Piezo1 signaling facilitates capillarization of LSECs and contributes to liver fibrosis progression | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Piezo1 signaling facilitates capillarization of LSECs and contributes to liver fibrosis progression Xiang Yang, Liyuan Gao, Yi Han, Yingchun Zhang, Xiaoyan Chang, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8630916/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Liver fibrosis arises from chronic injury-induced ECM stiffness, activating HSCs and disrupting sinusoidal homeostasis. LSECs undergo capillarization under mechanical stress, exacerbated by hemodynamic changes and ECM stiffness. The mechanosensor Piezo1 mediates this process via Ca²⁺ signaling, linking ECM stiffness to fibrotic progression, highlighting its therapeutic potential. Experimental Approaches Piezo1-knockout C57BL/6 mice were treated with CCl 4 to induce hepatic injury, followed by histopathological and biochemical analyses. Meticulous and comprehensive studies were performed in vitro using molecular approaches and stable cell lines. Results We demonstrated that increased matrix stiffness upregulates Piezo1 in LSECs, promoting capillarization. Piezo1 activation triggers Ca²⁺ overload, which stimulates MCU-dependent ROS production, leading to HIF-1α stabilization and subsequent pro-fibrotic cytokine release. Genetic inhibition of Piezo1 attenuates LSEC capillarization, reduces HSC activation, and ameliorates liver fibrosis in mice, highlighting Piezo1 as a potential therapeutic target. Conclusion Our findings reveal that mechano-activated channel Piezo1, triggered by elevated shear stress and ECM stiffening, regulates LSEC-dependent capillarization and HSC activation through the Ca²⁺-mROS-HIF-1α pathway and downstream pro-fibrotic mediators. Pharmacological inhibition of Piezo1 in LSECs may hold promise as an anti-fibrotic treatment. Biological sciences/Cell biology/Cell signalling/Calcium signalling Health sciences/Diseases/Gastrointestinal diseases/Liver diseases/Liver fibrosis Piezo1 liver sinusoidal endothelial cell Mitochondrial Calcium Uniporter HIF-1α capillarization liver fibrosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction Liver fibrosis typically arises as a pathological healing mechanism in response to persistent liver injury, characterized by excessive deposition and irregular organization of extracellular matrix (ECM) proteins in the space of Disse 1 . It is a shared feature of various chronic liver diseases, including viral hepatitis, alcoholic liver disease, and fatty liver disease. Without timely intervention, progressive fibrosis can progress to cirrhosis and even hepatocellular carcinoma (HCC), posing a severe threat to patients' lives 2 . The ECM is a dynamic network of secreted macromolecules including collagen, fibronectin, elastin, and hyaluronic acid that constitutes the cellular microenvironment. This extracellular microenvironment plays a pivotal role in hepatic physiology, delivering both biochemical signals and biomechanical forces that shape cellular phenotype and behavior 3 . ECM stiffness refers to excessive collagen deposition and enhanced cross-linking, leading to increased mechanical strength of the ECM, which is closely associated with the progression of liver fibrosis and cirrhosis 4 . Multiple studies have been conducted that ECM composition and stiffness could individually or in combination to regulate HSC fibrogenic phenotype and proliferation 5 , 6 . Activation of HSCs mediated chronic inflammatory responses and immune-derived profibrotic factors collectively create a microenvironment that induces hepatocytes, the major parenchymal cells, initiate critical pathogenic responses including transcriptional reprogramming, inflammatory activation, and programmed cell death 7 . Similarly, damaged hepatocytes also activate HSCs through paracrine signaling or via degradation products from cell death 8 . Evidently, hepatic cells not only respond to ECM microenvironmental alterations but also actively participate in ECM remodeling. LSECs, the predominant non-parenchymal liver cells, collaborate with hepatocytes, HSCs and ECM to constitute the hepatic sinusoid, governing material exchange in the hepatic microcirculatory terminus 9 . Under normal physiological conditions, the fenestrated structure of LSECs facilitates material exchange between hepatic sinusoids and hepatocytes. During the fibrogenic progression of chronic liver disease, LSEC fenestrations are lost and the continuous basement membrane form, thereby impeding material exchange. The resulting disruption of hepatic sinusoidal microenvironment homeostasis triggers compensatory angiogenesis in LSECs, a process also known as capillarization 10 . Unfortunately, the neovascularization disrupts hepatic architecture and promotes sinusoid remodeling and exacerbating liver fibrotic injury. Recent studies have suggested that inhibiting LSEC capillarization and pathological angiogenesis may be one of the important strategies for alleviating liver fibrosis 11 , 12 . Unlike other cells, LSECs are uniquely regulated by both ECM components and direct hemodynamic stimuli from circulating blood. Elucidating the mechanisms underlying LSEC dysfunction and their crosstalk with the hepatic microenvironment remodeling will provide critical insights for developing targeted therapies against liver fibrosis. Piezo1 is a mechanosensitive ion channel gene that encodes a pivotal transmembrane protein responsible for converting mechanical stimuli into electrochemical signals. As a member of the Piezo protein family, it forms trimeric, non-selective cation channels activated by membrane tension 13 . Piezo2 primarily mediates light touch sensation in the nervous system, whereas Piezo1 plays a broader role in sensing hemodynamic shear stress for proper vascular formation, regulating erythrocyte function, and controlling cell migration and differentiation 14 . During liver fibrosis, hepatic tissue undergoes remodeling with microcirculatory dysfunction, often accompanied by portal hypertension. LSECs, the most abundant endothelial cells in the liver, experience hemodynamic shear stress. Additionally, the progressively stiffening fibrotic ECM directly impacts LSECs through mechanical contact. Emerging evidence suggests that the mechanosensitive channel Piezo1 in LSECs mediates mechanotransduction signaling, leading to the production of pro-thrombotic factors that facilitate microthrombus formation in liver sinusoids 15 . Besides, activation of Piezo1 in vascular endothelial cells (VECs) promotes angiogenesis 16 and induces endothelial-mesenchymal transition (EMT) and proliferation in hepatocytes 17 . As a non-selective Ca²⁺ channel, Piezo1 on the LSEC membrane may sense blood flow or ECM mechanical stress, triggering Ca²⁺ influx and downstream signaling. This Ca²⁺-dependent pathway promotes the secretion of cytokines, modulating the ECM microenvironment and influencing liver fibrosis progression. Materials and Methods 1. Data Collection and Compilation Microarray datasets (GSE14323) were sourced from the GEO database ( http://www.ncbi.nlm.nih.gov/geo/ , accessed on 28 October 2023) 18 . GSE14323 comprised 19 controls and 41 cirrhotic liver samples. We selected the relevant gene data and reorganized the results for presentation in Figs. 1 A and 3 A. 2. Animal Ethics and Procedures The animal experiments were conducted at the Animal Experiment Center of Nanjing University of Chinese Medicine and were approved by the Ethics Committee of Zhangjiagang TCM Affiliated to Nanjing University of Chinese Medicine (Approval No.2023-11-109-1). All experimental operations should be conducted with maximal efforts to minimize animal pain and distress. The normal male C57BL/6J mice and C57BL/6JGpt-Piezo1 em14Cd10654 /Gpt mice (8 weeks old, 20-25g weight) were obtained from GemPharmatech Co., Ltd. (Nanjing, China). The animals were housed in ultra-clean airflow racks with ad libitum access to food and water. The animal facility was maintained at 20 ± 2°C, 40 ± 5% relative humidity, and a 12-hour light/dark cycle with dawn/dusk simulation. A mixture of carbon tetrachloride (CCl 4 ) purchased from Guangdong Daxiao Chemical Co., Ltd. ( # 56-23-5) and olive oil [1:9(v/v)] (0.5ml/100g body weight) injected intraperitoneally into mice (twice a week) for liver fibrotic model. Both mouse strains were randomly allocated into two groups (N = 10) receiving either olive oil (vehicle control) or CCl 4 -oil solution (fibrosis model). Animals underwent 24-hour fasting before sacrifice, with systematic blood draw and liver harvest at study conclusion. 3. Serum Biochemistry After 2-hour incubation at room temperature, whole blood was centrifuged (3000 rpm, 15 min, 4°C), and the supernatant was aliquoted for subsequent assays. Serum ALT and AST were quantified via automated biochemistry ( # Chemray 240, Rayto Life and Analytical Sciences Co., Ltd.) analysis, while serum Ca²⁺ levels were assessed using a calcium colorimetric assay kit ( # S1063S, Beyotime Biotech). 4. Quantitative Real-time PCR (qRT-PCR) Total RNA was extracted from (tissue/cells) using RNA rapid extraction kit ( # RN001-50Rxns, Shanghai Yishan Biotech) following the manufacturer’s protocol. RNA concentration and purity were assessed spectrophotometrically (NanoDrop™, absorbance ratios 260/280 nm ≥ 1.8). First-strand cDNA was synthesized from 1µg of total RNA using cDNA Synthesis Kit ( # 11121ES60, Yeason Biotech). Gene-specific primers were designed by Sangon Biotech (Shanghai) Co., Ltd. Primer sequences are listed in Table 1 (mouse) and 2 (human). Amplification efficiency (90–110%) and specificity were confirmed by standard curve analysis and melt curve assays. PCR amplification was performed in triplicate using qPCR SYBR Green Master Mix ( # 11202ES08, Yeason Biotech). Relative gene expression was calculated by the 2-ΔΔCt method, normalized to the endogenous control (GAPDH), and expressed as fold-change versus control group. Table 1 Primer sequences for determination of mRNA expression levels in mice. Gene Forward sequence (5’-3’) Reverse sequence (5’-3’) GAPDH GGCAAATTCAACGGCACAGTCAAG TCGCTCCTGGAAGATGGTGATGG Piezo1 AGTGCTGCTGGCGTCCTC CATCGTCGTCATCATCGTCATCG Lox AGCATATAGGGCGGATGTCAGAG AGGGCGGCTTGGTAAGAAGTC Loxl2 CTGACCTGGTGCTTAATGCTGAG GGAGGCGGAGAGGCAGTTC Elastin GCTGCTGCTAAGGCTGCTAAG CACCAGGAATGCCACCAACAC α-SMA CAGGGAGTAATGGTTGGAATGGG AGTTGGTGATGATGCCGTGTTC Col1a1 TCAGAGGCGAAGGCAACAGTC GCAGGCGGGAGGTCTTGG Col3a1 ACGAGGTGACAAAGGTGAAACTG ACCAGCAGCACCAGGAGAAC TGFβ1 AACAATTCCTGGCGTTACCTTGG GTATTCCGTCTCCTTGGTTCAGC Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the invariant control. The following primers of all genes available. Table 2 Primer sequences for determination of mRNA expression levels in human SK-Hep-1 cells. Gene Forward sequence (5’-3’) Reverse sequence (5’-3’) GAPDH CAGGAGGCATTGCTGATGAT GAAGGCTGGGGCTCATTT Piezo1 TGGAGGAGGCTGGCATCATCTG GACGTGCAGGTAGTAATGGCTAAGG LYVE1 GCTGGGTTGGAGATGGATTCGTG CAAACTGTCGGCTCACTGGAACC EDN1 TCTCTCTGCTGTTTGTGGCTTGC TTCTCCCCGCCGTTCTCACC Angiogenin GGCCGGGATGATGACAGATACTG CTGCGCTTGTTGCCATGAAT FGF2 TGAAGGAAGATGGACGGATG GTCCCGTTTTGGATCCGAGT OPN (SPP1) AGCAGAATCTCCTAGCCCCA CTGGCTGTCCACATGGTCAT HIF-1α CCATTAGAAAGCAGTTCCGCAAGC GTGGTAGTGGTGGCATTAGCAGTAG Mcu CGGACGGTACACCAGAGGATCG AACATCATCAGAGGGCACAACAGTG Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the invariant control. The following primers of all genes available. 5. Western Blot Tissues/cells were lysed in RIPA buffer ( # P0013, Beyotime Biotech) containing protease/phosphatase inhibitors ( # P1045, # ST506, Beyotime Biotech). Protein concentration was determined using a BCA assay ( # 23227, Thermo Scientific). Equal amounts of protein (20µg) were separated by SDS-PAGE (8 − 2% gels) and transferred to PVDF membranes. Membranes were blocked with QuickBlock buffer ( # P0252-500ml, Beyotime Biotech), then incubated overnight at 4°C with primary antibodies. HRP-conjugated secondary antibodies were applied for 2 hours at RT. Signals were visualized using ECL reagent ( # P10300, NCM Biotech) and analyzed by ImageJ. β-actin ( # 3700, CST) or Vinculin ( # ab129002, Abcam) served as the loading control. 6. Reagents and Antibodies The Jedi1 ( # SML2533-5MG) was purchased from Sigma-Aldrich; The Yoda1 ( # S6678-10mM), ACF ( # S8617), Cobalt chloride ( # S9490) and Mito-TEMPO ( # S9733) were bought from Selleck; The Calcimycin ( # HY-N6687) and MG132 ( # HY-13259) were purchased from MedChemExpress; The Calcium chloride (sterile) solution ( # ST365) was obtained from Beyotime Biotech. Primary antibody against Piezo1 ( # PA5-106296) was purchased from Invitrogen; Primary antibody against Angiogenin ( # 18302-1-AP), FGF-2 ( # 11234-1-AP), Osteopontin ( # 22952-1-AP), Collagen-Ⅰ ( # 14695-1-AP), Collagen-Ⅲ ( # 22734-1-AP) and Fibronectin ( # 15613-1-AP) were purchased from Proteintech; Primary antibody against HIF-1α ( # ab179483), p62 ( # ab109012), MCU ( # ab219827), α-SMA ( # ab7817) and Vinculin ( # ab129002) were purchased from Abcam; Primary antibody against Ubiquitin ( # 14049) and β-actin ( # 3700) were bought from CST. 7. Cell Operation The immortalized LSEC SK-Hep-1 ( # CL-0212) and immortalized human hepatocyte THLE-2 ( # CL-0833) were obtained from Procell Life Science & Technology Co., Ltd (Wuhan, China). The human HSC LX-2 ( # SCSP-527) came from Chinese Academy of Sciences Shanghai Cell Bank (Shanghai, China). The cell lines were cultured in incomplete DMEM/F12 medium, with 10% FBS and 1% penicillin-streptomycin added. DMEM/F12 ( # KGL1201-500) was purchased from Jiangsu KeyGEN BioTECH Corp., Ltd; FBS ( # A5669401) was purchased from Grand Island Biological Company. Besides, the primary human LSEC ( # PC-086h) was obtained from Wuhan SAIOS Biotechnology Co., Ltd, and cultured with specialized medium ( # PM-002). All cells were grown in a 5% CO 2 humidified atmosphere at 37°C. 8. Cell Viability Assay Cells (about 10 5 /ml) were seeded in 96-well plates or HTS96 well plates ( # SW96-COL-HTS, Matrigen). After indicated treatment and reaction time, dilute CCK-8 kit ( # CK04, DojinDo) to 10% with complete culture medium, and add 100µl of the reaction solution per well without bubbles. Then, incubate the 96-well plate for 1–2 hours at 37°C, and measure absorbance at 450 nm using a microplate reader. Each group in the experiments had six identical wells. 9. Cell Culture on Substrates with Different Stiffness Pre-coated 100mm plates ( # PS100-COL 0.2–50) with defined stiffness (0.2, 0.5, 1, 2, 4, 8, 12, 25, 50 kPa) were purchased from Matrigen (USA). The suspended SK-Hep-1 cells (1×10 6 ) in 5 ml completed culture medium were spread onto gel in different dishes and cultured for 4–6 hours at 37°C with 5% CO 2 . Next, 10 ml culture medium was added to dish, and the attached cells were continuously cultured for 48 hours. Cells were collected from gel surface with lysis for the following analysis. 10. Human XL Cytokine Array The Human XL Cytokine Array Kit ( # ARY022B, R&D Systems) for the parallel determination of the relative levels of selected human cytokines. Measured protein concentration in cell lysates using a BCA kit, then diluted the lysates to equal concentrations with Array buffer. Incubated the antibody-coated membrane with Blocking Buffer (1 hour, RT) to prevent nonspecific binding. Added diluted samples to the membrane (overnight, 4°C with gentle shaking). Washed membrane, then incubated with biotinylated detection antibodies (1–2 hours, RT). Added HRP-conjugated streptavidin (30 minutes, RT). Finally, visualized using chemiluminescent substrate ECL ( # P10300, NCM Biotech) and captured images with a gel imager. Quantify spot intensity with iBright Analysis Software. 11. Scanning Electronic Microscopy (SEM) Analyses After treatment, the mice were anesthetized with isoflurane inhalation. The abdominal cavity was opened, and the liver was fixed by portal vein perfusion with 1.5% glutaraldehyde solution ( # G1102-10ML, Servicebio). Once the liver turned pale, it was placed on ice for tissue dissection. The harvested liver samples were then immersed in 1.5% glutaraldehyde fixative for further preservation. Subsequently, the liver tissues underwent dehydration, followed by freezing and vacuum drying. They were then coated with a conductive ion-sputtered film to prepare for analysis using field-emission scanning electron microscopy ( # Regulus8100, Hitachi). The morphological changes in LSEC fenestrae were observed at random fields. 12. Intracellular Ca Measurement Prepared a 1–5µmol/L working solution by diluting the 1–5 mmol/L Fura2-AM ( # F015, DojinDo) stock in HBSS ( # C0218, Beyotime). For poor cellular uptake, added 0.04–0.05% Pluronic® F-127 ( # ST501-0.1g, Beyotime) (pre-dissolved in DMSO to 20% w/v) to prevent dye aggregation. Washed pre-cultured cells 3× with HBSS to remove serum (which contains esterases) and phenol red. Incubated cells with the working solution (enough to cover cells) at 37°C for 30 minutes. Removed the dye, wash cells 3× with HBSS, and incubated for 20–30 minutes to ensure complete intracellular de-esterification. Image using confocal microscopy (excitation at 488 nm) to monitor Ca²⁺-Fura2 fluorescence. 13. Tubulogenesis Assay LSECs (nearly 2×10 4 per well) were seeded on growth factor coated Matrigel ( # 354262, Corning) after 30 minutes of preincubation at 37°C in 48-well plates. LSECs were treated with different reagents at indicated concentrations for 3 hours. Tubulogenesis was visualized at random fields under a microscope. Tubulogenesis was assessed by measuring the length of tube using image J software. Representative images were shown. 