Bioengineered hybrid electrospun scaffold of Polycaprolacton/Gelatin-nano- hydroxyapatite, coated with platelet-rich fibrin, for enhanced osteogenesis and bone healing using adipose derived stem cells

preprint OA: closed
Full text JSON View at publisher
Full text 153,779 characters · extracted from preprint-html · click to expand
Bioengineered hybrid electrospun scaffold of Polycaprolacton/Gelatin-nano- hydroxyapatite, coated with platelet-rich fibrin, for enhanced osteogenesis and bone healing using adipose derived stem cells | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Bioengineered hybrid electrospun scaffold of Polycaprolacton/Gelatin-nano- hydroxyapatite, coated with platelet-rich fibrin, for enhanced osteogenesis and bone healing using adipose derived stem cells Khalil Pestehei, Mahdieh Ghiasi, Sepideh Moradkhani, Bita Fazel, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7462422/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background: Fractures, which may occur from trauma, tumor removal, or age-related decline, continue to be problematic within orthopedic practice. Tissue engineering has recently developed new opportunities for bone repair that combine biological agents with biomaterials. We developed a nanofibrous scaffold of polycaprolactone and gelatin (PCL/GEL) reinforced with nano-hydroxyapatite and different levels of Platelet-Rich Fibrin (PRF). We developed scaffolds using electrospinning or freeze-drying processes to create different scaffold configurations. Cell viability was tested using the MTT assay at 1-, 3- and 7-days. We also measured expression of bone-specific genes using Real Time PCR and assessed cell morphology with histological techniques. Results: The three-layer scaffold with a medium PRF concentration resulted in measurably higher cell viability. We continued to analyze the ability to support osteogenic differentiation by performing RT-qPCR for COL1, RUNX2 and COLX gene expression on day 14. The PRF concentration of collagen II expression and our analysis of morphology also supported the findings within the medium PRF group. Conclusion: Our findings demonstrated that this scaffold formulation enhanced cell viability and the expression of bone-specific genes, making it a potential option for bone tissue engineering. Bone Regeneration composite nanofiber/Fibrin-Rich Plasma Osteogenesis electrospinning technique Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Background Bones are essential for movement and organ protection, but bone defects can cause extreme damage and require long-term treatments [ 1 ]. As the population ages, bone diseases like osteopenia and osteoporosis are steadily increasing, which is leading to fractures every 3 seconds incidence, with an estimated 125 million affected individuals [ 2 ]. The economic burden of these injuries is expected to exceed $ 8.3 billion by 2023. Although bones have natural regenerative abilities, healing is often insufficient after diseases and trauma [ 3 ]. Currently, treatments such as surgery and transplantation, are the most effective options. Autologous bone grafting is considered the standard for repairing bone defects due to the fact that it will result in osteogenic cells, growth factors, and a natural scaffold. These components are essential for successful bone repair. However, some disadvantages exist. It can cause pain, increase the risk of infection, lead to bleeding, and require longer surgery times, these factors may offset its potential benefits. Grafts originate from genetically different donors of the same species. While they spare the need for another surgical site, these may have potential risks, such as pathogen transmission, immune system response, and poor blood supply, which can obstruct healing. Despite the successes of bone grafts in the treatment of skeletal defects, several limitations still arise. For instance, a shortage of donors, possibility of rejection, surgical complications, and sometimes the need for later surgeries can lead to failure rates of up to 50% [ 4 , 5 ]. Therefore, new alternative bone substitute materials are needed to improve the healing process [ 6 – 8 ]. Bone regenerative scaffolds can act as 3-dimensional conductive substrates that allow for cell attachment and infiltration, provide mechanical stability, and act as a template for new bone formation. In this context, engineered scaffolds are very promising as new, productive options [ 9 ]. The ECM represents a mixture of critical biomolecules and is very complex from a biological standpoint. The ECM provides mechanical, structural, and biochemical support to surrounding cells, while also allowing the tissue microenvironment to perform its normal physiological function [ 10 ]. It is important to understand the ECM as it relates to the design of ideal scaffold structures. Accordingly, investigating ways to successfully develop nanofiber/hydrogel composites and the appropriate choice of scaffold biomaterials is vital to advance regenerative medicine techniques. Both synthetic polymers and natural substances can be used in tissue engineering for scaffold construction. Among synthetic options, Polycaprolactone has some of the best biocompatibility, is least likely to provoke an immune reaction, is cheaper than many alternatives, has structural diversity, can be dissolved in a number of organic solvents, and can have many uses in medicine [ 11 , 12 ]. Nevertheless, PCL's hydrophobicity continues to limit surface porosity which can hinder cellular adhesion, growth and differentiation. Therefore, to address these limitations, PCL is commonly mixed with natural polymers to improve the PCL bio-functionality [ 13 ]. Natural biopolymers, such as gelatin, are very similar to the macromolecular matrix of the ECM. these biopolymers provide properties of biocompatibility, biodegradability, and bioactivity, which are essential for promoting cell growth and tissue integration [ 13 – 15 ]. Among the biopolymers discussed, gelatin (GEL) has many types of functional groups with which to create hydrogels, including hydroxyls to improve mechanical performance through crosslinking with ligands. The mechanical properties of gelatin hydrogels made by electrospinning (ES) are generally rigid and brittle which could affect mechanical performance [ 16 ]. When gelatin (GEL) is combined with PCL, scaffolds that are strong are generated that can promote tissue growth. Natural polymers have biological functionality that is complemented by the strength and durability of synthetic polymers [ 17 , 18 ]. Electrospinning method has advantages over traditional mechanical techniques. Direct current electrospinning uses electrical forces to pull charged polymer solutions into fibers, usually with diameters between 50 and 1000 nm, which can allow the ability to produce more uniform [ 19 ]. Therefore, electrospun fibers can model ECM structure to to provide a natural environment for cellular interaction [ 20 , 21 ]. In addition, the cortex shields the drug contained within the core layer, enhancing the drug's stability. The drug delivery system has the potential to minimize the distance of diffusion and increase solubility and efficacy, making it a good carrier for drug release [ 22 ]. The organic components primarily consist of collagen nanofibrils, the elastic protein that will improve fracture resistance. The inorganic components consist of hydroxyapatite (HA) nanocrystals, which are attached to the surface of collagen nanofibrils. A proper organic-inorganic matrix is critical to healthy bone growth. Thus, if a scaffold is made of organic (a protein molecule with a similar structure) and inorganic (HA) nanomaterials, the organic-inorganic structure would mimic the proliferating cells embedded in the ECM [ 23 ]. Hydrogel scaffolds with nanoparticle reinforcement, in particular, show great potential for improving the structural properties and regenerative properties of regular hydrogel scaffold composites. For example, adding nHA to engineered PCL/GEL scaffolds improved the structural properties of the scaffold and the bioactivity of PCL [ 24 ]. The improvement provides comfort that newly regenerated bone tissue would not exist on PCL alone and may suggest a stronger integration and overall, more effective bone regeneration [ 25 ]. PRF is a fibrin-based biomaterial consisting of a dense fibrin matrix containing leukocytes, platelets and proteins involved in the healing process [ 24 ]. The use of an autologous scaffold reduces the risk of immune rejection and addresses biocompatibility problems associated with synthetic scaffolds. Another important function of leukocytes in PRF is modulating the immune response by secreting anti-inflammatory cytokine IL-4, and IL-10, which regulate excessive inflammation and lead to the conversion of macrophages into the pro-regenerative M2 type [ 26 ]. Moreover, leukocyte-derived antimicrobial peptides from PRF lower infection risks—an important characteristic with PCL implants that are likely to be subject to bacterial colonization—without inciting chronic inflammation. The management of osteogenesis include platelet-derived growth factors such as vascular endothelial growth factor (VEGF), transforming growth factor (TGF), and the platelet-derived growth factor (PDGF), as these all work together in orchestrating cellular responses for bone formation and repair. Vascular endothelial growth factor induces new blood vessel formation (angiogenesis) and osteogenesis, when vascularized, will allow for continued mesenchymal stem cell population and bone-inducing condition which surrounds the osteoprogenitor cells which is optimal for bone formation. PDGF acts as a chemoattractant for mesenchymal cells, initiating intracellular signal transduction pathways, to facilitate their proliferation, migration and differentiation into an osteogenic lineage. In addition to PDGF, VEGF-mediated angiogenesis provides a nutrient source and progenitor cells, while PDGF acts directly to proliferate and differentiate cells attached to scaffolds. This study will assess the appropriate nanofiber layers of PCL/GEL scaffolds with RPF for cell viability and osteogenic gene expression in ADMSCs to establish as a potential scaffold for tissue engineering applications targeting bone repair. Methods ADMSCs isolation and characterization Adipose tissue samples were obtained from four healthy female patients, aged between 28 and 50 years, who underwent elective surgery at Imam Khomeini Hospital under the ethical principles and the national norms and standards evaluated by the research ethics committee of the neuroscience institute of Tehran university of mediacal sciences, Iran (Approval ID: IR.TUMS.NI.REC.1402.038). During this process, those samples required multiple washes with phosphate buffered saline (PBS) (Gibco, Invitrogen) and penicillin-streptomycin (Pen/Strep). Subsequently, the adipose tissue fragments should be finely minced with extensive washing PBS, 1% gentamicin, and 2% Pen/Strep to eliminate any remaining debris and blood cells. Furthermore, the tissue samples were digested with collagenase Type I (0.075%) (Sigma Aldrich). The mixture was incubated for 50 minutes at 37°C, and was gently agitated to achieve free cell liberation. To stop the action of the Collagenase, 10% FBS in media α-MEM was used to neutralize the buffer, and it was subsequently centrifuged at 1800rpm for 10 minutes. The pellet was re-suspended in α-MEM with 20% FBS and 1% Pen/Strep, and the final supernatant was centrifuged again. The final pellet was placed in a T75 flask along with α-MEM, 20% FBS, and 1% Pen/Strep, and was incubated at 37 ˚C with 5% CO₂ for 48 hours. After 48 hours, the culture medium was replaced every two days until the cultured cells reached ~ 90% confluence. Preparation of platelet‑rich fibrin (PRF) Blood samples were first obtained from ten healthy volunteers. The samples were centrifuged for 15 minutes at 3500 rpm. The buffy coat, which contains PRF was collected into a neural tube. Preparation of PCL/Gel-nHA scaffold by electrospinning technique In the first step, PCL and gelatin were dissolved at 30:70 ratio in solution mixture of 1:9 ratio of acetic acid and formic acid and stirred for 3 hours. Next, nHA was made at a concentration of 15%. The nanoparticle suspension was ultrasonicated at 40 W for 2minutes to obtain a uniform dispersion. The two prepared solutions were mixed and stirred for 1 hour to obtain a uniform homogenous nanocomposite solution. The prepared solution was subsequently loaded into a 5 mL syringe for electrospinning. (Full Option Lab2 ESI-II, Nano Azma Co, Iran, Ayatollah Rafsanjani Tissue Engineering Research Institute). Electrospun nanofibers were collected over a period of 2 hours (sample collection speed 5 mm/s, collector rotating 250 rpm). An applied voltage of 25 kV was applied with a permitted distance of 12 cm from a needle tip to a collector. Preparation of nHA-PRF with the PCL/Gel-nHA scaffold A 24-well plate was used as a mold to construct the scaffold. To determine the optimal concentration of nHA-PRF for deposition onto a PCL/GEL scaffold, three different concentrations were prepared, each with a varying number of nanofiber layers. The concentrations consisted of 18 µl, 36 µl, and 54 µl of PRF were used with scaffolds composed of 4, 3, and 2 nanofiber layers, respectively, in combination with a 10% nHA solution. Then, each was preserved at -20°C for 48 hours to remove moisture for further examination. Morphology characterization of the scaffold Scanning Electron Microscopy (SEM) of nHA-PCL/GEL-loaded PRF was performed, illustrating the overall morphology and physical structure of the scaffolds at various magnifications. Fourier Transform Infrared (FTIR) Spectroscopy To evaluate the synthesis of the composite scaffold and the chemical structures of PCL/Gel and PCL/Gel-nHA, an FTIR analysis was performed using a PE1760x model device, operating in the spectral range of 4000–400 cm⁻¹. MTT Assay The MTT assay evaluated the proliferation and viability of MSCs derived from adipose tissue cultured on PCL/GEL- nHA scaffolds enriched with PRF. The MTT assay is a colorimetric method commonly used to measure cell viability based on mitochondrial activity. This technique checks the activity of mitochondrial dehydrogenase enzymes in live cells, which reduce MTT substrate, a yellow color reagent, into insoluble purple formazan crystals. These crystals' concentrations are then quantified after solubilization, and their concentration is quantified. To determine the optimal concentration of PRF for treating scaffolds, ADMSCs were seeded onto multilayer scaffolds at a density of 1×10 4 cells per scaffold. After incubation for 1, 3, and 7 days, the three different concentrations of PRF were tested. Then, 40 µl of MTT solution (Sigma Aldrich) was added to each well and incubated for 4 hours at 37°C. After the 4-hour incubation, the media from all wells was carefully removed, and 200 µl of DMSO was added to each well to dissolve the formazan crystals that were developed during the assay. Finally, the optical density (OD) of each well was read using an ELISA reader at 570 nm. RNA extraction and RT-qPCR assays In this study, ADMSCs were induced to undergo osteogenic differentiation to evaluate the scaffold's effect on COLI, COLX, and RUNX2 expression. To achieve this aim, the three multilayer scaffolds with three different concentrations of PRF were incubated in MEMα medium for 3 hours. After incubation, 5 × 10 5 ADMSCs were seeded onto each scaffold. The scaffolds with seeded cells were incubated for 90 minutes. Following this period, osteogenic differentiation medium (ɑ MEM, FBS 10%, Dexamethasone 1µM, Insulin 10µg/ml, Indomethacin 100µM, IBMX 500 µM, L- Glutamine 2mM (Gibco, Invitrogen), Pen/strep 1%) was added to the cultures, and then the scaffolds were then maintained in an incubator for 14 days at 37°C, with 5% CO₂ and 90% humidity. In the subsequent step, treated scaffolds with cells were collected for RNA extraction. Initially, the scaffolds were fragmented with nitrogen and then added 1mL of cold RNX for 5 × 105 cells and incubated for 15 minutes on ice. After that, 200µL of cold chloroform (Merck) was added and incubated on ice. Then the solution was centrifuged at 12,000 × g for 15 minutes at 4°C. The upper phase containing the RNA was carefully removed to a new tube and mixed with 500µL of cold isopropanol (Merck) for 15 minutes on ice. After that, centrifuged, washed the RNA pellet with ethanol and centrifuged to dry and resuspended in 20µl of DEPC treated water (CinnaGen). The obtained total RNA with 0.4µg concentrates immediately converted to cDNA following qPCRBIO cDNA Synthesis Kit solutions and 20µL volume with DEPC water. Finally incubated to 30 minutes at 42°C and to 10 minutes at 80°C to inactivate the RTase (Fermentas). 