Identification of co-segregating RUBCN and KANK1 mutations in a UK ALS kindred

preprint OA: closed
📄 Open PDF Full text JSON View at publisher
Full text 75,012 characters · extracted from preprint-html · click to expand
Identification of co-segregating RUBCN and KANK1 mutations in a UK ALS kindred | medRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-P4HH5NV'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search Identification of co-segregating RUBCN and KANK1 mutations in a UK ALS kindred Midhat Salman , Intan Bakhtiar , Alex Morris , Alexandra Rother , Simon Topp , Christopher Shaw , Bradley Smith , Jacqueline de Belleroche doi: https://doi.org/10.1101/2025.07.23.25331426 Midhat Salman 1 Department of Brain Sciences, Imperial College London , UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: m.salman14{at}alumni.imperial.ac.uk Intan Bakhtiar 1 Department of Brain Sciences, Imperial College London , UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Alex Morris 1 Department of Brain Sciences, Imperial College London , UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Alexandra Rother 1 Department of Brain Sciences, Imperial College London , UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Simon Topp 2 Department of Basic and Clinical Neuroscience, King’s College London , UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Christopher Shaw 2 Department of Basic and Clinical Neuroscience, King’s College London , UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Bradley Smith 2 Department of Basic and Clinical Neuroscience, King’s College London , UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Jacqueline de Belleroche 1 Department of Brain Sciences, Imperial College London , UK Find this author on Google Scholar Find this author on PubMed Search for this author on this site Abstract Full Text Info/History Metrics Supplementary material Data/Code Preview PDF Abstract Bioinformatic analysis of next-generation sequencing data from a 3-generation UK amyotrophic lateral sclerosis (ALS) kindred identified co-segregating novel variants in RUBCN (p.Cys517Phe) and KANK1 (p.Pro1332Ala) genes. We tested the association of these variants segregating in this family with ALS using the EMMAX test, incorporating related individuals from the kindred and unrelated UK controls. Both variants were associated with ALS (p < 1 × 10 -8 ). We then applied sequence kernel association tests to these deleterious ultra-rare variants in ALS cohorts versus controls, which showed exome-wide significance with ALS (SKAT-O; p < 1 × 10 -9 ). Functional investigation of lymphoblastoid cell lines (LCL) derived from the variant carriers exhibited a significant increase in apoptosis (p < 0.05). In addition, the transcript levels of markers for endocytosis, LC3-associated phagocytosis, ER stress and cytoskeletal organisation were significantly dysregulated in these variant carriers, suggesting that these pathways were impaired. In ALS spinal cord cases, transcript analysis of RUBCN and KANK1 expression revealed a significant upregulation of RUBCN (2.85-fold) and a significant downregulation of KANK1 (0.40-fold) (p < 0.05), indicating their involvement in the broader context of sporadic ALS. Based on these findings, we conclude that RUBCN and KANK1 have a putative role in ALS pathogenesis. Introduction Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disease that is characterised by rapid progression of muscle spasticity, stiffness, and atrophy ( Brown & Al-Chalabi, 2017 ). It typically manifests from 55 years of age and proves fatal in most patients, who succumb to respiratory failure within 3-5 years of symptom onset ( Cox et al., 2010 ). Of the total ALS cases, approximately 10% are familial and the rest are sporadic ( Brown & Al-Chalabi, 2017 ). Forecasts on ALS suggest a 69% surge in cases globally from 2015 to 2040 ( Arthur et al., 2016 ). After the discovery of the first ALS gene, SOD1, the research community uncovered many other genetic contributors such as TARDBP , FUS , and C9orf72, leading to a better understanding of several pathways underlying ALS pathogenesis ( Farg et al., 2014 ; Woollacott & Mead, 2014 ). To date, more than 40 genes have been identified accounting for over 80% of FALS and 15% of sporadic cases ( Nguyen, Van Broeckhoven, & van der Zee, 2018 ; Wang, Guan, & Deng, 2023 ). As the large families with multiple affected members became scarce, researchers turned to whole-exome or -genome sequencing to analyse extensive cohorts of familial and sporadic cases for gene discovery. Techniques like burden tests, which aggregate variants over the candidate gene in matched cases and controls, have been pivotal in identifying new familial ALS genes, including TUBA4A , TBK1 , NEK1 , and DNAJC7 ( Cirulli et al., 2015 ; Farhan & Howrigan, 2019 ; Kenna et al., 2016 ; Smith et al., 2014 ). To identify novel ALS risk factors, our Imperial College FALS Cohort (n=13 index cases) was whole-exome sequenced (see Materials and methods for details). This included an index case with a cousin in kindred SM133 ( Figure 1 ). Intersection of novel and rare variants (filtered using Gnomad) revealed that both affected individuals of SM133 possessed two novel variants, p.Cys517Phe in RUBCN (ENST00000296343:c.1550G>T) and p.Pro1332Ala in KANK1 (ENST00000382297:c.3994C>G) that co-segregated with disease in this kindred. Both variants were absent in the European (non-Finnish) gnomAD controls without neurological disorders (v3.1.2, n = 67,413 & 67,367, respectively). As ALS kindreds have become increasingly rare, kindred SM133 offers a valuable opportunity to independently assess the association of these variants within a hereditary context. We used EMMAX to assess the association of the segregating variants in the affected pair and other variant carriers in the SM133 kindred with 91 unrelated UK controls, finding a significant result (p 20) in these two genes, showed exome-wide significance in ALS cases versus controls (p < 1 × 10 -9 ). Download figure Open in new tab Figure 1. Pedigree SM133 Kindred SM133 included two affected males with familial ALS (FALS), III-2 and III-6. Blood samples and lymphoblastoid cell lines (LCLs) were available from eight family members. Four individuals were heterozygous for two rare SNVs—c.1550G>T in RUBCN-202 (p.C517F, ‘R’) and c.3994C>G in KANK1-205 (p.P1332A, ‘K’). In addition to the affected males, variant carriers III 1, III 4 and III 5 were all females who had not presented with ALS symptoms (III-5 had only the KANK1 variant). The remaining unaffected individuals—III-3, IV-1, and married-in II-2a—were homozygous for the reference alleles (‘C’). The disease status of obligate variant carriers II-1 and II-2 was unknown. RUBCN-202 (ENST00000296343) and KANK1-205 (ENST00000382297) correspond to high-quality MANE transcripts (Matched Annotation from NCBI and EMBL-EBI). RUBCN (encoding Rubicon), which is abundantly expressed in the cerebral cortex ( Wong, Sil, & Martinez, 2018 ) has a functional role in various signalling pathways including canonical pathways of autophagy and endocytosis ( Matsunaga et al., 2009 ; Q. Sun, Westphal, Wong, Tan, & Zhong, 2010 ; Zhong et al., 2009 ), LC3-associated phagocytosis (LAP) ( Martinez et al., 2015 ) and LC3-associated endocytosis (LANDO) ( Heckmann et al., 2019 ). KANK1 is known to maintain the axonal cytoskeleton by regulating actin polymerisation and cell migration, and has recently been implicated as a risk factor in ALS by integrating regional fine-mapping (termed RefMap) with GWAS summary statistics ( Roy, Kakinuma, & Kiyama, 2009 ; Zhang et al., 2022 ). Here, we present genetic and functional evidence of the association of p.Cys517Phe RUBCN and p.Pro1332Ala KANK1 mutations with ALS. Results Segregation analysis of SM133 reveal mutations in KANK1 and RUBCN We performed whole exome sequencing (WES) of 17 familial ALS patients from the Imperial College London cohort that produced a mean coverage of 90.5% (88.9-92.6%) of RefSeq coding bases to a depth of 10×. Whole-genome sequencing (WGS), performed in parallel on 11 of these cases, also had very high coverage and concordance with the WES-derived variants. Seven of these cases had mutations in previously reported ALS-associated genes, including five cases (from three kindreds) with the pathogenic C9orf72 intronic hexanucleotide expansion, as detected by repeat-primed PCR analysis. One index case carried a c.1394-2del (rs1555509569) variant in FUS that was previously reported in 2014 ( Cady et al., 2015 ). This mutation is predicted to cause out-of-frame skipping of exon 14 that disrupts the FUS C-terminus, similar to another previously reported ALS-causing substitution at the same site (DeJesus-Hernandez, Mackenzie et al., 2011). A second index case harboured a c.290A>G variant, p.Lys97Arg in ENST00000397066 of