14. Ros Measurement Mitochondrial superoxide was measured by MitoSox red staining ( # 40778ES50, Yeason Biotech). LSECs treated with indicated reagent were incubated with the working solution (5µM) for 10 minutes at 37°C, and were washed 3× with PBS. Fluorescence microscope (excitation at 594 nm) was used to detect mitochondrial superoxide. 15. Mitochondrial Membrane Potential Assay The MMP was determined by JC-1 staining kit ( # C2003S, Beyotime Biotech). For one well of a 6-well plate, removed the culture medium and wash the cells 3× with PBS. Added 1 ml of culture medium. Then, added 1 ml of JC-1 working solution and mixed well. Incubated at 37°C for 20 minutes. After incubation, removed the supernatant and washed twice with JC-1 staining buffer. Added 2 ml of culture medium, and observed under a fluorescence microscope (excitation at 488 nm to detect JC-1 monomers/594 nm to detect JC-1 aggregates). Upon mitochondrial depolarization (loss of membrane potential), the decreased negativity causes JC-1 to exist as monomers in the cytoplasm, resulting in enhanced green fluorescence. 16. Immunofluorescence Staining Immunofluorescence staining was performed as we previously described 19 . For liver tissues, staining with CD31 was used to identify LSECs. DAPI was applied to stain the nucleus of cells in both liver tissues and cultured LSECs and HSCs. All assessments were performed in a blinded fashion, and representative images are displayed. 17. Histological Analysis Liver tissues were fixed in 10% neutral buffered formalin and embedded in paraffin for histological analysis. Pathological evaluation was performed using H&E staining, while collagen deposition was assessed through Masson's trichrome and Sirius Red staining. For IHC analysis, tissue sections underwent antigen retrieval in citrate buffer (100°C, 5 minutes), endogenous peroxidase blocking with 3% H 2 O 2 (10 minutes, RT), and non-specific binding blocking with 5% BSA. Primary antibody incubation was conducted overnight at 4°C with agitation, followed by 2-hour secondary antibody incubation at RT. Finally, sections were developed using HRP-DAB staining and counterstained with hematoxylin. All images were captured by microscope. 18. Statistical Analysis Data are presented as mean ± standard deviation (SD). Statistical comparisons between groups were performed using Student's t-test (for normally distributed data) or Mann-Whitney U test (for non-parametric data). One-way ANOVA followed by Tukey's post hoc test was used for multiple group comparisons. All statistical analyses were performed using GraphPad Prism (version 9.0.0), with a two-tailed p-value < 0.05 considered statistically significant. Results 1. Calcium (Ca²⁺) overload and ECM stiffness cooperatively contribute to hepatic fibrosis progression Our analysis incorporated baseline clinical data from 40 participants (19 controls, 21 cirrhotic patients) obtained from GEO database (GSE14323) to clarify Piezo1/2 expression and its association with hepatic fibrosis. Given that elevated expression of ACTA2 (α-SMA), Col3A1, Col1A1, Elastin (ELN), LOX, and LOXL2 serves as a molecular signature of ECM stiffening 16 , the gene data suggested that hepatic fibrosis involves extracellular matrix stiffening, wherein Piezo1 may mediate mechanotransduction signaling positively (Fig. 1 A). α-SMA, Col3A1, Col1A1, and elastin serve as the foundational structural components of the extracellular matrix (ECM). The LOX family proteins, as the primary collagen cross-linking enzymes, catalyze the formation of covalent bonds between elastin or collagen fibers within the ECM, thereby enhancing ECM stiffness 20 . Subsequently, we established our model of chemically induced liver fibrosis in mice (Fig. 1 B). Serum calcium ion (Ca²⁺) levels were significantly elevated in CCl₄-induced model mice compared to controls (Fig. 1 C). Concomitantly, both mRNA (Fig. 1 D) and protein expression (Fig. 1 E) of the mechanosensitive calcium channel Piezo1 were significantly upregulated in liver tissues. Gross morphological examination revealed progressive fibrotic remodeling, characterized by a distinct transition from the normal reddish-brown, pliable parenchyma to a fibrotic phenotype exhibiting yellowish discoloration and marked tissue rigidity. The mRNA levels of multiple collagen isoforms, elastic fibers, and collagen cross-linking enzymes were significantly upregulated in fibrotic liver tissues (Fig. 1 F). These data, together, showed that biomechanical ECM stiffening synergizes with Ca²⁺ dyshomeostasis to drive hepatic fibrogenesis. 2. Matrix stiffness mediates piezo1 upregulation and induces LSEC capillarization. We next investigated the functional consequences of ECM stiffening on LSEC phenotype and function. Using stiffness-tunable hydrogels to mimic pathological liver tissue environments, we observed that increasing substrate rigidity induced a morphological shift in LSECs from elongated to rounded phenotypes (Fig. 2 A). LSECs cultured on intermediate-stiffness substrates (2–8 kPa) exhibited marginally higher viability compared to other rigidity conditions (Fig. 2 B), suggesting stiffness-dependent phenotypic adaptation during ECM remodeling in liver disease. The transcripts of LYVE1 and EDN1, the key endothelial markers indicating capillarization, were all significantly changed in LSEC seeded on gradient gels (Fig. 2 C). Meanwhile, Piezo1 transcriptional activity also exhibited a stiffness-dependent elevation in LSEC, which was confirmed by western blot analysis (Fig. 2 D). Pharmacological promotion of Piezo1 by yoda1 and jedi1 enhanced LSEC viability at specific concentration (Fig. 2 E). Furthermore, scanning electron microscopy (SEM) revealed that Piezo1 agonist treatment significantly reduced the characteristic fenestrated pore structures of LSECs. Altogether, these data revealed that elevated matrix stiffness upregulated Piezo1 via mechanotransduction signaling, driving LSEC capillarization. 3. Ca²⁺ overload mediates cytokine secretion in LSEC We next explored the role of Piezo1 signaling in LSEC capillarization. Reanalysis of clinical datasets revealed significant dysregulation of secretory proteins (SPP1, ANGPTL1/2) and MCU in fibrotic livers (Fig. 3 A), implicating coordinated paracrine and mitochondrial homeostasis in disease progression. To mimic calcium overload in vitro, LSECs were treated with either calcium-supplemented medium (Fig. 3 B) or calcium ionophore (Calcimycin) (Fig. 3 C). CCK-8 assays identified calcimycin (optimal concentration at 250nM) for inducing physiological-relevant Ca²⁺ overload. Notably, only LSECs in the liver are most sensitive to calcium fluctuations, showing the most significant changes in Piezo1 protein levels (Fig. 3 D). Using a human XL cytokine array kit comprising 105 cytokines, we successfully found out 8 differentially expressed secretary proteins between Calcimycin-CM and Scramble-CM (Fig. 3 E), including 6 upregulated factors (Osteopontin, Angiogenin, FGF-2, IL-1a, IL-1β, and IL-8) and 2 downregulated factors (Endoglin and Dkk-1). Angiogenin (ANG), fibroblast growth factor 2 (FGF-2), and OPN are pivotal regulators of LSEC angiogenesis 12 and HSC activation/proliferation 21, 22 , serving as core investigative targets in our research. Calcimycin dose-dependently promotes the protein expression of Piezo1, ANG, FGF-2, and OPN (Fig. 3 F), which was confirmed by PCR analysis (Fig. 3 G). Interestingly, the Piezo1 RNA level was inversely correlated with its protein expression. We speculated that in our in vitro experiments, short-term exposure of LSECs to high-concentration calcium ion solution not only activated calcium signaling pathways but also triggered negative feedback regulation. This mechanism likely helped maintain intracellular calcium homeostasis and prevented acute cellular damage. As a large transmembrane channel protein, Piezo1 is primarily localized on the plasma membrane and serves as the first gateway for cellular regulation of calcium homeostasis (Fig. 3 H). Taken together, these data suggested that calcium overload triggers cytokine release in LSEC. 4. HIF-1α-mediated cytokine production in LSECs is mechanistically linked to Ca²⁺ overload We next examined the mechanism underlying regulation of cytokine production in LSEC. Given that hypoxia occurs in fibrotic liver 23 and HIF-1α has been confirmed to regulate downstream FGF-2 24 , ANG 25 , and OPN 26 , 27 , we speculated that HIF-1α is involved in calcium overload-induced cytokine secretion in LSECs. Intriguingly, calcium overload did not alter HIF-1α protein expression (Fig. 4 A) but markedly elevated its mRNA transcription levels (Fig. 4 B). Considering that HIF-1α is subject to ubiquitin/acetylation-mediated proteasomal degradation under normaxia, we used protease inhibitors (MG132) to halt this dynamic process. We observed an accumulation of HIF-1α protein that positively correlated with calcimycin concentration (Fig. 4 A). Subsequent WB assay showed that the protein levels of HIF-1α and the critical ubiquitination substrate p62 are upregulated by calcimycin, but ubiquitin molecules and proteases mediate their degradation, restoring them to comparable levels (Fig. 4 C). A hypoxia-agonist CoCl 2 was employed to confirm the role of HIF-1α in LSEC secreting cytokine, and its optimal working concentration was determined to be 200µM (Fig. 4 D). As expected, hypoxic conditions can induce the overexpression of HIF-1α and downstream cytokines (ANG, FGF-2, and OPN) (Fig. 4 E). Meanwhile, ACF (100nM) (Fig. 4 F), a HIF-1α antagonist, effectively blocked calcimycin-induced upregulation of LSEC-associated cytokines (Fig. 4 G). Taken together, these data suggested that HIF-1α was activated by Ca 2+ overload and was critically involved in cytokines secretion of LSECs. 5. MCU-mediated mitochondrial ROS burst drives HIF-1α accumulation in Ca²⁺ overload LSEC Considering the significant alterations of MCU in fibrotic liver (Fig. 4 A), it is essential to investigate the impact of mitochondrial calcium homeostasis on HIF-1α. We systematically examined the effects of calcium overload on both MCU protein expression (Fig. 5 A and C) and mRNA transcriptional levels (Fig. 5 B). Similar to Piezo1, calcium overload-induced MCU overexpression appears to trigger a negative feedback mechanism as well. The majority of fluorescence-labeled Ca²⁺ was observed in the cytosol with prominent mitochondrial accumulation (Fig. 5 D), potentially driving the observed mitochondrial reactive oxygen species (mROS) burst (Fig. 5 E) and loss of mitochondrial membrane potential (MMP) (Fig. 5 F). Furthermore, we successfully mitigated calcimycin-induced expression of HIF-1α and downstream cytokines (Fig. 5 H) using the mitochondrial ROS scavenger Mito-Tempo at indicated concentration (Fig. 5 G). These data, together, indicated that MCU mediated mROS homeostasis was required for HIF-1α accumulation and the cytokines secretion of LSECs. 6. Piezo1 signaling ablation ameliorates LSEC capillarization and adjacent HSC activation To further investigate the role of Piezo1 in Calcimycin-induced LSEC, we constructed a CRISPR knock out immortalized human LSEC (SK-Hep-1) with lentivirus packaging sgRNA. PCR validation showed efficient Piezo1 knockout, and further revealed that Piezo1 deletion disrupted calcimycin's modulation of the LSEC Ca²⁺-mROS-HIF-1 axis (Fig. 6 A). The results of relative proteins were confirmed via Human XL Cytokine Array Kit (Fig. 6 B), Western blot assay (Fig. 6 C), and Immunofluorescence staining (Fig. 6 D). Furthermore, tubulogenesis assays showed that Piezo1 knockout abolished calcimycin-induced angiogenesis, the critical event in capillarization, in LSECs (Fig. 6 E). ANG, as a regulatory factor of angiogenesis, may act through autocrine mechanisms to induce angiogenesis in LSECs. We subsequently examined the relationship between LSEC and HSC under calcium overload. LSECs and HSCs were co-cultured, with LSECs exerting paracrine-mediated effects on HSCs following specific treatment (Fig. 6 F). Relative fibrotic markers including fibronectin, collagen-Ⅲ, and α-SMA were assessed in HSCs via Western blot assay (Fig. 6 G), and Immunofluorescence staining (Fig. 6 H). During the early phase of fibrosis, collagen type III is abundantly synthesized and co-assembles with collagen type I to form a cross-linked fibrillar network, and fibronectin concurrently serves as a provisional scaffold facilitating the deposition and organization of additional collagenous proteins 28 . Together, these ECM components drive progressive matrix stiffening. The above findings have established Piezo1 as the key regulator of the calcium signaling pathway in LSECs. Inhibition of Piezo1 effectively mitigates LSEC capillarization and HSC activation induced by calcium overload, thereby alleviating ECM stiffening. 7. Piezo1 knockout alleviates liver fibrosis in mice by attenuating LSEC capillarization and HSC activation We finally attempted to confirm these actions of Piezo1 in vivo, using gene knockout mice with CCl 4 -induced liver fibrosis (Fig. 7 A), and PCR verification of Piezo1 knockout efficiency (Fig. 7 G). In these mice, Piezo1 ablation reduced the necrotic area and tube formation in mouse fibrotic liver as shown by H&E staining (Fig. 7 B). Meanwhile, Masson staining (Fig. 7 C) and Sirius Red staining (Fig. 7 D) showed that inhibition of Piezo1 could alleviate the collagen deposition, and this outcome was directly visualized by collagen I immunostaining (Fig. 7 E). Besides, the serum levels of ALT, AST were reduced in Piezo1-ko mice (Fig. 7 F), which implicated improved liver injury. The transcripts of α-SMA, TGFβ1, and Collagen Ⅰ, three HSC activation markers, were all significantly downregulated upon Piezo1 gene ablation (Fig. 7 G). Notably, Piezo1 knockout alleviated hepatic fibrosis in mice by reducing calcium overload in liver tissues. To investigate the potential role of Piezo1 in liver fibrosis, we conducted a proteomics analysis of three groups containing wild type group (WT), CCl 4 model group (M), and Piezo1-ko group (KO). Volcano plots were used to display the significance and expression patterns of these genes, revealing gene expression differences between different samples (Fig. 8 A). Cross-comparison analysis demonstrated statistically significant variations in three key gene clusters: (1) hepatic fibrogenesis-related genes (Col8a1, Tgfb1/2, Spp1, Loxl1/2/4), (2) angiogenesis regulators (Fgfr4, Fgf2, Angpt2, Pdgfa), and (3) calcium signaling components (Mcu, Itpr2). To elucidate the functional implications of these differentially expressed genes and their associated biological pathways, we performed gene set enrichment analysis (GSEA). Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses were performed on the proteomic data of KO vs M groups. Go analysis revealed that the differentially expressed genes were significantly enriched in processes such as angiogenesis, mitochondrial inner membrane, and cytokine receptor binding (Fig. 8 B), which were closely related to the core mechanisms of LSEC calcium pathway. KEGG pathway analysis further indicated that the differentially expressed genes were significantly enriched in the fluid shear stress and atherosclerosis, which correlates with fibrotic portal hypertension resulting from LSEC capillarization (Fig. 8 C). Additionally, Genes exhibiting significant differential expression across distinct signaling pathways were systematically clustered and visualized in the heatmap (Fig. 8 D). Moreover, SEM analyses of sinusoidal fenestration showed that loss of LSEC fenestrae was reversed in Piezo1-ko mice (Fig. 8 E). Inhibition of Piezo1 also effected the expression of Collagen Ⅰ, HIF-1α, and MCU induced by CCl 4 stimulation (Fig. 8 F). Similar results were obtained on FGF-2 and OPN via immunofluorescence staining in which CD31 was utilized to target the LSECs (Fig. 8 G). Collectively, these data demonstrated that Piezo1 blockade attenuates fibrotic injury in murine liver fibrosis by suppressing LSEC capillarization and HSC activation. Discussion Liver fibrosis results from chronic liver injury triggering excessive scar tissue formation. Activated HSCs drive this process by depositing abnormal ECM, disrupting liver structure. Persistent fibrosis leads to cirrhosis, impairing liver function and increasing portal hypertension and HCC risk 29 . Therapeutic strategies generally target HSC deactivation 30 , hepatocyte protection 31 , or immunoregulation 32 to halt progression. As specialized liver endothelial cells, LSECs exhibit unique fenestrated and discontinuous structures that enable specialized functions in liver immunity and vascular homeostasis 9 . Our previous studies have demonstrated that inhibiting LSEC capillarization and pathological angiogenesis exerts a beneficial effect on alleviating liver fibrosis 33 , 34 . Considering that LSECs are simultaneously subjected to portal hypertension and ECM stiffening during chronic liver disease, this study specifically focuses on mechanosensitive receptor-mediated adaptations in LSECs under pathological biomechanical stress, and particularly focus on downstream signaling transduction. Analysis of clinical data initially revealed upregulated ECM stiffening genes in liver fibrosis, with Piezo1 as a key mechanosensor. Furthermore, we established a CCl₄-induced classical liver fibrosis model, which consistently demonstrated elevated expression of both Piezo1 and ECM stiffening-associated proteins during fibrotic progression. Although we were unable to directly measure sinusoidal blood pressure, we identified significantly elevated Ca²⁺ concentrations, a key biomechanical trigger for Piezo1 activation, in fibrotic liver circulation. Hypercalcemia is occasionally observed in patients with liver cirrhosis. Notably, the