2 µL cDNA along with 1 µL of each forward (F) and reverse (R) primers and 12 µL SYBR-Green-qPCR were made and volume into 20 by ddH 2 O for qPCR evaluation using Rotor-Gene® Q 5plex HRM System (QIAGEN®). The system modes include one initial hold phase for 2 minutes at 95 o C, 40× cycles of 5 seconds of denaturation at 95°C, 30 seconds annealing 64 o C, and finally 55–95 o C melting for Ct analysis, which makes qPCR highly optimized and specific. The amplification cycles were analyzed using Rotor-Gene software, which calculated Ct values by comparing the target gene expressions to β-actin as the reference gene. The primer sequences are as shown in (Table 1 ). Table 1 Sequence of designed primers and expected fragment size Genes Sense strand Antisense strand Size of product β-actin TGGGGTGGCTTTTAGGATGG AGGTTCACAATGTGGCCGAG 114 bp Col I TTCTCGCTCTCGTTCAGAAGTCTC AGTACCCGCACTTGCACAAC 76 bp RUNX2 CTTGGGTGGGTGGAGGATTC TGGCAGTCACATGGCAGATT 136 bp COLX GCTGAACGATACCAAATGCC TGGTGGACCAGGAGTACCTT 132 bp Immunohistochemistry IHC for Collagen II isolated antigens and tissue sections were placed in 10 mM sodium citrate buffer (pH 6.0) and heated at 95°C for 20 minutes. Endogenous peroxidase was blocked with 3% hydrogen peroxide for 10 minutes. The sections were then incubated overnight at 4°C with a rabbit anti-human Collagen II polyclonal antibody (Abcam, ab34712, 1:200 dilution). The next day, sections were treated for 1 hour at room temperature with a horseradish peroxidase (HRP) conjugated goat anti-rabbit secondary antibody (Abcam, ab6721, 1:500 dilution). For visualization, the sections used 3,3'-diaminobenzidine (DAB) as the substrate (Dako) and were counterstained with hematoxylin. Images were taken at 40x magnification using an Olympus BX51 microscope (Olympus, Tokyo, Japan) [ 27 ]. Hematoxylin and Eosin (H&E) Staining For H&E staining, the tissue sections were stained with hematoxylin (Sigma-Aldrich) for five minutes to stain the nuclei, rinsed with tap water, followed by 2 minutes of staining with eosin (Sigma-Aldrich) to stain the cytoplasm and the extracellular matrix. The tissues were dehydrated in a serial concentration of ethanol and cleared in xylene. The sections were mounted using Entellan (Merck, Darmstadt, Germany). Images were taken using an Olympus BX51 microscope at magnifications of 10x and 40x. [ 28 ] Statistical analysis Statistical analysis was conducted using SPSS 21.0 for Windows. Quantitative variables are expressed as mean ± standard error of the mean (SEM). Group differences were evaluated by one-way analysis of variance (One-Way ANOVA), with P < 0.05 considered statistically significant. Results Phenotypic Evaluation of Adipose Tissue-Derived Stem Cells Using Inverted Light Microscopy When conducting morphological evaluations, these cells exhibited a predominantly spindle-shaped appearance, resembling fibroblasts (Fig. 1 ). Structural analysis of composite scaffolds using SEM The structural characteristics of the scaffolds produced in this study was characterized under a scanning electron microscope (SEM) in three different stages. In the first stage, the morphology of a polycaprolactone/gelatin scaffold at a ratio of 70/30 was analyzed. In the second stage, the structural features of a polycaprolactone/gelatin scaffold containing 15% hydroxyapatite nanoparticles at a 70/30/15% ratio was described. In the third stage, the structural characteristics of a polycaprolactone/gelatin scaffold containing 15% hydroxyapatite nanoparticles and added 10–100% fibrin-rich plasma (PRF) was examined, forming a composite of 70/30/15%-10/100% ( Fig. 2 ). FTIR Spectroscopy Analysis The FTIR analysis revealed distinct vibrational bands indicating the structural contributions of various functional groups present in the scaffold compositions (Fig. 3 ). The PCL/Gel spectrum demonstrated characteristic bonds of esters, carbonyl, and alkyl chains. Upon the incorporation of nHA, the PCL/Gel-nHA spectrum exhibited additional peaks consistent with phosphate groups and nitrogen-containing moieties, alongside intensified and broadened bands in the hydroxyl and amine regions. These spectral modifications confirm the structural presence of nHA and PRF, suggesting potential molecular interactions between the bioactive additives and the polymer network. The appearance of combined features in the composite spectra highlights the successful integration and compatibility of the scaffold constituents (Fig. 3 ). The characteristic absorption bands of each component are observed in their respective spectra. PCL/Gel show prominent peaks at 1041–1171, 1726 cm⁻¹, and 2942 cm⁻¹, corresponding to C-O (alcohol/ether), C = O (carbonyl), and, CH (alkane) stretching respectively. PCL/Gel/nHA exhibit a peak at 690 cm⁻¹ for PO 4 − 3 (phosphate) stretching, 1028 cm⁻¹ (C = O) at 1534–1605 cm⁻¹ for N-H, C = C (amide/aromatic), 2930 cm⁻¹ (CH) and, 3293 cm⁻¹ for O-H, N-H (hydroxyl and amine) stretching. These peaks confirm the successful incorporation of PRF into the nanocomposite scaffold matrix. Evaluation of ADMSCs Viability Using the MTT Assay The impact of various concentrations of PRF on the viability of ADMSCs was evaluated on days 1, 3, and 7 using the MTT assay. As illustrated in charts 3–4, the nanofibrous scaffolds treated with a medium concentration of PRF exhibited the highest cell viability across all evaluated time points. Based on these findings, the medium concentration was selected for subsequent experiments and further analysis throughout the remainder of the study (Fig. 4 ). Effect of Optimal PRF Concentration with Triple Nanofiber Layers on the Expression of RUNX2, Collagen Types X, and I Genes To evaluate the relative changes in gene expression levels of RUNX2, as well as collagen types I, and X, quantitative real-time PCR (qPCR) was conducted. The analysis was performed under the influence of various concentrations of PRF integrated with triple-layered nanofibrous scaffolds. Adipose-derived mesenchymal stem cells (5 × 10 5 cells/ml) were seeded onto the composite scaffolds consisting of nanofibers and PRF Total RNA was extracted after 14 days of incubation, and the osteogenic marker gene expression levels were assessed. The findings demonstrated that RUNX2 and collagen types I mRNA expression in the group treated with nanofibrous scaffolds combined with a medium concentration of PRF was approximately 3.5-fold higher compared to the control group. Furthermore, the expression levels of collagen types X mRNA were elevated—Each showed an approximately 2-fold increase compared to the control group (Fig. 5 ). Immunohistochemistry Immunohistochemical staining for Collagen II demonstrated a dose-dependent reduction in expression. The medium and high concentration of the PRF group exhibited a high level of COL I and X deposition, while the medium concentration of the PRF group showed moderate staining. These findings are consistent with the 4-fold increase in COLI and RUNX2 gene expression observed in qRT-PCR (Fig. 6 ). Hematoxylin and Eosin (H&E) Staining H&E staining revealed better cellularity and ECM organization in the 3 nanofiber layers/medium concentration of PRF and 4 nanofiber layers/ high concentration of PRF groups compared to the 2nanofiber layers/ low concentration of PRF group. At 40x magnification, the medium concentration of PRF and high concentration of PRF showed tightly packed cell clusters and a rich ECM deposition. spindle-shaped ADMSCs and a well-organized ECM were clearly visible (Fig. 7 ). Discussion In recent years, there has been a rising interest in the application of MSCs/scaffolds for treating various bone injuries and exploring their therapeutic potential. These studies' results highlight the potential of composite scaffolds with synthetic and natural layers in regenerative medicine. Despite the considerable developments made in scaffold design and fabrication, there is still a need for a scaffold that is appropriate regarding strength and efficiency. The objective of this study was to assess, in an ex vivo setting, the regenerative potential of a multilayered nanofibrous scaffold of PCL-GEL containing nano-hydroxyapatite (nHA) and varying concentrations of platelet-rich fibrin (PRF) for the repair of bone defects. The findings indicated that the three-layered nanofibrous scaffold incorporating a PRF medium concentration representing the average PRF level—exerted the most pronounced effect on the viability and longevity of ADMSCs. Improving tissue regenerative outcomes in bones requires scaffolds to meet several specific conditions that create an environment conducive to the repair of bone tissue. In this context, Raucci et al. identified HA-Gel as a suitable scaffold for promoting osteogenesis [ 29 ]. It demonstrated the feasibility of creating composite hydrogel scaffolds with controlled bioactive signal distribution using a combination of sol-gel and freeze-drying techniques. One of the significant outcomes was that electrostatic forces between calcium ions (Ca²⁺) and carboxylate groups (COO⁻) in the gelatin matrix controlled the orientation of HA crystals which mimics the process of natural bone mineralization, enhancing osteogenic potential. Specifically, with decreasing levels of the inorganic content, the HA crystals were evenly dispersed throughout the scaffold. The combined application of a HA-Gel nanocomposite and endometrial-derived stem cells was reported in a 2013 study to significantly enhance bone tissue formation [ 30 ]. Scaffolds can generate tissue engineered constructs and approaches when oriented with stem cells or bioactive molecules to assist in tissue repair and regeneration. The physicochemical properties and morphology of the scaffolds, as well the rate of degradation, are key aspects of considerations in advancing scaffolds. The degradation of the scaffold would ideally be biocompatible and biodegradable allowing for a tissue formation rate that are aligned [ 31 ]. Electrospinning describes a method in which a fiber producing state for materials is created by using direct electrostatic forces to produce fibers usually on the order of nanometers, with the use of either aqueous or non-aqueous solutions of NF or NP composites (or materials) [ 31 ]. Nanofibers are defined by an extremely large surface-to-volume ratio with a subtle high porosity and ultrafine pore diameters providing a great increase to cell adhesion and proliferation. Samples have shown promising outcomes with regard to biomedical applications from tissue engineering, drug delivery systems, and wound dressings [ 32 ]. Lee et al. evaluated the physical properties and bioactivity of a multilayered PCL/silica composite scaffold for bone tissue regeneration. Their findings demonstrated enhanced cell viability, increased ALP activity, and significant calcium deposition on the scaffold surface—all indicative of MSC differentiation into osteogenic lineage [ 33 ]. In a different study, MSC differentiation and growth were explored on cellulose/gelatin nanofiber scaffolds modified with HA for bone tissue engineering. Surface modification of HA on cellulose nanofibers led to a negatively charged surface that supported HA nucleation. The study showed that MSC cell proliferation and osteogenic differentiation were greatly improved on HA-modified scaffolds compared to unmodified scaffolds. The negatively charged surface adsorbed calcium ions, which promoted the adsorption of osteocalcin—a negatively charged bone protein—thus resulting in greater calcium deposition. The greater calcium accumulation on the scaffold surface was suggestive of greater osteogenic differentiation of MSCs into osteoblasts [ 34 ]. Ren et al. prepared a PCL/Gel composite nanofiber scaffold through electrospinning for bone regeneration. The osteoinductive ability of the scaffold was evaluated by Alizarin Red S staining of calcium deposition—a marker of osteogenic differentiation. The red color on the surface of PCL/Gel nanofibers illustrated the appearance of calcium nodules and successful osteoblast differentiation of stem cells. In addition, the presence of gelatin in the scaffold played a crucial role in enhancing integrin-mediated cell adhesion and subsequent cell attachment to the scaffold surface [ 35 ]. In another study, electrospun nanofiber scaffolds based on PCL, reinforced with HA and calcium carbonate nanoparticles, were analyzed for their potential in bone tissue engineering applications. The addition of these nanoparticles to the nanofibers significantly increased the tensile strength of the scaffold and enhanced the adhesion, proliferation, and growth of osteogenic cells on its surface [ 36 ]. In a study by Edward et al. a bi-component scaffold composed of keratin and PCL was fabricated to assess its suitability for bone tissue engineering. The study found that the increase in the proportion of keratin compared to PCL resulted in a decrease in physical and mechanical strength. The modification, however, greatly improved the scaffolds' hydrophilic nature, thus leading to the proliferation of osteogenic cells [ 37 ]. A study investigated the osteogenic differentiation of MSCs cultured on PCL/collagen/HA scaffolds in PDGF. The results demonstrated a significant increase in calcium deposition and osteocalcin expression in scaffolds containing HA compared to those without it, indicating enhanced bone-forming potential [ 38 ]. Our experimental findings reveal that, under in vitro conditions, a composite scaffold made of PCL, gelatin, and nHA, combined with a moderate concentration of PRF, can effectively accelerate the osteogenic differentiation of ADMSCs. This combination also led to a notable upregulation in the expression of bone-specific genes, highlighting its potential for bone tissue engineering applications. In a study, the application of a HA-silk fibroin scaffold combined with bone marrow stromal cells (BMSCs) successfully led to the complete repair of a bone defect in the radius of a rabbit, demonstrating the scaffold's strong potential for clinical bone regeneration [ 39 ]. According to the findings of Gholipour et al. the HA-silk fibroin (HA-SF), scaffolds did not negatively impact the BMSC's stem cell's viability and biological character in comparison to the control group. In addition, SEM images revealed that the cells not only had good attachment to the surface of the scaffold but also infiltrated into the scaffold's porous structure. This indicates the scaffold's capacity for cell attachment and osteogenic differentiation. In total, the HA-SF scaffolds exhibited excellent biocompatibility, non-cytotoxicity, and, the ability to regenerate bone tissue [ 40 ]. A composite of poly (L-lactic acid) (PLLA), or PLLA/HA was used to observe the behavior of human ADSCs (hADSCs) using electrospun scaffolds. Micrographs of the cultures showed that composite scaffolds were more effective in the cell's growth and infiltration. Improvements in cellular activity result from the structural changes of cells due to the admixture of HA. These enhanced properties of the nanocomposite scaffold are attributed to the functional groups of HA and PLLA forming hydrogen bonds, which improved framework bioactivity and bioactive scaffolds' structural integrity. Some researchers have noted that PLLA can be directly grafted onto the surface hydroxyl groups of HA nanoparticles through ring-opening polymerization of L-lactide [ 41 , 42 ]. PRP therapy has evoked considerable interest as a non-surgical mode of treating musculoskeletal injuries. Recent years have seen PRP become increasingly accepted as a treatment method for soft tissue injury for its regenerative properties, simplicity of use, and lack of dangerous side effects [ 43 ]. It is anticipated that based on the available evidence, different growth factors and active proteins secreted from PRP achieve their biological activity upon activation via a familiar process known as degranulation. In this way, the release of bioactive molecules is targeted, playing a key role in tissue regeneration and repair [ 44 ]. One of the key benefits of 3D culture environments compared to conventional 2D systems is that they can more closely replicate the physiological conditions of native tissue. This closes the gap between in vitro cell culture models and in vivo cell behavior, resulting in more predictive and relevant biological responses [ 45 ]. There have been notable discrepancies in cell behavior between 2D and 3D culture systems. These include discrepancies in drug sensitivity, apoptosis, cell viability, gene expression, protein expression, and differentiation potential [ 46 ]. Furthermore, it has been shown that when cells are cultured on a basement membrane-like matrix, i.e., a hydrogel, they form more compact and physiologically meaningful interactions in signaling pathways [ 47 ]. These findings highlight the contribution of 3D systems to the reproduction of in vivo-like cell responses toward more predictive biological modeling. In the present research, hADMSCs were seeded on a 3D scaffold in the presence of different concentrations of PRF. Osteogenic differentiation was measured by analyzing the expression level of collagen type I, X genes. The findings showed that the addition of PRF could considerably improve the osteoblast differentiation of stem cells on the nHA- PCL/Gel scaffold. Additional research determined that the scaffold possessed a uniformly porous microstructure with pore size favorable for osteoblast attachment, inner proliferation, growth, and migration. These findings approve the potential application of the scaffold in bone tissue engineering. Some studies have shown that the high density of platelets can be a deciding factor in achieving successful bone regeneration [ 48 , 49 ]. In an in vivo study, osteogenic differentiation of embryonic umbilical cord-derived stem cells was quantified on scaffolds of HA. Outcomes demonstrated increased osteoblast differentiation, exhibiting the potential of scaffold-mediated regenerative approaches [ 50 ]. Another study once more revealed that PRP could induce long-term enhancement in bone formation, indicating its prolonged osteoinductive capability [ 51 ]. Contrary to our findings, a review by Del Fabbro et al. indicated that there is no consensus regarding the effects of various platelet concentrations on osteoblast differentiation, function, and apoptosis [ 52 ]. In a study conducted by Kasten et al, the results showed that