the Cyclin F gene (rs1465313712 in CCNF ). This variant was published as part of a wider study ( Williams et al., 2016 ). The variant was found in 5/63,904 alleles in the gnomAD v3.1.2 non-Finnish European individuals who were not ascertained to have a neurological condition (‘non-neuro NFE’). Although the remaining 8 index cases were free of candidate mutations in any genes previously associated with ALS, they each harboured between 18 and 44 novel protein-altering variants. To narrow down the search for causative mutations in this subset, we focused our attention on kindred SM133 as there was whole exome and whole genome sequence from the index case and also an affected cousin. Additionally, the genes carrying the shared variants were expressed in the central nervous system and their functional properties were relevant to known ALS pathogenic pathways such as autophagy and cytoskeletal formation. A novel missense single-nucleotide variant (SNV) was found in both RUBCN and KANK1 genes after filtering against the gnomAD v3.1.2 ‘non-neuro NFE’ database of non-Finnish Europeans who had not been ascertained for a neurological condition. The first variant identified in RUBCN was a c.1550G>T transversion in exon 10 of the RUBCN-202 isoform (ENST00000296343, NM_014687), resulting in a missense substitution of cysteine to phenylalanine in the Rubicon protein (p.C517F). This single-nucleotide variant (SNV) was not present in the above gnomAD v3.1.2 database, which included data from 67,413 individuals. A second variant, found in the same kindred, was a c.3994C>G transversion in exon 15 of the KANK1-205 isoform (ENST00000382297, NM_015158, rs768866619), leading to a proline-to-alanine substitution in the Kank1 protein (p.P1332A). This SNV was likewise absent from the database, which included 67,367 individuals. The segregation of these SNVs in the kindred SM133 ( Figure 1 ) was then determined by Sanger resequencing in eight individuals (Supplementary figure 1). The presence of both RUBCN c.1550G>T and KANK1 c.3994C>G variants was confirmed in the male index case (III-2) and the second affected male cousin (III-6), as well as two female variant carriers (III-1, III-4). In addition, the KANK1 SNV was found in III-5, a third female and sibling of III-6, who did not harbour the RUBCN variant. Both SNVs were found as heterozygotes that appeared to have segregated in an autosomal dominant pattern of inheritance. Of the eight screened family members, four harboured these rare SNVs (or 5 for the KANK1 mutation), and the remaining family members III-3, IV-1, and the married-in II-2a did not possess them. There were an additional two obligate carriers, II-1 and II-2, of unknown status. The penetrance of these missense alleles in the SM133 kindred members appears to be split by sex, where both male heterozygotes developed FALS compared to none of the female heterozygotes. The absence of these SNVs in the above ‘non-neuro’ control populations contrasts with their much higher frequencies in the consanguineous members of SM133 kindred. The allele frequencies of the RUBCN and KANK1 heterozygous variant carriers are 28.6% and 35.7%, respectively. To test an association of the variants segregating within this small pedigree with ALS status, we applied the EMMAX test. This can leverage the genetic relatedness of kindred members, including those with multiple related individuals, to provide genetic associations. It constructs a Genetic Relationship Matrix (GRM) which reflects the proportion of the genome that each pair of individuals shares identical by descent (IBD). The GRM is incorporated into the linear mixed model that enables EMMAX to account for the shared genetic background due to relatedness, which gives a family-based measure of association. We conducted the test using data from eight sequenced members of the kindred ( Figure 1 ) and a control group of 91 unrelated individuals from the UK (46 males and 45 females). Both the RUBCN c.1550G>T variant and the KANK1 c.3994C>G variant showed highly significant associations in this analysis (p < 1 × 10 8 ). When the EMMAX model was applied to males only, the association of each variant with male affecteds was p < 1 × 10 -11 . Since none of the female family members presented with disease symptoms, no test was attempted. The pathogenicity of p.C517F in RUBCN and p.P1332A in KANK1 was predicted by both PolyPhen 2 and Mutation Taster as probably deleterious. CADD gave a score of 17.3 and 25, suggesting possibly or probably damaging effects, respectively (supplementary table 1). We also performed multiple sequence alignments of amino acids flanking the missense variants to reveal their conservation across species, indicating their functional importance. The reference amino acids, p.Cys517 in Rubicon and p.Pro1332 in Kank1, together with their flanking residues, were found to be conserved in their evolutionary orthologues: Cys 517 was conserved across mammals between humans and marsupials, whereas Pro 1332 was further conserved between humans and insects (supplementary figure 2). Gene level burden testing shows a significant association of KANK1 and RUBCN with ALS Since rare variants are present in only a small number of people, they may not individually show a significant association with disease. For a given gene, burden tests detect rare variant effects by evaluating the cumulative association of multiple rare variants with disease in cases and controls. For KANK1 and RUBCN , we performed burden tests using the aggregate of pathogenic rare missense SNVs with a CADD score ≥ 20 in each gene (the Cys517Phe variant in RUBCN was excluded due to a CADD score < 20). The cases included our FALS cohort and the ALSdb3 and MinE datasets, totalling 7,696 ALS patients with variants absent or present at <0.001% frequency in controls. The control dataset included singleton missense variants with allele frequencies <0.001%, enabling detection of evolutionarily recent alleles, critical for traits under purifying selection (Povisyl et al., 2019). As a result, collapsing analyses often produce the strongest signals from the rarest variants. A sample of 53,424 individuals was used, consisting of 1,832 MinE ALS controls and 51,592 non-Finnish European ‘non-neurological’ controls from gnomAD who had not been ascertained with a neurological condition (see Methods). Out of the 7,696 ALS cases, seventeen and twenty-five missense variants were found in RUBCN and KANK1, respectively. Moreover, three doubletons were found in the patient group: two in RUBCN (A504V and R813Q) and one in KANK1 (N1156T). None of the above variants were found in the control group. In KANK1, the G1002R and P1332A variants were found in one case and a control. The control samples had five RUBCN and twenty KANK1 ultra-rare variants. Association of the SNVs in each gene with ALS was estimated by the SKAT-O binary robust tests as implemented in R, which estimated a p-value < 1×10 -9 for both genes (supplementary Figure 3). This is significant relative to a threshold for whole-exome sequencing (WES) of p = 2.5 × 10 -7 ( Fadista, Manning, Florez, & Groop, 2016 ). Transcript analysis identifies dysregulation to the endocytosis, ER stress and autophagy pathways The RUBCN gene encodes for Rubicon protein, which is widely expressed in most tissues of the body, and is abundant in both cerebral cortex and spinal cord neurons ( Beltran et al., 2019 ; Wong et al., 2018 ). Rubicon is localized to the late endosome and lysosome compartments ( Matsunaga et al., 2009 ) that consists of multiple domains that interact with other proteins of canonical and non-canonical autophagy, and endocytosis pathways (Q. Sun et al., 2010 ; Yang, Rodgers, et al., 2012). These features enable Rubicon to play a role in multiple signalling pathways: Rubicon down-regulates the maturation steps in the canonical pathways of autophagy and endocytosis ( Matsunaga et al., 2009 ; Q. Sun et al., 2010 ; Zhong et al., 2009 ). Conversely, Rubicon is an essential positive regulator of the NADPH oxidase complex in the non-canonical pathway of LC3-associated phagocytosis (LAP) ( Martinez et al., 2015 ) and in LC3-associated endocytosis (LANDO) ( Heckmann et al., 2019 ). Kank1, KN Motif and Ankyrin Repeat Domains 1, attenuates the remodelling of cytoskeletal actin fibres during neurite outgrowth and lamellipodia formation with a role also in cell polarity and migration ( Roy et al., 2009 ) ( Gee et al., 2015 ). Kank1 cross-talks between focal adhesions and cortical microtubules by physically linking the two macromolecular assemblies with the microtubule-stabilizing complex. It does this via several proteins including KIF21A ( Bouchet et al., 2016 ; Rafiq et al., 2019 ). We therefore performed functional studies in cellular models to investigate the influence of RUBCN and KANK1 mutations on the relevant