duration of hypercalcemia is positively associated with 90-day mortality, suggesting it may serve as a potential interventional target to reduce mortality in this high-risk population 35 . Meanwhile, LSECs were cultured on elastic dishes coated with substrates to simulate fibrotic liver environments at different stages in vitro. The results confirmed that increased ECM stiffness upregulated Piezo1 expression in LSECs and promoted their capillarization. These findings were consistently replicated in vascular endothelial cells of HCC models 16 . Thus, it is conceivable that Piezo1activation could regulate LSECs dysfunction and promoted liver fibrotic progression. Furthermore, calcimycin, a calcium ionophore, was used to stimulate piezo1 receptor, and OPN, FGF-2, and ANG were identified as key downstream cytokines of Piezo1, which regulate LSEC capillarization and HSC activation, thereby exacerbating liver fibrosis. Among these, ANG is the first human tumor-derived protein that was found to stimulate the growth of blood vessels 36 . It could play a crucial role in pathological angiogenesis of LSEC 12 . Indeed, ANG acts as a permissive factor, enabling and enhancing angiogenesis induced by other pro-angiogenic factors such as vascular endothelial growth factor (VEGF), basic/acidic fibroblast growth factors (bFGF/aFGF), and epidermal growth factor (EGF) 37 . Since no expression changes in VEGF or other cytokines were detected in the cell lysates, we speculate that these factors are secreted immediately after protein production, resulting in their low and stable intracellular levels. Besides, OPN and FGF-2 were recognized as critical cytokines promoting HSC activation. OPN is an important component of ECM, which promotes liver fibrosis and has been described as a biomarker for its severity. Hepatocyte E4BP4 can induce OPN via YAP to activate HSCs and promote liver fibrosis during diet-induced MASH 38 . Intriguingly, recent study reported that macrophage-derived OPN protected from NASH, by upregulating OSM, which increased ARG2 through STAT3 signaling 39 . We propose that macrophage-mediated immune responses are inherently a double-edged sword. Whether OPN exerts anti-inflammatory or pro-inflammatory effects remains to be further elucidated. Here, we primarily focus on the role of OPN in promoting HSC activation and its subsequent exacerbation of ECM deposition, thereby driving hepatic fibrosis. FGF2 has been considered to be pro-fibrotic because of its potential chemotactic and mitogenic activities in HSCs 40 . Similarly, several recent studies have reached opposing conclusions, suggesting that FGF-2 may act as a potential anti-fibrotic target in the liver 41 , 42 . However, this is explainable, as FGF-2 exists in high- (HMW) and low-molecular-weight (LMW) forms with distinct functions 21 . These isoforms may also explain our experimental variability about FGF-2. Therefore, additional experiments are required to investigate the specific targets of Piezo1 downstream cytokines (OPN, FGF-2, ANG) on HSCs and LSECs. Next, we investigated the mechanisms underlying piezo1 regulation of relative cytokines and identified a key role for HIF-1α in this context. Antagonist and inhibitor of HIF-1α were both employed to validate its regulatory effects on cytokines. During chronic liver disease progression, LSEC fenestration loss parallels fibrotic matrix deposition, which increases resistance to blood flow and reduces oxygen delivery 23 . Our preliminary studies have demonstrated that HIF-1α serves as a master regulator of pathological angiogenesis in LSECs via inducing many hypoxia-sensitive pro-angiogenic genes 33 , 43 . Emerging evidence has established HIF-1α's regulatory role over OPN 27 , FGF-2 24 , and ANG 25 across multiple cell types such as HUVEC, lung fibroblasts. Our current work now confirms this regulatory axis in LSECs. Therefore, HIF-1α could be a key molecule linking metabolic turnover to the dysfunctions of LSECs. We further explored the relationship between HIF-1α and piezo1 mediated calcium overload. Calcium plays a fundamental role in modulating a wide array of cellular and molecular functions, such as secretion, autophagy, motility, proliferation, and programmed cell death 44 . The endoplasmic reticulum (ER) and sarcoplasmic reticulum (SR) serve as major intracellular calcium reservoirs. Within the ER lumen, Ca²⁺ is essential for correct protein folding, while the release of Ca²⁺ generates cytosolic Ca²⁺ signals 45 . Mitochondria play a key role in calcium signaling by modulating cytosolic Ca²⁺ flux through their Ca²⁺ uptake and release mechanisms. Mitochondrial Ca 2+ influx is mediated by the pore-forming mitochondrial calcium uniporter protein (MCU) subunits 46 . In our experiments, significant modulation of MCU expression was detected in fibrotic livers, and accumulated Ca 2+ in the mitochondria stimulated oxidative metabolism and upon return to the cytoplasm. These mitochondrial ROS are mandatory to stabilize HIF-1α under normoxia 47 , and then triggered HIF-1α-mediated release of downstream cytokines. It is worth noting that mitochondria do not store Ca 2+ in a prolonged manner under physiological conditions, so that subsets of mitochondria are positioned close to the ER, SR and plasma membrane 48 . These findings suggested that Piezo1-mediated intracellular calcium overload is unlikely to be the primary direct trigger of mitochondrial oxidative stress. Intense research effort should be focused on the involvement of mitochondria in local Ca 2+ communication with other organelles. Finally, we assessed the therapeutic implications of our mechanistic experiments. The Piezo1-knockdown stable cell line and knockout mice were utilized in the relevant validation experiments. As expected, inhibition of Piezo1 effectively alleviated calcium overload-induced expression of LSEC-associated cytokines (OPN, FGF-2, ANG) and pathological angiogenesis, while also reducing the activation of co-cultured HSCs and their secretion of ECM fibrotic proteins (Fibronectin, Collagen III, α-SMA). More importantly, our in vitro findings were recapitulated in fibrotic mouse livers. Compared to control (empty vector) mice, Piezo1-knockout mice exhibited enhanced adaptability and resistance to CCl 4 -induced liver injury. The knockout of Piezo1 effectively suppressed multiple HSC activation markers, hepatic microvascular density, and perisinusoidal collagen deposition area. Furthermore, transcript sequencing results further demonstrated that Piezo1 knockout modulated genes associated with liver angiogenesis, oxidative stress, and fluid shear stress. Direct observation of LSEC fenestration structures confirmed that Piezo1 knockout ameliorated LSEC capillarization. Additionally, CD31-labeled LSECs were subjected to co-immunofluorescence staining with relevant proteins to visualize spatial changes in LSEC-associated protein expression. However, our current data cannot conclusively establish the role of Piezo1 in LSECs during liver fibrosis, as we did not perform cell-specific knockout mice. Notably, recent studies investigating the role of Piezo1 in liver macrophages have reported seemingly contradictory conclusions. While pharmacological activation of Piezo1 promotes macrophage efferocytosis and facilitates fibrosis regression 49 , Piezo1 deficiency in macrophages restricts liver fibrosis progression by suppressing inflammatory responses and reducing cathepsin S secretion 50 . The biological role of Piezo1 could be dependent on cell types and pathological conditions. In summary, we demonstrated that Piezo1, mechanactivated by elevated shear stress and ECM stiffening, regulated LSEC-mediated liver angiogenesis and HSC activation through modulating Ca 2+ -mROS-HIF-1α signaling pathway and downstream bioactive cytokines (as illustrated in Fig. 9 ). Selective inhibition of Piezo1 in LSECs may represent a therapeutic option for hepatic fibrosis. Abbreviations ECM, extracellular matrix; HCC, hepatocellular carcinoma; LSEC, liver sinusoidal endothelial cell; HSC, hepatic stellate cell; VECs, vascular endothelial cells; EMT, endothelial-mesenchymal transition; DMEM, Dulbecco’s Modified Eagle Medium; FBS, fetal bovine serum; ACF, acriflavine; RT, room temperature; H&E, Haematoxylin-Eosin; IHC, immunohistochemical; ANG, Angiogenin; FGF-2, Fibroblast growth factor 2; OPN, Osteopontin (SPP1); MCU, Mitochondrial Calcium Uniporter; EDN1, Enthedolial-1; CM, conditioned medium; SEM, scanning electron microscope; mROS, mitochondrial reactive oxygen species; MMP, mitochondrial membrane potential; GSEA, gene set enrichment analysis; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; ALT, alanine aminotransferase; AST, aspartate aminotransferase; HIF-1α, hypoxia-inducible factor 1-alpha; Metabolic Dysfunction-Associated Steatohepatitis, MASH; ER, endoplasmic reticulum; SR, sarcoplasmic reticulum. Declarations Acknowledgements The work was supported by the National Natural Science Foundation of China (82204929, 82505375), the Suzhou Science and Technology Plan Project (SYW2025157, SYWD2024262, SKYD2023055, SKYD2023228), the Scientific Research Project of Jiangsu Provincial Association of Chinese Medicine (CYTF2024053), the Nanjing University of Chinese Medicine Research Funding (XZR2024371, XZR2024388). Author contributions The construction of the main framework: YX, JZT, and HY. Cell culture researcher: JYF, ZYJ, and YT. Animal experiment operator: CXY. Literatures reading and analysis: GLY, YX, and ZYC. Write manuscript: GLY, YX and ZYC. Critical revision of the manuscript: LYJ, HY, and JZT. Data organization and chart plotting: ZLW, YX. Drawing schematic diagram: YX. Collection of references: MY. All authors approved the final version of the manuscript. Conflict of interest The authors declare no conflicts of interest. Data availability Data will be made available on request. References Kisseleva T. & Brenner D. Molecular and cellular mechanisms of liver fibrosis and its regression. Nat Rev Gastroenterol Hepatol , 18, 151–166 (2021). Friedman S. L. & Pinzani M. Hepatic fibrosis 2022: Unmet needs and a blueprint for the future. Hepatology , 75, 473–488 (2022). Jain I., Brougham-Cook A. & Underhill G. H. Effect of distinct ECM microenvironments on the genome-wide chromatin accessibility and gene expression responses of hepatic stellate cells. Acta Biomater , 167, 278–292 (2023). Fan W., et al. Matrix viscoelasticity promotes liver cancer progression in the pre-cirrhotic liver. Nature , 626, 635–642 (2024). Liu Z., et al. Matrix stiffness modulates hepatic stellate cell activation into tumor-promoting myofibroblasts via E2F3-dependent signaling and regulates malignant progression. Cell Death Dis , 12, 1134 (2021). Brougham-Cook A., et al. High throughput interrogation of human liver stellate cells reveals microenvironmental regulation of phenotype. Acta Biomater , 138, 240–253 (2022). Pan Q., et al. Hepatocyte FoxO1 Deficiency Protects From Liver Fibrosis via Reducing Inflammation and TGF-beta1-mediated HSC Activation. Cell Mol Gastroenterol Hepatol , 17, 41–58 (2024). Wang Y., et al. Hepatocyte Ninjurin2 promotes hepatic stellate cell activation and liver fibrosis through the IGF1R/EGR1/PDGF-BB signaling pathway. Metabolism , 140, 155380 (2023). Qu J., Wang L., Li Y. & Li X. Liver sinusoidal endothelial cell: An important yet often overlooked player in the liver fibrosis. Clin Mol Hepatol , 30, 303–325 (2024). McConnell M. J., Kostallari E., Ibrahim S. H. & Iwakiri Y. The evolving role of liver sinusoidal endothelial cells in liver health and disease. Hepatology , 78, 649–669 (2023). Ojha U., et al. Endothelial RUNX3 controls LSEC dysfunction and angiocrine LRG1 signaling to prevent liver fibrosis. Hepatology , 81, 1228–1243 (2025). Wang Y., et al. USP9X-enriched MSC-sEV inhibits LSEC angiogenesis in MASH mice by downregulating the IkappaBalpha/NF-kappaB/Ang-2 pathway. Pharmacol Res , 209, 107471 (2024). Xiao B. Mechanisms of mechanotransduction and physiological roles of PIEZO channels. Nat Rev Mol Cell Biol , 25, 886–903 (2024). Murthy S. E., Dubin A. E. & Patapoutian A. Piezos thrive under pressure: mechanically activated ion channels in health and disease. Nat Rev Mol Cell Biol , 18, 771–783 (2017). Hilscher M. B., et al. Mechanical Stretch Increases Expression of CXCL1 in Liver Sinusoidal Endothelial Cells to Recruit Neutrophils, Generate Sinusoidal Microthombi, and Promote Portal Hypertension. Gastroenterology , 157, 193–209 e9 (2019). Li M., et al. Activation of Piezo1 contributes to matrix stiffness-induced angiogenesis in hepatocellular carcinoma. Cancer Commun (Lond) , 42, 1162–1184 (2022). Hu Y., et al. EGFR-mediated crosstalk between vascular endothelial cells and hepatocytes promotes Piezo1-dependent liver regeneration. Genes Dis , 12, 101321 (2025). Barrett T., et al. NCBI GEO: archive for high-throughput functional genomic data. Nucleic Acids Res , 37, D885-90 (2009). Gao L., et al. OTULIN orchestrates NCOA4-FTH1 complex to alleviate APAP-induced hepatocyte Ferroptosis. Int Immunopharmacol , 154, 114490 (2025). Jiang D., et al. LOX-mediated ECM mechanical stress induces Piezo1 activation in hypoxic-ischemic brain damage and identification of novel inhibitor of LOX. Redox Biol , 76, 103346 (2024). Pan R. L., et al. Low-molecular-weight fibroblast growth factor 2 attenuates hepatic fibrosis by epigenetic down-regulation of Delta-like1. Hepatology , 61, 1708–20 (2015). Song Z., et al. Osteopontin Takes Center Stage in Chronic Liver Disease. Hepatology , 73, 1594–1608 (2021). Cai J., Hu M., Chen Z. & Ling Z. The roles and mechanisms of hypoxia in liver fibrosis. J Transl Med , 19, 186 (2021). Lv X. M., et al. Neotuberostemonine inhibits the differentiation of lung fibroblasts into myofibroblasts in mice by regulating HIF-1alpha signaling. Acta Pharmacol Sin , 39, 1501–1512 (2018). Tao E. W., et al. A specific tRNA half, 5'tiRNA-His-GTG, responds to hypoxia via the HIF1alpha/ANG axis and promotes colorectal cancer progression by regulating LATS2. J Exp Clin Cancer Res , 40, 67 (2021). Tang Z., et al. Safflower yellow promotes angiogenesis through p-VHL/ HIF-1alpha/VEGF signaling pathway in the process of osteogenic differentiation. Biomed Pharmacother , 107, 1736–1743 (2018). Luo H., et al. PLIN2 Promotes Lipid Accumulation in Ascites-Associated Macrophages and Ovarian Cancer Progression by HIF1alpha/SPP1 Signaling. Adv Sci (Weinh) , 12, e2411314 (2025). Zhang Y., et al. Mechanical forces in the tumor microenvironment: roles, pathways, and therapeutic approaches. J Transl Med , 23, 313 (2025). Sharma S., Le Guillou D. & Chen J. Y. Cellular stress in the pathogenesis of nonalcoholic steatohepatitis and liver fibrosis. Nat Rev Gastroenterol Hepatol , 20, 662–678 (2023). Isaac R., et al. TM7SF3 controls TEAD1 splicing to prevent MASH-induced liver fibrosis. Cell Metab , 36, 1030–1043 e7 (2024). Fu Y., et al. Salvianolic acid B attenuates liver fibrosis by targeting Ecm1 and inhibiting hepatocyte ferroptosis. Redox Biol , 69, 103029 (2024). Shi H., et al. CD47-SIRPalpha axis blockade in NASH promotes necroptotic hepatocyte clearance by liver macrophages and decreases hepatic fibrosis. Sci Transl Med , 14, eabp8309 (2022). Yang X., et al. Curcumol attenuates liver sinusoidal endothelial cell angiogenesis via regulating Glis-PROX1-HIF-1alpha in liver fibrosis. Cell Prolif , 53, e12762 (2020). Gao L., et al. Curcumol inhibits KLF5-dependent angiogenesis by blocking the ROS/ERK signaling in liver sinusoidal endothelial cells. Life Sci , 264, 118696 (2021). Majety P., Groysman A., Erlikh N., Chen Z. Z. & Westcott G. P. Predictors of Mortality in Hypercalcemia of Advanced Chronic Liver Disease. Endocr Pract , 28, 1062–1068 (2022). Loveland A. B., Koh C. S., Ganesan R., Jacobson A. & Korostelev A. A. Structural mechanism of angiogenin activation by the ribosome. Nature , 630, 769–776 (2024). Sheng J. & Xu Z. Three decades of research on angiogenin: a review and perspective. Acta Biochim Biophys Sin (Shanghai) , 48, 399–410 (2016). Wang S., et al. OPN-Mediated Crosstalk Between Hepatocyte E4BP4 and Hepatic Stellate Cells Promotes MASH-Associated Liver Fibrosis. Adv Sci (Weinh) , 11, e2405678 (2024). Han H., et al. Macrophage-derived Osteopontin (SPP1) Protects From Nonalcoholic Steatohepatitis. Gastroenterology , 165, 201–217 (2023). Yu C., et al. Role of fibroblast growth factor type 1 and 2 in carbon tetrachloride-induced hepatic injury and fibrogenesis. Am J Pathol , 163, 1653–62 (2003). Sato-Matsubara M., et al. Fibroblast growth factor 2 (FGF2) regulates cytoglobin expression and activation of human hepatic stellate cells via JNK signaling. J Biol Chem , 292, 18961–18972 (2017). Kurniawan D. W., et al. Fibroblast growth factor 2 conjugated superparamagnetic iron oxide nanoparticles (FGF2-SPIONs) ameliorate hepatic stellate cells activation in vitro and acute liver injury in vivo. J Control Release , 328, 640–652 (2020). Gao L., et al. Autophagy-induced p62 accumulation is required for curcumol to regulate KLF5-mediated angiogenesis in liver sinusoidal endothelial cells. Toxicology , 452, 152707 (2021). Berridge M. J., Lipp P. & Bootman M. D. The versatility and universality of calcium signalling. Nat Rev Mol Cell Biol , 1, 11–21 (2000). Wu L., Lian W. & Zhao L. Calcium signaling in cancer progression and therapy. FEBS J , 288, 6187–6205 (2021). De Stefani D., Raffaello A., Teardo E., Szabo I. & Rizzuto R. A forty-kilodalton protein of the inner membrane is the mitochondrial calcium uniporter. Nature , 476, 336–40 (2011). Willson J. A., et al. Neutrophil HIF-1alpha stabilization is augmented by mitochondrial ROS produced via the glycerol 3-phosphate shuttle. Blood , 139, 281–286 (2022). Cartes-Saavedra B., Ghosh