PRP did not have a pronounced effect on the osteogenic differentiation of MSCs [ 53 ]. Similarly, in another study conducted by Hernández-Fernández et al. there was no histological and radiological evidence of bone formation enhancement in distraction osteogenesis when PRP was administered during the first stage of treatment [ 54 ]. In addition, the other research by Kon et al. [ 55 ] and Oliveira Filho et al. [ 56 ] The study also found that the administration of PRP did not result in enhanced bone regeneration. Such discrepancies in the literature could be due to the differences in the concentration and type of growth factors in various PRP preparations. A study demonstrated that the use of PRP increased the number of osteoblasts and osteoclasts in the grafted area during the first month. In PRP-free grafts, however, the same quantity of these cells was observed after two or more months. These results suggest that while PRP can influence the early cellular response, its biological effect is short-lived and has little impact on bone regeneration over time [ 57 ]. In a research, Wang et al. demonstrated that engineered scaffolds composed of a mixture of natural and synthetic biomineral materials—specifically oyster shell (OS) and alpha-calcium sulfate hemihydrate (α-CSH)—show promising potential for bone tissue regeneration. The scaffolds were subsequently strengthened using PRP, a source of growth factors, and BMSCs. The research demonstrated that this multifunctional construct supports effective bone regeneration with a focus on its clinical application [ 58 ]. In spite of PCL's pros in tissue engineering because of biocompatibility, low cost, and solubility in most organic solvents, it has some cons such as limited hydrophilicity and lack of surface cell receptors which interfere with its effectiveness in inducing cell adhesion, proliferation, and differentiation. So, researchers have used a mixture of PCL and natural polymers like GEL. Research indicates that adding GEL significantly enhances cell proliferation and infiltration compared to pure PCL scaffolds, making this composite a more advantageous option for tissue regeneration [ 59 , 60 ]. Gautam et al. reported that the incorporation of gelatin into PCL scaffolds significantly improves cell attachment and proliferation. Based on their results, cell growth on PCL/ GEL composite scaffolds was markedly higher compared to pure PCL, demonstrating the advantage of natural polymer blending for biological performance [ 61 ]. In addition, research has shown that combining PCL with nHA can eliminate key limitations of the polymer, including poor bioactivity, low biodegradability, and insufficient mechanical strength—factors critical for supporting bone tissue regeneration [ 62 ]. PRF, a second-generation platelet concentrate, was initially introduced by Choukroun et al. Compared to PRP, PRF preparation is free from anticoagulant additives and subsequent neutralization steps. Therefore, successful PRF preparation requires rapid blood collection followed immediately by centrifugation, before the coagulation cascade fully initiates [ 63 ]. PRF, prepared as a platelet gel, plays varied roles in regenerative medicine. It can be used to support bone graft adhesion, improve wound healing, promote bone growth and maturation, stabilize grafts, maintain hemostasis, and function as a biological membrane. PRF-deposited PCL/GEL scaffolds not only promote the late-stage osteogenic differentiation of bone marrow mesenchymal stem cells in vitro, but they also exhibit enhanced cell proliferation capacity, demonstrating their effectiveness in bone regeneration. In this direction, Mao's and Mishra's research reveals that the incorporation of bioactive molecules like RGD-phage nanofibers or cell-loaded hydrogels into scaffold composition significantly enhances vascularization and bone regeneration compared to acellular constructs [ 64 , 65 ]. In another study, Ghiasi et al. combined osteochondral allografts with PRF transplanted into the rabbit knee. Histological results showed that adding PRF and umbilical cord blood stem cells (UCBSCs) to osteochondral grafts resulted in better healing and regeneration of the area than grafts alone or cells alone. PRF, by releasing growth factors, promotes the growth and proliferation of UCBSCs [ 66 ]. In a clinical trial, combining bone grafts with PRF growth factors may enhance bone density [ 67 ]. While PRP is widely recognized, comparative studies have shown that the growth factor levels in PRF are relatively similar to those in PRP, further indicating its potential as an effective alternative in bone tissue engineering [ 68 ]. In an experimental study, the effect of PRP on the survival of composite grafts was assessed using a rabbit model. The composite grafts were applied to the ears of rabbits, divided into a PRP-treated group and a control group. According to their results, graft viability and vascularization were significantly higher in the PRP group in comparison to controls. These findings suggest that PRP promotes early revascularization and as a result improves blood supply [ 69 ]. In a study, Ghiasi et al. used a PCL-Gel composite scaffold with lyophilized blood growth factors to differentiate Wharton Jelly mesenchymal stem cells (WJ-MSCs) into bone. They reported that this structure increased the expression of ALP, RUNX2, COLX, and COLI genes and that the expression of these genes also increased with increasing concentrations of lyophilized blood growth factors. The structure of this scaffold is in the form of layers consisting of PCL-Gel and lyophilized blood growth factors [ 70 ]. Two studies have demonstrated that the transplantation of cultured cells in combination with calcium ceramic bone grafts yields highly favorable outcomes in bone regeneration [ 71 , 72 ]. It was further observed that these implanted cells not only proliferate but also secrete an osteoconductive matrix on the scaffold surface, thereby accelerating the bone healing process [ 73 ]. The findings of the current study are consistent with earlier observations, suggesting that the hybrid of synthetic and natural scaffolds, when integrated with stem cells and appropriate growth factors, can greatly enhance the therapeutic effects. The integrative strategy not only increases the effectiveness of bone regeneration but also plays a significant part in expediting the osteogenesis process. Conclusion The results of our study show that, during the first stage, multilayer composite scaffolds made of nanofibers and a specific number of PRF improve gene expression related to bone formation. This suggests that these scaffolds help stem cells turn into osteoblast-like cells, accelerating bone regeneration. Further investigations are recommended to evaluate the use of multilayer composite scaffolds made of nanofibers, PRF, and ADMSCs both in vitro and in vivo. More studies are required to assess their therapeutic potential and to examine the impact of various biodegradable scaffolds on the healing process of osteoarthritis in animal models. It is also necessary to examine the influence of varying nHA concentrations in multilayer scaffold fabrication and also to examine a broad range of PRF concentrations. In addition, the effect of scaffold thickness on biological performance should be examined thoroughly. Declarations Funding Part of the research budget for this research project was provided by the Neuroscience Research Institute. Data availability Data is provided within the manuscript. Ethics approval research ethics committee of the neuroscience institute of Tehran university of mediacal sciences, Iran (Approval ID: IR.TUMS.NI.REC.1402.038). Informed consent was obtained from all participants. Data were recorded using coded checklists to maintain confidentiality and participants were free to withdraw from the study at any time. This article is original research. Consent for publication Not applicable. Competing interests There is no conflict of interest. Clinical trial number Not applicable Author Contribution Mahdieh Ghiasi was involved in writing the manuscript, designing the model, reviewing tests, analyzing data, and reporting results. Khalil Pestehei contributed to the analysis of the results. Setareh Ebrahimi performed the English editing. Bita Fazel and Sepideh Moradkhani contributed to writing the manuscript. Amirhossein Ghiasi participated in the project. Acknowledgements The authors would like to thank the Director of the Neuroscience Institute for providing the facilities. References Cowan PT, Launico MV, Kahai P, Anatomy. Bones. StatPearls [Internet]: StatPearls Publishing; 2024. Reid IR, McClung MR. Osteopenia: a key target for fracture prevention. Lancet Diabetes Endocrinol. 2024;12(11):856–64. Zeng J-H, Liu S-W, Xiong L, Qiu P, Ding L-H, Xiong S-L, et al. Scaffolds for the repair of bone defects in clinical studies: A systematic review. J Orthop Surg Res. 2018;13:1–14. Bernardo MP, da Silva BC, Hamouda AE, de Toledo MA, Schalla C, Rütten S, et al. PLA/Hydroxyapatite scaffolds exhibit in vitro immunological inertness and promote robust osteogenic differentiation of human mesenchymal stem cells without osteogenic stimuli. Sci Rep. 2022;12(1):2333. Farokhi M, Mottaghitalab F, Shokrgozar MA, Ou K-L, Mao C, Hosseinkhani H. Importance of dual delivery systems for bone tissue engineering. J Controlled Release. 2016;225:152–69. Porter JR, Ruckh TT, Popat KC. Bone tissue engineering: a review in bone biomimetics and drug delivery strategies. Biotechnol Prog. 2009;25(6):1539–60. Amini Z, Lari R. A systematic review of decellularized allograft and xenograft–derived scaffolds in bone tissue regeneration. Tissue Cell. 2021;69:101494. Kumawat VS, Bandyopadhyay-Ghosh S, Ghosh SB. An overview of translational research in bone graft biomaterials. J Biomater Sci Polym Ed. 2023;34(4):497–540. Hassanajili S, Karami-Pour A, Oryan A, Talaei-Khozani T. Preparation and characterization of PLA/PCL/HA composite scaffolds using indirect 3D printing for bone tissue engineering. Mater Sci Engineering: C. 2019;104:109960. Muncie JM, Weaver VM. The physical and biochemical properties of the extracellular matrix regulate cell fate. Curr Top Dev Biol. 2018;130:1–37. Hosseini A, Shahverdi M, Sourani Z, Habibi R, Ahangari Z, Shirian S et al. A Review on Synthesis, Characterization and Applications of Polycaprolactone as a Novel Drug Delivery System and Tissue Engineering. J Inflamm Dis.27(3). Hirsch WDB, Weber A, Ferri J, Etges A, Neto PI, Pereira FDAS, et al. An Analysis of the Biocompatibility, Cytotoxicity, and Bone Conductivity of Polycaprolactone: An In Vivo Study. Polymers. 2024;16(16):2271. Backes EH, Harb SV, Beatrice CAG, Shimomura KMB, Passador FR, Costa LC, et al. Polycaprolactone usage in additive manufacturing strategies for tissue engineering applications: A review. J Biomedical Mater Res Part B: Appl Biomaterials. 2022;110(6):1479–503. Etxabide A, Long J, Guerrero P, de la Caba K, Seyfoddin A. 3D printed lactose-crosslinked gelatin scaffolds as a drug delivery system for dexamethasone. Eur Polymer J. 2019;114:90–7. Hamid OA, Eltaher HM, Sottile V, Yang J. 3D bioprinting of a stem cell-laden, multi-material tubular composite: An approach for spinal cord repair. Mater Sci Engineering: C. 2021;120:111707. Butcher AL, Koh CT, Oyen ML. Systematic mechanical evaluation of electrospun gelatin meshes. J Mech Behav Biomed Mater. 2017;69:412–9. Yao R, He J, Meng G, Jiang B, Wu F. Electrospun PCL/Gelatin composite fibrous scaffolds: mechanical properties and cellular responses. J Biomater Sci Polym Ed. 2016;27(9):824–38. Bikuna-Izagirre M, Aldazabal J, Paredes J. Gelatin Blends Enhance Performance of Electrospun Polymeric Scaffolds in Comparison to Coating Protocols. Polymers 2022,14, 1311. s Note: MDPI stays neutral with regard to jurisdictional claims in published…. Jirkovec R, Holec P, Hauzerova S, Samkova A, Kalous T, Chvojka J. Preparation of a composite scaffold from polycaprolactone and hydroxyapatite particles by means of alternating current electrospinning. ACS omega. 2021;6(13):9234–42. Politi S, Carotenuto F, Rinaldi A, Di Nardo P, Manzari V, Albertini MC, et al. Smart ECM-based electrospun biomaterials for skeletal muscle regeneration. Nanomaterials. 2020;10(9):1781. Li Y, Wang J, Qian D, Chen L, Mo X, Wang L, et al. Electrospun fibrous sponge via short fiber for mimicking 3D ECM. J Nanobiotechnol. 2021;19(1):131. Zhao Q, Du X, Wang M. Electrospinning and Cell Fibers in Biomedical Applications. Adv Biology. 2023;7(10):2300092. Mondragón E, Cowdin M, Taraballi F, Minardi S, Tasciotti E, Gregory CA, et al. Mimicking the organic and inorganic composition of anabolic bone enhances human mesenchymal stem cell osteoinduction and scaffold mechanical properties. Front Bioeng Biotechnol. 2020;8:753. Chen J-P, Chang Y-S. Preparation and characterization of composite nanofibers of polycaprolactone and nanohydroxyapatite for osteogenic differentiation of mesenchymal stem cells. Colloids Surf B. 2011;86(1):169–75. Venkatesan J, Kim S-K. Nano-hydroxyapatite composite biomaterials for bone tissue engineering—a review. J Biomed Nanotechnol. 2014;10(10):3124–40. de Carvalho CKL, Fernandes BL, de Souza MA. Autologous matrix of platelet-rich fibrin in wound care settings: a systematic review of randomized clinical trials. J Funct Biomaterials. 2020;11(2):31. Sheykhhasan M, Qomi RT, Ghiasi M. Fibrin scaffolds designing in order to human adipose-derived mesenchymal stem cells differentiation to chondrocytes in the presence of TGF-β3. Int J Stem Cells. 2015;8(2):219–27. Hassibi H, et al. Allogenic bone graft enriched by periosteal stem cell and growth factors for osteogenesis in critical size bone defect in rabbit model: histopathological and radiological evaluation. Iran J Pathol. 2020;15(3):205. Raucci MG, DemitriC, Soriente A, Fasolino I, Sannino A, Ambrosio L. Gelatin/nano-hydroxyapatite hydrogel scaffold prepared by sol-gel technology as filler to repair bone defects. J Biomed Mater Res Part A. 2018;106A:2007–19. Ai J, Heidari-Keshel S, Azami M, et al. Repair of critical size rat calvarial defects using endometrial-derived stem cells embedded within gelatin/apatite nanocomposite scaffold. Stem Cell Disc. 2013;3(1):36–43. Mi HY, Jing X, Napiwocki BN, Li ZT, Turng LS, Huang HX. Fabrication of fibrous silica sponges by self-assembly electrospinning and their application in tissue engineering for threedimensional tissue regeneration. Chem Eng J. 2018;331:652–62. Ghosal K, Agatemor C, Špitálsky Z, Thomas S, Kny E. Electrospinning Tissue Engineering and Wound Dressing Scaffolds from Polymer–Titanium Dioxide Nanocomposites. Chem Eng J. 2018;358:1262–78. Lee H, Hwang H, Kim Y, Jeon H, Kim G. Physical and bioactive properties of multi-layered PCL/silica composite scaffolds for bone tissue regeneration. Chem Eng J. 2014;250:399–408. Gorgieva S, Girandon L, Kokol V. Mineralization potential of cellulose-nanofibrils reinforced gelatine scaffolds for promoted calcium deposition by mesenchymal stem cells. Mater Sci Engineering: C. 2017;73:478–89. Ren K, Wang Y, Sun T, Yue W, Zhang H. Electrospun PCL/gelatin composite nanofiber structures for effective guided bone regeneration membranes. Mater Sci Engineering: C. 2017;78:324–32. Wutticharoenmong kol P, Sanchavanakit N, Pavasant P, Supaphol P. Preparation and characterization of novel bone scaffolds based on electrospun polycaprolactone fibers filled with nanoparticles. Macromol Biosci. 2006;6:70–7. Edwards A, Jarvis D, Hopkins T, Pixley S, Bhattarai N. Poly (ε-caprolactone)/keratin-based composite nanofibers for biomedical applications. J Biomedical Mater Res Part B: Appl Biomaterials. 2015;103:21–30. Raghavendran HRB, Mohan S, Genasan K, Murali MR, Naveen SV, Talebian S, McKean R, Kamarul T. Synergistic interaction of platelet derived growth factor (PDGF) with the surface of PLLA/Col/HA and PLLA/HA scaffolds produces rapid osteogenic differentiation. Colloids Surf B. 2016;139:68–78. Wang G, Yang H, Li M, et al. The use of silk fibroin/hydroxyapatite composite co-cultured with rabbit bone-marrow stromal cells in the healing of a segmental bone defect. J Bone Joint Surg - Br Volume. 2010;92–B(2):320–5. Gholipourmalekabadi M, Mozafari M, Gholipourmalekabadi M, et al. In vitro and in vivo evaluations of three-dimensional hydroxyapatite/silk fibroin nanocomposite scaffolds. Biotechnol Appl Biochem. 2015;62(4):441–50. Agarwal S, Wendorff JH, Greiner A. Use of electrospinning technique for biomedical applications. Polymer. 2008;49(26):5603–21. Sill TJ, von Recum HA. Electrospinning: applications in drug delivery and tissue engineering. Biomaterials. 2008;29(13):1989–2006. Irianto KA, Bakri AH, Kloping NA. Platelet Rich Plasma Injection for Soft Tissue Musculoskeletal Pain. Malaysian Orthop J. 2021;15(2):96–100. Pineda-Cortel MR, Suarez C, Cabrera JT, Daya M, Bonifacio L, Vergara RB. Complexity of Platelet-Rich Plasma: Mechanism of Action, Growth Factor Utilization and Variation in Preparation. Plasmatology. 2024;18:1–11. Park CH, Park JH, Suh YJ. Perspective of 3D culture in medicine: transforming disease research and therapeutic applications. Front Bioeng Biotechnol. 2024;12:1491669. Tang R. Application of platelet-rich plasma in traumatic bone infections. Exp Rev Anti Infect Ther. 2020;18(1):1–12. Lee GY, Kenny PA, Lee EH, Bissell MJ. Threedimensional culture models of normal and malignant breast epithelial cells. Nat Methods. 