cellular pathways. We investigated the effects under basal conditions (with no drug treatment) and cell stress by gene expression profiling of pathway markers using qPCR. We chose lymphoblastoid cell lines (LCLs) as a cellular model since they have previously been used to identify altered signalling pathways in neurological disorders ( Annesley & Fisher, 2021 ). We used eight LCLs derived from the SM133 kindred ( Figure 1 ) to compare LCLs containing both RUBCN and KANK1 mutations with wild-type LCLs. The RUBCN and KANK1 mutations in LCLs were confirmed by Sanger sequencing. The following pathway markers were selected for investigation: (1) RAB7A for endocytosis, (2) NOX2 for LC3-associated phagocytosis (LAP). We measured three autophagy pathway transcripts: (3a) RUBCN , as well as two components of the PI3KC3 complex, (3b) VPS34 and (3c) UVRAG . Three markers of the ER stress pathway, (4a) DNAJC10 , (4b) HSPA5 , (4c) XBP1, and finally, (5) KANK1 for cytoskeletal organization. Cell stress was induced in LCLs to create a model that mimics the cellular conditions of ALS by using three drugs (rapamycin, tunicamycin and thapsigargin) for activating autophagy and ER stress. Under basal conditions, the KANK1 and RUBCN mutations caused a significant dysregulation in the expression of the following marker genes in LCLs ( Figure 2 ): for endocytosis, downregulation of RAB7A (fold-change (FC) = 0.38, p-value = 0.02) and for LC3-associated-phagocytosis (LAP), downregulation of NOX2 (FC = 0.43, p = 0.01). Of the ER stress transcripts, DNAJC10 was downregulated (FC = 0.53, p = 0.03) and XBP1 was upregulated (FC = 2.83, p = 0.006). For the cytoskeletal organisation, KANK1 was upregulated (FC = 7.41, p = 0.01). To analyze KANK1 expression, we included wild-type control cell lines that lacked known ALS variants from another family due to the limited number of wild-type cell lines available in kindred SM133. Overall, these significant changes suggest that the mutations dysregulated endocytosis, LAP, ER stress, and cytoskeletal organisation. Download figure Open in new tab Figure 2. Effect of the C517F and P1332A mutations on pathway transcript levels Effect of the RUBCN C517F and KANK1 P1332A mutations on basal transcript levels in lymphoblastoid cell lines (LCLs) from variant carriers and wild-type individuals in the SM133 kindred. Data are presented as –ΔCq (–ΔCt) values with means ± SEM. The top row shows transcript levels of RUBCN and KANK1 . The blue panel includes LAP-related genes, the pink panel highlights autophagy transcripts, and the yellow panel shows ER stress response genes. Expression levels were normalised to ACTB . Bars represent mean ± SEM: blue for wild-type, red for mutant. Statistical analysis was performed using unpaired Student’s t-tests (*p < 0.05, **p < 0.01). WT – wild-type; Mut – mutant; V – vehicle control for basal expression. Rapamycin (R) induces autophagy by inhibiting the mTOR (mammalian target of rapamycin). In both wild-type and mutant LCLs separately, R caused a significant downregulation in the mRNA expression of RUBCN compared to untreated LCLs (Supplementary table 2). In the wild-type LCLs, R also caused a significant downregulation of mRNA expression for the autophagy marker gene VPS34 , the endosomal pathway marker RAB7A as well as the ER stress marker DNAJC10 compared to untreated LCLs. In contrast, for the corresponding mutant LCLs, the effect of R on these genes was not evident suggesting that the mutation may have disabled the downregulating effect of rapamycin. The RUBCN and KANK1 mutations caused cell death FITC-Annexin V assay in conjunction with cell-sorting was used to examine the effect of the RUBCN p.C517F and KANK1 p.P1332A mutations on lymphoblastoid cell lines. The effects on cell survival were measured under basal and cell stress conditions. ER stress was induced using tunicamycin (TN) or thapsigargin (TG) treatments. In comparison to wild-type LCLs, the mutations showed a significant increase in total apoptosis when cultured in vehicle only (p < 0.05). Drug treatment itself gave rise to significantly elevated total apoptosis levels in cell lines (repeated measures ANOVA, p < 0.05), indicating the induction of the relevant pathways. Although mutant cell lines treated with TN or TG always exhibited a higher mean of cell death than the wild-type, this was mostly accompanied by larger and overlapping standard deviations resulting in non-significant mean differences ( Figure 3 ). Download figure Open in new tab Figure 3. Annexin V assay for cell survival. Means and standard deviations (SD) of % cell death in early apoptosis and total apoptosi detected by flow cytometry with the annexin V assay. The measurements were of wild-type (blue, n = 3) or mutant lymphoblastoid cell lines (red, n = 5) treated with vehicle. Apoptosis levels of mutant versus wildtype cells were compared using unpaired two-tailed t-tests (p < 0.05 is marked by *). RUBCN and KANK1 are involved in sporadic ALS Pathogenesis Based on our findings in LCLs, we wanted to investigate the possible alterations in RUBCN and KANK1 expression levels along with markers of the pathways involved in the action of these genes in sporadic ALS (SALS) pathology. For this, the human spinal cord post-mortem samples derived from SALS cases were compared to age-matched healthy controls samples that were available in the laboratory. Using qPCR, we found a significant increase of RUBCN mRNA expression (FC = 2.85, p = 6 × 10 -4 ( Figure 4 ). Similarly, KANK1 mRNA expression level was significantly decreased (FC=0.81, p = 2.33 × 10 -2 ) in SALS patients compared to controls. Additionally, we found a corresponding significant decrease in the mRNA expression of the binding partner of KANK1, KIF21A , in SALS patients compared to controls (p<0.0001) ( Figure 5 ). The KANK1/KIF21A interaction is evolutionarily conserved in different species ( Weng, Shang, Yao, Zhu, & Zhang, 2018 ) and is also important for cell migration and polarity ( Gee et al., 2015 ), where KIF21A inhibits the formation of microtubules in the cortical regions of cells ( van der Vaart et al., 2013 ). Download figure Open in new tab Figure 4. Levels of RUBCN mRNA in spinal cord. RUBCN mRNA expression levels in the spinal cord post-mortem samples from SALS cases (red dots) and controls (blue dots). The number of samples analysed is given in brackets below the X-axis. The gene expression values were normalised to GAPDH or ACTB and are given as -ΔCt where the black bars show means and coloured bars, SEMs. The data were normally distributed as tested by the D’Agostino and Pearson normality test and were compared using the unpaired Student’s t-test (***p < 0.0005). Download figure Open in new tab Figure 5. Levels of KANK1 and KIF21A mRNA in spinal cord. Quantitative PCR analysis of spinal cord. Using unpaired t-test, normalised -ΔCt values showed a significant decrease both of KANK1 total transcript levels in SALS compared to controls, and of KIF21A in SALS individuals compared to controls (*p < 0.05, ***p < 0.0005). Error bars represent standard error of means (S.E.M). Our RUBCN and KANK1 gene expressions were significantly changed in both SALS and FALS though in the opposite directions in SALS compared to FALS for both the genes. This observation further supported the effect of the mutations on cellular pathways in FALS where the mutations caused a deviation in the expected response of genes observed in SALS. Thus, these findings jointly add further support for the involvement of RUBCN and KANK1 in ALS pathogenesis. Discussion We have identified the novel mutations in RUBCN (c.1550G>T) and KANK1 (c.3520C>G) using whole-exome data from the Imperial College FALS cohort. The presence of mutations in these two genes is consistent with an oligogenic basis of FALS, previously found in 4% of FALS patients ( Morgan et al., 2017 ). We have described the association of RUBCN and KANK1 with ALS by showing first, an association of the identified variants segregating with FALS using pairwise relatedness between 8 kindred members and a sample of UK unrelated controls. Second, a burden test of an aggregate of ultra-rare RUBCN and KANK1 variants showed an association with ALS, which was significant at a WES threshold of p < 2.5 × 10 -7 . The impact of these two missense variants on the viability of the FALS-transformed LCL model was shown by a significant increase in total apoptosis in the LCLs harbouring these mutations versus wild-type LCLs from unaffected family members who were not mutation carriers. Furthermore, our qPCR measurements of the transcripts revealed a significant upregulation of XBP1 and a downregulation of DNAJC10 in mutant LCLs compared to wild type. XBP1 is a component of the IRE1-mediated unfolded protein response, and DNAJC10 functions as an endoplasmic reticulum co-chaperone. Both markers