A. & Hajnoczky G. The roles of mitochondria in global and local intracellular calcium signalling. Nat Rev Mol Cell Biol , 26, 456–475 (2025). Wang Y., et al. Stiffness sensing via Piezo1 enhances macrophage efferocytosis and promotes the resolution of liver fibrosis. Sci Adv , 10, eadj3289 (2024). Luo S., et al. Piezo1 specific deletion in macrophage protects the progression of liver fibrosis in mice. Theranostics , 13, 5418–5434 (2023). Additional Declarations There is no conflict of interest Supplementary Files Originaldata.pdf Original data Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8630916","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":588614356,"identity":"a11cdbf0-0cb9-453b-ae0d-16494199cc07","order_by":0,"name":"Xiang Yang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAwElEQVRIiWNgGAWjYLACxj82cvzMzIcfEKmeGailIc1Ysp0tzYAULYcTDc7zKEgQpcHgRv7BTzd3MCcYH+ZhMGCosYkmrOXMYWbp3DNseWaHeQ88YDiWlttAUMvxZjbmHDaeYrPDfAkGQBcSoeUwM0iLROLmZh4DCeK0gGzJbTNI3MBMrBbJM4eNpXPOJBhLHAYGcgIxfuG7kfjwc07Ffzn+/sOHH3yosSGsReEAMi+BkHIQkCdo6CgYBaNgFIwCAMAXPmVk+hKaAAAAAElFTkSuQmCC","orcid":"","institution":"Zhangjiagang TCM Hospital affiliated to Nanjing University of Chinese Medicine","correspondingAuthor":true,"prefix":"","firstName":"Xiang","middleName":"","lastName":"Yang","suffix":""},{"id":588614357,"identity":"9b13e6cc-a6e6-48de-8239-bc518e3843b9","order_by":1,"name":"Liyuan Gao","email":"","orcid":"","institution":"Zhangjiagang TCM Hospital affiliated to Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Liyuan","middleName":"","lastName":"Gao","suffix":""},{"id":588614358,"identity":"85f154a2-504d-41f2-b2c0-b641f17269cb","order_by":2,"name":"Yi Han","email":"","orcid":"","institution":"Zhangjiagang TCM Hospital affiliated to Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yi","middleName":"","lastName":"Han","suffix":""},{"id":588614359,"identity":"f53dab39-8aeb-49bc-b231-40be550b18a9","order_by":3,"name":"Yingchun Zhang","email":"","orcid":"","institution":"Zhangjiagang TCM Hospital affiliated to Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yingchun","middleName":"","lastName":"Zhang","suffix":""},{"id":588614360,"identity":"daea063d-484a-4a59-9279-fa783a9efca1","order_by":4,"name":"Xiaoyan Chang","email":"","orcid":"","institution":"Zhangjiagang TCM Hospital Affiliated to Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Xiaoyan","middleName":"","lastName":"Chang","suffix":""},{"id":588614361,"identity":"d7013065-196d-46b3-bc30-fdcd0b596d16","order_by":5,"name":"Liwei Zhu","email":"","orcid":"","institution":"Zhangjiagang TCM Hospital Affiliated to Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Liwei","middleName":"","lastName":"Zhu","suffix":""},{"id":588614362,"identity":"11f4ae99-d34a-4779-84b5-06a926ae042f","order_by":6,"name":"Ying Meng","email":"","orcid":"","institution":"Zhangjiagang TCM Hospital Affiliated to Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Ying","middleName":"","lastName":"Meng","suffix":""},{"id":588614363,"identity":"60914d82-16d7-42af-b92b-99ce59152ed8","order_by":7,"name":"Yanfei Ju","email":"","orcid":"","institution":"Zhangjiagang TCM Hospital Affiliated to Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yanfei","middleName":"","lastName":"Ju","suffix":""},{"id":588614364,"identity":"b1961b40-a031-4be3-9e0e-8125b3b45a83","order_by":8,"name":"Yunjie Zheng","email":"","orcid":"","institution":"Zhangjiagang TCM Hospital Affiliated to Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yunjie","middleName":"","lastName":"Zheng","suffix":""},{"id":588614365,"identity":"4cf2001c-2c71-472c-a5b1-876d5575d1ba","order_by":9,"name":"Ting Yang","email":"","orcid":"","institution":"Zhangjiagang TCM Hospital Affiliated to Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Ting","middleName":"","lastName":"Yang","suffix":""},{"id":588614366,"identity":"84a8cd8d-cf15-457b-b02e-070f2daaeca1","order_by":10,"name":"Zhitao Jiang","email":"","orcid":"","institution":"Zhangjiagang TCM Hospital Affiliated to Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Zhitao","middleName":"","lastName":"Jiang","suffix":""},{"id":588614367,"identity":"6607dac4-4fbb-4672-9b45-dccf17a2aed6","order_by":11,"name":"Yujia Li","email":"","orcid":"","institution":"Nantong Third People's Hospital","correspondingAuthor":false,"prefix":"","firstName":"Yujia","middleName":"","lastName":"Li","suffix":""}],"badges":[],"createdAt":"2026-01-18 11:25:29","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8630916/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8630916/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":102582934,"identity":"b0790537-efd3-4a95-ae46-cd8e969503df","added_by":"auto","created_at":"2026-02-13 09:42:01","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":331983,"visible":true,"origin":"","legend":"\u003cp\u003eCa²⁺ overload and ECM stiffness participate in fibrotic mice. (A) Relative gene expression levels in the validation dataset (GSE14323). (B) Mice were injected i.p. with CCl\u003csub\u003e4\u003c/sub\u003e for 8 weeks, to induce liver fibrosis. (C) Serum Ca\u003csup\u003e2+\u003c/sup\u003e content measurement (N≥6 independent experiments and the data are presented as mean values±SD). (E) Immunohistochemical analyses of piezo1 in liver tissues (N=6). (D and F) Real-time PCR analyses of matrix stiffness markers in liver tissues. Data were expressed as fold of control value (N=6). *p\u0026lt;0.05, **p\u0026lt;0.01 and ***p\u0026lt;0.005 versus control group.\u003c/p\u003e","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-8630916/v1/ee0c88623e6dd036aa0c30f8.png"},{"id":102582906,"identity":"6a1d8389-28a5-41c0-9f18-88ec206e4de3","added_by":"auto","created_at":"2026-02-13 09:41:51","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":445925,"visible":true,"origin":"","legend":"\u003cp\u003eIncreased matrix stiffness upregulates Piezo1 expression through mechanotransduction, promoting LSEC capillarization. (A) SK-Hep-1 cells were seeded on gels of different stiffness and observed under an optical microscope after 48 hours. (B and E) Cell viability was determined via Cell Counting Kit-8. Data were presented as percentage of control value (N=6). (C) Real-time PCR analyses of piezo1 and capillarization relative cytokines. Data were expressed as fold of control value (N=3). (D) Western blot analyses of piezo1 in SK-Hep-1 cells cultured on gradient stiffness gel (N=3). (F) Primary LSEC were cultured on collagen-covered plates mimicking in vivo environment, and the fenestrae (white arrowhead) of LSEC treated with piezo1 agonists (Jedi1, 10ng/ml and Yoda1, 10nM) were observed with scanning electron microscope scale (magnification, 1500×and 10000×). *p\u0026lt;0.05, **p\u0026lt;0.01 and ***p\u0026lt;0.005 versus control group.\u003c/p\u003e","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-8630916/v1/7496219fb24cdaff2bd20ada.png"},{"id":102582926,"identity":"57cde505-600c-41b0-92bb-36005ddbb851","added_by":"auto","created_at":"2026-02-13 09:41:55","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":434503,"visible":true,"origin":"","legend":"\u003cp\u003eCa²⁺ overload mediates cytokine secretion in LSEC. (A) Relative gene expression levels in the validation dataset (GSE14323). (B and C) Cell viability was determined via Cell Counting Kit-8. Data were presented as percentage of control value (N=6). (E) Screening of differentially expressed secretory protein using Human XL Cytokine Array Kit between DMSO-CM and Calcimycin-CM (upper panel). Fold change analysis of differentially expressed protein (bottom panel) (N=2). (D and F) Western blot analyses of relative protein in SK-Hep-1, LX-2 , or THLE-2 cells treated with calcimycin (N=3). (G) Real-time PCR analyses of relative mRNA. Data were expressed as fold of control value (N=3). (H) Immunofluorescence analysis of piezo1 expression (scale bar=50μm) (N=3). *p\u0026lt;0.05, **p\u0026lt;0.01 and ***p\u0026lt;0.005 versus control group.\u003c/p\u003e","description":"","filename":"Fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-8630916/v1/e9c2f2fc488090e7d10bf663.png"},{"id":102582889,"identity":"cad7b0a2-c8f2-4f8f-8f4c-933d0b83c170","added_by":"auto","created_at":"2026-02-13 09:41:47","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":272910,"visible":true,"origin":"","legend":"\u003cp\u003eCa²⁺ overload transactivates HIF-1α, which mediates the secretion cytokines of LSEC. (A and C) Western blot analyses of HIF-1α expression in calcimycin-treated SK-Hep-1 cells exposed to protease inhibitor MG132 (0.5μM) or not (N=3/2). (B) Real-time PCR analyses of HIF-1α. Data were expressed as fold of control value (N=3). (D and F) Cell viability was determined via Cell Counting Kit-8. Data were presented as percentage of control value (N=6). (E and G) Western blot analyses of relative protein in SK-Hep-1 cells treated with chemical reagents (N=3). *p\u0026lt;0.05, **p\u0026lt;0.01 and ***p\u0026lt;0.005 versus control group, and #p\u0026lt;0.05, ##p\u0026lt;0.01 and ###p\u0026lt;0.005 versus model group.\u003c/p\u003e","description":"","filename":"Fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-8630916/v1/540d68e8802d3c041ab9f4a7.png"},{"id":102583011,"identity":"4090fabf-388d-4ee2-a0a0-8b6f69280982","added_by":"auto","created_at":"2026-02-13 09:42:18","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":424368,"visible":true,"origin":"","legend":"\u003cp\u003eMCU-mediated mitochondrial ROS burst drives HIF-1αaccumulation in Ca²⁺ overload LSEC. (A and H) Western blot analyses of relative protein expression (N=3). (B) Real-time PCR analyses of Mcu. Data were expressed as fold of control value (N=3). (C) Immunofluorescence analysis of MCU expression (scale bar=50μm) (N=3). (D) Fluorescence assay to determine the intracellular Ca²⁺ in SK-Hep-1 cells under calcimycin stimulation. The Ca²⁺ were visualized in green fluorescence using confocal microscopy (scale bar=20μm). (E) Mitochondrial superoxide was detected by immunofluorescence using MitoSox Red staining (scale bar=200μm). (F) The JC-1 fluorescence ratio evaluated mitochondrial membrane potential (MMP) (scale bar=200μm). (G) Cell viability was determined via Cell Counting Kit-8. Data were presented as percentage of control value (N=6). *p\u0026lt;0.05, **p\u0026lt;0.01 and ***p\u0026lt;0.005 versus control group, and #p\u0026lt;0.05, ##p\u0026lt;0.01 and ###p\u0026lt;0.005 versus model group.\u003c/p\u003e","description":"","filename":"Fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-8630916/v1/7bf0aab8ef3b77b34122206a.png"},{"id":102582937,"identity":"b36e7465-0a5d-432a-9682-60682b4465ba","added_by":"auto","created_at":"2026-02-13 09:42:01","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":495708,"visible":true,"origin":"","legend":"\u003cp\u003ePiezo1 signaling ablation ameliorates LSEC capillarization and adjacent HSC activation. (A) Piezo1 CRISPR knock out immortalized human LSEC (SK-Hep-1) with lentivirus packaging sgRNA. Real-time PCR analysis was conducted to determine PIEZO1 interference efficiency and evaluate expression of associated factors to verify Piezo1-mediated regulation (N=3). (B) Human XL Cytokine Array Kit was performed to reveal Piezo1-dependent modulation of calcimycin-triggered cytokine expression (upper panel). Fold change analysis of differentially expressed protein (bottom panel) (N=2). (C and G) Western blot analyses of relative proteinexpression in LSEC or HSC (N=3). (D and H) Immunofluorescence analysis of relative protein expression in LSEC or HSC (scale bar=50μm) (N=3). (E) Tubulogenesis assay with quantification of length of intercellular compartments with ImageJ (n = 3). (F) Following drug treatment, LSECs were placed in the transwell chamber (0.4μm) while HSCs were cultured in the bottom well to establish a co-culture system. *p\u0026lt;0.05, **p\u0026lt;0.01 and ***p\u0026lt;0.005 versus control group, and #p\u0026lt;0.05, ##p\u0026lt;0.01 and ###p\u0026lt;0.005 versus model group.\u003c/p\u003e","description":"","filename":"Fig6.png","url":"https://assets-eu.researchsquare.com/files/rs-8630916/v1/8dae085a0af895bebe016562.png"},{"id":102583019,"identity":"43dfdcd4-903a-4dce-b86c-da88ee99618e","added_by":"auto","created_at":"2026-02-13 09:42:21","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":779634,"visible":true,"origin":"","legend":"\u003cp\u003ePiezo1 knockout alleviates liver fibrosis in mice. (A) Piezo1-ko and vehicle mice were injected i.p. with CCl\u003csub\u003e4\u003c/sub\u003e for 8 weeks to induce liver fibrosis. (B) Liver sections were stained with H\u0026amp;E for histological examinations (Scale bar=100, 500μm) (N=6). (C and D) Liver sections were stained with Masson reagents (C) and Sirius Red reagents (D) for collagen examinations (Scale bar=100, 500μm) (N=6). (E) Immunohistochemical analysis revealed the expression pattern of Collagen l (Scale bar=100, 500μm) (N=6). (F) Measurements of serum levels of liver injury markers AST and ALT (n≥6). (G) Real-time PCR analyses of Piezo1 and fibrotic markers (α-SMA, TGFβ1 and Collagen l). *p\u0026lt;0.05, **p\u0026lt;0.01 and ***p\u0026lt;0.005 versus control group, and #p\u0026lt;0.05, ##p\u0026lt;0.01 and ###p\u0026lt;0.005 versus model group.\u003c/p\u003e","description":"","filename":"Fig7.png","url":"https://assets-eu.researchsquare.com/files/rs-8630916/v1/92f6dada2a9bcfb8e49b48b8.png"},{"id":102582999,"identity":"2e41556c-3799-48f1-ab64-ba8284c9e7aa","added_by":"auto","created_at":"2026-02-13 09:42:11","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":440866,"visible":true,"origin":"","legend":"\u003cp\u003ePiezo1 knockout attenuates LSEC capillarization and HSC activation in hepatic. (A) illustrating the significance and expression trends of differentially expressed genes (DEGs). (B) Gene Ontology (GO) analysis demonstrated significant enrichment of differentially expressed genes in angiogenesis, mitochondrial homeostasis and cytokine receptor binding (KOvsM). (C) KEGG pathway analysis further revealed significant enrichment of IL-17 signaling pathway and Fluid shear stress and atherosclerosis (KOvsM). (D) Proteomic profiling of mice hepatic tissues revealed significant alterations in genes related to Ca\u003csup\u003e2+\u003c/sup\u003e-mROS-HIF-1α pathway. (E) SEM analyses of sinusoidal fenestration in liver tissues (Scale bar=3μm) (N=3). (F) Western blot analyses of relative protein expression in hepatic tissues (N=3). (G) Immunofluorescence analysis of endothelial markers CD31 accompanied by FGF-2, OPN, MCU and HIF-1α in liver tissues (scale bar=50μm) (N=3). *p\u0026lt;0.05, **p\u0026lt;0.01 and ***p\u0026lt;0.005 versus control group, and #p\u0026lt;0.05, ##p\u0026lt;0.01 and ###p\u0026lt;0.005 versus model group.\u003c/p\u003e","description":"","filename":"Fig8.png","url":"https://assets-eu.researchsquare.com/files/rs-8630916/v1/40f2ac8f596e6c73457539fc.png"},{"id":102583059,"identity":"bb6e72a8-d088-42ea-9392-2e4c93f240db","added_by":"auto","created_at":"2026-02-13 09:42:24","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":247080,"visible":true,"origin":"","legend":"\u003cp\u003eMechanism Diagram. In fibrotic liver disease, elevated calcium ions (Ca²⁺) and ECM stiffness activate the mechanosensitive ion channel Piezo1 on LSEC membranes. This triggers the Ca²⁺-mROS-HIF-1α signaling pathway, promoting the secretion of cytokines such as OPN, FGF-2, and Angiogenin, which induces LSEC capillarization and HSC activation, thereby exacerbating liver fibrosis.\u003c/p\u003e","description":"","filename":"Fig9.png","url":"https://assets-eu.researchsquare.com/files/rs-8630916/v1/5e745a409d64c4c1527f88e5.png"},{"id":107480367,"identity":"53246a43-cd8c-4339-a706-8f14ce2f3043","added_by":"auto","created_at":"2026-04-22 02:09:18","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3884827,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8630916/v1/a21556b8-2836-45c1-80d1-54a29e0a2939.pdf"},{"id":102582869,"identity":"5ff4abdb-8768-4056-95cb-002ee176c932","added_by":"auto","created_at":"2026-02-13 09:41:38","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":3364931,"visible":true,"origin":"","legend":"Original data","description":"","filename":"Originaldata.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8630916/v1/193b14ca8f8e0d57ed4b3ff1.pdf"}],"financialInterests":"There is no conflict of interest","formattedTitle":"Piezo1 signaling facilitates capillarization of LSECs and contributes to liver fibrosis progression","fulltext":[{"header":"Introduction","content":"\u003cp\u003eLiver fibrosis typically arises as a pathological healing mechanism in response to persistent liver injury, characterized by excessive deposition and irregular organization of extracellular matrix (ECM) proteins in the space of Disse\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. It is a shared feature of various chronic liver diseases, including viral hepatitis, alcoholic liver disease, and fatty liver disease. Without timely intervention, progressive fibrosis can progress to cirrhosis and even hepatocellular carcinoma (HCC), posing a severe threat to patients' lives\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. The ECM is a dynamic network of secreted macromolecules including collagen, fibronectin, elastin, and hyaluronic acid that constitutes the cellular microenvironment. This extracellular microenvironment plays a pivotal role in hepatic physiology, delivering both biochemical signals and biomechanical forces that shape cellular phenotype and behavior\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. ECM stiffness refers to excessive collagen deposition and enhanced cross-linking, leading to increased mechanical strength of the ECM, which is closely associated with the progression of liver fibrosis and cirrhosis\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. Multiple studies have been conducted that ECM composition and stiffness could individually or in combination to regulate HSC fibrogenic phenotype and proliferation\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Activation of HSCs mediated chronic inflammatory responses and immune-derived profibrotic factors collectively create a microenvironment that induces hepatocytes, the major parenchymal cells, initiate critical pathogenic responses including transcriptional reprogramming, inflammatory activation, and programmed cell death\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. Similarly, damaged hepatocytes also activate HSCs through paracrine signaling or via degradation products from cell death\u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. Evidently, hepatic cells not only respond to ECM microenvironmental alterations but also actively participate in ECM remodeling.