2007;4(4):359–65. Kawasumi M, Kitoh H, Siwicka K, Ishiguro N. Theeffect of the platelet concentration in plateletrich plasma gel on the regeneration of bone. Bone Joint J. 2008;90(7):966–72. Moreira DC, Sá CN, Andrade MGS, dos Santos Calmon TCB, de Almeida Reis SR, Pithon MM, et al. Angiogenesis and osteogenesis at incorporation process of onlay bone graft. J Oral Maxillo Surg. 2013;71(12):2048–57. Baba K, Yamazaki Y, Ikemoto S, Aoyagi K, Takeda A, uchinuma E. oateogenic potential of human umbilical cord-derived mesenchymal stromal cells cultured with umbilical cord blood-derived autoserum. J Cranio-maxillo-facial Surg. 2012;40:768–72. Pessoa RS, Oliveira SR, Menezes HH, de Magalhaes D. Effects of platelet-rich plasma on healing of PRP alveolar socket: split-mouth histological and histometric evaluation in Cebus apella monkeys. Indian J Dent Res. 2009;20(4):442. Del Fabbro M, Bortolin M, Taschieri S. Is autologous platelet concentrate beneficial for postextraction socket healing? A systematic review. Int J Oral Maxillofac Surg. 2011;40(9):891–900. Kasten P, Vogel J, Beyen I, Weiss S, Niemeyer P, Leo A, et al. Effect of platelet-rich plasma on the in vitro proliferation and osteogenic differentiation of human mesenchymal stem cells on distinct calcium phosphate scaffolds: the specific surface area makes a difference. J Biomater App. 2008;23(2):88–9. Hernandez-Fernandez A, Vélez R, Soldado F, Saenz-Ríos JC, Barber I, Aguirre-Canyadell M. Effect of administration of platelet-rich plasma in early phases of distraction osteogenesis: an experimental study in an ovine femur model. Injury. 2013;44(7):901–7. Kon E, Filardo G, Delcogliano M, Fini M, Salamanna F, Giavaresi G, et al. Platelet autologous growth factors decrease the osteochondral regeneration capability of a collagen-hydroxyapatite scaffold in a sheep model. BMC Musculo Disord. 2010;11(1):220. MAd OF, Nassif PAN, Malafaia O, Ribas Filho JM, Ribas CAPM, Camacho AC, et al. Effects of a highly concentrated platelet-rich plasma on the bone repair using non-critical defects in the calvaria of rabbits. Acta Cir Bras. 2010;25(1):28–33. Nagata MJH, Melo LGN, Messora MR, Bomfim SRM, Fucini SE, Garcia VG, et al. Effect of platelet-rich plasma on bone healing of autogenous bone grafts in critical-size defects. Clin Periodontol. 2009;36:775–83. Wang J, Xie L, Wang X, Zheng W, Chen H, Cai L. The effects of oyster shell/alpha-calcium sulfate hemihydrate/platelet-rich plasma/bone mesenchymal stem cells bioengineering scaffold on rat critical-sized calvarial defects. J Mater Sci Mater Med. 2020;31(11):1–14. Vatankhah E, Semnani D, Prabhakaran MP, Tadayon M, Razavi S, Ramakrishna S. Artificial neural network for modeling the elastic modulus of electrospun polycaprolactone/gelatin scaffolds. Acta biomater. 2014;10(2):709–21. Chong EJ, Phan TT, Lim IJ, Zhang YZ, Bay BH, Ramakrishna S, et al. Evaluation of electrospun PCL/gelatin nanofibrous scaffold for wound healing and layered dermal reconstruction. Acta Biomater. 2007;3(3):321–30. Gautam S, Dinda AK, Mishra NC. Fabrication and characterization of PCL/gelatin composite nanofibrous scaffold for tissue engineering applications by electrospinning method. Mater Sci Eng C. 2013;33:1228–35. Chen JP, Chang YS. Preparation and characterization of composite nanofibers of polycaprolactone and nano-hydroxyapatite for osteogenic differentiation of mesenchymal stemcells. Colloida Surf B Biointerfaces. 2011;89(1):169–75. Choukroun J, Diss A, Simonpieri A, Girard MO, Schoeffler C, Dohan SL, Dohan AJ, Mouhyi J, Dohan DM. Platelet-rich fibrin (PRF): a second-generation platelet concentrate. Part IV: clinical effects on tissue healing. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2006;101(3):e56-60. 10.1016/j.tripleo.2005.07.011 . PMID: 16504852. Wang J, Yang M, Zhu Y, Wang L, Tomsia AP, Mao C. Phage nanofibers induce vascularized osteogenesis in 3D printed bone scaffolds. Adv Mater. 2014;26(29):4961–6. 10.1002/adma.201400154 . Epub 2014 Apr 7. PMID: 24711251; PMCID: PMC4122615. Mishra R, Roux BM, Posukonis M, Bodamer E, Brey EM, Fisher JP, Dean D. Effect of prevascularization on in vivo vascularization of poly(propylene fumarate)/fibrin scaffolds. Biomaterials. 2016;77:255 – 66. 10.1016/j.biomaterials.2015.10.026 . Epub 2015 Oct 22. PMID: 26606451; PMCID: PMC5059847. Pestehei SK, Ghiasi M, Bagheri N. Evaluation the Impressionability of Acellular Scaffolds in Presence of Different Combination of Umbilical Cord Blood Stem Cells and Platelet Rich Fibrin in Repair of Knee Defects in Rabbit (Novel Method with Xeno-Material Elements. Arch Neurosci. 2024;11(4):e147989. 10.5812/ans-147989 . Clark D, Rajendran Y, Paydar S, Ho S, Cox D, Ryder M, Dollard J, Kao RT. Advanced platelet-rich fibrin and freeze-dried bone allograft for ridge preservation: A randomized controlled clinical trial. J Periodontol. 2018;89(4):379–87. PMID: 29683498; PMCID: PMC6483085. Mijiritsky E, Assaf HD, Peleg O, Shacham M, Cerroni L, Mangani L. Use of PRP, PRF and CGF in Periodontal Regeneration and Facial Rejuvenation-A Narrative Review. Biology (Basel). 2021;10(4):317. 10.3390/biology10040317 . PMID: 33920204; PMCID: PMC8070566. Choi HN, Han YS, Kim SR, Kim HK, Kim H, Park JH. The effect of platelet-rich plasma on survival of the composite graft and the proper time of injection in a rabbit ear composite graft model. Arch Plast Surg. 2014;41(6):647–53. Epub 2014 Nov 3. PMID: 25396175; PMCID: PMC4228205. Ghiasi M, Mehdizadeh M. Designing Nanofiber Multilayer Composite Scaffolds and Lyophilized Blood Growth Factors in the Process of Osteogenesis. J Mazandaran Univ Med Sci. 2022;32(210):1–12. Almansoori AA, Kwon OJ, Nam JH, Seo YK, Song HR, Lee JH. Mesenchymal stem cells and platelet-rich plasma-impregnated polycaprolactone-β tricalcium phosphate bio-scaffold enhanced bone regeneration around dental implants. Int J Implant Dent. 2021;7(1):35. 10.1186/s40729-021-00317-y . PMID: 33948811; PMCID: PMC8096877. Qiu G, Shi Z, Xu HHK, Yang B, Weir MD, Li G, Song Y, Wang J, Hu K, Wang P, Zhao L. Bone regeneration in minipigs via calcium phosphate cement scaffold delivering autologous bone marrow mesenchymal stem cells and platelet-rich plasma. J Tissue Eng Regen Med. 2018;12(2):e937–48. 10.1002/term.2416 . Epub 2017 Jun 2. PMID: 28102000. Zhao C, Zeng Z, Qazvini NT, Yu X, Zhang R, Yan S, Shu Y, Zhu Y, Duan C, Bishop E, Lei J, Zhang W, Yang C, Wu K, Wu Y, An L, Huang S, Ji X, Gong C, Yuan C, Zhang L, Liu W, Huang B, Feng Y, Zhang B, Dai Z, Shen Y, Wang X, Luo W, Oliveira L, Athiviraham A, Lee MJ, Wolf JM, Ameer GA, Reid RR, He TC, Huang W. Thermoresponsive Citrate-Based Graphene Oxide Scaffold Enhances Bone Regeneration from BMP9-Stimulated Adipose-Derived Mesenchymal Stem Cells. ACS Biomater Sci Eng. 2018;4(8):2943–55. 10.1021/acsbiomaterials.8b00179 . Epub 2018 Jun 7. PMID: 30906855; PMCID: PMC6425978. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7462422","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":508407727,"identity":"1130dec0-9e0d-48e2-a88a-affe7143b59e","order_by":0,"name":"Khalil Pestehei","email":"","orcid":"","institution":"Tehran University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Khalil","middleName":"","lastName":"Pestehei","suffix":""},{"id":508407728,"identity":"afb5bc4c-0cbf-46a3-9b60-702feafb8e99","order_by":1,"name":"Mahdieh Ghiasi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+klEQVRIiWNgGAWjYFACHgaJBIYDDAwSjA0MDAY2QAaJWtKI1MIA1gLmHSasRbf97MEbDyruMMhHNzd+/FFwPrF/dvPBBww1NtG4tJidyUu2SDjzjMHwzsFmaR6D24kz7hxLNmA4lpbbgEvLgRwzicS2wwyGMxIbpBmAWhpuAEUYGw7j1nL+DVDLP7CW5p8/DM4lzieoBaQgseEwgzzQLgkegwOJGwhreWNskXDsMI8BUIs1j0Gy8cYbackGCfj8cj7H8OaPmsNy8jPSH9/88cdOdt6N5IMPPtTY4NQCA0AnQRiOYJUJBJSDgTzUUHtiFI+CUTAKRsHIAgCgsWP13pqY9AAAAABJRU5ErkJggg==","orcid":"","institution":"Tehran University of Medical Sciences","correspondingAuthor":true,"prefix":"","firstName":"Mahdieh","middleName":"","lastName":"Ghiasi","suffix":""},{"id":508407729,"identity":"82980172-7882-478b-9956-e1cf2b23f55b","order_by":2,"name":"Sepideh Moradkhani","email":"","orcid":"","institution":"University of Tehran","correspondingAuthor":false,"prefix":"","firstName":"Sepideh","middleName":"","lastName":"Moradkhani","suffix":""},{"id":508407730,"identity":"623f2af2-a986-4ed2-babe-381e0032c0f9","order_by":3,"name":"Bita Fazel","email":"","orcid":"","institution":"Tehran University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Bita","middleName":"","lastName":"Fazel","suffix":""},{"id":508407731,"identity":"29c212be-cb8d-4e93-9a50-cd48077592a2","order_by":4,"name":"Setareh Ebrahimi","email":"","orcid":"","institution":"Tehran University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Setareh","middleName":"","lastName":"Ebrahimi","suffix":""},{"id":508407732,"identity":"7c5c3363-c807-4b5a-8ec5-502a6dccf71e","order_by":5,"name":"Amirhossein Ghiasi","email":"","orcid":"","institution":"Tehran University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Amirhossein","middleName":"","lastName":"Ghiasi","suffix":""}],"badges":[],"createdAt":"2025-08-26 11:23:28","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7462422/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7462422/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":90536126,"identity":"fc2a6dd1-01b8-4396-96ab-86bc45844a86","added_by":"auto","created_at":"2025-09-03 20:17:26","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":174355,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eMorphological evaluation of ADMSCs using an inverted light microscope. At 10× magnification, ADMSCs display a fibroblast-like morphology.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7462422/v1/c8fe1f8d84857c0b569919c4.jpeg"},{"id":90536472,"identity":"262364af-433b-4db9-bf34-1d0d9a657b28","added_by":"auto","created_at":"2025-09-03 20:25:26","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":61835,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eSEM images of scaffold structures. From left to right: A) Polycaprolactone/gelatin scaffold with a 70/30 ratio, B) PCL/Gel scaffold containing 15% hydroxyapatite nanoparticles (70/30–15%), C) PCL/Gel scaffold containing hydroxyapatite nanoparticles and fibrin-rich plasma (70/30–15%– (10–50%)).\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7462422/v1/d8138a82df057a7d2379a850.jpeg"},{"id":90536131,"identity":"d59a7821-5ac5-4b69-8c89-c884d2af51ab","added_by":"auto","created_at":"2025-09-03 20:17:26","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":459705,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eFTIR spectra of PCL/Gel (A) and PCL/Gel-nHA (B) scaffolds.\u003cbr\u003e\nThe characteristic absorption bands of each component are observed in their respective spectra. PCL/Gel show prominent peaks at 1041-1171, 1726 cm⁻¹, and 2942 cm⁻¹, corresponding to C-O (alcohol/ether), C=O (carbonyl), and, CH (alkane) stretching respectively. PCL/Gel/nHA exhibit a peak at 690 cm⁻¹ for PO\u003c/em\u003e\u003csub\u003e\u003cem\u003e4\u003c/em\u003e\u003c/sub\u003e\u003csup\u003e\u003cem\u003e-3 \u003c/em\u003e\u003c/sup\u003e\u003cem\u003e(phosphate)\u003c/em\u003e\u003csup\u003e\u003cem\u003e \u003c/em\u003e\u003c/sup\u003e\u003cem\u003estretching, 1028 cm⁻¹ (C=O) at 1534–1605 cm⁻¹ for N-H, C=C (amide/aromatic), 2930 cm⁻¹ (CH) and, 3293 cm⁻¹ for O-H, N-H (hydroxyl and amine) stretching. These peaks confirm the successful incorporation of PRF into the nanocomposite scaffold matrix.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7462422/v1/3a59d1e4c0cb518b3706df36.jpeg"},{"id":90536130,"identity":"88c8cf91-b5ee-45e7-8cce-77c2fe32af64","added_by":"auto","created_at":"2025-09-03 20:17:26","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":21539,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eAssessment of ADMSCs viability in response to varying concentrations of PRF and different numbers of nanofibrous layers using the MTT assay. The medium concentration of PRF demonstrated the most pronounced effect on cell viability across days 1, 3, and 7. Statistical significance is as follows: ***p \u0026lt; 0.001, **p \u0026lt; 0.01, *p \u0026lt; 0.05. Data are presented as mean ± SEM.\u003c/em\u003e \u003cem\u003e(C: AMSCs, I: 2 nanofiber layers/ low concentration of PRF, II: 3 nanofiber layers/medium concentration of PRF, III: 4 nanofiber layers/ high concentration of PRF, IV: PRF)\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7462422/v1/c5491a73925a4acde1ff8adc.png"},{"id":90536129,"identity":"15532eb2-4a0a-46ad-a955-9d42a10bb6da","added_by":"auto","created_at":"2025-09-03 20:17:26","extension":"jpeg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":255302,"visible":true,"origin":"","legend":"\u003cp\u003eAnalysis of the effect of medium (optimal) PRF concentration on the gene expression of RUNX2, and collagen types I and X. qPCR was used to assess mRNA expression levels in stem cells cultured on nanofibrous scaffolds combined with different concentrations of PRF. Results indicate differential expression patterns associated with osteogenic genes. Statistical significance is indicated as follows: ***p \u0026lt; 0.001, **p \u0026lt; 0.01, *p \u0026lt; 0.05. C: AMSCs, I: 2 nanofiber layers/ low concentration of PRF, II: 3 nanofiber layers/medium concentration of PRF, III: 4 nanofiber layers/ high concentration of PRF.\u003c/p\u003e","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7462422/v1/f1fd3fc41a69f5e499cb458b.jpeg"},{"id":90536599,"identity":"5df9f2d5-43c5-4bb7-8c40-2447cf9ff4e9","added_by":"auto","created_at":"2025-09-03 20:33:26","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":176419,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eImmunohistochemical staining for Collagen II in ADMSCs on scaffolds; A: 2 nanofiber layers/ low concentration of PRF, B: 3 nanofiber layers/medium concentration of PRF, C: 4 nanofiber layers/ high concentration of PRF) at 40x magnification, showing reduced expression of collagen II in the medium concentration of PRF group.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7462422/v1/4b58af3cd9253fac7f772312.png"},{"id":90536477,"identity":"040b1bbf-d572-4ad8-879a-60341dd21b54","added_by":"auto","created_at":"2025-09-03 20:25:26","extension":"jpeg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":352730,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eH\u0026amp;E staining demonstrated enhanced ADMSCs density in the medium concentration of PRF group relative to the high concentration of PRF and low concentration of PRF\u003c/em\u003e \u003cem\u003eAt 40x magnification. \u003c/em\u003e\u0026nbsp;\u003cem\u003eA: 2 nanofiber layers/ low concentration of PRF, B: 3 nanofiber layers/medium concentration of PRF, C: 4 nanofiber layers/ high concentration of PRF.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"floatimage8.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7462422/v1/d149c2bb511f224a9de89007.jpeg"},{"id":91987863,"identity":"c292e57c-73a5-4ba3-816d-16c914473dd3","added_by":"auto","created_at":"2025-09-23 12:12:15","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2489012,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7462422/v1/96778f21-64b2-40c7-9af7-1905a28019af.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003eBioengineered hybrid electrospun scaffold of Polycaprolacton/Gelatin-nano- hydroxyapatite, coated with platelet-rich fibrin, for enhanced osteogenesis and bone healing using adipose derived stem cells\u003c/p\u003e","fulltext":[{"header":"Background","content":"\u003cp\u003eBones are essential for movement and organ protection, but bone defects can cause extreme damage and require long-term treatments [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. As the population ages, bone diseases like osteopenia and osteoporosis are steadily increasing, which is leading to fractures every 3 seconds incidence, with an estimated 125\u0026nbsp;million affected individuals [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The economic burden of these injuries is expected to exceed \u003cspan\u003e$\u003c/span\u003e 8.3\u0026nbsp;billion by 2023. Although bones have natural regenerative abilities, healing is often insufficient after diseases and trauma [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Currently, treatments such as surgery and transplantation, are the most effective options. Autologous bone grafting is considered the standard for repairing bone defects due to the fact that it will result in osteogenic cells, growth factors, and a natural scaffold. These components are essential for successful bone repair. However, some disadvantages exist. It can cause pain, increase the risk of infection, lead to bleeding, and require longer surgery times, these factors may offset its potential benefits. Grafts originate from genetically different donors of the same species. While they spare the need for another surgical site, these may have potential risks, such as pathogen transmission, immune system response, and poor blood supply, which can obstruct healing. Despite the successes of bone grafts in the treatment of skeletal defects, several limitations still arise. For instance, a shortage of donors, possibility of rejection, surgical complications, and sometimes the need for later surgeries can lead to failure rates of up to 50% [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Therefore, new alternative bone substitute materials are needed to improve the healing process [\u003cspan additionalcitationids=\"CR7\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eBone regenerative scaffolds can act as 3-dimensional conductive substrates that allow for cell attachment and infiltration, provide mechanical stability, and act as a template for new bone formation. In this context, engineered scaffolds are very promising as new, productive options [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. The ECM represents a mixture of critical biomolecules and is very complex from a biological standpoint. The ECM provides mechanical, structural, and biochemical support to surrounding cells, while also allowing the tissue microenvironment to perform its normal physiological function [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. It is important to understand the ECM as it relates to the design of ideal scaffold structures. Accordingly, investigating ways to successfully develop nanofiber/hydrogel composites and the appropriate choice of scaffold biomaterials is vital to advance regenerative medicine techniques.