have previously been reported to be upregulated in the lumbar spinal cord of sporadic ALS patients, indicating the activation of the UPR pathway ( Montibeller & de Belleroche, 2018 ). A significant downregulation of DNAJC10 in our LCLs, therefore points to the possible disruption of the UPR pathway. UPR has already been widely associated with neuronal dysfunction in neurodegenerative diseases including ALS (Karademir, et al., 2015; ( Montibeller & de Belleroche, 2018 ). Moreover DNAJC7 , a gene paralogous to DNAJC10 , has been associated with ALS ( Farhan & Howrigan, 2019 ), where p.Arg156Ter led to decreased protein expression in an ALS case, which is in the same direction as the decreased DNAJC10 expression in our mutant LCLs. These findings indicate that the disturbed expression of components of the UPR machinery could be contributing towards the increased cell death in the mutation-containing-LCLs. The gene product of NOX2 interacts with the C-terminal segment of Rubicon (Supplementary Figure 4). Under basal conditions, the mutant LCLs showed significantly lower mRNA expression levels of NOX2 , a marker gene for the LAP pathway. Since Rubicon recruits NOX2 protein for LAP ( Martinez et al., 2015 ) by binding it to amino acids 558-625 (Yang, Lee, et al., 2012), the nearby p.C517F mutation may have led to the associated downregulation of the NOX2 transcript levels. This in turn could impair the LAP pathway by causing a decrease in the level of required reactive oxygen species production (Supplementary figure 5). The deleterious effects of this mutation may be relevant to microglia in the human CNS. In a murine model of multiple sclerosis, deletion of Atg7 in microglia led to impaired LAP, which failed to clear tissue debris and brought about persistent neuroinflammation ( Berglund & Guerreiro-Cacais, 2020 ). This stood in contrast to the controls, where functional LAP carried out efferocytosis that curbed both disease progression and neuroinflammation. Similarly, in Alzheimer’s disease, Heckmann et al. found that a deficiency of microglial Rubicon in the related pathway, LC3-associated endocytosis (LANDO), also led to accelerated neurodegeneration with elevated neuroinflammation ( Heckmann et al., 2019 ). Moreover, in another study, very low NOX2 levels were shown to promote autoimmune neurodegeneration ( Sorce et al., 2017 ). Together, these studies suggest that the decreased NOX2 expression by p.C517F mutation in LAP may also lead to defective efferocytosis and anti-inflammatory responses. Confirmation of this will require further studies. Similar to NOX2, Rab7 also interacts with the C-terminal segment of Rubicon (Supplementary Figure 4) and is a marker gene for endosomal pathway. These missense variants were also associated with a significant decrease in mRNA expression levels of RAB7A under basal conditions. Rubicon is a negative regulator of endosomal maturation. Active GTP-bound Rab7 on binding to Rubicon releases the UVRAG-containing PI3KC3 complex from Rubicon sequestration and allows endosomal maturation and subsequent lysosomal degradation of its cargo ( Lin & Zhong, 2011 ; Q. Sun et al., 2010 ). The significant downregulation of the RAB7A mRNA expression indicates a possible hindrance in endosomal maturation, which could have resulted from binding to disrupted Rab7A on the RH domain of p.C517F Rubicon. A previous report of a frameshift mutation in RUBCN, associated the gene with autosomal recessive spinocerebellar ataxia-15. The mutation, p.Ala875ValfsX146, is adjacent to the C-terminal domain that binds to Rab7A, and impairs the endosomal localisation of Rubicon ( Assoum et al., 2013 ). To find if the p.C517F RUBCN disrupts the interaction of Rubicon with Rab7A and endosomal localization will require further studies. The site of Rubicon containing the p.C517F mutation interacts with UVRAG and Beclin-1 (supplementary Figure 4). Since both of these proteins are components of the class III phosphatidylinositol 3-kinase (PI3KC3) complex involved in autophagy, we hypothesized that the mutation might affect the binding and/or expression of either or both proteins with Rubicon. Unexpectedly, there was no effect of the mutation on the expression of BECN1, and UVRAG. This could be explained by the ability of Rubicon to maintain its binding to the PI3KC3 complex via Vps34, which has multiple interactions with Beclin1 and UVRAG (Supplementary Figure 4) ( Martinez et al., 2015 ; Q. Sun et al., 2010 ). Rubicon shares high sequence homology with a previously reported ALS-associated protein, Pacer (also known as Rubicon-like), which acts as a positive regulator of autophagosome maturation, in contrast to the inhibitory activity of Rubicon ( Beltran et al., 2019 ). Like Pacer, Rubicon is also expressed in spinal cord neurons ( Beltran et al., 2019 ) signifying its importance in these cells. A recent study on astrocytes revealed a downregulation of RUBCN expression in ALS, which raised the possibility that RUBCN is a protective gene whose effect is lost in ALS ( Ziff et al., 2022 ). We also found an upregulation in the mRNA expression of KANK1 . The upregulation may disrupt key cellular mechanisms due to the role of KANK1 in regulating actin cytoskeleton dynamics which are crucial for cellular processes like motility, adhesion and intracellular signaling (Kakinuma, 2008). Thus the overexpression could impair neuron morphology and synaptic function by interfering with actin filament stability. This may exacerbate neuronal stress, a hallmark of ALS pathology. KANK1 has recently been implicated as a risk factor in ALS ( Zhang et al., 2022 ). Zhang et al performed studies on motor neurons derived from induced pluripotent stem cells (iPSCs) to recapitulate the functional effect of exonic nonsense-mutations in KANK1 . These motor neurons underwent increased nuclear fragmentation and apoptosis. Furthermore, they displayed significantly shorter neurite and branch lengths ( Zhang et al., 2022 ). Our qPCR expression studies on the involvement of RUBCN in sporadic disease, using post-mortem lumbar spinal cord samples from SALS cases and controls, showed a substantial upregulation in the mRNA levels of RUBCN in SALS. These results confirmed previous findings of Beltran et al. (2019) that were obtained from a smaller number of samples (2 controls and 6 SALS), which showed a corresponding increase in Rubicon protein expression. Our threefold upregulation of RUBCN mRNA in SALS suggests a hypothesis for a disease process involving a shift from macro-autophagy to LAP, which is consistent with Rubicon’s inhibition of macro-autophagy and activation of noncanonical autophagy pathways, such as LAP and LANDO ( Heckmann et al., 2019 ; Martinez et al., 2015 ). We observed a significant downregulation of KANK1 and KIF21A mRNA in SALS cases. KIF21A and KANK1 interaction is necessary for the development of the dendritic spine and synaptic plasticity (S. Y. Sun et al., 2025 ). A downregulation of both proteins indicates defects in these processes. Together, these findings further support a role for RUBCN and KANK1 as ALS-associated genes. Our findings in FALS and SALS provide important insights into the cellular impact of the identified mutations. While lymphoblastoid cell lines offered a practical model to study conserved cellular pathways, further validation in motor neurons will be valuable to confirm mutation-specific effects in disease-relevant cell types. Additionally, although the FITC-Annexin V assay remains a commonly used approach for detecting apoptosis, incorporating complementary methods such as DAPI staining could further distinguish between apoptotic and necrotic cell death, thereby providing greater insight into the underlying mechanisms of cell death. Future studies may also benefit from using organoid models to replicate key experiments, which better replicate tissue architecture and may reveal context-dependent cellular responses. Furthermore, exploring the subcellular localization of proteins affected by these mutations through histological techniques could offer deeper mechanistic insight into ALS pathogenesis. Our findings in FALS and SALS highlight the cellular impact of identified mutations. Lymphoblastoid cell lines provided a practical model for studying conserved pathways, but validation in motor neurons is needed to confirm the effects of mutation on disease-relevant cell types. While the FITC-Annexin V assay is commonly used to detect apoptosis, complementary methods like DAPI staining could better distinguish apoptotic from necrotic death. Future studies may benefit from organoid models that better mimic tissue architecture and reveal context-dependent responses. Additionally, histological analysis of subcellular protein localisation could offer deeper mechanistic insights into ALS pathogenesis. Conclusion To summarise, both