\u003c/p\u003e \u003cp\u003eLSECs, the predominant non-parenchymal liver cells, collaborate with hepatocytes, HSCs and ECM to constitute the hepatic sinusoid, governing material exchange in the hepatic microcirculatory terminus\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. Under normal physiological conditions, the fenestrated structure of LSECs facilitates material exchange between hepatic sinusoids and hepatocytes. During the fibrogenic progression of chronic liver disease, LSEC fenestrations are lost and the continuous basement membrane form, thereby impeding material exchange. The resulting disruption of hepatic sinusoidal microenvironment homeostasis triggers compensatory angiogenesis in LSECs, a process also known as capillarization\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. Unfortunately, the neovascularization disrupts hepatic architecture and promotes sinusoid remodeling and exacerbating liver fibrotic injury. Recent studies have suggested that inhibiting LSEC capillarization and pathological angiogenesis may be one of the important strategies for alleviating liver fibrosis\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. Unlike other cells, LSECs are uniquely regulated by both ECM components and direct hemodynamic stimuli from circulating blood. Elucidating the mechanisms underlying LSEC dysfunction and their crosstalk with the hepatic microenvironment remodeling will provide critical insights for developing targeted therapies against liver fibrosis.\u003c/p\u003e \u003cp\u003ePiezo1 is a mechanosensitive ion channel gene that encodes a pivotal transmembrane protein responsible for converting mechanical stimuli into electrochemical signals. As a member of the Piezo protein family, it forms trimeric, non-selective cation channels activated by membrane tension\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. Piezo2 primarily mediates light touch sensation in the nervous system, whereas Piezo1 plays a broader role in sensing hemodynamic shear stress for proper vascular formation, regulating erythrocyte function, and controlling cell migration and differentiation\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. During liver fibrosis, hepatic tissue undergoes remodeling with microcirculatory dysfunction, often accompanied by portal hypertension. LSECs, the most abundant endothelial cells in the liver, experience hemodynamic shear stress. Additionally, the progressively stiffening fibrotic ECM directly impacts LSECs through mechanical contact. Emerging evidence suggests that the mechanosensitive channel Piezo1 in LSECs mediates mechanotransduction signaling, leading to the production of pro-thrombotic factors that facilitate microthrombus formation in liver sinusoids\u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. Besides, activation of Piezo1 in vascular endothelial cells (VECs) promotes angiogenesis\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e and induces endothelial-mesenchymal transition (EMT) and proliferation in hepatocytes\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. As a non-selective Ca\u0026sup2;⁺ channel, Piezo1 on the LSEC membrane may sense blood flow or ECM mechanical stress, triggering Ca\u0026sup2;⁺ influx and downstream signaling. This Ca\u0026sup2;⁺-dependent pathway promotes the secretion of cytokines, modulating the ECM microenvironment and influencing liver fibrosis progression.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\n\u003ch3\u003e1. Data Collection and Compilation\u003c/h3\u003e\n\u003cp\u003eMicroarray datasets (GSE14323) were sourced from the GEO database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.ncbi.nlm.nih.gov/geo/\u003c/span\u003e\u003cspan address=\"http://www.ncbi.nlm.nih.gov/geo/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e, accessed on 28 October 2023)\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. GSE14323 comprised 19 controls and 41 cirrhotic liver samples. We selected the relevant gene data and reorganized the results for presentation in Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eA.\u003c/p\u003e \n\u003ch3\u003e2. Animal Ethics and Procedures\u003c/h3\u003e\n\u003cp\u003e The animal experiments were conducted at the Animal Experiment Center of Nanjing University of Chinese Medicine and were approved by the Ethics Committee of Zhangjiagang TCM Affiliated to Nanjing University of Chinese Medicine (Approval No.2023-11-109-1). All experimental operations should be conducted with maximal efforts to minimize animal pain and distress. The normal male C57BL/6J mice and C57BL/6JGpt-Piezo1\u003csup\u003eem14Cd10654\u003c/sup\u003e/Gpt mice (8 weeks old, 20-25g weight) were obtained from GemPharmatech Co., Ltd. (Nanjing, China). The animals were housed in ultra-clean airflow racks with ad libitum access to food and water. The animal facility was maintained at 20\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C, 40\u0026thinsp;\u0026plusmn;\u0026thinsp;5% relative humidity, and a 12-hour light/dark cycle with dawn/dusk simulation. A mixture of carbon tetrachloride (CCl\u003csub\u003e4\u003c/sub\u003e) purchased from Guangdong Daxiao Chemical Co., Ltd. (\u003csup\u003e#\u003c/sup\u003e56-23-5) and olive oil [1:9(v/v)] (0.5ml/100g body weight) injected intraperitoneally into mice (twice a week) for liver fibrotic model. Both mouse strains were randomly allocated into two groups (N\u0026thinsp;=\u0026thinsp;10) receiving either olive oil (vehicle control) or CCl\u003csub\u003e4\u003c/sub\u003e-oil solution (fibrosis model). Animals underwent 24-hour fasting before sacrifice, with systematic blood draw and liver harvest at study conclusion.\u003c/p\u003e\n\u003ch3\u003e3. Serum Biochemistry\u003c/h3\u003e\n\u003cp\u003eAfter 2-hour incubation at room temperature, whole blood was centrifuged (3000 rpm, 15 min, 4\u0026deg;C), and the supernatant was aliquoted for subsequent assays. Serum ALT and AST were quantified via automated biochemistry (\u003csup\u003e#\u003c/sup\u003eChemray 240, Rayto Life and Analytical Sciences Co., Ltd.) analysis, while serum Ca\u0026sup2;⁺ levels were assessed using a calcium colorimetric assay kit (\u003csup\u003e#\u003c/sup\u003eS1063S, Beyotime Biotech).\u003c/p\u003e\n\u003ch3\u003e4. Quantitative Real-time PCR (qRT-PCR)\u003c/h3\u003e\n\u003cp\u003eTotal RNA was extracted from (tissue/cells) using RNA rapid extraction kit (\u003csup\u003e#\u003c/sup\u003eRN001-50Rxns, Shanghai Yishan Biotech) following the manufacturer\u0026rsquo;s protocol. RNA concentration and purity were assessed spectrophotometrically (NanoDrop\u0026trade;, absorbance ratios 260/280 nm\u0026thinsp;\u0026ge;\u0026thinsp;1.8). First-strand cDNA was synthesized from 1\u0026micro;g of total RNA using cDNA Synthesis Kit (\u003csup\u003e#\u003c/sup\u003e11121ES60, Yeason Biotech). Gene-specific primers were designed by Sangon Biotech (Shanghai) Co., Ltd. Primer sequences are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e (mouse) and 2 (human). Amplification efficiency (90\u0026ndash;110%) and specificity were confirmed by standard curve analysis and melt curve assays. PCR amplification was performed in triplicate using qPCR SYBR Green Master Mix (\u003csup\u003e#\u003c/sup\u003e11202ES08, Yeason Biotech). Relative gene expression was calculated by the 2-ΔΔCt method, normalized to the endogenous control (GAPDH), and expressed as fold-change versus control group.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences for determination of mRNA expression levels in mice.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward sequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse sequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGCAAATTCAACGGCACAGTCAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCGCTCCTGGAAGATGGTGATGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePiezo1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGTGCTGCTGGCGTCCTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCATCGTCGTCATCATCGTCATCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLox\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGCATATAGGGCGGATGTCAGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGGGCGGCTTGGTAAGAAGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLoxl2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGACCTGGTGCTTAATGCTGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGAGGCGGAGAGGCAGTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eElastin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTGCTGCTAAGGCTGCTAAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACCAGGAATGCCACCAACAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eα-SMA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGGGAGTAATGGTTGGAATGGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGTTGGTGATGATGCCGTGTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCol1a1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCAGAGGCGAAGGCAACAGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCAGGCGGGAGGTCTTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCol3a1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACGAGGTGACAAAGGTGAAACTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACCAGCAGCACCAGGAGAAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTGFβ1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAACAATTCCTGGCGTTACCTTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTATTCCGTCTCCTTGGTTCAGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"3\"\u003eGlyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the invariant control. The following primers of all genes available.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences for determination of mRNA expression levels in human SK-Hep-1 cells.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward sequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse sequence (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGGAGGCATTGCTGATGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAAGGCTGGGGCTCATTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePiezo1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGGAGGAGGCTGGCATCATCTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGACGTGCAGGTAGTAATGGCTAAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLYVE1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCTGGGTTGGAGATGGATTCGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCAAACTGTCGGCTCACTGGAACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEDN1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCTCTCTGCTGTTTGTGGCTTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTCTCCCCGCCGTTCTCACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAngiogenin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGCCGGGATGATGACAGATACTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGCGCTTGTTGCCATGAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFGF2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGAAGGAAGATGGACGGATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTCCCGTTTTGGATCCGAGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOPN (SPP1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGCAGAATCTCCTAGCCCCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGGCTGTCCACATGGTCAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHIF-1α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCATTAGAAAGCAGTTCCGCAAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTGGTAGTGGTGGCATTAGCAGTAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMcu\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGGACGGTACACCAGAGGATCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAACATCATCAGAGGGCACAACAGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"3\"\u003eGlyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the invariant control. The following primers of all genes available.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003e5. Western Blot\u003c/h3\u003e\n\u003cp\u003eTissues/cells were lysed in RIPA buffer (\u003csup\u003e#\u003c/sup\u003eP0013, Beyotime Biotech) containing protease/phosphatase inhibitors (\u003csup\u003e#\u003c/sup\u003eP1045, \u003csup\u003e#\u003c/sup\u003eST506, Beyotime Biotech). Protein concentration was determined using a BCA assay (\u003csup\u003e#\u003c/sup\u003e23227, Thermo Scientific). Equal amounts of protein (20\u0026micro;g) were separated by SDS-PAGE (8\u0026thinsp;\u0026minus;\u0026thinsp;2% gels) and transferred to PVDF membranes. Membranes were blocked with QuickBlock buffer (\u003csup\u003e#\u003c/sup\u003eP0252-500ml, Beyotime Biotech), then incubated overnight at 4\u0026deg;C with primary antibodies. HRP-conjugated secondary antibodies were applied for 2 hours at RT. Signals were visualized using ECL reagent (\u003csup\u003e#\u003c/sup\u003eP10300, NCM Biotech) and analyzed by ImageJ. β-actin (\u003csup\u003e#\u003c/sup\u003e3700, CST) or Vinculin (\u003csup\u003e#\u003c/sup\u003eab129002, Abcam) served as the loading control.\u003c/p\u003e\n\u003ch3\u003e6. Reagents and Antibodies\u003c/h3\u003e\n\u003cp\u003eThe Jedi1 (\u003csup\u003e#\u003c/sup\u003eSML2533-5MG) was purchased from Sigma-Aldrich; The Yoda1 (\u003csup\u003e#\u003c/sup\u003eS6678-10mM), ACF (\u003csup\u003e#\u003c/sup\u003eS8617), Cobalt chloride (\u003csup\u003e#\u003c/sup\u003eS9490) and Mito-TEMPO (\u003csup\u003e#\u003c/sup\u003eS9733) were bought from Selleck; The Calcimycin (\u003csup\u003e#\u003c/sup\u003eHY-N6687) and MG132 (\u003csup\u003e#\u003c/sup\u003eHY-13259) were purchased from MedChemExpress; The Calcium chloride (sterile) solution (\u003csup\u003e#\u003c/sup\u003eST365) was obtained from Beyotime Biotech. Primary antibody against Piezo1 (\u003csup\u003e#\u003c/sup\u003ePA5-106296) was purchased from Invitrogen; Primary antibody against Angiogenin (\u003csup\u003e#\u003c/sup\u003e18302-1-AP), FGF-2 (\u003csup\u003e#\u003c/sup\u003e11234-1-AP), Osteopontin (\u003csup\u003e#\u003c/sup\u003e22952-1-AP), Collagen-Ⅰ (\u003csup\u003e#\u003c/sup\u003e14695-1-AP), Collagen-Ⅲ (\u003csup\u003e#\u003c/sup\u003e22734-1-AP) and Fibronectin (\u003csup\u003e#\u003c/sup\u003e15613-1-AP) were purchased from Proteintech; Primary antibody against HIF-1α (\u003csup\u003e#\u003c/sup\u003eab179483), p62 (\u003csup\u003e#\u003c/sup\u003eab109012), MCU (\u003csup\u003e#\u003c/sup\u003eab219827), α-SMA (\u003csup\u003e#\u003c/sup\u003eab7817) and Vinculin (\u003csup\u003e#\u003c/sup\u003eab129002) were purchased from Abcam; Primary antibody against Ubiquitin (\u003csup\u003e#\u003c/sup\u003e14049) and β-actin (\u003csup\u003e#\u003c/sup\u003e3700) were bought from CST.\u003c/p\u003e\n\u003ch3\u003e7. Cell Operation\u003c/h3\u003e\n\u003cp\u003eThe immortalized LSEC SK-Hep-1 (\u003csup\u003e#\u003c/sup\u003eCL-0212) and immortalized human hepatocyte THLE-2 (\u003csup\u003e#\u003c/sup\u003eCL-0833) were obtained from Procell Life Science \u0026amp; Technology Co., Ltd (Wuhan, China). The human HSC LX-2 (\u003csup\u003e#\u003c/sup\u003eSCSP-527) came from Chinese Academy of Sciences Shanghai Cell Bank (Shanghai, China). The cell lines were cultured in incomplete DMEM/F12 medium, with 10% FBS and 1% penicillin-streptomycin added. DMEM/F12 (\u003csup\u003e#\u003c/sup\u003eKGL1201-500) was purchased from Jiangsu KeyGEN BioTECH Corp., Ltd; FBS (\u003csup\u003e#\u003c/sup\u003eA5669401) was purchased from Grand Island Biological Company. Besides, the primary human LSEC (\u003csup\u003e#\u003c/sup\u003ePC-086h) was obtained from Wuhan SAIOS Biotechnology Co., Ltd, and cultured with specialized medium (\u003csup\u003e#\u003c/sup\u003ePM-002). All cells were grown in a 5% CO\u003csub\u003e2\u003c/sub\u003e humidified atmosphere at 37\u0026deg;C.\u003c/p\u003e\n\u003ch3\u003e8. Cell Viability Assay\u003c/h3\u003e\n\u003cp\u003eCells (about 10\u003csup\u003e5\u003c/sup\u003e/ml) were seeded in 96-well plates or HTS96 well plates (\u003csup\u003e#\u003c/sup\u003eSW96-COL-HTS, Matrigen). After indicated treatment and reaction time, dilute CCK-8 kit (\u003csup\u003e#\u003c/sup\u003eCK04, DojinDo) to 10% with complete culture medium, and add 100\u0026micro;l of the reaction solution per well without bubbles. Then, incubate the 96-well plate for 1\u0026ndash;2 hours at 37\u0026deg;C, and measure absorbance at 450 nm using a microplate reader. Each group in the experiments had six identical wells.\u003c/p\u003e\n\u003ch3\u003e9. Cell Culture on Substrates with Different Stiffness\u003c/h3\u003e\n\u003cp\u003ePre-coated 100mm plates (\u003csup\u003e#\u003c/sup\u003ePS100-COL 0.2\u0026ndash;50) with defined stiffness (0.2, 0.5, 1, 2, 4, 8, 12, 25, 50 kPa) were purchased from Matrigen (USA). The suspended SK-Hep-1 cells (1\u0026times;10\u003csup\u003e6\u003c/sup\u003e) in 5 ml completed culture medium were spread onto gel in different dishes and cultured for 4\u0026ndash;6 hours at 37\u0026deg;C with 5% CO\u003csub\u003e2\u003c/sub\u003e. Next, 10 ml culture medium was added to dish, and the attached cells were continuously cultured for 48 hours. Cells were collected from gel surface with lysis for the following analysis.