\u003c/p\u003e\u003cp\u003eBoth synthetic polymers and natural substances can be used in tissue engineering for scaffold construction. Among synthetic options, Polycaprolactone has some of the best biocompatibility, is least likely to provoke an immune reaction, is cheaper than many alternatives, has structural diversity, can be dissolved in a number of organic solvents, and can have many uses in medicine [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Nevertheless, PCL's hydrophobicity continues to limit surface porosity which can hinder cellular adhesion, growth and differentiation. Therefore, to address these limitations, PCL is commonly mixed with natural polymers to improve the PCL bio-functionality [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Natural biopolymers, such as gelatin, are very similar to the macromolecular matrix of the ECM. these biopolymers provide properties of biocompatibility, biodegradability, and bioactivity, which are essential for promoting cell growth and tissue integration [\u003cspan additionalcitationids=\"CR14\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Among the biopolymers discussed, gelatin (GEL) has many types of functional groups with which to create hydrogels, including hydroxyls to improve mechanical performance through crosslinking with ligands. The mechanical properties of gelatin hydrogels made by electrospinning (ES) are generally rigid and brittle which could affect mechanical performance [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. When gelatin (GEL) is combined with PCL, scaffolds that are strong are generated that can promote tissue growth. Natural polymers have biological functionality that is complemented by the strength and durability of synthetic polymers [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Electrospinning method has advantages over traditional mechanical techniques. Direct current electrospinning uses electrical forces to pull charged polymer solutions into fibers, usually with diameters between 50 and 1000 nm, which can allow the ability to produce more uniform [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Therefore, electrospun fibers can model ECM structure to to provide a natural environment for cellular interaction [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. In addition, the cortex shields the drug contained within the core layer, enhancing the drug's stability. The drug delivery system has the potential to minimize the distance of diffusion and increase solubility and efficacy, making it a good carrier for drug release [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. The organic components primarily consist of collagen nanofibrils, the elastic protein that will improve fracture resistance. The inorganic components consist of hydroxyapatite (HA) nanocrystals, which are attached to the surface of collagen nanofibrils. A proper organic-inorganic matrix is critical to healthy bone growth. Thus, if a scaffold is made of organic (a protein molecule with a similar structure) and inorganic (HA) nanomaterials, the organic-inorganic structure would mimic the proliferating cells embedded in the ECM [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Hydrogel scaffolds with nanoparticle reinforcement, in particular, show great potential for improving the structural properties and regenerative properties of regular hydrogel scaffold composites. For example, adding nHA to engineered PCL/GEL scaffolds improved the structural properties of the scaffold and the bioactivity of PCL [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. The improvement provides comfort that newly regenerated bone tissue would not exist on PCL alone and may suggest a stronger integration and overall, more effective bone regeneration [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e\u003cp\u003ePRF is a fibrin-based biomaterial consisting of a dense fibrin matrix containing leukocytes, platelets and proteins involved in the healing process [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. The use of an autologous scaffold reduces the risk of immune rejection and addresses biocompatibility problems associated with synthetic scaffolds. Another important function of leukocytes in PRF is modulating the immune response by secreting anti-inflammatory cytokine IL-4, and IL-10, which regulate excessive inflammation and lead to the conversion of macrophages into the pro-regenerative M2 type [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Moreover, leukocyte-derived antimicrobial peptides from PRF lower infection risks\u0026mdash;an important characteristic with PCL implants that are likely to be subject to bacterial colonization\u0026mdash;without inciting chronic inflammation. The management of osteogenesis include platelet-derived growth factors such as vascular endothelial growth factor (VEGF), transforming growth factor (TGF), and the platelet-derived growth factor (PDGF), as these all work together in orchestrating cellular responses for bone formation and repair. Vascular endothelial growth factor induces new blood vessel formation (angiogenesis) and osteogenesis, when vascularized, will allow for continued mesenchymal stem cell population and bone-inducing condition which surrounds the osteoprogenitor cells which is optimal for bone formation. PDGF acts as a chemoattractant for mesenchymal cells, initiating intracellular signal transduction pathways, to facilitate their proliferation, migration and differentiation into an osteogenic lineage. In addition to PDGF, VEGF-mediated angiogenesis provides a nutrient source and progenitor cells, while PDGF acts directly to proliferate and differentiate cells attached to scaffolds. This study will assess the appropriate nanofiber layers of PCL/GEL scaffolds with RPF for cell viability and osteogenic gene expression in ADMSCs to establish as a potential scaffold for tissue engineering applications targeting bone repair.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eADMSCs isolation and characterization\u003c/h2\u003e\u003cp\u003eAdipose tissue samples were obtained from four healthy female patients, aged between 28 and 50 years, who underwent elective surgery at Imam Khomeini Hospital under the ethical principles and the national norms and standards evaluated by the research ethics committee of the neuroscience institute of Tehran university of mediacal sciences, Iran (Approval ID: IR.TUMS.NI.REC.1402.038). During this process, those samples required multiple washes with phosphate buffered saline (PBS) (Gibco, Invitrogen) and penicillin-streptomycin (Pen/Strep). Subsequently, the adipose tissue fragments should be finely minced with extensive washing PBS, 1% gentamicin, and 2% Pen/Strep to eliminate any remaining debris and blood cells. Furthermore, the tissue samples were digested with collagenase Type I (0.075%) (Sigma Aldrich). The mixture was incubated for 50 minutes at 37\u0026deg;C, and was gently agitated to achieve free cell liberation. To stop the action of the Collagenase, 10% FBS in media α-MEM was used to neutralize the buffer, and it was subsequently centrifuged at 1800rpm for 10 minutes. The pellet was re-suspended in α-MEM with 20% FBS and 1% Pen/Strep, and the final supernatant was centrifuged again. The final pellet was placed in a T75 flask along with α-MEM, 20% FBS, and 1% Pen/Strep, and was incubated at 37 ˚C with 5% CO₂ for 48 hours. After 48 hours, the culture medium was replaced every two days until the cultured cells reached\u0026thinsp;~\u0026thinsp;90% confluence.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003ePreparation of platelet‑rich fibrin (PRF)\u003c/h3\u003e\n\u003cp\u003eBlood samples were first obtained from ten healthy volunteers. The samples were centrifuged for 15 minutes at 3500 rpm. The buffy coat, which contains PRF was collected into a neural tube.\u003c/p\u003e\n\u003ch3\u003ePreparation of PCL/Gel-nHA scaffold by electrospinning technique\u003c/h3\u003e\n\u003cp\u003eIn the first step, PCL and gelatin were dissolved at 30:70 ratio in solution mixture of 1:9 ratio of acetic acid and formic acid and stirred for 3 hours. Next, nHA was made at a concentration of 15%. The nanoparticle suspension was ultrasonicated at 40 W for 2minutes to obtain a uniform dispersion. The two prepared solutions were mixed and stirred for 1 hour to obtain a uniform homogenous nanocomposite solution. The prepared solution was subsequently loaded into a 5 mL syringe for electrospinning. (Full Option Lab2 ESI-II, Nano Azma Co, Iran, Ayatollah Rafsanjani Tissue Engineering Research Institute). Electrospun nanofibers were collected over a period of 2 hours (sample collection speed 5 mm/s, collector rotating 250 rpm). An applied voltage of 25 kV was applied with a permitted distance of 12 cm from a needle tip to a collector.\u003c/p\u003e\n\u003ch3\u003ePreparation of nHA-PRF with the PCL/Gel-nHA scaffold\u003c/h3\u003e\n\u003cp\u003eA 24-well plate was used as a mold to construct the scaffold. To determine the optimal concentration of nHA-PRF for deposition onto a PCL/GEL scaffold, three different concentrations were prepared, each with a varying number of nanofiber layers. The concentrations consisted of 18 \u0026micro;l, 36 \u0026micro;l, and 54 \u0026micro;l of PRF were used with scaffolds composed of 4, 3, and 2 nanofiber layers, respectively, in combination with a 10% nHA solution. Then, each was preserved at -20\u0026deg;C for 48 hours to remove moisture for further examination.\u003c/p\u003e\n\u003ch3\u003eMorphology characterization of the scaffold\u003c/h3\u003e\n\u003cp\u003eScanning Electron Microscopy (SEM) of nHA-PCL/GEL-loaded PRF was performed, illustrating the overall morphology and physical structure of the scaffolds at various magnifications.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eFourier Transform Infrared (FTIR) Spectroscopy\u003c/h2\u003e\u003cp\u003eTo evaluate the synthesis of the composite scaffold and the chemical structures of PCL/Gel and PCL/Gel-nHA, an FTIR analysis was performed using a PE1760x model device, operating in the spectral range of 4000\u0026ndash;400 cm⁻\u0026sup1;.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eMTT Assay\u003c/h3\u003e\n\u003cp\u003eThe MTT assay evaluated the proliferation and viability of MSCs derived from adipose tissue cultured on PCL/GEL- nHA scaffolds enriched with PRF. The MTT assay is a colorimetric method commonly used to measure cell viability based on mitochondrial activity. This technique checks the activity of mitochondrial dehydrogenase enzymes in live cells, which reduce MTT substrate, a yellow color reagent, into insoluble purple formazan crystals. These crystals' concentrations are then quantified after solubilization, and their concentration is quantified. To determine the optimal concentration of PRF for treating scaffolds, ADMSCs were seeded onto multilayer scaffolds at a density of 1\u0026times;10\u003csup\u003e4\u003c/sup\u003e cells per scaffold. After incubation for 1, 3, and 7 days, the three different concentrations of PRF were tested. Then, 40 \u0026micro;l of MTT solution (Sigma Aldrich) was added to each well and incubated for 4 hours at 37\u0026deg;C. After the 4-hour incubation, the media from all wells was carefully removed, and 200 \u0026micro;l of DMSO was added to each well to dissolve the formazan crystals that were developed during the assay. Finally, the optical density (OD) of each well was read using an ELISA reader at 570 nm.\u003c/p\u003e\n\u003ch3\u003eRNA extraction and RT-qPCR assays\u003c/h3\u003e\n\u003cp\u003eIn this study, ADMSCs were induced to undergo osteogenic differentiation to evaluate the scaffold's effect on COLI, COLX, and RUNX2 expression. To achieve this aim, the three multilayer scaffolds with three different concentrations of PRF were incubated in MEMα medium for 3 hours. After incubation, 5 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e ADMSCs were seeded onto each scaffold. The scaffolds with seeded cells were incubated for 90 minutes. Following this period, osteogenic differentiation medium (ɑ MEM, FBS 10%, Dexamethasone 1\u0026micro;M, Insulin 10\u0026micro;g/ml, Indomethacin 100\u0026micro;M, IBMX 500 \u0026micro;M, L- Glutamine 2mM (Gibco, Invitrogen), Pen/strep 1%) was added to the cultures, and then the scaffolds were then maintained in an incubator for 14 days at 37\u0026deg;C, with 5% CO₂ and 90% humidity.\u003c/p\u003e\u003cp\u003eIn the subsequent step, treated scaffolds with cells were collected for RNA extraction. Initially, the scaffolds were fragmented with nitrogen and then added 1mL of cold RNX for 5 \u0026times; 105 cells and incubated for 15 minutes on ice. After that, 200\u0026micro;L of cold chloroform (Merck) was added and incubated on ice. Then the solution was centrifuged at 12,000 \u0026times; g for 15 minutes at 4\u0026deg;C. The upper phase containing the RNA was carefully removed to a new tube and mixed with 500\u0026micro;L of cold isopropanol (Merck) for 15 minutes on ice. After that, centrifuged, washed the RNA pellet with ethanol and centrifuged to dry and resuspended in 20\u0026micro;l of DEPC treated water (CinnaGen). The obtained total RNA with 0.4\u0026micro;g concentrates immediately converted to cDNA following qPCRBIO cDNA Synthesis Kit solutions and 20\u0026micro;L volume with DEPC water. Finally incubated to 30 minutes at 42\u0026deg;C and to 10 minutes at 80\u0026deg;C to inactivate the RTase (Fermentas).\u003c/p\u003e\u003cp\u003e2 \u0026micro;L cDNA along with 1 \u0026micro;L of each forward (F) and reverse (R) primers and 12 \u0026micro;L SYBR-Green-qPCR were made and volume into 20 by ddH\u003csub\u003e2\u003c/sub\u003eO for qPCR evaluation using Rotor-Gene\u0026reg; Q 5plex HRM System (QIAGEN\u0026reg;). The system modes include one initial hold phase for 2 minutes at 95\u003csup\u003eo\u003c/sup\u003e C, 40\u0026times; cycles of 5 seconds of denaturation at 95\u0026deg;C, 30 seconds annealing 64\u003csup\u003eo\u003c/sup\u003e C, and finally 55\u0026ndash;95 \u003csup\u003eo\u003c/sup\u003e C melting for Ct analysis, which makes qPCR highly optimized and specific. The amplification cycles were analyzed using Rotor-Gene software, which calculated Ct values by comparing the target gene expressions to β-actin as the reference gene. The primer sequences are as shown in (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eSequence of designed primers and expected fragment size\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGenes\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSense strand\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAntisense strand\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eSize of product\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eβ-actin\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTGGGGTGGCTTTTAGGATGG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAGGTTCACAATGTGGCCGAG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e114 bp\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCol I\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTTCTCGCTCTCGTTCAGAAGTCTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eAGTACCCGCACTTGCACAAC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e76 bp\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRUNX2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCTTGGGTGGGTGGAGGATTC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTGGCAGTCACATGGCAGATT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e136 bp\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCOLX\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCTGAACGATACCAAATGCC\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eTGGTGGACCAGGAGTACCTT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e132 bp\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eImmunohistochemistry\u003c/h2\u003e\u003cp\u003eIHC for \u003cem\u003eCollagen II\u003c/em\u003e isolated antigens and tissue sections were placed in 10 mM sodium citrate buffer (pH 6.0) and heated at 95\u0026deg;C for 20 minutes. Endogenous peroxidase was blocked with 3% hydrogen peroxide for 10 minutes. The sections were then incubated overnight at 4\u0026deg;C with a rabbit anti-human Collagen II polyclonal antibody (Abcam, ab34712, 1:200 dilution). The next day, sections were treated for 1 hour at room temperature with a horseradish peroxidase (HRP) conjugated goat anti-rabbit secondary antibody (Abcam, ab6721, 1:500 dilution). For visualization, the sections used 3,3'-diaminobenzidine (DAB) as the substrate (Dako) and were counterstained with hematoxylin. Images were taken at 40x magnification using an Olympus BX51 microscope (Olympus, Tokyo, Japan) [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e].