the p.C517F variant of RUBCN and the p.P1332A variant of KANK1 were seen to be absent in a large control sample, in contrast to their enriched frequency in eight consanguineous kindred members, who were genotyped for these SNVs with MAFs of 28.6% and 35.7%, respectively. Both variants were associated with disease status in the kindred and both genes were associated with disease using SKAT-O tests of rare missense variants in Northern European samples. LCLs from the kindred harbouring the two SNVs showed dysregulated components of the non-canonical autophagy pathway, the UPR machinery and cytoskeletal polymerisation, together with significantly increased levels of apoptosis. This suggests that the cell’s vulnerability to ER stress, disturbed LAP and endocytosis could give rise to the observed increase in apoptotic events due to the variants. These findings in addition to our findings in SALS cases, strongly support RUBCN and KANK1 as novel ALS-causing genes. The observed effect of the two mutations on multiple cellular pathways is depicted in Figure 6 . Download figure Open in new tab Figure 6. Overview of the changes occurring inside the cell from the p.C517F RUBCN and p.P1332A KANK1 mutations. In this study, we assessed the effects of the p.C517F RUBCN and p.P1332A KANK1 mutations on autophagy, endocytosis, LC3-associated phagocytosis, and ER stress pathways. Rapamycin (R) was used to induce autophagy and tunicamycin (TN) or thapsigargin (TG) were used to induce ER stress. The two mutations jointly affected the expression of the KANK1 , Rab7 , NOX2 , DNAJC10 , and XBP1 , affecting microtubule formation, endocytosis, LC3-associated phagocytosis, and UPR pathways. We propose that these cellular changes jointly led to cell death. Black circles indicate the genes whose expression was affected by the p.C517F RUBCN and/or p.P1332A KANK1 mutations. Materials and Methods Whole Exome and Genome Sequencing DNA was isolated from blood cell of 17 patients (13 index cases) from the Imperial College London Familial ALS cohort, and exome capture was performed using standard protocols with Roche NimbleGen SeqCap EZ Exome V3 probes. The samples were exome sequenced as the component of the first international FALS exome consortium that led to the association of rare variants in TUBA4A with ALS ( Smith et al., 2014 ). Paired-end sequencing was carried out at the Guy’s Hospital Genomics Facility, London, on an Illumina Hi-Seq 2000 to produce 100bp reads. In parallel, DNA from 11 of the patient LCLs (9 index cases) was also whole genome sequenced at the Massachusetts General Hospital, Boston, producing 150bp paired-end reads. Reads were assembled to the hg19 human reference genome with NovoCraft Novoalign. Variants were called with samtools-mpileup, normalised with bcftools norm, and annotated using Annovar and additional custom Perl scripts. Variants were quality filtered at DP ≥ 10, GQ ≥ 90 and MQ ≥ 50. Variants were excluded if they were present in any of the following population datasets: the 1000 Genomes Project, 670 local control exomes, UK10K exomes, Exome Variant Server, ExAC, Greater Middle Eastern Exomes, or the non-neurological subset of gnomAD. Variants were further excluded if a manual inspection in the Integrated Genomics Viewer suggested they were false-positive variant calls. Potential effects on splicing were assessed for variants within 25 bp of a known splice site by ADA, randomForest, Spidex, NetGene2 and GeneSplicer. Synonymous, 5′ or 3′ UTR and intronic variants were excluded from consideration in this analysis unless they were predicted to alter splicing by two or more independent algorithms, as well as those loci with poor coverage in gnomAD v2.1.1 (i.e. a read depth >=10x in <60,000 non-neurological individuals). Samples This study was approved by the Riverside Research Ethics Committee, NRES committee Fulham, and Genetics of Motor Neurone Disease/ Amyotrophic Lateral Sclerosis. REC reference: 12/LO/0902. NRES Committee Yorkshire and the Humber, Gene expression in Motor Neurone Disease/ Amyotrophic Lateral Sclerosis. Reference: 12/YH/0281 and the study was performed according to their guidelines. Patients with ALS were diagnosed according to El Escorial diagnostic criteria defined by the World Federation of Neurology ( Brooks, 1994 ; Brooks, Miller, Swash, & Munsat, 2000 ). SM133 FALS samples: Blood samples or buffy coats were available from eight individuals of the SM133 kindred. At the time of ascertainment, two males were diagnosed with FALS (III-2 and III-6), while the remaining six did not present with ALS symptoms (III-1, III-3, III-4, III-5, IV-1, and a married-in II-2a) ( Figure 1 ). Two ancestral individuals were obligate variant carriers of unknown disease status: II-1 and II-2). Lymphoblastoid cell lines (LCLs) were also available from the same eight individuals established by ECACC (HPA, Porton). Both affected individuals had disease onset in their 60s, with a disease duration ranging from two to four years until death. SALS samples: Spinal cord post-mortem tissue samples stored at −80°C were available. The samples were taken from the lumbar regions (L3 to L5) of 49 individuals, of which there were 32 SALS cases and 17 controls. The median age at death was 68 years for SALS cases and 66 years for controls. The median post-mortem delay in the sample collection was 14 hours for SALS cases and 11 hours for controls (Supplementary table 3). The pathological characteristics of these tissue samples were described in detail in our previous work ( Paul, Murphy, Oseni, Sivalokanathan, & de Belleroche, 2014 ). Cell culture We grew lymphoblastoid cell lines (LCLs) in RPMI 1640 medium (Gibco) with 10% foetal bovine serum (Sigma-Aldrich), 1% glutamax (Gibco), 1% penicillin/streptomycin (Gibco) at 37°C, 5% CO2 until an appropriate number of cells was obtained. Cells were counted and 1 ml of culture medium containing about 3 x 10 6 cells was transferred into each well of a 24 well plate for subsequent drug treatment. We used the following drugs: tunicamycin (2 µg/ml) (Sigma-Aldrich), thapsigargin (0.5 µM) (Sigma-Aldrich), rapamycin (0.2 µM) (Sigma-Aldrich), and tertiary-butyl hydroperoxide (50 µM) (Sigma-Aldrich). Drugs were diluted using DMSO. After 24 hours incubation at 37°C and 5% CO2, the cells were treated for 6 hours with thapsigargin, 24 hours with tunicamycin and 24 hours with rapamycin. Experimental controls, with either only medium or medium with DMSO, were included in the experiment. Cold phosphate buffer saline (PBS) was added to each well to inhibit drug treatment. The cells were transferred into tubes and centrifuged for 5 min at 2000g. The supernatants were discarded and the pellets were stored at −80°C for DNA, RNA, or protein extraction. DNA extraction and Sanger sequencing We extracted genomic DNA from whole blood or lymphoblastoid cell lines using the QIAamp® DNA Midi kit (Qiagen, UK) according to the manufacturer’s protocol. Extracted DNA was quantified using an ND-1000 spectrophotometer (NanoDrop®). DNA had a 260/280 absorbance ratio of 1.8 or greater. For PCR amplification of RUBCN , we used forward primer: AGGAGAATGCCCACTTCAGC and reverse primer: CAGGTTCTTGGTGCGGATTT. For PCR amplification of KANK1 , we used forward primer: GGTTTGAGAAACCCAACATGGC and reverse primer: GTGGAGGCGGAAAGGATGAA. These primers were designed using Primer3 software. The purity and yield of the required PCR products were confirmed by agarose gel electrophoresis. The PCR products were treated with Exonuclease I and Shrimp Alkaline Phosphatase for the removal of unused primers and dNTPs. PCR products were then sequenced by Sanger sequencing at the MRC CSC Genomic Core Facility of Imperial College London. The DNA sequence files were analysed using CodonCode aligner software. RNA extraction and RNA quality assessment We extracted RNA from the frozen spinal cord post-mortem tissue samples and lymphoblastoid cell lines using the Direct-zol TM RNA miniprep kit (Zymo Research, USA) according to the manufacturer’s protocol. Extracted RNA was eluted in 40 µl of DNase/RNase-free water. RNA was quantified using an ND-1000 spectrophotometer (NanoDrop®) and stored at −80°C. 260/280 absorbance ratios were in the range of 1.8 to 1.9 for all tissue samples. We measured the pH of the spinal cord tissues from SALS cases and controls. The median value of pH was 6.3 for SALS cases and 6.4 for controls ( Anagnostou et al., 2010 ). RNA integrity of the extracts was assessed using the Agilent 2100 Bioanalyser system in combination with the RNA 6000 LabChip®. Total RNAs with 28S:18S rRNA ratios >1.0 were selected for further study ( Montibeller & de Belleroche, 2018 ). cDNA synthesis and qPCR cDNA was synthesized from RNA extracts using cloned Avian Myeloblastosis Virus (AMV) cDNA synthesis kit (Invitrogen). cDNA was stored at −20°C for further use. Primers