\u003c/p\u003e\n\u003ch3\u003e10. Human XL Cytokine Array\u003c/h3\u003e\n\u003cp\u003eThe Human XL Cytokine Array Kit (\u003csup\u003e#\u003c/sup\u003eARY022B, R\u0026amp;D Systems) for the parallel determination of the relative levels of selected human cytokines. Measured protein concentration in cell lysates using a BCA kit, then diluted the lysates to equal concentrations with Array buffer. Incubated the antibody-coated membrane with Blocking Buffer (1 hour, RT) to prevent nonspecific binding. Added diluted samples to the membrane (overnight, 4\u0026deg;C with gentle shaking). Washed membrane, then incubated with biotinylated detection antibodies (1\u0026ndash;2 hours, RT). Added HRP-conjugated streptavidin (30 minutes, RT). Finally, visualized using chemiluminescent substrate ECL (\u003csup\u003e#\u003c/sup\u003eP10300, NCM Biotech) and captured images with a gel imager. Quantify spot intensity with iBright Analysis Software.\u003c/p\u003e\n\u003ch3\u003e11. Scanning Electronic Microscopy (SEM) Analyses\u003c/h3\u003e\n\u003cp\u003eAfter treatment, the mice were anesthetized with isoflurane inhalation. The abdominal cavity was opened, and the liver was fixed by portal vein perfusion with 1.5% glutaraldehyde solution (\u003csup\u003e#\u003c/sup\u003eG1102-10ML, Servicebio). Once the liver turned pale, it was placed on ice for tissue dissection. The harvested liver samples were then immersed in 1.5% glutaraldehyde fixative for further preservation. Subsequently, the liver tissues underwent dehydration, followed by freezing and vacuum drying. They were then coated with a conductive ion-sputtered film to prepare for analysis using field-emission scanning electron microscopy (\u003csup\u003e#\u003c/sup\u003eRegulus8100, Hitachi). The morphological changes in LSEC fenestrae were observed at random fields.\u003c/p\u003e\n\u003ch3\u003e12. Intracellular Ca Measurement\u003c/h3\u003e\n\u003cp\u003ePrepared a 1\u0026ndash;5\u0026micro;mol/L working solution by diluting the 1\u0026ndash;5 mmol/L Fura2-AM (\u003csup\u003e#\u003c/sup\u003eF015, DojinDo) stock in HBSS (\u003csup\u003e#\u003c/sup\u003eC0218, Beyotime). For poor cellular uptake, added 0.04\u0026ndash;0.05% Pluronic\u0026reg; F-127 (\u003csup\u003e#\u003c/sup\u003eST501-0.1g, Beyotime) (pre-dissolved in DMSO to 20% w/v) to prevent dye aggregation. Washed pre-cultured cells 3\u0026times; with HBSS to remove serum (which contains esterases) and phenol red. Incubated cells with the working solution (enough to cover cells) at 37\u0026deg;C for 30 minutes. Removed the dye, wash cells 3\u0026times; with HBSS, and incubated for 20\u0026ndash;30 minutes to ensure complete intracellular de-esterification. Image using confocal microscopy (excitation at 488 nm) to monitor Ca\u0026sup2;⁺-Fura2 fluorescence.\u003c/p\u003e\n\u003ch3\u003e13. Tubulogenesis Assay\u003c/h3\u003e\n\u003cp\u003eLSECs (nearly 2\u0026times;10\u003csup\u003e4\u003c/sup\u003e per well) were seeded on growth factor coated Matrigel (\u003csup\u003e#\u003c/sup\u003e354262, Corning) after 30 minutes of preincubation at 37\u0026deg;C in 48-well plates. LSECs were treated with different reagents at indicated concentrations for 3 hours. Tubulogenesis was visualized at random fields under a microscope. Tubulogenesis was assessed by measuring the length of tube using image J software. Representative images were shown.\u003c/p\u003e\n\u003ch3\u003e14. Ros Measurement\u003c/h3\u003e\n\u003cp\u003eMitochondrial superoxide was measured by MitoSox red staining (\u003csup\u003e#\u003c/sup\u003e40778ES50, Yeason Biotech). LSECs treated with indicated reagent were incubated with the working solution (5\u0026micro;M) for 10 minutes at 37\u0026deg;C, and were washed 3\u0026times; with PBS. Fluorescence microscope (excitation at 594 nm) was used to detect mitochondrial superoxide.\u003c/p\u003e\n\u003ch3\u003e15. Mitochondrial Membrane Potential Assay\u003c/h3\u003e\n\u003cp\u003eThe MMP was determined by JC-1 staining kit (\u003csup\u003e#\u003c/sup\u003eC2003S, Beyotime Biotech). For one well of a 6-well plate, removed the culture medium and wash the cells 3\u0026times; with PBS. Added 1 ml of culture medium. Then, added 1 ml of JC-1 working solution and mixed well. Incubated at 37\u0026deg;C for 20 minutes. After incubation, removed the supernatant and washed twice with JC-1 staining buffer. Added 2 ml of culture medium, and observed under a fluorescence microscope (excitation at 488 nm to detect JC-1 monomers/594 nm to detect JC-1 aggregates). Upon mitochondrial depolarization (loss of membrane potential), the decreased negativity causes JC-1 to exist as monomers in the cytoplasm, resulting in enhanced green fluorescence.\u003c/p\u003e\n\u003ch3\u003e16. Immunofluorescence Staining\u003c/h3\u003e\n\u003cp\u003eImmunofluorescence staining was performed as we previously described\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. For liver tissues, staining with CD31 was used to identify LSECs. DAPI was applied to stain the nucleus of cells in both liver tissues and cultured LSECs and HSCs. All assessments were performed in a blinded fashion, and representative images are displayed.\u003c/p\u003e\n\u003ch3\u003e17. Histological Analysis\u003c/h3\u003e\n\u003cp\u003eLiver tissues were fixed in 10% neutral buffered formalin and embedded in paraffin for histological analysis. Pathological evaluation was performed using H\u0026amp;E staining, while collagen deposition was assessed through Masson's trichrome and Sirius Red staining. For IHC analysis, tissue sections underwent antigen retrieval in citrate buffer (100\u0026deg;C, 5 minutes), endogenous peroxidase blocking with 3% H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e (10 minutes, RT), and non-specific binding blocking with 5% BSA. Primary antibody incubation was conducted overnight at 4\u0026deg;C with agitation, followed by 2-hour secondary antibody incubation at RT. Finally, sections were developed using HRP-DAB staining and counterstained with hematoxylin. All images were captured by microscope.\u003c/p\u003e\n\u003ch3\u003e18. Statistical Analysis\u003c/h3\u003e\n\u003cp\u003eData are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD). Statistical comparisons between groups were performed using Student's t-test (for normally distributed data) or Mann-Whitney U test (for non-parametric data). One-way ANOVA followed by Tukey's post hoc test was used for multiple group comparisons. All statistical analyses were performed using GraphPad Prism (version 9.0.0), with a two-tailed p-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 considered statistically significant.\u003c/p\u003e"},{"header":"Results","content":"\n\u003ch3\u003e1. Calcium (Ca²⁺) overload and ECM stiffness cooperatively contribute to hepatic fibrosis progression\u003c/h3\u003e\n\u003cp\u003eOur analysis incorporated baseline clinical data from 40 participants (19 controls, 21 cirrhotic patients) obtained from GEO database (GSE14323) to clarify Piezo1/2 expression and its association with hepatic fibrosis. Given that elevated expression of ACTA2 (α-SMA), Col3A1, Col1A1, Elastin (ELN), LOX, and LOXL2 serves as a molecular signature of ECM stiffening\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e, the gene data suggested that hepatic fibrosis involves extracellular matrix stiffening, wherein Piezo1 may mediate mechanotransduction signaling positively (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). α-SMA, Col3A1, Col1A1, and elastin serve as the foundational structural components of the extracellular matrix (ECM). The LOX family proteins, as the primary collagen cross-linking enzymes, catalyze the formation of covalent bonds between elastin or collagen fibers within the ECM, thereby enhancing ECM stiffness\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. Subsequently, we established our model of chemically induced liver fibrosis in mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Serum calcium ion (Ca\u0026sup2;⁺) levels were significantly elevated in CCl₄-induced model mice compared to controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Concomitantly, both mRNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD) and protein expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE) of the mechanosensitive calcium channel Piezo1 were significantly upregulated in liver tissues. Gross morphological examination revealed progressive fibrotic remodeling, characterized by a distinct transition from the normal reddish-brown, pliable parenchyma to a fibrotic phenotype exhibiting yellowish discoloration and marked tissue rigidity. The mRNA levels of multiple collagen isoforms, elastic fibers, and collagen cross-linking enzymes were significantly upregulated in fibrotic liver tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF). These data, together, showed that biomechanical ECM stiffening synergizes with Ca\u0026sup2;⁺ dyshomeostasis to drive hepatic fibrogenesis.\u003c/p\u003e\n\u003ch3\u003e2. Matrix stiffness mediates piezo1 upregulation and induces LSEC capillarization.\u003c/h3\u003e\n\u003cp\u003eWe next investigated the functional consequences of ECM stiffening on LSEC phenotype and function. Using stiffness-tunable hydrogels to mimic pathological liver tissue environments, we observed that increasing substrate rigidity induced a morphological shift in LSECs from elongated to rounded phenotypes (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). LSECs cultured on intermediate-stiffness substrates (2\u0026ndash;8 kPa) exhibited marginally higher viability compared to other rigidity conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eB), suggesting stiffness-dependent phenotypic adaptation during ECM remodeling in liver disease. The transcripts of LYVE1 and EDN1, the key endothelial markers indicating capillarization, were all significantly changed in LSEC seeded on gradient gels (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). Meanwhile, Piezo1 transcriptional activity also exhibited a stiffness-dependent elevation in LSEC, which was confirmed by western blot analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). Pharmacological promotion of Piezo1 by yoda1 and jedi1 enhanced LSEC viability at specific concentration (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). Furthermore, scanning electron microscopy (SEM) revealed that Piezo1 agonist treatment significantly reduced the characteristic fenestrated pore structures of LSECs. Altogether, these data revealed that elevated matrix stiffness upregulated Piezo1 via mechanotransduction signaling, driving LSEC capillarization.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003e3. Ca²⁺ overload mediates cytokine secretion in LSEC\u003c/h3\u003e\n\u003cp\u003eWe next explored the role of Piezo1 signaling in LSEC capillarization. Reanalysis of clinical datasets revealed significant dysregulation of secretory proteins (SPP1, ANGPTL1/2) and MCU in fibrotic livers (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eA), implicating coordinated paracrine and mitochondrial homeostasis in disease progression. To mimic calcium overload in vitro, LSECs were treated with either calcium-supplemented medium (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eB) or calcium ionophore (Calcimycin) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). CCK-8 assays identified calcimycin (optimal concentration at 250nM) for inducing physiological-relevant Ca\u0026sup2;⁺ overload. Notably, only LSECs in the liver are most sensitive to calcium fluctuations, showing the most significant changes in Piezo1 protein levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). Using a human XL cytokine array kit comprising 105 cytokines, we successfully found out 8 differentially expressed secretary proteins between Calcimycin-CM and Scramble-CM (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eE), including 6 upregulated factors (Osteopontin, Angiogenin, FGF-2, IL-1a, IL-1β, and IL-8) and 2 downregulated factors (Endoglin and Dkk-1). Angiogenin (ANG), fibroblast growth factor 2 (FGF-2), and OPN are pivotal regulators of LSEC angiogenesis\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e and HSC activation/proliferation\u003csup\u003e21, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e, serving as core investigative targets in our research. Calcimycin dose-dependently promotes the protein expression of Piezo1, ANG, FGF-2, and OPN (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eF), which was confirmed by PCR analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eG). Interestingly, the Piezo1 RNA level was inversely correlated with its protein expression. We speculated that in our in vitro experiments, short-term exposure of LSECs to high-concentration calcium ion solution not only activated calcium signaling pathways but also triggered negative feedback regulation. This mechanism likely helped maintain intracellular calcium homeostasis and prevented acute cellular damage. As a large transmembrane channel protein, Piezo1 is primarily localized on the plasma membrane and serves as the first gateway for cellular regulation of calcium homeostasis (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e3\u003c/span\u003eH). Taken together, these data suggested that calcium overload triggers cytokine release in LSEC.\u003c/p\u003e\n\u003ch3\u003e4. HIF-1α-mediated cytokine production in LSECs is mechanistically linked to Ca²⁺ overload\u003c/h3\u003e\n\u003cp\u003eWe next examined the mechanism underlying regulation of cytokine production in LSEC. Given that hypoxia occurs in fibrotic liver\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e and HIF-1α has been confirmed to regulate downstream FGF-2\u003csup\u003e24\u003c/sup\u003e, ANG\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e, and OPN\u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e, we speculated that HIF-1α is involved in calcium overload-induced cytokine secretion in LSECs. Intriguingly, calcium overload did not alter HIF-1α protein expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA) but markedly elevated its mRNA transcription levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Considering that HIF-1α is subject to ubiquitin/acetylation-mediated proteasomal degradation under normaxia, we used protease inhibitors (MG132) to halt this dynamic process. We observed an accumulation of HIF-1α protein that positively correlated with calcimycin concentration (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Subsequent WB assay showed that the protein levels of HIF-1α and the critical ubiquitination substrate p62 are upregulated by calcimycin, but ubiquitin molecules and proteases mediate their degradation, restoring them to comparable levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). A hypoxia-agonist CoCl\u003csub\u003e2\u003c/sub\u003e was employed to confirm the role of HIF-1α in LSEC secreting cytokine, and its optimal working concentration was determined to be 200\u0026micro;M (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). As expected, hypoxic conditions can induce the overexpression of HIF-1α and downstream cytokines (ANG, FGF-2, and OPN) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). Meanwhile, ACF (100nM) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF), a HIF-1α antagonist, effectively blocked calcimycin-induced upregulation of LSEC-associated cytokines (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG). Taken together, these data suggested that HIF-1α was activated by Ca\u003csup\u003e2+\u003c/sup\u003e overload and was critically involved in cytokines secretion of LSECs.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003e5. MCU-mediated mitochondrial ROS burst drives HIF-1α accumulation in Ca²⁺ overload LSEC\u003c/h3\u003e\n\u003cp\u003eConsidering the significant alterations of MCU in fibrotic liver (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA), it is essential to investigate the impact of mitochondrial calcium homeostasis on HIF-1α. We systematically examined the effects of calcium overload on both MCU protein expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA and C) and mRNA transcriptional levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Similar to Piezo1, calcium overload-induced MCU overexpression appears to trigger a negative feedback mechanism as well. The majority of fluorescence-labeled Ca\u0026sup2;⁺ was observed in the cytosol with prominent mitochondrial accumulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD), potentially driving the observed mitochondrial reactive oxygen species (mROS) burst (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE) and loss of mitochondrial membrane potential (MMP) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF). Furthermore, we successfully mitigated calcimycin-induced expression of HIF-1α and downstream cytokines (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eH) using the mitochondrial ROS scavenger Mito-Tempo at indicated concentration (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG). These data, together, indicated that MCU mediated mROS homeostasis was required for HIF-1α accumulation and the cytokines secretion of LSECs.