\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eHematoxylin and Eosin (H\u0026amp;E) Staining\u003c/h2\u003e\u003cp\u003eFor H\u0026amp;E staining, the tissue sections were stained with hematoxylin (Sigma-Aldrich) for five minutes to stain the nuclei, rinsed with tap water, followed by 2 minutes of staining with eosin (Sigma-Aldrich) to stain the cytoplasm and the extracellular matrix. The tissues were dehydrated in a serial concentration of ethanol and cleared in xylene. The sections were mounted using Entellan (Merck, Darmstadt, Germany). Images were taken using an Olympus BX51 microscope at magnifications of 10x and 40x. [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eStatistical analysis was conducted using SPSS 21.0 for Windows. Quantitative variables are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean (SEM). Group differences were evaluated by one-way analysis of variance (One-Way ANOVA), with P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 considered statistically significant.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003ePhenotypic Evaluation of Adipose Tissue-Derived Stem Cells Using Inverted Light Microscopy\u003c/h2\u003e\u003cp\u003eWhen conducting morphological evaluations, these cells exhibited a predominantly spindle-shaped appearance, resembling fibroblasts (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003eStructural analysis of composite scaffolds using SEM\u003c/h2\u003e\u003cp\u003eThe structural characteristics of the scaffolds produced in this study was characterized under a scanning electron microscope (SEM) in three different stages. In the first stage, the morphology of a polycaprolactone/gelatin scaffold at a ratio of 70/30 was analyzed. In the second stage, the structural features of a polycaprolactone/gelatin scaffold containing 15% hydroxyapatite nanoparticles at a 70/30/15% ratio was described. In the third stage, the structural characteristics of a polycaprolactone/gelatin scaffold containing 15% hydroxyapatite nanoparticles and added 10\u0026ndash;100% fibrin-rich plasma (PRF) was examined, forming a composite of 70/30/15%-10/100% ( Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003eFTIR Spectroscopy Analysis\u003c/h2\u003e\u003cp\u003eThe FTIR analysis revealed distinct vibrational bands indicating the structural contributions of various functional groups present in the scaffold compositions (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). The PCL/Gel spectrum demonstrated characteristic bonds of esters, carbonyl, and alkyl chains. Upon the incorporation of nHA, the PCL/Gel-nHA spectrum exhibited additional peaks consistent with phosphate groups and nitrogen-containing moieties, alongside intensified and broadened bands in the hydroxyl and amine regions. These spectral modifications confirm the structural presence of nHA and PRF, suggesting potential molecular interactions between the bioactive additives and the polymer network. The appearance of combined features in the composite spectra highlights the successful integration and compatibility of the scaffold constituents (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cem\u003eThe characteristic absorption bands of each component are observed in their respective spectra. PCL/Gel show prominent peaks at 1041\u0026ndash;1171, 1726 cm⁻\u0026sup1;, and 2942 cm⁻\u0026sup1;, corresponding to C-O (alcohol/ether), C\u0026thinsp;=\u0026thinsp;O (carbonyl), and, CH (alkane) stretching respectively. PCL/Gel/nHA exhibit a peak at 690 cm⁻\u0026sup1; for PO\u003c/em\u003e\u003csub\u003e\u003cem\u003e4\u003c/em\u003e\u003c/sub\u003e\u0026thinsp;\u003csup\u003e\u003cem\u003e\u0026minus;\u0026thinsp;3\u003c/em\u003e\u003c/sup\u003e \u003cem\u003e(phosphate) stretching, 1028 cm⁻\u0026sup1; (C\u0026thinsp;=\u0026thinsp;O) at 1534\u0026ndash;1605 cm⁻\u0026sup1; for N-H, C\u0026thinsp;=\u0026thinsp;C (amide/aromatic), 2930 cm⁻\u0026sup1; (CH) and, 3293 cm⁻\u0026sup1; for O-H, N-H (hydroxyl and amine) stretching. These peaks confirm the successful incorporation of PRF into the nanocomposite scaffold matrix.\u003c/em\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003eEvaluation of ADMSCs Viability Using the MTT Assay\u003c/h2\u003e\u003cp\u003eThe impact of various concentrations of PRF on the viability of ADMSCs was evaluated on days 1, 3, and 7 using the MTT assay. As illustrated in charts 3\u0026ndash;4, the nanofibrous scaffolds treated with a medium concentration of PRF exhibited the highest cell viability across all evaluated time points. Based on these findings, the medium concentration was selected for subsequent experiments and further analysis throughout the remainder of the study (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cb\u003eEffect of Optimal PRF Concentration with Triple Nanofiber Layers on the Expression of RUNX2, Collagen Types X, and I Genes\u003c/b\u003e\u003c/p\u003e\u003c/li\u003e\u003c/ul\u003e\u003c/p\u003e\u003cp\u003eTo evaluate the relative changes in gene expression levels of RUNX2, as well as collagen types I, and X, quantitative real-time PCR (qPCR) was conducted. The analysis was performed under the influence of various concentrations of PRF integrated with triple-layered nanofibrous scaffolds. Adipose-derived mesenchymal stem cells (5 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e cells/ml) were seeded onto the composite scaffolds consisting of nanofibers and PRF Total RNA was extracted after 14 days of incubation, and the osteogenic marker gene expression levels were assessed. The findings demonstrated that RUNX2 and collagen types I mRNA expression in the group treated with nanofibrous scaffolds combined with a medium concentration of PRF was approximately 3.5-fold higher compared to the control group. Furthermore, the expression levels of collagen types X mRNA were elevated\u0026mdash;Each showed an approximately 2-fold increase compared to the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003eImmunohistochemistry\u003c/h2\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eImmunohistochemical staining for Collagen II demonstrated a dose-dependent reduction in expression. The medium and high concentration of the PRF group exhibited a high level of COL I and X deposition, while the medium concentration of the PRF group showed moderate staining. These findings are consistent with the 4-fold increase in COLI and RUNX2 gene expression observed in qRT-PCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003eHematoxylin and Eosin (H\u0026amp;E) Staining\u003c/h2\u003e\u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eH\u0026amp;E staining revealed better cellularity and ECM organization in the 3 nanofiber layers/medium concentration of PRF and 4 nanofiber layers/ high concentration of PRF groups compared to the 2nanofiber layers/ low concentration of PRF group. At 40x magnification, the medium concentration of PRF and high concentration of PRF showed tightly packed cell clusters and a rich ECM deposition. spindle-shaped ADMSCs and a well-organized ECM were clearly visible (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn recent years, there has been a rising interest in the application of MSCs/scaffolds for treating various bone injuries and exploring their therapeutic potential. These studies' results highlight the potential of composite scaffolds with synthetic and natural layers in regenerative medicine. Despite the considerable developments made in scaffold design and fabrication, there is still a need for a scaffold that is appropriate regarding strength and efficiency.\u003c/p\u003e\u003cp\u003eThe objective of this study was to assess, in an ex vivo setting, the regenerative potential of a multilayered nanofibrous scaffold of PCL-GEL containing nano-hydroxyapatite (nHA) and varying concentrations of platelet-rich fibrin (PRF) for the repair of bone defects. The findings indicated that the three-layered nanofibrous scaffold incorporating a PRF medium concentration representing the average PRF level\u0026mdash;exerted the most pronounced effect on the viability and longevity of ADMSCs.\u003c/p\u003e\u003cp\u003eImproving tissue regenerative outcomes in bones requires scaffolds to meet several specific conditions that create an environment conducive to the repair of bone tissue. In this context, Raucci et al. identified HA-Gel as a suitable scaffold for promoting osteogenesis [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. It demonstrated the feasibility of creating composite hydrogel scaffolds with controlled bioactive signal distribution using a combination of sol-gel and freeze-drying techniques. One of the significant outcomes was that electrostatic forces between calcium ions (Ca\u0026sup2;⁺) and carboxylate groups (COO⁻) in the gelatin matrix controlled the orientation of HA crystals which mimics the process of natural bone mineralization, enhancing osteogenic potential. Specifically, with decreasing levels of the inorganic content, the HA crystals were evenly dispersed throughout the scaffold. The combined application of a HA-Gel nanocomposite and endometrial-derived stem cells was reported in a 2013 study to significantly enhance bone tissue formation [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Scaffolds can generate tissue engineered constructs and approaches when oriented with stem cells or bioactive molecules to assist in tissue repair and regeneration. The physicochemical properties and morphology of the scaffolds, as well the rate of degradation, are key aspects of considerations in advancing scaffolds. The degradation of the scaffold would ideally be biocompatible and biodegradable allowing for a tissue formation rate that are aligned [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eElectrospinning describes a method in which a fiber producing state for materials is created by using direct electrostatic forces to produce fibers usually on the order of nanometers, with the use of either aqueous or non-aqueous solutions of NF or NP composites (or materials) [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Nanofibers are defined by an extremely large surface-to-volume ratio with a subtle high porosity and ultrafine pore diameters providing a great increase to cell adhesion and proliferation. Samples have shown promising outcomes with regard to biomedical applications from tissue engineering, drug delivery systems, and wound dressings [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Lee et al. evaluated the physical properties and bioactivity of a multilayered PCL/silica composite scaffold for bone tissue regeneration. Their findings demonstrated enhanced cell viability, increased ALP activity, and significant calcium deposition on the scaffold surface\u0026mdash;all indicative of MSC differentiation into osteogenic lineage [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. In a different study, MSC differentiation and growth were explored on cellulose/gelatin nanofiber scaffolds modified with HA for bone tissue engineering. Surface modification of HA on cellulose nanofibers led to a negatively charged surface that supported HA nucleation. The study showed that MSC cell proliferation and osteogenic differentiation were greatly improved on HA-modified scaffolds compared to unmodified scaffolds. The negatively charged surface adsorbed calcium ions, which promoted the adsorption of osteocalcin\u0026mdash;a negatively charged bone protein\u0026mdash;thus resulting in greater calcium deposition. The greater calcium accumulation on the scaffold surface was suggestive of greater osteogenic differentiation of MSCs into osteoblasts [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Ren et al. prepared a PCL/Gel composite nanofiber scaffold through electrospinning for bone regeneration. The osteoinductive ability of the scaffold was evaluated by Alizarin Red S staining of calcium deposition\u0026mdash;a marker of osteogenic differentiation. The red color on the surface of PCL/Gel nanofibers illustrated the appearance of calcium nodules and successful osteoblast differentiation of stem cells. In addition, the presence of gelatin in the scaffold played a crucial role in enhancing integrin-mediated cell adhesion and subsequent cell attachment to the scaffold surface [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. In another study, electrospun nanofiber scaffolds based on PCL, reinforced with HA and calcium carbonate nanoparticles, were analyzed for their potential in bone tissue engineering applications. The addition of these nanoparticles to the nanofibers significantly increased the tensile strength of the scaffold and enhanced the adhesion, proliferation, and growth of osteogenic cells on its surface [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. In a study by Edward et al. a bi-component scaffold composed of keratin and PCL was fabricated to assess its suitability for bone tissue engineering. The study found that the increase in the proportion of keratin compared to PCL resulted in a decrease in physical and mechanical strength. The modification, however, greatly improved the scaffolds' hydrophilic nature, thus leading to the proliferation of osteogenic cells [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. A study investigated the osteogenic differentiation of MSCs cultured on PCL/collagen/HA scaffolds in PDGF. The results demonstrated a significant increase in calcium deposition and osteocalcin expression in scaffolds containing HA compared to those without it, indicating enhanced bone-forming potential [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Our experimental findings reveal that, under \u003cem\u003ein vitro\u003c/em\u003e conditions, a composite scaffold made of PCL, gelatin, and nHA, combined with a moderate concentration of PRF, can effectively accelerate the osteogenic differentiation of ADMSCs. This combination also led to a notable upregulation in the expression of bone-specific genes, highlighting its potential for bone tissue engineering applications.\u003c/p\u003e\u003cp\u003eIn a study, the application of a HA-silk fibroin scaffold combined with bone marrow stromal cells (BMSCs) successfully led to the complete repair of a bone defect in the radius of a rabbit, demonstrating the scaffold's strong potential for clinical bone regeneration [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. According to the findings of Gholipour et al. the HA-silk fibroin (HA-SF), scaffolds did not negatively impact the BMSC's stem cell's viability and biological character in comparison to the control group. In addition, SEM images revealed that the cells not only had good attachment to the surface of the scaffold but also infiltrated into the scaffold's porous structure. This indicates the scaffold's capacity for cell attachment and osteogenic differentiation. In total, the HA-SF scaffolds exhibited excellent biocompatibility, non-cytotoxicity, and, the ability to regenerate bone tissue [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. A composite of poly (L-lactic acid) (PLLA), or PLLA/HA was used to observe the behavior of human ADSCs (hADSCs) using electrospun scaffolds. Micrographs of the cultures showed that composite scaffolds were more effective in the cell's growth and infiltration. Improvements in cellular activity result from the structural changes of cells due to the admixture of HA. These enhanced properties of the nanocomposite scaffold are attributed to the functional groups of HA and PLLA forming hydrogen bonds, which improved framework bioactivity and bioactive scaffolds' structural integrity. Some researchers have noted that PLLA can be directly grafted onto the surface hydroxyl groups of HA nanoparticles through ring-opening polymerization of L-lactide [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. PRP therapy has evoked considerable interest as a non-surgical mode of treating musculoskeletal injuries. Recent years have seen PRP become increasingly accepted as a treatment method for soft tissue injury for its regenerative properties, simplicity of use, and lack of dangerous side effects [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. It is anticipated that based on the available evidence, different growth factors and active proteins secreted from PRP achieve their biological activity upon activation via a familiar process known as degranulation. In this way, the release of bioactive molecules is targeted, playing a key role in tissue regeneration and repair [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. One of the key benefits of 3D culture environments compared to conventional 2D systems is that they can more closely replicate the physiological conditions of native tissue. This closes the gap between in vitro cell culture models and in vivo cell behavior, resulting in more predictive and relevant biological responses [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. There have been notable discrepancies in cell behavior between 2D and 3D culture systems. These include discrepancies in drug sensitivity, apoptosis, cell viability, gene expression, protein expression, and differentiation potential [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Furthermore, it has been shown that when cells are cultured on a basement membrane-like matrix, i.e., a hydrogel, they form more compact and physiologically meaningful interactions in signaling pathways [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. These findings highlight the contribution of 3D systems to the reproduction of in vivo-like cell responses toward more predictive biological modeling.