were designed using Primer3 software to amplify the target sequence (Supplementary table 4). qPCR reactions were prepared using PowerUp™ SYBR ® Green Master Mix (ThermoFisher Scientific) and 6 μM of primers. ROX dye was also included for signal normalization to reduce variability between technical replicates. Amplification was carried out using a Stratagene ® MX3000p qPCR system. The following cycling conditions were applied: initial denaturation at 95°C for 10 min followed by 35 cycles each with denaturation at 95°C for 30 sec, annealing at an optimized temperature for 30 sec, and extension at 72°C for 45 seconds. A final cycle was also included with denaturation at 95°C for 1 minute, annealing at an optimized temperature for 30 sec, and an extension at 72°C for 45 sec. All the amplified qPCR products were analysed by observing thermal dissociation curves in addition to gel electrophoresis to confirm the purity and size of required products. FITC annexin V assay For FITC annexin V assays, we grew the LCLs as described above. Cells were counted and 1ml of culture medium containing 3 x 10 6 cells was added in each well of a 24 well plate. The cells were seeded for approximately 24 hrs followed by drug treatment with tunicamycin, thapsigargin, and rapamycin as mentioned earlier with the corresponding vehicle control. The cells were also treated with staurosporine (5uM) (Sigma-Aldrich) for 4 hours. Staurosporine was used as a positive control for apoptotic cell death. The drug treatment was inhibited with the addition of cold phosphate buffer saline (PBS) in each well. The cells were subsequently stained for the assay using a FITC Annexin V Apoptosis Detection kit 1 (BD Biosciences) according to the manufacturer’s protocol. The cells were sorted using 2 Laser FacsCalibur Flow Cytometer (BD Biosciences) to detect apoptosis. Data obtained was analyzed using FlowJo 10.1 software. Variant Data and Statistical Analysis An Imperial College cohort of 13 index cases was subjected to exome sequencing as part of an international consortium ( Smith et al., 2014 ), including one that is in a British kindred ‘SM133’ of multiply affected individuals with ALS. A missense variant was identified in both RUBCN and the KANK1 genes in two cousins with ALS from the SM133 kindred ( Figure 1 ). The genotypes of these variants were either determined by Sanger sequencing of the eight family members or were inferred from the three obligate carriers. To assess the association of the two SNVs segregating in the family with ALS, we conducted an analysis that accounted for pairwise relatedness among the eight sequenced family members and included 91 unrelated British individuals who lacked the alternative alleles at both loci ( https://www.internationalgenome.org/data-portal/population/GBR ; Fairley, Lowy-Gallego, Perry, & Flicek, 2020). A kinship matrix of genetic identity by descent was constructed of the sequenced family members with 91 unrelateds, using kindred coefficients from Lange (2003). Then the association of each variant was tested using the ‘efficient mixed-model association expedited’ (EMMAX) software ( Kang et al., 2010 ) as implemented in R using the SNP-set sequence kernel association test package (SKAT at github.com/leelabsg/SKAT) ( Wu et al., 2011 ). The same test was applied to the male group consisting of the 4 kindred members and 46 unrelated British males. Secondly, the occurrence of these SNVs was scanned in two control databases. These consisted of a total of 53,424 controls, firstly with 51,592 ‘non-neurological’ controls drawn from those gnomAD non-Finnish Europeans who had not been ascertained for a neurological condition ( gnomad.broadinstitute.org ) ( Karczewski et al., 2020 ) and secondly with 1,832 controls from the MINE project who were also of European ancestry ( van der Spek et al., 2019 ) ( databrowser.projectmine.com ). The gnomAD non-neurological control sample included 104,068 exomes and 10,636 genomes, including 44,779 and 6,813 non-Finnish European exomes and genomes respectively (where the ExAC data has now been incorporated into gnomAD). Rare variant collapsing analysis was applied to regional rare variants within the RUBCN and KANK1 genes of ALS patients. These were retrieved from the MinE database of 4,366 ALS cases as well as 3,317 cases of ALSdb ( ALSdb.org ). In a review of sequence-based association studies of three disease groups, Povisyl, Petrovski et al. recurrently observed that the strongest disease risk was concentrated in ‘ultra-rare’ missense variants with a (MAF) minor allele frequency < 0.001% that are also predicted as deleterious ( Povysil et al., 2019 ); this ‘enrichment’ has also been reported for quantitative traits ( Barton, Sherman, Mukamel, & Loh, 2021 ). Such ultra-rare variants were selected with the same MAF < 0.001% or absent in 53,424 controls from the above gnomAD and MinE datasets. All such variants were further filtered for pathogenicity when they showed a Combined Annotation Dependent Depletion (CADD) score ≥ 20 (cadd.gs.washington.edu/snv) ( Rentzsch, Witten, Cooper, Shendure, & Kircher, 2019 ). Region-based burden tests of association for such variants with ALS in the above datasets were estimated using optimised sequence kernel association test (SKAT-O) which combines burden testing and SKAT for optimal power across different genetic architectures. We used the ‘SKATBinary_Robust’ function to adjust for unbalanced case-control ratios ( Zhao et al., 2020 ). For whole-exome sequencing (WES), Fadista, Manning et al. recommended an allele frequency-adjusted threshold of significance of P< 2.5×10 -7 ( Fadista et al., 2016 ). Gene expression levels were normalised against house-keeping genes, GAPDH or ACTB, by using transcript values of ΔCt =(Ct gene of interest – Ct housekeeping gene ). ΔCt, also called ΔCq, can be expressed as 2 -ΔCt = fold change (FC) values. Negative ΔCt values are plotted in graphs since an increase in transcript levels may be shown as an upward shift in the ordinates. Statistical analysis of gene expression was performed using GraphPad Prism software. The effect of drugs was analysed using the paired Student’s t-test and the effect of the mutation was analysed using the unpaired Student’s t-test (parametric) or Mann-Whitney test (non-parametric). The effect of the mutation together with the drug treatment on cell survival was analysed using two-way ANOVA with a Bonferroni post-hoc test. Results were given as mean ± Standard error of the mean (SEM). Data Availability All data produced in the present study are available upon reasonable request to the authors. Author contributions M.S. performed the validation and functional characterisation of the p.C517F RUBCN and contributed to manuscript preparation. I.B. performed the validation and functional characterisation of the p.P1332A KANK1 and contributed to manuscript preparation. A.M. performed genetic analysis and functional associations of both gene variants and contributed towards manuscript preparation. A.R. performed a subset of the functional characterisation of p.C517F RUBCN and prepared figure 6 . B.S., S.T., C.H. generated and analysed exome and genome data. B.S. and S.T. contributed to manuscript preparation. M.S., I.B., A.M., and J.D.B. designed the project. Conflict of interest The authors declare that there are no conflicts of interest. Acknowledgements This work is dedicated to the memory of Jacqueline de Belleroche, an intelligent scientist with passion and dedication who has contributed to scientific progress in the study of ALS. She was a mentor to all of us in her lab and she will always be. We are grateful to the tissue donors and their relatives involved in this research through the Imperial College ALS Tissue Bank. We thank Luigi Montibeller and Maria Teresa Cencioni for their support. We are grateful to Imperial College London for the award of President’s PhD scholarship to Midhat Salman, to Majlis Amanah Rakyat (MARA) Malaysia for the award of PhD scholarship to Intan Bakhtiar, to the MRC and MND associations for funding the project. References ↵ Anagnostou , G. , Akbar , M. T. , Paul , P. , Angelinetta , C. , Steiner , T. J. , & de Belleroche , J. ( 2010 ). Vesicle associated membrane protein B (VAPB) is decreased in ALS spinal cord . Neurobiol Aging , 31 ( 6 ), 969 – 985 . doi: 10.1016/j.neurobiolaging.2008.07.005 OpenUrl CrossRef PubMed Web of Science ↵ Annesley , S. J. , & Fisher , P. R . ( 2021 ). Lymphoblastoid Cell Lines as Models to Study Mitochondrial Function in Neurological Disorders . Int J Mol Sci , 22 ( 9 ). doi: 10.3390/ijms22094536 OpenUrl CrossRef ↵ Arthur , K. C. , Calvo , A. , Price , T. R. , Geiger , J. T. , Chiò , A. , & Traynor , B. J . ( 2016 ). Projected increase in amyotrophic lateral sclerosis from 2015 to 2040 . Nat Commun , 7 , 12408 . doi: 10.1038/ncomms12408 OpenUrl CrossRef PubMed ↵ Assoum , M. , Salih , M. A. , Drouot , N. , Hnia , K. , Martelli , A. , & Koenig , M . ( 2013 ). The Salih ataxia mutation impairs Rubicon endosomal localization . Cerebellum , 12 ( 6 ), 835 – 840 . doi: 10.1007/s12311-013-0489-4 OpenUrl CrossRef PubMed ↵ Barton , A. R. , Sherman , M. A. , Mukamel , R. E. , & Loh , P. R . ( 2021 ). Whole-exome imputation within UK Biobank powers rare coding variant association and fine-mapping analyses . Nat Genet , 53 ( 8 ), 1260 – 1269 . doi: 10.1038/s41588-021-00892-1 OpenUrl CrossRef PubMed ↵ Beltran , S. , Nassif , M. , Vicencio , E. , Arcos , J. , Labrador , L. , Cortes , B. I. , … Woehlbier , U. ( 2019 ). Network approach identifies Pacer as an autophagy protein involved in ALS pathogenesis . Mol Neurodegener , 14 ( 1 ), 14 . doi: 10.1186/s13024-019-0313-9 OpenUrl CrossRef ↵ Berglund , R. , & Guerreiro-Cacais , A. O . ( 2020 ). Microglial autophagy-associated phagocytosis is essential for recovery from neuroinflammation . 