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003e6. Piezo1 signaling ablation ameliorates LSEC capillarization and adjacent HSC activation\u003c/h3\u003e\n\u003cp\u003eTo further investigate the role of Piezo1 in Calcimycin-induced LSEC, we constructed a CRISPR knock out immortalized human LSEC (SK-Hep-1) with lentivirus packaging sgRNA. PCR validation showed efficient Piezo1 knockout, and further revealed that Piezo1 deletion disrupted calcimycin's modulation of the LSEC Ca\u0026sup2;⁺-mROS-HIF-1 axis (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). The results of relative proteins were confirmed via Human XL Cytokine Array Kit (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB), Western blot assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC), and Immunofluorescence staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD). Furthermore, tubulogenesis assays showed that Piezo1 knockout abolished calcimycin-induced angiogenesis, the critical event in capillarization, in LSECs (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE). ANG, as a regulatory factor of angiogenesis, may act through autocrine mechanisms to induce angiogenesis in LSECs. We subsequently examined the relationship between LSEC and HSC under calcium overload. LSECs and HSCs were co-cultured, with LSECs exerting paracrine-mediated effects on HSCs following specific treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF). Relative fibrotic markers including fibronectin, collagen-Ⅲ, and α-SMA were assessed in HSCs via Western blot assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG), and Immunofluorescence staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eH). During the early phase of fibrosis, collagen type III is abundantly synthesized and co-assembles with collagen type I to form a cross-linked fibrillar network, and fibronectin concurrently serves as a provisional scaffold facilitating the deposition and organization of additional collagenous proteins\u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. Together, these ECM components drive progressive matrix stiffening. The above findings have established Piezo1 as the key regulator of the calcium signaling pathway in LSECs. Inhibition of Piezo1 effectively mitigates LSEC capillarization and HSC activation induced by calcium overload, thereby alleviating ECM stiffening.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003e7. Piezo1 knockout alleviates liver fibrosis in mice by attenuating LSEC capillarization and HSC activation\u003c/h3\u003e\n\u003cp\u003eWe finally attempted to confirm these actions of Piezo1 in vivo, using gene knockout mice with CCl\u003csub\u003e4\u003c/sub\u003e-induced liver fibrosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA), and PCR verification of Piezo1 knockout efficiency (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eG). In these mice, Piezo1 ablation reduced the necrotic area and tube formation in mouse fibrotic liver as shown by H\u0026amp;E staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB). Meanwhile, Masson staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC) and Sirius Red staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD) showed that inhibition of Piezo1 could alleviate the collagen deposition, and this outcome was directly visualized by collagen I immunostaining (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eE). Besides, the serum levels of ALT, AST were reduced in Piezo1-ko mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eF), which implicated improved liver injury. The transcripts of α-SMA, TGFβ1, and Collagen Ⅰ, three HSC activation markers, were all significantly downregulated upon Piezo1 gene ablation (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eG). Notably, Piezo1 knockout alleviated hepatic fibrosis in mice by reducing calcium overload in liver tissues. To investigate the potential role of Piezo1 in liver fibrosis, we conducted a proteomics analysis of three groups containing wild type group (WT), CCl\u003csub\u003e4\u003c/sub\u003e model group (M), and Piezo1-ko group (KO). Volcano plots were used to display the significance and expression patterns of these genes, revealing gene expression differences between different samples (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA). Cross-comparison analysis demonstrated statistically significant variations in three key gene clusters: (1) hepatic fibrogenesis-related genes (Col8a1, Tgfb1/2, Spp1, Loxl1/2/4), (2) angiogenesis regulators (Fgfr4, Fgf2, Angpt2, Pdgfa), and (3) calcium signaling components (Mcu, Itpr2). To elucidate the functional implications of these differentially expressed genes and their associated biological pathways, we performed gene set enrichment analysis (GSEA). Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses were performed on the proteomic data of KO vs M groups. Go analysis revealed that the differentially expressed genes were significantly enriched in processes such as angiogenesis, mitochondrial inner membrane, and cytokine receptor binding (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB), which were closely related to the core mechanisms of LSEC calcium pathway. KEGG pathway analysis further indicated that the differentially expressed genes were significantly enriched in the fluid shear stress and atherosclerosis, which correlates with fibrotic portal hypertension resulting from LSEC capillarization (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC). Additionally, Genes exhibiting significant differential expression across distinct signaling pathways were systematically clustered and visualized in the heatmap (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eD). Moreover, SEM analyses of sinusoidal fenestration showed that loss of LSEC fenestrae was reversed in Piezo1-ko mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eE). Inhibition of Piezo1 also effected the expression of Collagen Ⅰ, HIF-1α, and MCU induced by CCl\u003csub\u003e4\u003c/sub\u003e stimulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eF). Similar results were obtained on FGF-2 and OPN via immunofluorescence staining in which CD31 was utilized to target the LSECs (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eG). Collectively, these data demonstrated that Piezo1 blockade attenuates fibrotic injury in murine liver fibrosis by suppressing LSEC capillarization and HSC activation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eLiver fibrosis results from chronic liver injury triggering excessive scar tissue formation. Activated HSCs drive this process by depositing abnormal ECM, disrupting liver structure. Persistent fibrosis leads to cirrhosis, impairing liver function and increasing portal hypertension and HCC risk\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. Therapeutic strategies generally target HSC deactivation\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e, hepatocyte protection\u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e, or immunoregulation\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e to halt progression. As specialized liver endothelial cells, LSECs exhibit unique fenestrated and discontinuous structures that enable specialized functions in liver immunity and vascular homeostasis\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. Our previous studies have demonstrated that inhibiting LSEC capillarization and pathological angiogenesis exerts a beneficial effect on alleviating liver fibrosis\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. Considering that LSECs are simultaneously subjected to portal hypertension and ECM stiffening during chronic liver disease, this study specifically focuses on mechanosensitive receptor-mediated adaptations in LSECs under pathological biomechanical stress, and particularly focus on downstream signaling transduction.\u003c/p\u003e \u003cp\u003eAnalysis of clinical data initially revealed upregulated ECM stiffening genes in liver fibrosis, with Piezo1 as a key mechanosensor. Furthermore, we established a CCl₄-induced classical liver fibrosis model, which consistently demonstrated elevated expression of both Piezo1 and ECM stiffening-associated proteins during fibrotic progression. Although we were unable to directly measure sinusoidal blood pressure, we identified significantly elevated Ca\u0026sup2;⁺ concentrations, a key biomechanical trigger for Piezo1 activation, in fibrotic liver circulation. Hypercalcemia is occasionally observed in patients with liver cirrhosis. Notably, the duration of hypercalcemia is positively associated with 90-day mortality, suggesting it may serve as a potential interventional target to reduce mortality in this high-risk population\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. Meanwhile, LSECs were cultured on elastic dishes coated with substrates to simulate fibrotic liver environments at different stages in vitro. The results confirmed that increased ECM stiffness upregulated Piezo1 expression in LSECs and promoted their capillarization. These findings were consistently replicated in vascular endothelial cells of HCC models\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. Thus, it is conceivable that Piezo1activation could regulate LSECs dysfunction and promoted liver fibrotic progression.\u003c/p\u003e \u003cp\u003eFurthermore, calcimycin, a calcium ionophore, was used to stimulate piezo1 receptor, and OPN, FGF-2, and ANG were identified as key downstream cytokines of Piezo1, which regulate LSEC capillarization and HSC activation, thereby exacerbating liver fibrosis. Among these, ANG is the first human tumor-derived protein that was found to stimulate the growth of blood vessels\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. It could play a crucial role in pathological angiogenesis of LSEC\u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. Indeed, ANG acts as a permissive factor, enabling and enhancing angiogenesis induced by other pro-angiogenic factors such as vascular endothelial growth factor (VEGF), basic/acidic fibroblast growth factors (bFGF/aFGF), and epidermal growth factor (EGF)\u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. Since no expression changes in VEGF or other cytokines were detected in the cell lysates, we speculate that these factors are secreted immediately after protein production, resulting in their low and stable intracellular levels. Besides, OPN and FGF-2 were recognized as critical cytokines promoting HSC activation. OPN is an important component of ECM, which promotes liver fibrosis and has been described as a biomarker for its severity. Hepatocyte E4BP4 can induce OPN via YAP to activate HSCs and promote liver fibrosis during diet-induced MASH\u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. Intriguingly, recent study reported that macrophage-derived OPN protected from NASH, by upregulating OSM, which increased ARG2 through STAT3 signaling\u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. We propose that macrophage-mediated immune responses are inherently a double-edged sword. Whether OPN exerts anti-inflammatory or pro-inflammatory effects remains to be further elucidated. Here, we primarily focus on the role of OPN in promoting HSC activation and its subsequent exacerbation of ECM deposition, thereby driving hepatic fibrosis. FGF2 has been considered to be pro-fibrotic because of its potential chemotactic and mitogenic activities in HSCs\u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e. Similarly, several recent studies have reached opposing conclusions, suggesting that FGF-2 may act as a potential anti-fibrotic target in the liver\u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e. However, this is explainable, as FGF-2 exists in high- (HMW) and low-molecular-weight (LMW) forms with distinct functions\u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. These isoforms may also explain our experimental variability about FGF-2. Therefore, additional experiments are required to investigate the specific targets of Piezo1 downstream cytokines (OPN, FGF-2, ANG) on HSCs and LSECs.\u003c/p\u003e \u003cp\u003eNext, we investigated the mechanisms underlying piezo1 regulation of relative cytokines and identified a key role for HIF-1α in this context. Antagonist and inhibitor of HIF-1α were both employed to validate its regulatory effects on cytokines. During chronic liver disease progression,\u003c/p\u003e \u003cp\u003eLSEC fenestration loss parallels fibrotic matrix deposition, which increases resistance to blood flow and reduces oxygen delivery\u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. Our preliminary studies have demonstrated that HIF-1α serves as a master regulator of pathological angiogenesis in LSECs via inducing many hypoxia-sensitive pro-angiogenic genes\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u003c/sup\u003e. Emerging evidence has established HIF-1α's regulatory role over OPN\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e, FGF-2\u003csup\u003e24\u003c/sup\u003e, and ANG\u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e across multiple cell types such as HUVEC, lung fibroblasts. Our current work now confirms this regulatory axis in LSECs. Therefore, HIF-1α could be a key molecule linking metabolic turnover to the dysfunctions of LSECs.\u003c/p\u003e \u003cp\u003eWe further explored the relationship between HIF-1α and piezo1 mediated calcium overload. Calcium plays a fundamental role in modulating a wide array of cellular and molecular functions, such as secretion, autophagy, motility, proliferation, and programmed cell death\u003csup\u003e\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u003c/sup\u003e. The endoplasmic reticulum (ER) and sarcoplasmic reticulum (SR) serve as major intracellular calcium reservoirs. Within the ER lumen, Ca\u0026sup2;⁺ is essential for correct protein folding, while the release of Ca\u0026sup2;⁺ generates cytosolic Ca\u0026sup2;⁺ signals\u003csup\u003e\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e\u003c/sup\u003e. Mitochondria play a key role in calcium signaling by modulating cytosolic Ca\u0026sup2;⁺ flux through their Ca\u0026sup2;⁺ uptake and release mechanisms. Mitochondrial Ca\u003csup\u003e2+\u003c/sup\u003e influx is mediated by the pore-forming mitochondrial calcium uniporter protein (MCU) subunits\u003csup\u003e\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e. In our experiments, significant modulation of MCU expression was detected in fibrotic livers, and accumulated Ca\u003csup\u003e2+\u003c/sup\u003e in the mitochondria stimulated oxidative metabolism and upon return to the cytoplasm. These mitochondrial ROS are mandatory to stabilize HIF-1α under normoxia\u003csup\u003e\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u003c/sup\u003e, and then triggered HIF-1α-mediated release of downstream cytokines. It is worth noting that mitochondria do not store Ca\u003csup\u003e2+\u003c/sup\u003e in a prolonged manner under physiological conditions, so that subsets of mitochondria are positioned close to the ER, SR and plasma membrane\u003csup\u003e\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e\u003c/sup\u003e. These findings suggested that Piezo1-mediated intracellular calcium overload is unlikely to be the primary direct trigger of mitochondrial oxidative stress. Intense research effort should be focused on the involvement of mitochondria in local Ca\u003csup\u003e2+\u003c/sup\u003e communication with other organelles.\u003c/p\u003e \u003cp\u003eFinally, we assessed the therapeutic implications of our mechanistic experiments. The Piezo1-knockdown stable cell line and knockout mice were utilized in the relevant validation experiments. As expected, inhibition of Piezo1 effectively alleviated calcium overload-induced expression of LSEC-associated cytokines (OPN, FGF-2, ANG) and pathological angiogenesis, while also reducing the activation of co-cultured HSCs and their secretion of ECM fibrotic proteins (Fibronectin, Collagen III, α-SMA). More importantly, our in vitro findings were recapitulated in fibrotic mouse livers. Compared to control (empty vector) mice, Piezo1-knockout mice exhibited enhanced adaptability and resistance to CCl\u003csub\u003e4\u003c/sub\u003e-induced liver injury. The knockout of Piezo1 effectively suppressed multiple HSC activation markers, hepatic microvascular density, and perisinusoidal collagen deposition area. Furthermore, transcript sequencing results further demonstrated that Piezo1 knockout modulated genes associated with liver angiogenesis, oxidative stress, and fluid shear stress. Direct observation of LSEC fenestration structures confirmed that Piezo1 knockout ameliorated LSEC capillarization. Additionally, CD31-labeled LSECs were subjected to co-immunofluorescence staining with relevant proteins to visualize spatial changes in LSEC-associated protein expression. However, our current data cannot conclusively establish the role of Piezo1 in LSECs during liver fibrosis, as we did not perform cell-specific knockout mice. Notably, recent studies investigating the role of Piezo1 in liver macrophages have reported seemingly contradictory conclusions. While pharmacological activation of Piezo1 promotes macrophage efferocytosis and facilitates fibrosis regression\u003csup\u003e\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u003c/sup\u003e, Piezo1 deficiency in macrophages restricts liver fibrosis progression by suppressing inflammatory responses and reducing cathepsin S secretion\u003csup\u003e\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e\u003c/sup\u003e. The biological role of Piezo1 could be dependent on cell types and pathological conditions.