\u003c/p\u003e\u003cp\u003eIn the present research, hADMSCs were seeded on a 3D scaffold in the presence of different concentrations of PRF. Osteogenic differentiation was measured by analyzing the expression level of collagen type I, X genes. The findings showed that the addition of PRF could considerably improve the osteoblast differentiation of stem cells on the nHA- PCL/Gel scaffold. Additional research determined that the scaffold possessed a uniformly porous microstructure with pore size favorable for osteoblast attachment, inner proliferation, growth, and migration. These findings approve the potential application of the scaffold in bone tissue engineering.\u003c/p\u003e\u003cp\u003eSome studies have shown that the high density of platelets can be a deciding factor in achieving successful bone regeneration [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. In an \u003cem\u003ein vivo\u003c/em\u003e study, osteogenic differentiation of embryonic umbilical cord-derived stem cells was quantified on scaffolds of HA. Outcomes demonstrated increased osteoblast differentiation, exhibiting the potential of scaffold-mediated regenerative approaches [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. Another study once more revealed that PRP could induce long-term enhancement in bone formation, indicating its prolonged osteoinductive capability [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eContrary to our findings, a review by Del Fabbro et al. indicated that there is no consensus regarding the effects of various platelet concentrations on osteoblast differentiation, function, and apoptosis [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. In a study conducted by Kasten et al, the results showed that PRP did not have a pronounced effect on the osteogenic differentiation of MSCs [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. Similarly, in another study conducted by Hern\u0026aacute;ndez-Fern\u0026aacute;ndez et al. there was no histological and radiological evidence of bone formation enhancement in distraction osteogenesis when PRP was administered during the first stage of treatment [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. In addition, the other research by Kon et al. [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e] and Oliveira Filho et al. [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e] The study also found that the administration of PRP did not result in enhanced bone regeneration. Such discrepancies in the literature could be due to the differences in the concentration and type of growth factors in various PRP preparations.\u003c/p\u003e\u003cp\u003eA study demonstrated that the use of PRP increased the number of osteoblasts and osteoclasts in the grafted area during the first month. In PRP-free grafts, however, the same quantity of these cells was observed after two or more months. These results suggest that while PRP can influence the early cellular response, its biological effect is short-lived and has little impact on bone regeneration over time [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. In a research, Wang et al. demonstrated that engineered scaffolds composed of a mixture of natural and synthetic biomineral materials\u0026mdash;specifically oyster shell (OS) and alpha-calcium sulfate hemihydrate (α-CSH)\u0026mdash;show promising potential for bone tissue regeneration. The scaffolds were subsequently strengthened using PRP, a source of growth factors, and BMSCs. The research demonstrated that this multifunctional construct supports effective bone regeneration with a focus on its clinical application [\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIn spite of PCL's pros in tissue engineering because of biocompatibility, low cost, and solubility in most organic solvents, it has some cons such as limited hydrophilicity and lack of surface cell receptors which interfere with its effectiveness in inducing cell adhesion, proliferation, and differentiation. So, researchers have used a mixture of PCL and natural polymers like GEL. Research indicates that adding GEL significantly enhances cell proliferation and infiltration compared to pure PCL scaffolds, making this composite a more advantageous option for tissue regeneration [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e, \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]. Gautam et al. reported that the incorporation of gelatin into PCL scaffolds significantly improves cell attachment and proliferation. Based on their results, cell growth on PCL/ GEL composite scaffolds was markedly higher compared to pure PCL, demonstrating the advantage of natural polymer blending for biological performance [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]. In addition, research has shown that combining PCL with nHA can eliminate key limitations of the polymer, including poor bioactivity, low biodegradability, and insufficient mechanical strength\u0026mdash;factors critical for supporting bone tissue regeneration [\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e].\u003c/p\u003e\u003cp\u003ePRF, a second-generation platelet concentrate, was initially introduced by Choukroun et al. Compared to PRP, PRF preparation is free from anticoagulant additives and subsequent neutralization steps. Therefore, successful PRF preparation requires rapid blood collection followed immediately by centrifugation, before the coagulation cascade fully initiates [\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e]. PRF, prepared as a platelet gel, plays varied roles in regenerative medicine. It can be used to support bone graft adhesion, improve wound healing, promote bone growth and maturation, stabilize grafts, maintain hemostasis, and function as a biological membrane.\u003c/p\u003e\u003cp\u003ePRF-deposited PCL/GEL scaffolds not only promote the late-stage osteogenic differentiation of bone marrow mesenchymal stem cells in vitro, but they also exhibit enhanced cell proliferation capacity, demonstrating their effectiveness in bone regeneration. In this direction, Mao's and Mishra's research reveals that the incorporation of bioactive molecules like RGD-phage nanofibers or cell-loaded hydrogels into scaffold composition significantly enhances vascularization and bone regeneration compared to acellular constructs [\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e, \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e]. In another study, Ghiasi et al. combined osteochondral allografts with PRF transplanted into the rabbit knee. Histological results showed that adding PRF and umbilical cord blood stem cells (UCBSCs) to osteochondral grafts resulted in better healing and regeneration of the area than grafts alone or cells alone. PRF, by releasing growth factors, promotes the growth and proliferation of UCBSCs [\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIn a clinical trial, combining bone grafts with PRF growth factors may enhance bone density [\u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e]. While PRP is widely recognized, comparative studies have shown that the growth factor levels in PRF are relatively similar to those in PRP, further indicating its potential as an effective alternative in bone tissue engineering [\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eIn an experimental study, the effect of PRP on the survival of composite grafts was assessed using a rabbit model. The composite grafts were applied to the ears of rabbits, divided into a PRP-treated group and a control group. According to their results, graft viability and vascularization were significantly higher in the PRP group in comparison to controls. These findings suggest that PRP promotes early revascularization and as a result improves blood supply [\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e]. In a study, Ghiasi et al. used a PCL-Gel composite scaffold with lyophilized blood growth factors to differentiate Wharton Jelly mesenchymal stem cells (WJ-MSCs) into bone. They reported that this structure increased the expression of ALP, RUNX2, COLX, and COLI genes and that the expression of these genes also increased with increasing concentrations of lyophilized blood growth factors. The structure of this scaffold is in the form of layers consisting of PCL-Gel and lyophilized blood growth factors [\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eTwo studies have demonstrated that the transplantation of cultured cells in combination with calcium ceramic bone grafts yields highly favorable outcomes in bone regeneration [\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e, \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e]. It was further observed that these implanted cells not only proliferate but also secrete an osteoconductive matrix on the scaffold surface, thereby accelerating the bone healing process [\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e]. The findings of the current study are consistent with earlier observations, suggesting that the hybrid of synthetic and natural scaffolds, when integrated with stem cells and appropriate growth factors, can greatly enhance the therapeutic effects. The integrative strategy not only increases the effectiveness of bone regeneration but also plays a significant part in expediting the osteogenesis process.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThe results of our study show that, during the first stage, multilayer composite scaffolds made of nanofibers and a specific number of PRF improve gene expression related to bone formation. This suggests that these scaffolds help stem cells turn into osteoblast-like cells, accelerating bone regeneration.\u003c/p\u003e\u003cp\u003eFurther investigations are recommended to evaluate the use of multilayer composite scaffolds made of nanofibers, PRF, and ADMSCs both in vitro and in vivo. More studies are required to assess their therapeutic potential and to examine the impact of various biodegradable scaffolds on the healing process of osteoarthritis in animal models. It is also necessary to examine the influence of varying nHA concentrations in multilayer scaffold fabrication and also to examine a broad range of PRF concentrations. In addition, the effect of scaffold thickness on biological performance should be examined thoroughly.\u003c/p\u003e"},{"header":"Declarations","content":"\u003ch2\u003eFunding\u003c/h2\u003e\n\u003cp\u003ePart of the research budget for this research project was provided by the Neuroscience Research Institute.\u003c/p\u003e\n\u003cp\u003eData availability\u003c/p\u003e\n\u003cp\u003eData is provided within the manuscript.\u003c/p\u003e\n\u003cp\u003eEthics approval\u003c/p\u003e\n\u003cp\u003eresearch ethics committee of the neuroscience institute of Tehran university of mediacal sciences, Iran (Approval ID: IR.TUMS.NI.REC.1402.038). Informed consent was obtained from all participants. Data were recorded using coded checklists to maintain confidentiality and participants were free to withdraw from the study at any time. This article is original research.\u003c/p\u003e\n\u003cp\u003eConsent for publication\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003eCompeting interests There is no conflict of interest.\u003c/p\u003e\n\u003cp\u003eClinical trial number\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\n\u003cp\u003eMahdieh Ghiasi was involved in writing the manuscript, designing the model, reviewing tests, analyzing data, and reporting results. Khalil Pestehei contributed to the analysis of the results. Setareh Ebrahimi performed the English editing. Bita Fazel and Sepideh Moradkhani contributed to writing the manuscript. Amirhossein Ghiasi participated in the project.\u003c/p\u003e\n\u003ch2\u003eAcknowledgements\u003c/h2\u003e\n\u003cp\u003eThe authors would like to thank the Director of the Neuroscience Institute for providing the facilities.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eCowan PT, Launico MV, Kahai P, Anatomy. Bones. StatPearls [Internet]: StatPearls Publishing; 2024.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eReid IR, McClung MR. Osteopenia: a key target for fracture prevention. Lancet Diabetes Endocrinol. 2024;12(11):856\u0026ndash;64.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZeng J-H, Liu S-W, Xiong L, Qiu P, Ding L-H, Xiong S-L, et al. Scaffolds for the repair of bone defects in clinical studies: A systematic review. J Orthop Surg Res. 2018;13:1\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBernardo MP, da Silva BC, Hamouda AE, de Toledo MA, Schalla C, R\u0026uuml;tten S, et al. PLA/Hydroxyapatite scaffolds exhibit in vitro immunological inertness and promote robust osteogenic differentiation of human mesenchymal stem cells without osteogenic stimuli. Sci Rep. 2022;12(1):2333.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFarokhi M, Mottaghitalab F, Shokrgozar MA, Ou K-L, Mao C, Hosseinkhani H. Importance of dual delivery systems for bone tissue engineering. J Controlled Release. 2016;225:152\u0026ndash;69.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePorter JR, Ruckh TT, Popat KC. Bone tissue engineering: a review in bone biomimetics and drug delivery strategies. Biotechnol Prog. 2009;25(6):1539\u0026ndash;60.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAmini Z, Lari R. A systematic review of decellularized allograft and xenograft\u0026ndash;derived scaffolds in bone tissue regeneration. Tissue Cell. 2021;69:101494.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKumawat VS, Bandyopadhyay-Ghosh S, Ghosh SB. An overview of translational research in bone graft biomaterials. J Biomater Sci Polym Ed. 2023;34(4):497\u0026ndash;540.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHassanajili S, Karami-Pour A, Oryan A, Talaei-Khozani T. Preparation and characterization of PLA/PCL/HA composite scaffolds using indirect 3D printing for bone tissue engineering. Mater Sci Engineering: C. 2019;104:109960.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMuncie JM, Weaver VM. The physical and biochemical properties of the extracellular matrix regulate cell fate. Curr Top Dev Biol. 2018;130:1\u0026ndash;37.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHosseini A, Shahverdi M, Sourani Z, Habibi R, Ahangari Z, Shirian S et al. A Review on Synthesis, Characterization and Applications of Polycaprolactone as a Novel Drug Delivery System and Tissue Engineering. J Inflamm Dis.27(3).\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHirsch WDB, Weber A, Ferri J, Etges A, Neto PI, Pereira FDAS, et al. An Analysis of the Biocompatibility, Cytotoxicity, and Bone Conductivity of Polycaprolactone: An In Vivo Study. Polymers. 2024;16(16):2271.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBackes EH, Harb SV, Beatrice CAG, Shimomura KMB, Passador FR, Costa LC, et al. Polycaprolactone usage in additive manufacturing strategies for tissue engineering applications: A review. J Biomedical Mater Res Part B: Appl Biomaterials. 2022;110(6):1479\u0026ndash;503.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEtxabide A, Long J, Guerrero P, de la Caba K, Seyfoddin A. 3D printed lactose-crosslinked gelatin scaffolds as a drug delivery system for dexamethasone. Eur Polymer J. 2019;114:90\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHamid OA, Eltaher HM, Sottile V, Yang J. 3D bioprinting of a stem cell-laden, multi-material tubular composite: An approach for spinal cord repair. Mater Sci Engineering: C. 2021;120:111707.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eButcher AL, Koh CT, Oyen ML. Systematic mechanical evaluation of electrospun gelatin meshes. J Mech Behav Biomed Mater. 2017;69:412\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYao R, He J, Meng G, Jiang B, Wu F. Electrospun PCL/Gelatin composite fibrous scaffolds: mechanical properties and cellular responses. J Biomater Sci Polym Ed. 2016;27(9):824\u0026ndash;38.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBikuna-Izagirre M, Aldazabal J, Paredes J. Gelatin Blends Enhance Performance of Electrospun Polymeric Scaffolds in Comparison to Coating Protocols. Polymers 2022,14, 1311. s Note: MDPI stays neutral with regard to jurisdictional claims in published\u0026amp;#8230.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJirkovec R, Holec P, Hauzerova S, Samkova A, Kalous T, Chvojka J. Preparation of a composite scaffold from polycaprolactone and hydroxyapatite particles by means of alternating current electrospinning. ACS omega. 2021;6(13):9234\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePoliti S, Carotenuto F, Rinaldi A, Di Nardo P, Manzari V, Albertini MC, et al. Smart ECM-based electrospun biomaterials for skeletal muscle regeneration. Nanomaterials. 2020;10(9):1781.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLi Y, Wang J, Qian D, Chen L, Mo X, Wang L, et al. Electrospun fibrous sponge via short fiber for mimicking 3D ECM. J Nanobiotechnol. 2021;19(1):131.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhao Q, Du X, Wang M. Electrospinning and Cell Fibers in Biomedical Applications. Adv Biology. 2023;7(10):2300092.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMondrag\u0026oacute;n E, Cowdin M, Taraballi F, Minardi S, Tasciotti E, Gregory CA, et al. Mimicking the organic and inorganic composition of anabolic bone enhances human mesenchymal stem cell osteoinduction and scaffold mechanical properties. Front Bioeng Biotechnol. 2020;8:753.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen J-P, Chang Y-S. Preparation and characterization of composite nanofibers of polycaprolactone and nanohydroxyapatite for osteogenic differentiation of mesenchymal stem cells. Colloids Surf B. 2011;86(1):169\u0026ndash;75.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVenkatesan J, Kim S-K. Nano-hydroxyapatite composite biomaterials for bone tissue engineering\u0026mdash;a review. J Biomed Nanotechnol. 