5 ( 52 ). doi: 10.1126/sciimmunol.abb5077 OpenUrl Abstract / FREE Full Text ↵ Bouchet , B. P. , Gough , R. E. , Ammon , Y. C. , van de Willige , D. , Post , H. , Jacquemet , G. , … Akhmanova , A. ( 2016 ). Talin-KANK1 interaction controls the recruitment of cortical microtubule stabilizing complexes to focal adhesions . Elife , 5 . doi: 10.7554/eLife.18124 OpenUrl CrossRef PubMed ↵ Brooks , B. R . ( 1994 ). El Escorial World Federation of Neurology criteria for the diagnosis of amyotrophic lateral sclerosis. Subcommittee on Motor Neuron Diseases/Amyotrophic Lateral Sclerosis of the World Federation of Neurology Research Group on Neuromuscular Diseases and the El Escorial “Clinical limits of amyotrophic lateral sclerosis” workshop contributors . J Neurol Sci , 124 Suppl , 96 – 107 . doi: 10.1016/0022-510x(94)90191-0 OpenUrl CrossRef PubMed Web of Science ↵ Brooks , B. R. , Miller , R. G. , Swash , M. , & Munsat , T. L . ( 2000 ). El Escorial revisited: revised criteria for the diagnosis of amyotrophic lateral sclerosis . Amyotroph Lateral Scler Other Motor Neuron Disord , 1 ( 5 ), 293 – 299 . doi: 10.1080/146608200300079536 OpenUrl CrossRef PubMed Web of Science ↵ Brown , R. H. , & Al-Chalabi , A . ( 2017 ). Amyotrophic Lateral Sclerosis . N Engl J Med , 377 ( 2 ), 162 – 172 . doi: 10.1056/NEJMra1603471 OpenUrl CrossRef PubMed ↵ Cady , J. , Allred , P. , Bali , T. , Pestronk , A. , Goate , A. , Miller , T. M. , … Baloh , R. H. ( 2015 ). Amyotrophic lateral sclerosis onset is influenced by the burden of rare variants in known amyotrophic lateral sclerosis genes . Ann Neurol , 77 ( 1 ), 100 – 113 . doi: 10.1002/ana.24306 OpenUrl CrossRef PubMed ↵ Cirulli , E. T. , Lasseigne , B. N. , Petrovski , S. , Sapp , P. C. , Dion , P. A. , Leblond , C. S. , … Goldstein , D. B. ( 2015 ). Exome sequencing in amyotrophic lateral sclerosis identifies risk genes and pathways . Science , 347 ( 6229 ), 1436 – 1441 . doi: 10.1126/science.aaa3650 OpenUrl Abstract / FREE Full Text ↵ Cox , L. E. , Ferraiuolo , L. , Goodall , E. F. , Heath , P. R. , Higginbottom , A. , Mortiboys , H. , … Shaw , P. J. ( 2010 ). Mutations in CHMP2B in lower motor neuron predominant amyotrophic lateral sclerosis (ALS) . PLoS One , 5 ( 3 ), e9872 . doi: 10.1371/journal.pone.0009872 OpenUrl CrossRef PubMed ↵ Fadista , J. , Manning , A. K. , Florez , J. C. , & Groop , L . ( 2016 ). The (in)famous GWAS P-value threshold revisited and updated for low-frequency variants . Eur J Hum Genet , 24 ( 8 ), 1202 – 1205 . doi: 10.1038/ejhg.2015.269 OpenUrl CrossRef PubMed ↵ Farg , M. A. , Sundaramoorthy , V. , Sultana , J. M. , Yang , S. , Atkinson , R. A. , Levina , V. , … Atkin , J. D. ( 2014 ). C9ORF72, implicated in amytrophic lateral sclerosis and frontotemporal dementia, regulates endosomal trafficking . Hum Mol Genet , 23 ( 13 ), 3579 – 3595 . doi: 10.1093/hmg/ddu068 OpenUrl CrossRef PubMed Web of Science ↵ Farhan , S. M. K. , & Howrigan , D. P . ( 2019 ). Exome sequencing in amyotrophic lateral sclerosis implicates a novel gene, DNAJC7, encoding a heat-shock protein . Nat Neurosci , 22 ( 12 ), 1966 – 1974 . doi: 10.1038/s41593-019-0530-0 OpenUrl CrossRef PubMed ↵ Gee , H. Y. , Zhang , F. , Ashraf , S. , Kohl , S. , Sadowski , C. E. , Vega-Warner , V. , … Hildebrandt , F. ( 2015 ). KANK deficiency leads to podocyte dysfunction and nephrotic syndrome . The Journal of Clinical Investigation , 125 ( 6 ), 2375 – 2384 . doi: 10.1172/JCI79504 OpenUrl CrossRef PubMed ↵ Heckmann , B. L. , Teubner , B. J. W. , Tummers , B. , Boada-Romero , E. , Harris , L. , Yang , M. , … Green , D. R. ( 2019 ). LC3-Associated Endocytosis Facilitates β-Amyloid Clearance and Mitigates Neurodegeneration in Murine Alzheimer’s Disease . Cell , 178 ( 3 ), 536 – 551 .e514. doi: 10.1016/j.cell.2019.05.056 OpenUrl CrossRef PubMed ↵ Kang , H. M. , Sul , J. H. , Service , S. K. , Zaitlen , N. A. , Kong , S. Y. , Freimer , N. B. , … Eskin , E. ( 2010 ). Variance component model to account for sample structure in genome-wide association studies . Nat Genet , 42 ( 4 ), 348 – 354 . doi: 10.1038/ng.548 OpenUrl CrossRef PubMed Web of Science ↵ Karczewski , K. J. , Francioli , L. C. , Tiao , G. , Cummings , B. B. , Alföldi , J. , Wang , Q. , … MacArthur , D. G. ( 2020 ). The mutational constraint spectrum quantified from variation in 141,456 humans . Nature , 581 ( 7809 ), 434 – 443 . doi: 10.1038/s41586-020-2308-7 OpenUrl CrossRef PubMed ↵ Kenna , K. P. , van Doormaal , P. T. , Dekker , A. M. , Ticozzi , N. , Kenna , B. J. , Diekstra , F. P. , … Sproviero , W. ( 2016 ). NEK1 variants confer susceptibility to amyotrophic lateral sclerosis . 48 (9), 1037 – 1042 . doi: 10.1038/ng.3626 OpenUrl CrossRef PubMed ↵ Lin , M. G. , & Zhong , Q . ( 2011 ). Interaction between small GTPase Rab7 and PI3KC3 links autophagy and endocytosis: A new Rab7 effector protein sheds light on membrane trafficking pathways . Small GTPases , 2 ( 2 ), 85 – 88 . doi: 10.4161/sgtp.2.2.15256 OpenUrl CrossRef PubMed ↵ Martinez , J. , Malireddi , R. K. , Lu , Q. , Cunha , L. D. , Pelletier , S. , Gingras , S. , … Green , D. R. ( 2015 ). Molecular characterization of LC3-associated phagocytosis reveals distinct roles for Rubicon, NOX2 and autophagy proteins . Nat Cell Biol , 17 ( 7 ), 893 – 906 . doi: 10.1038/ncb3192 OpenUrl CrossRef PubMed ↵ Matsunaga , K. , Saitoh , T. , Tabata , K. , Omori , H. , Satoh , T. , Kurotori , N. , … Yoshimori , T. ( 2009 ). Two Beclin 1-binding proteins, Atg14L and Rubicon, reciprocally regulate autophagy at different stages . Nat Cell Biol , 11 ( 4 ), 385 – 396 . doi: 10.1038/ncb1846 OpenUrl CrossRef PubMed Web of Science ↵ Montibeller , L. , & de Belleroche , J. ( 2018 ). Amyotrophic lateral sclerosis (ALS) and Alzheimer’s disease (AD) are characterised by differential activation of ER stress pathways : focus on UPR target genes . 23 ( 5 ), 897 – 912 . doi: 10.1007/s12192-018-0897-y OpenUrl CrossRef PubMed ↵ Morgan , S. , Shatunov , A. , Sproviero , W. , Jones , A. R. , Shoai , M. , Hughes , D. , … Al-Chalabi , A. ( 2017 ). A comprehensive analysis of rare genetic variation in amyotrophic lateral sclerosis in the UK . Brain , 140 ( 6 ), 1611 – 1618 . doi: 10.1093/brain/awx082 OpenUrl CrossRef PubMed ↵ Nguyen , H. P. , Van Broeckhoven , C. , & van der Zee , J. ( 2018 ). ALS Genes in the Genomic Era and their Implications for FTD . Trends Genet , 34 ( 6 ), 404 – 423 . doi: 10.1016/j.tig.2018.03.001 OpenUrl CrossRef PubMed ↵ Paul , P. , Murphy , T. , Oseni , Z. , Sivalokanathan , S. , & de Belleroche , J. S. ( 2014 ). Pathogenic effects of amyotrophic lateral sclerosis-linked mutation in D-amino acid oxidase are mediated by D-serine . Neurobiol Aging , 35 ( 4 ), 876 – 885 . doi: 10.1016/j.neurobiolaging.2013.09.005 OpenUrl CrossRef PubMed ↵ Povysil , G. , Petrovski , S. , Hostyk , J. , Aggarwal , V. , Allen , A. S. , & Goldstein , D. B . ( 2019 ). Rare-variant collapsing analyses for complex traits: guidelines and applications . Nat Rev Genet , 20 ( 12 ), 747 – 759 . doi: 10.1038/s41576-019-0177-4 OpenUrl CrossRef PubMed ↵ Rafiq , N. B. M. , Nishimura , Y. , Plotnikov , S. V. , Thiagarajan , V. , Zhang , Z. , Shi , S. , … Bershadsky , A. D. ( 2019 ). A mechano-signalling network linking microtubules, myosin IIA filaments and integrin-based adhesions . Nat Mater , 18 ( 6 ), 638 – 649 . doi: 10.1038/s41563-019-0371-y OpenUrl CrossRef PubMed ↵ Rentzsch , P. , Witten , D. , Cooper , G. M. , Shendure , J. , & Kircher , M . ( 2019 ). CADD: predicting the deleteriousness of variants throughout the human genome . Nucleic Acids Res , 47 ( D1 ), D886 – d894 . doi: 10.1093/nar/gky1016 OpenUrl CrossRef PubMed ↵ Roy , B. C. , Kakinuma , N. , & Kiyama , R . ( 2009 ). Kank attenuates actin remodeling by preventing interaction between IRSp53 and Rac1 . The Journal of Cell Biology , 184 ( 2 ), 253 – 267 . doi: 10.1083/jcb.200805147 OpenUrl Abstract / FREE Full Text ↵ Smith , B. N. , Ticozzi , N. , Fallini , C. , Gkazi , A. S. , Topp , S. , Kenna , K. P. , … Landers , J. E. ( 2014 ). Exome-wide rare variant analysis identifies TUBA4A mutations associated with familial ALS . Neuron , 84 ( 2 ), 324 – 331 . doi: 10.1016/j.neuron.2014.09.027 OpenUrl CrossRef PubMed Web of Science ↵ Sorce , S. , Stocker , R. , Seredenina , T. , Holmdahl , R. , Aguzzi , A. , Chio , A. , Jaquet , V . ( 2017 ). NADPH oxidases as drug targets and biomarkers in neurodegenerative diseases: What is the evidence? Free Radic Biol Med , 112 , 387 – 396 . doi: 10.1016/j.freeradbiomed.2017.08.006 OpenUrl CrossRef PubMed ↵ Sun , Q. , Westphal , W. , Wong , K. N. , Tan , I. , & Zhong , Q . ( 2010 ). Rubicon controls endosome maturation as a Rab7 effector . Proc Natl Acad Sci U S A , 107 ( 45 ), 19338 – 19343 . doi: 10.1073/pnas.1010554107 OpenUrl Abstract / FREE Full Text ↵ Sun , S. Y. , Nie , L. , Zhang , J. , Fang , X. , Luo , H. , Fu , C. , Tang , A. H . ( 2025 ). The interaction between KIF21A and KANK1 regulates dendritic morphology and synapse plasticity in neurons . Neural Regen Res , 20 ( 1 ), 209 – 223 . doi: 10.4103/1673-5374.391301 OpenUrl CrossRef PubMed ↵ van der Spek , R. A. A. , van Rheenen , W. , Pulit , S. L. , Kenna , K. P. , van den Berg , L. H. , & Veldink , J. H. ( 2019 ). The project MinE databrowser: bringing large-scale whole-genome sequencing in ALS to researchers and the public . Amyotrophic Lateral Sclerosis and Frontotemporal Degeneration , 20 ( 5-6 ), 432 – 440 . doi: 10.1080/21678421.2019.1606244 OpenUrl CrossRef PubMed ↵ van der Vaart , B. , van Riel , W. E. , Doodhi , H. , Kevenaar , J. T. , Katrukha , E. A. , Gumy , L. , … Akhmanova , A. ( 2013 ). CFEOM1-associated kinesin KIF21A is a cortical microtubule growth inhibitor . Dev Cell , 27 ( 2 ), 145 – 160 . doi: 10.1016/j.devcel.2013.09.010 OpenUrl CrossRef PubMed Web of Science ↵ Wang , H. , Guan , L. , & Deng , M . ( 2023 ). Recent progress of the genetics of amyotrophic lateral sclerosis and challenges of gene therapy . Front Neurosci , 17 , 1170996 . doi: 10.3389/fnins.2023.1170996 OpenUrl CrossRef PubMed ↵ Weng , Z. , Shang , Y. , Yao , D. , Zhu , J. , & Zhang , R . ( 2018 ). Structural analyses of key features in the KANK1·KIF21A complex yield mechanistic insights into the cross-talk between microtubules and the cell cortex . Journal of Biological Chemistry , 293 ( 1 ), 215 – 225 . doi: 10.1074/jbc.M117.816017 OpenUrl Abstract / FREE Full Text ↵ Williams , K. L. , Topp , S. , Yang , S. , Smith , B. , Fifita , J. A. , Warraich , S. T. , … Blair , I. P. ( 2016 ). CCNF mutations in amyotrophic lateral sclerosis and frontotemporal dementia . Nat Commun , 7 , 11253 . doi: 10.1038/ncomms11253 OpenUrl CrossRef PubMed ↵ Wong , S. W. , Sil , P. , & Martinez , J . ( 2018 ). Rubicon: LC3-associated phagocytosis and beyond . Febs j , 285 ( 8 ), 1379 – 1388 . doi: 10.1111/febs.14354 OpenUrl CrossRef PubMed ↵ Woollacott , I. O. , & Mead , S . ( 2014 ). The C9ORF72 expansion mutation: gene structure, phenotypic and diagnostic issues . Acta Neuropathol , 127 ( 3 ), 319 – 332 . doi: 10.1007/s00401-014-1253-7 OpenUrl CrossRef PubMed ↵ Wu , M. C. , Lee , S. , Cai , T. , Li , Y. , Boehnke , M. , & Lin , X . ( 2011 ). Rare-variant association testing for sequencing data with the sequence kernel association test . Am J Hum Genet , 89 ( 1 ), 82 – 93 . doi: 10.1016/j.ajhg.2011.05.029 OpenUrl CrossRef PubMed Yang , C. S. , Lee , J. S. , Rodgers , M. , Min , C. K. , Lee , J. Y. , Kim , H. J. , … Jung , J. U. ( 2012 ). Autophagy protein Rubicon mediates phagocytic NADPH oxidase activation in response to microbial infection or TLR stimulation . Cell Host Microbe , 11 ( 3 ), 264 – 276 . doi: 10.1016/j.chom.2012.01.018 OpenUrl CrossRef PubMed Yang , C. S. , Rodgers , M. , Min , C. K. , Lee , J. S. , Kingeter , L. , Lee , J. Y. , … Jung , J. U. ( 2012 ). The autophagy regulator Rubicon is a feedback inhibitor of CARD9-mediated host innate immunity . Cell Host Microbe , 11 ( 3 ), 277 – 289 . doi: 10.1016/j.chom.2012.01.019 OpenUrl CrossRef PubMed ↵ Zhang , S. , Cooper-Knock , J. , Weimer , A. K. , Shi , M. , Moll , T. , Marshall , J. N. G. , … Snyder , M. P. ( 2022 ). Genome-wide identification of the genetic basis of amyotrophic lateral sclerosis . Neuron , 110 ( 6 ), 992 – 1008 .e1011. doi: 10.1016/j.neuron.2021.12.019 OpenUrl CrossRef PubMed ↵ Zhao , Z. , Bi , W. , Zhou , W. , VandeHaar , P. , Fritsche , L. G. , & Lee , S . ( 2020 ). UK Biobank Whole-Exome Sequence Binary Phenome Analysis with Robust Region-Based Rare-Variant Test . Am J Hum Genet , 106 ( 1 ), 3 – 12 . doi: 10.1016/j.ajhg.2019.11.012 OpenUrl CrossRef PubMed ↵ Zhong , Y. , Wang , Q. J. , Li , X. , Yan , Y. , Backer , J. M. , Chait , B. T. , … Yue , Z. ( 2009 ). Distinct regulation of autophagic activity by Atg14L and Rubicon associated with Beclin 1-phosphatidylinositol-3-kinase complex . Nat Cell Biol , 11 ( 4 ), 468 – 476 . doi: 10.1038/ncb1854 OpenUrl CrossRef PubMed Web of Science ↵ Ziff , O. J. , Clarke , B. E. , Taha , D. M. , Crerar , H. , Luscombe , N. M. , & Patani , R . ( 2022 ). Meta-analysis of human and mouse ALS astrocytes reveals multi-omic signatures of inflammatory reactive states . Genome Res , 32 ( 1 ), 71 – 84 . doi: 10.1101/gr.275939.121 OpenUrl Abstract / FREE Full Text View the discussion thread. Back to top Previous Next Posted July 23, 2025. Download PDF Supplementary Material Data/Code Email Thank you for your interest in spreading the word about medRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Identification of co-segregating RUBCN and KANK1 mutations in a UK ALS kindred Message Subject (Your Name) has forwarded a page to you from medRxiv Message Body (Your Name) thought you would like to see this page from the medRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Identification of co-segregating RUBCN and KANK1 mutations in a UK ALS kindred Midhat Salman , Intan Bakhtiar , Alex Morris , Alexandra Rother , Simon Topp , Christopher Shaw , Bradley Smith , Jacqueline de Belleroche medRxiv 2025.07.23.25331426; doi: https://doi.org/10.1101/2025.07.23.25331426 Share This Article: Copy Citation Tools Identification of co-segregating RUBCN and KANK1 mutations in a UK ALS kindred Midhat Salman , Intan Bakhtiar , Alex Morris , Alexandra Rother , Simon Topp , Christopher Shaw , Bradley Smith , Jacqueline de Belleroche medRxiv 2025.07.23.25331426; doi: https://doi.org/10.1101/2025.07.23.25331426 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Genetic and Genomic Medicine Subject Areas All Articles Addiction Medicine (568) Allergy and Immunology (863) Anesthesia (299) Cardiovascular Medicine (4425) Dentistry and Oral Medicine (443) Dermatology (382) Emergency Medicine (607) Endocrinology (including Diabetes Mellitus and Metabolic Disease) (1507) Epidemiology (15221) Forensic Medicine (30) Gastroenterology (1123) Genetic and Genomic Medicine (6588) Geriatric Medicine (667) Health Economics (997) Health Informatics (4524) Health Policy (1368) Health Systems and Quality Improvement (1612) Hematology (540) HIV/AIDS (1264) Infectious Diseases (except HIV/AIDS) (15910) Intensive Care and Critical Care Medicine (1103) Medical Education (623) Medical Ethics (145) Nephrology (667) Neurology (6588) Nursing (346) Nutrition (998) Obstetrics and Gynecology (1143) Occupational and Environmental Health (956) Oncology (3331) Ophthalmology (970) Orthopedics (369) Otolaryngology (420) Pain Medicine (435) Palliative Medicine (129) Pathology (663) Pediatrics (1690) Pharmacology and Therapeutics (691) Primary Care Research (710) Psychiatry and Clinical Psychology (5440) Public and Global Health (9219) Radiology and Imaging (2195) Rehabilitation Medicine and Physical Therapy (1369) Respiratory Medicine (1196) Rheumatology (593) Sexual and Reproductive Health (710) Sports Medicine (529) Surgery (710) Toxicology (99) Transplantation (289) Urology (265) (function(){function c(){var b=a.contentDocument||a.contentWindow.document;if(b){var d=b.createElement('script');d.innerHTML="window.__CF$cv$params={r:'9ffb78498ac64193',t:'MTc3OTQ0OTIyNw=='};var a=document.createElement('script');a.src='/cdn-cgi/challenge-platform/scripts/jsd/main.js';document.getElementsByTagName('head')[0].appendChild(a);";b.getElementsByTagName('head')[0].appendChild(d)}}if(document.body){var a=document.createElement('iframe');a.height=1;a.width=1;a.style.position='absolute';a.style.top=0;a.style.left=0;a.style.border='none';a.style.visibility='hidden';document.body.appendChild(a);if('loading'!==document.readyState)c();else if(window.addEventListener)document.addEventListener('DOMContentLoaded',c);else{var e=document.onreadystatechange||function(){};document.onreadystatechange=function(b){e(b);'loading'!==document.readyState&&(document.onreadystatechange=e,c())}}}})();

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00