash;441. https://doi.org/10.1007/s10295-004-0165-2\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhu, Z., and Zhuang, W. J. M. (2015). Three new species of \u003cem\u003eTrichoderma\u003c/em\u003e with hyaline ascospores from China. Mycologia 107, 328\u0026ndash;345. https://doi.org/10.3852/14-141\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"biotechnology-letters","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bile","sideBox":"Learn more about [Biotechnology Letters](https://www.springer.com/journal/10529)","snPcode":"10529","submissionUrl":"https://submission.nature.com/new-submission/10529/3","title":"Biotechnology Letters","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Trichoderma semiorbis, Xylanase, Single-factor optimization, Protein sequencing","lastPublishedDoi":"10.21203/rs.3.rs-7863122/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7863122/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003ePurpose\u003c/h2\u003e\u003cp\u003eXylanases have attracted considerable attention due to their excellent potential industrial uses.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e\u003cp\u003eIn this study, a xylanase producing strain was isolated from soil and identified as Trichoderma semiorbis Tsejk8, and the conditions for xylanase production were optimized. Additionally, two xylanase-related genes were cloned, and their functions were analyzed. The results indicated that the optimal conditions for xylanase production included maltose as the carbon source, peptone as the nitrogen source, an optimal pH of 6.0, and an incubation time of 120 h, yielding an enzyme activity of 40.7 U/mL. Following the purification of the protein via ammonium sulfate precipitation and ion exchange chromatography, four distinct protein bands were observed. Mass spectrometry analysis of these bands identified 14 associated proteins. Bioinformatics analysis revealed that two of these proteins belongs to GH3 (Glycoside Hydrolase family 3) beta- xylosidase.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e\u003cp\u003eIn summary, the newly isolated strain Tasjk8 exhibits xylanase activity, which offers an effective and eco-friendly means of converting biomass into raw materials for industrial applications.\u003c/p\u003e","manuscriptTitle":"Screening of the Xylanase-producing Trichoderma Strain and the Optimization of its Enzyme Production Conditions","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-11-11 09:04:11","doi":"10.21203/rs.3.rs-7863122/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2025-11-02T06:38:54+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-10-30T21:36:18+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-10-18T13:42:13+00:00","index":"","fulltext":""},{"type":"submitted","content":"Biotechnology Letters","date":"2025-10-17T21:20:40+00:00","index":"","fulltext":""},{"type":"decision","content":"Major revisions","date":"2025-10-17T10:29:47+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"biotechnology-letters","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bile","sideBox":"Learn more about [Biotechnology Letters](https://www.springer.com/journal/10529)","snPcode":"10529","submissionUrl":"https://submission.nature.com/new-submission/10529/3","title":"Biotechnology Letters","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"df774b0a-667b-489c-8c83-817f87c46284","owner":[],"postedDate":"November 11th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-03-23T16:00:59+00:00","versionOfRecord":{"articleIdentity":"rs-7863122","link":"https://doi.org/10.1007/s10529-026-03718-4","journal":{"identity":"biotechnology-letters","isVorOnly":false,"title":"Biotechnology Letters"},"publishedOn":"2026-03-16 15:58:24","publishedOnDateReadable":"March 16th, 2026"},"versionCreatedAt":"2025-11-11 09:04:11","video":"","vorDoi":"10.1007/s10529-026-03718-4","vorDoiUrl":"https://doi.org/10.1007/s10529-026-03718-4","workflowStages":[]},"version":"v1","identity":"rs-7863122","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7863122","identity":"rs-7863122","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}