2014;10(10):3124\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ede Carvalho CKL, Fernandes BL, de Souza MA. Autologous matrix of platelet-rich fibrin in wound care settings: a systematic review of randomized clinical trials. J Funct Biomaterials. 2020;11(2):31.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSheykhhasan M, Qomi RT, Ghiasi M. Fibrin scaffolds designing in order to human adipose-derived mesenchymal stem cells differentiation to chondrocytes in the presence of TGF-β3. Int J Stem Cells. 2015;8(2):219\u0026ndash;27.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHassibi H, et al. Allogenic bone graft enriched by periosteal stem cell and growth factors for osteogenesis in critical size bone defect in rabbit model: histopathological and radiological evaluation. Iran J Pathol. 2020;15(3):205.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRaucci MG, DemitriC, Soriente A, Fasolino I, Sannino A, Ambrosio L. Gelatin/nano-hydroxyapatite hydrogel scaffold prepared by sol-gel technology as filler to repair bone defects. J Biomed Mater Res Part A. 2018;106A:2007\u0026ndash;19.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAi J, Heidari-Keshel S, Azami M, et al. Repair of critical size rat calvarial defects using endometrial-derived stem cells embedded within gelatin/apatite nanocomposite scaffold. Stem Cell Disc. 2013;3(1):36\u0026ndash;43.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMi HY, Jing X, Napiwocki BN, Li ZT, Turng LS, Huang HX. Fabrication of fibrous silica sponges by self-assembly electrospinning and their application in tissue engineering for threedimensional tissue regeneration. Chem Eng J. 2018;331:652\u0026ndash;62.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGhosal K, Agatemor C, Špit\u0026aacute;lsky Z, Thomas S, Kny E. Electrospinning Tissue Engineering and Wound Dressing Scaffolds from Polymer\u0026ndash;Titanium Dioxide Nanocomposites. Chem Eng J. 2018;358:1262\u0026ndash;78.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLee H, Hwang H, Kim Y, Jeon H, Kim G. Physical and bioactive properties of multi-layered PCL/silica composite scaffolds for bone tissue regeneration. Chem Eng J. 2014;250:399\u0026ndash;408.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGorgieva S, Girandon L, Kokol V. Mineralization potential of cellulose-nanofibrils reinforced gelatine scaffolds for promoted calcium deposition by mesenchymal stem cells. Mater Sci Engineering: C. 2017;73:478\u0026ndash;89.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRen K, Wang Y, Sun T, Yue W, Zhang H. Electrospun PCL/gelatin composite nanofiber structures for effective guided bone regeneration membranes. Mater Sci Engineering: C. 2017;78:324\u0026ndash;32.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWutticharoenmong kol P, Sanchavanakit N, Pavasant P, Supaphol P. Preparation and characterization of novel bone scaffolds based on electrospun polycaprolactone fibers filled with nanoparticles. Macromol Biosci. 2006;6:70\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEdwards A, Jarvis D, Hopkins T, Pixley S, Bhattarai N. Poly (ε-caprolactone)/keratin-based composite nanofibers for biomedical applications. J Biomedical Mater Res Part B: Appl Biomaterials. 2015;103:21\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRaghavendran HRB, Mohan S, Genasan K, Murali MR, Naveen SV, Talebian S, McKean R, Kamarul T. Synergistic interaction of platelet derived growth factor (PDGF) with the surface of PLLA/Col/HA and PLLA/HA scaffolds produces rapid osteogenic differentiation. Colloids Surf B. 2016;139:68\u0026ndash;78.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang G, Yang H, Li M, et al. The use of silk fibroin/hydroxyapatite composite co-cultured with rabbit bone-marrow stromal cells in the healing of a segmental bone defect. J Bone Joint Surg - Br Volume. 2010;92\u0026ndash;B(2):320\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGholipourmalekabadi M, Mozafari M, Gholipourmalekabadi M, et al. In vitro and in vivo evaluations of three-dimensional hydroxyapatite/silk fibroin nanocomposite scaffolds. Biotechnol Appl Biochem. 2015;62(4):441\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAgarwal S, Wendorff JH, Greiner A. Use of electrospinning technique for biomedical applications. Polymer. 2008;49(26):5603\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSill TJ, von Recum HA. Electrospinning: applications in drug delivery and tissue engineering. Biomaterials. 2008;29(13):1989\u0026ndash;2006.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eIrianto KA, Bakri AH, Kloping NA. Platelet Rich Plasma Injection for Soft Tissue Musculoskeletal Pain. Malaysian Orthop J. 2021;15(2):96\u0026ndash;100.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePineda-Cortel MR, Suarez C, Cabrera JT, Daya M, Bonifacio L, Vergara RB. Complexity of Platelet-Rich Plasma: Mechanism of Action, Growth Factor Utilization and Variation in Preparation. Plasmatology. 2024;18:1\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePark CH, Park JH, Suh YJ. Perspective of 3D culture in medicine: transforming disease research and therapeutic applications. Front Bioeng Biotechnol. 2024;12:1491669.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTang R. Application of platelet-rich plasma in traumatic bone infections. Exp Rev Anti Infect Ther. 2020;18(1):1\u0026ndash;12.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLee GY, Kenny PA, Lee EH, Bissell MJ. Threedimensional culture models of normal and malignant breast epithelial cells. Nat Methods. 2007;4(4):359\u0026ndash;65.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKawasumi M, Kitoh H, Siwicka K, Ishiguro N. Theeffect of the platelet concentration in plateletrich plasma gel on the regeneration of bone. Bone Joint J. 2008;90(7):966\u0026ndash;72.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMoreira DC, S\u0026aacute; CN, Andrade MGS, dos Santos Calmon TCB, de Almeida Reis SR, Pithon MM, et al. Angiogenesis and osteogenesis at incorporation process of onlay bone graft. J Oral Maxillo Surg. 2013;71(12):2048\u0026ndash;57.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBaba K, Yamazaki Y, Ikemoto S, Aoyagi K, Takeda A, uchinuma E. oateogenic potential of human umbilical cord-derived mesenchymal stromal cells cultured with umbilical cord blood-derived autoserum. J Cranio-maxillo-facial Surg. 2012;40:768\u0026ndash;72.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePessoa RS, Oliveira SR, Menezes HH, de Magalhaes D. Effects of platelet-rich plasma on healing of PRP alveolar socket: split-mouth histological and histometric evaluation in Cebus apella monkeys. Indian J Dent Res. 2009;20(4):442.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDel Fabbro M, Bortolin M, Taschieri S. Is autologous platelet concentrate beneficial for postextraction socket healing? A systematic review. Int J Oral Maxillofac Surg. 2011;40(9):891\u0026ndash;900.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKasten P, Vogel J, Beyen I, Weiss S, Niemeyer P, Leo A, et al. Effect of platelet-rich plasma on the in vitro proliferation and osteogenic differentiation of human mesenchymal stem cells on distinct calcium phosphate scaffolds: the specific surface area makes a difference. J Biomater App. 2008;23(2):88\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHernandez-Fernandez A, V\u0026eacute;lez R, Soldado F, Saenz-R\u0026iacute;os JC, Barber I, Aguirre-Canyadell M. Effect of administration of platelet-rich plasma in early phases of distraction osteogenesis: an experimental study in an ovine femur model. Injury. 2013;44(7):901\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKon E, Filardo G, Delcogliano M, Fini M, Salamanna F, Giavaresi G, et al. Platelet autologous growth factors decrease the osteochondral regeneration capability of a collagen-hydroxyapatite scaffold in a sheep model. BMC Musculo Disord. 2010;11(1):220.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMAd OF, Nassif PAN, Malafaia O, Ribas Filho JM, Ribas CAPM, Camacho AC, et al. Effects of a highly concentrated platelet-rich plasma on the bone repair using non-critical defects in the calvaria of rabbits. Acta Cir Bras. 2010;25(1):28\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNagata MJH, Melo LGN, Messora MR, Bomfim SRM, Fucini SE, Garcia VG, et al. Effect of platelet-rich plasma on bone healing of autogenous bone grafts in critical-size defects. Clin Periodontol. 2009;36:775\u0026ndash;83.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang J, Xie L, Wang X, Zheng W, Chen H, Cai L. The effects of oyster shell/alpha-calcium sulfate hemihydrate/platelet-rich plasma/bone mesenchymal stem cells bioengineering scaffold on rat critical-sized calvarial defects. J Mater Sci Mater Med. 2020;31(11):1\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVatankhah E, Semnani D, Prabhakaran MP, Tadayon M, Razavi S, Ramakrishna S. Artificial neural network for modeling the elastic modulus of electrospun polycaprolactone/gelatin scaffolds. Acta biomater. 2014;10(2):709\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChong EJ, Phan TT, Lim IJ, Zhang YZ, Bay BH, Ramakrishna S, et al. Evaluation of electrospun PCL/gelatin nanofibrous scaffold for wound healing and layered dermal reconstruction. Acta Biomater. 2007;3(3):321\u0026ndash;30.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGautam S, Dinda AK, Mishra NC. Fabrication and characterization of PCL/gelatin composite nanofibrous scaffold for tissue engineering applications by electrospinning method. Mater Sci Eng C. 2013;33:1228\u0026ndash;35.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChen JP, Chang YS. Preparation and characterization of composite nanofibers of polycaprolactone and nano-hydroxyapatite for osteogenic differentiation of mesenchymal stemcells. Colloida Surf B Biointerfaces. 2011;89(1):169\u0026ndash;75.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChoukroun J, Diss A, Simonpieri A, Girard MO, Schoeffler C, Dohan SL, Dohan AJ, Mouhyi J, Dohan DM. Platelet-rich fibrin (PRF): a second-generation platelet concentrate. Part IV: clinical effects on tissue healing. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2006;101(3):e56-60. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.tripleo.2005.07.011\u003c/span\u003e\u003cspan address=\"10.1016/j.tripleo.2005.07.011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 16504852.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang J, Yang M, Zhu Y, Wang L, Tomsia AP, Mao C. Phage nanofibers induce vascularized osteogenesis in 3D printed bone scaffolds. Adv Mater. 2014;26(29):4961\u0026ndash;6. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/adma.201400154\u003c/span\u003e\u003cspan address=\"10.1002/adma.201400154\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2014 Apr 7. PMID: 24711251; PMCID: PMC4122615.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMishra R, Roux BM, Posukonis M, Bodamer E, Brey EM, Fisher JP, Dean D. Effect of prevascularization on in vivo vascularization of poly(propylene fumarate)/fibrin scaffolds. Biomaterials. 2016;77:255\u0026thinsp;\u0026ndash;\u0026thinsp;66. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.biomaterials.2015.10.026\u003c/span\u003e\u003cspan address=\"10.1016/j.biomaterials.2015.10.026\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2015 Oct 22. PMID: 26606451; PMCID: PMC5059847.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePestehei SK, Ghiasi M, Bagheri N. Evaluation the Impressionability of Acellular Scaffolds in Presence of Different Combination of Umbilical Cord Blood Stem Cells and Platelet Rich Fibrin in Repair of Knee Defects in Rabbit (Novel Method with Xeno-Material Elements. Arch Neurosci. 2024;11(4):e147989. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.5812/ans-147989\u003c/span\u003e\u003cspan address=\"10.5812/ans-147989\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eClark D, Rajendran Y, Paydar S, Ho S, Cox D, Ryder M, Dollard J, Kao RT. Advanced platelet-rich fibrin and freeze-dried bone allograft for ridge preservation: A randomized controlled clinical trial. J Periodontol. 2018;89(4):379\u0026ndash;87. PMID: 29683498; PMCID: PMC6483085.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMijiritsky E, Assaf HD, Peleg O, Shacham M, Cerroni L, Mangani L. Use of PRP, PRF and CGF in Periodontal Regeneration and Facial Rejuvenation-A Narrative Review. Biology (Basel). 2021;10(4):317. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/biology10040317\u003c/span\u003e\u003cspan address=\"10.3390/biology10040317\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 33920204; PMCID: PMC8070566.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChoi HN, Han YS, Kim SR, Kim HK, Kim H, Park JH. The effect of platelet-rich plasma on survival of the composite graft and the proper time of injection in a rabbit ear composite graft model. Arch Plast Surg. 2014;41(6):647\u0026ndash;53. Epub 2014 Nov 3. PMID: 25396175; PMCID: PMC4228205.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGhiasi M, Mehdizadeh M. Designing Nanofiber Multilayer Composite Scaffolds and Lyophilized Blood Growth Factors in the Process of Osteogenesis. J Mazandaran Univ Med Sci. 2022;32(210):1\u0026ndash;12.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAlmansoori AA, Kwon OJ, Nam JH, Seo YK, Song HR, Lee JH. Mesenchymal stem cells and platelet-rich plasma-impregnated polycaprolactone-β tricalcium phosphate bio-scaffold enhanced bone regeneration around dental implants. Int J Implant Dent. 2021;7(1):35. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s40729-021-00317-y\u003c/span\u003e\u003cspan address=\"10.1186/s40729-021-00317-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. PMID: 33948811; PMCID: PMC8096877.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eQiu G, Shi Z, Xu HHK, Yang B, Weir MD, Li G, Song Y, Wang J, Hu K, Wang P, Zhao L. Bone regeneration in minipigs via calcium phosphate cement scaffold delivering autologous bone marrow mesenchymal stem cells and platelet-rich plasma. J Tissue Eng Regen Med. 2018;12(2):e937\u0026ndash;48. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/term.2416\u003c/span\u003e\u003cspan address=\"10.1002/term.2416\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2017 Jun 2. PMID: 28102000.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhao C, Zeng Z, Qazvini NT, Yu X, Zhang R, Yan S, Shu Y, Zhu Y, Duan C, Bishop E, Lei J, Zhang W, Yang C, Wu K, Wu Y, An L, Huang S, Ji X, Gong C, Yuan C, Zhang L, Liu W, Huang B, Feng Y, Zhang B, Dai Z, Shen Y, Wang X, Luo W, Oliveira L, Athiviraham A, Lee MJ, Wolf JM, Ameer GA, Reid RR, He TC, Huang W. Thermoresponsive Citrate-Based Graphene Oxide Scaffold Enhances Bone Regeneration from BMP9-Stimulated Adipose-Derived Mesenchymal Stem Cells. ACS Biomater Sci Eng. 2018;4(8):2943\u0026ndash;55. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/acsbiomaterials.8b00179\u003c/span\u003e\u003cspan address=\"10.1021/acsbiomaterials.8b00179\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Epub 2018 Jun 7. PMID: 30906855; PMCID: PMC6425978.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Bone Regeneration, composite nanofiber/Fibrin-Rich Plasma, Osteogenesis, electrospinning technique","lastPublishedDoi":"10.21203/rs.3.rs-7462422/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7462422/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBackground: Fractures, which may occur from trauma, tumor removal, or age-related decline, continue to be problematic within orthopedic practice. Tissue engineering has recently developed new opportunities for bone repair that combine biological agents with biomaterials. We developed a nanofibrous scaffold of polycaprolactone and gelatin (PCL/GEL) reinforced with nano-hydroxyapatite and different levels of Platelet-Rich Fibrin (PRF). We developed scaffolds using electrospinning or freeze-drying processes to create different scaffold configurations. Cell viability was tested using the MTT assay at 1-, 3- and 7-days. We also measured expression of bone-specific genes using Real Time PCR and assessed cell morphology with histological techniques.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eResults: The three-layer scaffold with a medium PRF concentration resulted in measurably higher cell viability. We continued to analyze the ability to support osteogenic differentiation by performing RT-qPCR for COL1, RUNX2 and COLX gene expression on day 14. The PRF concentration of collagen II expression and our analysis of morphology also supported the findings within the medium PRF group.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eConclusion: Our findings demonstrated that this scaffold formulation enhanced cell viability and the expression of bone-specific genes, making it a potential option for bone tissue engineering.\u003c/p\u003e","manuscriptTitle":"Bioengineered hybrid electrospun scaffold of Polycaprolacton/Gelatin-nano- hydroxyapatite, coated with platelet-rich fibrin, for enhanced osteogenesis and bone healing using adipose derived stem cells","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-03 20:17:21","doi":"10.21203/rs.3.rs-7462422/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"3feead13-1e9f-4e3b-accc-3b414cbf7073","owner":[],"postedDate":"September 3rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-09-23T12:10:03+00:00","versionOfRecord":[],"versionCreatedAt":"2025-09-03 20:17:21","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7462422","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7462422","identity":"rs-7462422","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00