\u003c/p\u003e \u003cp\u003eIn summary, we demonstrated that Piezo1, mechanactivated by elevated shear stress and ECM stiffening, regulated LSEC-mediated liver angiogenesis and HSC activation through modulating Ca\u003csup\u003e2+\u003c/sup\u003e-mROS-HIF-1α signaling pathway and downstream bioactive cytokines (as illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e). Selective inhibition of Piezo1 in LSECs may represent a therapeutic option for hepatic fibrosis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Abbreviations","content":" \u003cp\u003eECM, extracellular matrix; HCC, hepatocellular carcinoma; LSEC, liver sinusoidal endothelial cell; HSC, hepatic stellate cell; VECs, vascular endothelial cells; EMT, endothelial-mesenchymal transition; DMEM, Dulbecco\u0026rsquo;s Modified Eagle Medium; FBS, fetal bovine serum; ACF, acriflavine; RT, room temperature; H\u0026amp;E, Haematoxylin-Eosin; IHC, immunohistochemical; ANG, Angiogenin; FGF-2, Fibroblast growth factor 2; OPN, Osteopontin (SPP1); MCU, Mitochondrial Calcium Uniporter; EDN1, Enthedolial-1; CM, conditioned medium; SEM, scanning electron microscope; mROS, mitochondrial reactive oxygen species; MMP, mitochondrial membrane potential; GSEA, gene set enrichment analysis; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; ALT, alanine aminotransferase; AST, aspartate aminotransferase; HIF-1α, hypoxia-inducible factor 1-alpha; Metabolic Dysfunction-Associated Steatohepatitis, MASH; ER, endoplasmic reticulum; SR, sarcoplasmic reticulum.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe work was supported by the National Natural Science Foundation of China (82204929, 82505375), the Suzhou Science and Technology Plan Project (SYW2025157, SYWD2024262, SKYD2023055, SKYD2023228), the Scientific Research Project of Jiangsu Provincial Association of Chinese Medicine (CYTF2024053), the Nanjing University of Chinese Medicine Research Funding (XZR2024371, XZR2024388).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe construction of the main framework: YX, JZT, and HY. Cell culture researcher: JYF, ZYJ, and YT. Animal experiment operator: CXY. Literatures reading and analysis: GLY, YX, and ZYC. Write manuscript: GLY, YX and ZYC. Critical revision of the manuscript: LYJ, HY, and JZT. Data organization and chart plotting: ZLW, YX. Drawing schematic diagram: YX. Collection of references: MY. All authors approved the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflicts of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData will be made available on request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eKisseleva T. \u0026amp; Brenner D. Molecular and cellular mechanisms of liver fibrosis and its regression. \u003cem\u003eNat Rev Gastroenterol Hepatol\u003c/em\u003e, 18, 151\u0026ndash;166 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFriedman S. L. \u0026amp; Pinzani M. Hepatic fibrosis 2022: Unmet needs and a blueprint for the future. \u003cem\u003eHepatology\u003c/em\u003e, 75, 473\u0026ndash;488 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJain I., Brougham-Cook A. \u0026amp; Underhill G. H. Effect of distinct ECM microenvironments on the genome-wide chromatin accessibility and gene expression responses of hepatic stellate cells. \u003cem\u003eActa Biomater\u003c/em\u003e, 167, 278\u0026ndash;292 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFan W., et al. Matrix viscoelasticity promotes liver cancer progression in the pre-cirrhotic liver. \u003cem\u003eNature\u003c/em\u003e, 626, 635\u0026ndash;642 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Z., et al. Matrix stiffness modulates hepatic stellate cell activation into tumor-promoting myofibroblasts via E2F3-dependent signaling and regulates malignant progression. \u003cem\u003eCell Death Dis\u003c/em\u003e, 12, 1134 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrougham-Cook A., et al. High throughput interrogation of human liver stellate cells reveals microenvironmental regulation of phenotype. \u003cem\u003eActa Biomater\u003c/em\u003e, 138, 240\u0026ndash;253 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePan Q., et al. Hepatocyte FoxO1 Deficiency Protects From Liver Fibrosis via Reducing Inflammation and TGF-beta1-mediated HSC Activation. \u003cem\u003eCell Mol Gastroenterol Hepatol\u003c/em\u003e, 17, 41\u0026ndash;58 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y., et al. Hepatocyte Ninjurin2 promotes hepatic stellate cell activation and liver fibrosis through the IGF1R/EGR1/PDGF-BB signaling pathway. \u003cem\u003eMetabolism\u003c/em\u003e, 140, 155380 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQu J., Wang L., Li Y. \u0026amp; Li X. Liver sinusoidal endothelial cell: An important yet often overlooked player in the liver fibrosis. \u003cem\u003eClin Mol Hepatol\u003c/em\u003e, 30, 303\u0026ndash;325 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcConnell M. J., Kostallari E., Ibrahim S. H. \u0026amp; Iwakiri Y. The evolving role of liver sinusoidal endothelial cells in liver health and disease. \u003cem\u003eHepatology\u003c/em\u003e, 78, 649\u0026ndash;669 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOjha U., et al. Endothelial RUNX3 controls LSEC dysfunction and angiocrine LRG1 signaling to prevent liver fibrosis. \u003cem\u003eHepatology\u003c/em\u003e, 81, 1228\u0026ndash;1243 (2025).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y., et al. USP9X-enriched MSC-sEV inhibits LSEC angiogenesis in MASH mice by downregulating the IkappaBalpha/NF-kappaB/Ang-2 pathway. \u003cem\u003ePharmacol Res\u003c/em\u003e, 209, 107471 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiao B. Mechanisms of mechanotransduction and physiological roles of PIEZO channels. \u003cem\u003eNat Rev Mol Cell Biol\u003c/em\u003e, 25, 886\u0026ndash;903 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMurthy S. E., Dubin A. E. \u0026amp; Patapoutian A. Piezos thrive under pressure: mechanically activated ion channels in health and disease. \u003cem\u003eNat Rev Mol Cell Biol\u003c/em\u003e, 18, 771\u0026ndash;783 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHilscher M. B., et al. Mechanical Stretch Increases Expression of CXCL1 in Liver Sinusoidal Endothelial Cells to Recruit Neutrophils, Generate Sinusoidal Microthombi, and Promote Portal Hypertension. \u003cem\u003eGastroenterology\u003c/em\u003e, 157, 193\u0026ndash;209 e9 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi M., et al. Activation of Piezo1 contributes to matrix stiffness-induced angiogenesis in hepatocellular carcinoma. \u003cem\u003eCancer Commun (Lond)\u003c/em\u003e, 42, 1162\u0026ndash;1184 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu Y., et al. EGFR-mediated crosstalk between vascular endothelial cells and hepatocytes promotes Piezo1-dependent liver regeneration. \u003cem\u003eGenes Dis\u003c/em\u003e, 12, 101321 (2025).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarrett T., et al. NCBI GEO: archive for high-throughput functional genomic data. \u003cem\u003eNucleic Acids Res\u003c/em\u003e, 37, D885-90 (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao L., et al. OTULIN orchestrates NCOA4-FTH1 complex to alleviate APAP-induced hepatocyte Ferroptosis. \u003cem\u003eInt Immunopharmacol\u003c/em\u003e, 154, 114490 (2025).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang D., et al. LOX-mediated ECM mechanical stress induces Piezo1 activation in hypoxic-ischemic brain damage and identification of novel inhibitor of LOX. \u003cem\u003eRedox Biol\u003c/em\u003e, 76, 103346 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePan R. L., et al. Low-molecular-weight fibroblast growth factor 2 attenuates hepatic fibrosis by epigenetic down-regulation of Delta-like1. \u003cem\u003eHepatology\u003c/em\u003e, 61, 1708\u0026ndash;20 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong Z., et al. Osteopontin Takes Center Stage in Chronic Liver Disease. \u003cem\u003eHepatology\u003c/em\u003e, 73, 1594\u0026ndash;1608 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCai J., Hu M., Chen Z. \u0026amp; Ling Z. The roles and mechanisms of hypoxia in liver fibrosis. \u003cem\u003eJ Transl Med\u003c/em\u003e, 19, 186 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLv X. M., et al. Neotuberostemonine inhibits the differentiation of lung fibroblasts into myofibroblasts in mice by regulating HIF-1alpha signaling. \u003cem\u003eActa Pharmacol Sin\u003c/em\u003e, 39, 1501\u0026ndash;1512 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTao E. W., et al. A specific tRNA half, 5'tiRNA-His-GTG, responds to hypoxia via the HIF1alpha/ANG axis and promotes colorectal cancer progression by regulating LATS2. \u003cem\u003eJ Exp Clin Cancer Res\u003c/em\u003e, 40, 67 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTang Z., et al. Safflower yellow promotes angiogenesis through p-VHL/ HIF-1alpha/VEGF signaling pathway in the process of osteogenic differentiation. \u003cem\u003eBiomed Pharmacother\u003c/em\u003e, 107, 1736\u0026ndash;1743 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuo H., et al. PLIN2 Promotes Lipid Accumulation in Ascites-Associated Macrophages and Ovarian Cancer Progression by HIF1alpha/SPP1 Signaling. \u003cem\u003eAdv Sci (Weinh)\u003c/em\u003e, 12, e2411314 (2025).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y., et al. Mechanical forces in the tumor microenvironment: roles, pathways, and therapeutic approaches. \u003cem\u003eJ Transl Med\u003c/em\u003e, 23, 313 (2025).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharma S., Le Guillou D. \u0026amp; Chen J. Y. Cellular stress in the pathogenesis of nonalcoholic steatohepatitis and liver fibrosis. \u003cem\u003eNat Rev Gastroenterol Hepatol\u003c/em\u003e, 20, 662\u0026ndash;678 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIsaac R., et al. TM7SF3 controls TEAD1 splicing to prevent MASH-induced liver fibrosis. \u003cem\u003eCell Metab\u003c/em\u003e, 36, 1030\u0026ndash;1043 e7 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFu Y., et al. Salvianolic acid B attenuates liver fibrosis by targeting Ecm1 and inhibiting hepatocyte ferroptosis. \u003cem\u003eRedox Biol\u003c/em\u003e, 69, 103029 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi H., et al. CD47-SIRPalpha axis blockade in NASH promotes necroptotic hepatocyte clearance by liver macrophages and decreases hepatic fibrosis. \u003cem\u003eSci Transl Med\u003c/em\u003e, 14, eabp8309 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang X., et al. Curcumol attenuates liver sinusoidal endothelial cell angiogenesis via regulating Glis-PROX1-HIF-1alpha in liver fibrosis. \u003cem\u003eCell Prolif\u003c/em\u003e, 53, e12762 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao L., et al. Curcumol inhibits KLF5-dependent angiogenesis by blocking the ROS/ERK signaling in liver sinusoidal endothelial cells. \u003cem\u003eLife Sci\u003c/em\u003e, 264, 118696 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMajety P., Groysman A., Erlikh N., Chen Z. Z. \u0026amp; Westcott G. P. Predictors of Mortality in Hypercalcemia of Advanced Chronic Liver Disease. \u003cem\u003eEndocr Pract\u003c/em\u003e, 28, 1062\u0026ndash;1068 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLoveland A. B., Koh C. S., Ganesan R., Jacobson A. \u0026amp; Korostelev A. A. Structural mechanism of angiogenin activation by the ribosome. \u003cem\u003eNature\u003c/em\u003e, 630, 769\u0026ndash;776 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSheng J. \u0026amp; Xu Z. Three decades of research on angiogenin: a review and perspective. \u003cem\u003eActa Biochim Biophys Sin (Shanghai)\u003c/em\u003e, 48, 399\u0026ndash;410 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang S., et al. OPN-Mediated Crosstalk Between Hepatocyte E4BP4 and Hepatic Stellate Cells Promotes MASH-Associated Liver Fibrosis. \u003cem\u003eAdv Sci (Weinh)\u003c/em\u003e, 11, e2405678 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan H., et al. Macrophage-derived Osteopontin (SPP1) Protects From Nonalcoholic Steatohepatitis. \u003cem\u003eGastroenterology\u003c/em\u003e, 165, 201\u0026ndash;217 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu C., et al. Role of fibroblast growth factor type 1 and 2 in carbon tetrachloride-induced hepatic injury and fibrogenesis. \u003cem\u003eAm J Pathol\u003c/em\u003e, 163, 1653\u0026ndash;62 (2003).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSato-Matsubara M., et al. Fibroblast growth factor 2 (FGF2) regulates cytoglobin expression and activation of human hepatic stellate cells via JNK signaling. \u003cem\u003eJ Biol Chem\u003c/em\u003e, 292, 18961\u0026ndash;18972 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKurniawan D. W., et al. Fibroblast growth factor 2 conjugated superparamagnetic iron oxide nanoparticles (FGF2-SPIONs) ameliorate hepatic stellate cells activation in vitro and acute liver injury in vivo. \u003cem\u003eJ Control Release\u003c/em\u003e, 328, 640\u0026ndash;652 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao L., et al. Autophagy-induced p62 accumulation is required for curcumol to regulate KLF5-mediated angiogenesis in liver sinusoidal endothelial cells. \u003cem\u003eToxicology\u003c/em\u003e, 452, 152707 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBerridge M. J., Lipp P. \u0026amp; Bootman M. D. The versatility and universality of calcium signalling. \u003cem\u003eNat Rev Mol Cell Biol\u003c/em\u003e, 1, 11\u0026ndash;21 (2000).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu L., Lian W. \u0026amp; Zhao L. Calcium signaling in cancer progression and therapy. \u003cem\u003eFEBS J\u003c/em\u003e, 288, 6187\u0026ndash;6205 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe Stefani D., Raffaello A., Teardo E., Szabo I. \u0026amp; Rizzuto R. A forty-kilodalton protein of the inner membrane is the mitochondrial calcium uniporter. \u003cem\u003eNature\u003c/em\u003e, 476, 336\u0026ndash;40 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWillson J. A., et al. Neutrophil HIF-1alpha stabilization is augmented by mitochondrial ROS produced via the glycerol 3-phosphate shuttle. \u003cem\u003eBlood\u003c/em\u003e, 139, 281\u0026ndash;286 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCartes-Saavedra B., Ghosh A. \u0026amp; Hajnoczky G. The roles of mitochondria in global and local intracellular calcium signalling. \u003cem\u003eNat Rev Mol Cell Biol\u003c/em\u003e, 26, 456\u0026ndash;475 (2025).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y., et al. Stiffness sensing via Piezo1 enhances macrophage efferocytosis and promotes the resolution of liver fibrosis. \u003cem\u003eSci Adv\u003c/em\u003e, 10, eadj3289 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuo S., et al. Piezo1 specific deletion in macrophage protects the progression of liver fibrosis in mice. \u003cem\u003eTheranostics\u003c/em\u003e, 13, 5418\u0026ndash;5434 (2023).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Piezo1, liver sinusoidal endothelial cell, Mitochondrial Calcium Uniporter, HIF-1α, capillarization, liver fibrosis","lastPublishedDoi":"10.21203/rs.3.rs-8630916/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8630916/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLiver fibrosis arises from chronic injury-induced ECM stiffness, activating HSCs and disrupting sinusoidal homeostasis. LSECs undergo capillarization under mechanical stress, exacerbated by hemodynamic changes and ECM stiffness. The mechanosensor Piezo1 mediates this process via Ca²⁺ signaling, linking ECM stiffness to fibrotic progression, highlighting its therapeutic potential.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eExperimental Approaches\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePiezo1-knockout C57BL/6 mice were treated with CCl\u003csub\u003e4\u003c/sub\u003e to induce hepatic injury, followed by histopathological and biochemical analyses. Meticulous and comprehensive studies were performed in vitro using molecular approaches and stable cell lines.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe demonstrated that increased matrix stiffness upregulates Piezo1 in LSECs, promoting capillarization. Piezo1 activation triggers Ca²⁺ overload, which stimulates MCU-dependent ROS production, leading to HIF-1α stabilization and subsequent pro-fibrotic cytokine release. Genetic inhibition of Piezo1 attenuates LSEC capillarization, reduces HSC activation, and ameliorates liver fibrosis in mice, highlighting Piezo1 as a potential therapeutic target.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOur findings reveal that mechano-activated channel Piezo1, triggered by elevated shear stress and ECM stiffening, regulates LSEC-dependent capillarization and HSC activation through the Ca²⁺-mROS-HIF-1α pathway and downstream pro-fibrotic mediators. Pharmacological inhibition of Piezo1 in LSECs may hold promise as an anti-fibrotic treatment.\u003c/p\u003e","manuscriptTitle":"Piezo1 signaling facilitates capillarization of LSECs and contributes to liver fibrosis progression","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-13 09:39:14","doi":"10.21203/rs.3.rs-8630916/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"7d02e9a5-181e-46ff-8492-5ff70c729cbc","owner":[],"postedDate":"February 13th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":62622601,"name":"Biological sciences/Cell biology/Cell signalling/Calcium signalling"},{"id":62622602,"name":"Health sciences/Diseases/Gastrointestinal diseases/Liver diseases/Liver fibrosis"}],"tags":[],"updatedAt":"2026-04-15T10:03:38+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-13 09:39:14","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8630916","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8630916","identity":"rs-8630916","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.