Thymol improves ischemic brain injury by inhibiting microglia-mediated neuroinflammation

preprint OA: closed
Full text JSON View at publisher
Full text 124,273 characters · extracted from preprint-html · click to expand
Thymol improves ischemic brain injury by inhibiting microglia-mediated neuroinflammation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Thymol improves ischemic brain injury by inhibiting microglia-mediated neuroinflammation Chenchen Zhao, Liang Sun, Yuxin Zhang, Xin Shu, Yujie Hu, Zhi Zhang, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3836157/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 30 Jun, 2024 Read the published version in Brain Research Bulletin → Version 1 posted You are reading this latest preprint version Abstract Background Microglia-mediated inflammation is one of the key aggravating factors in the development of ischemic stroke. Therefore, ameliorating microglial over-activation is a potential therapeutic target for ischemic injury. Thymol is a monophenol isolated from plant essential oil, which has various beneficial biological activities including anti-inflammatory and antioxidant, and protective effects in many disease models. However, its effects on ischemic stroke or microglial inflammation have not been reported. Methods Rodent transient middle cerebral artery occlusion (tMCAO) model was established to simulate ischemic stroke. TTC, modified neurological function score (mNSS) and behavioral tests were used to assess the severity of neurological damage. Then immunofluorescence staining and cytoskeleton analysis were used to determine activation of microglia. Lipopolysaccharide (LPS) was utilized to induce the inflammatory response of primary microglia in vitro . Quantitative real-time polymerase chain reaction (qRT-PCR), western blot and enzyme-linked immunosorbent assay (ELISA) were performed to exam the expression of inflammatory cytokines. And western blot was used to investigate the mechanism of the anti-inflammatory effect of thymol. Results In this study, we found that thymol treatment could ameliorate post-stroke neurological impairment and reduce infarct volume by reducing microglial activation and pro-inflammatory response (IL-1β, IL-6 and TNF-α). Mechanically, thymol could inhibit the phosphorylation of phosphatidylinositol-3-kinase (PI3K), sink serine/threonine kinase (Akt) and mammalian target of rapamycin (mTOR), and suppress the activation of nuclear factor-κB (NF-κB). Conclusions Our study demonstrated that thymol could reduce the microglial inflammation by targeting PI3K/Akt/mTOR/NF-κB signaling pathway, and further alleviate ischemic brain injury, suggesting that thymol is a promising candidate as a neuroprotective agent against ischemic stroke. thymol ischemic stroke microglia neuroinflammation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1 Background Ischemic stroke, with high prevalence, recurrence, is a major cause of disability and mortality [ 1 ]. However, thrombolytic therapy which is commonly used for clinical treatment has a high risk and benefits a small population [ 2 ]. Therefore, a safe and effective drug for ischemic stroke, especially in the early stage, is urgently needed. Microglia-mediated neuroinflammation plays an essential role in pathophysiology of ischemic stroke [ 3 , 4 ]. As the resident immune cells in the central nervous system (CNS), microglia can be rapidly activated after the onset of brain injury [ 5 ]. Meanwhile, microglial pro-inflammatory cytokines such as tumor necrosis factor-alpha (TNF-α), interleukin-1 beta (IL-1β), and interleukin-6 (IL-6), would cause inflammatory cascade, and further exacerbating secondary brain injury [ 6 – 8 ]. Therefore, inhibiting microglia-mediated inflammation is an increasingly attractive therapeutic target for ischemic stroke [ 9 – 11 ]. Thymol, chemically known as 2-isopropyl-5-methylphenol, has a molecular weight of 150.22. It is one of the major constituents of the essential oils isolated from Labiatae , Verbenaceae , Genicaceae , Buttercup , Umbelliferae and other plants [ 12 ]. Thymol is a monoterpene phenol with various biological activities including antioxidant, gastroprotection, antimicrobial and anti-tumor [ 13 – 16 ]. Recently, researches have also described that thymol can alleviate bronchitis, myocardial injury and liver toxicity by inhibiting inflammation [ 17 – 19 ]. Meanwhile, thymol has been found to be protective in multiple neurological disease models, such as Alzheimer's disease, epilepsy, depression and anxiety [20] . However, its effect on ischemic stroke has not been clarified. In this study, transient middle cerebral artery occlusion (tMCAO) was established to validate the modulatory effect of thymol on the post-stroke injury [ 21 – 23 ]. Moreover, toll-like receptor 4 (TLR4)/ nuclear factor kappa-B (NF-κB) pathway would be upregulated in microglia after the onset of ischemic stroke [ 24 ]. Therefore, lipopolysaccharide (LPS), an agonist of TLR4, was used to stimulate microglia-mediated neuroinflammation in vitro experiment. 2 Methods 2.1 Reagents Thymol (Thy, purity: 99.90%) and SC79, purchased from the Med Chem Express (MCE, China), was dissolved in dimethyl sulfoxide (DMSO, Biosharp Life Science, China). LPS (Escherichia coli 055: B5) was purchased from the Aladdin Biochemical Technology (China). The primary antibodies of phosphatidylinositol-3-kinase (PI3K, 4257S), phosphorylated PI3K (p-PI3K, 4228S), sink serine/threonine kinase (Akt, 4685S), phosphorylated Akt (p-Akt, 4060S), mammalian target of rapamycin (mTOR, 2972S), phosphorylated mTOR (p-mTOR, 2971S), NF-κB (p65, 8242S), phosphorylated NF-κB (p-p65, 3033S) and phosphorylated inhibitor of NF-κB (p-IκB, 2859S) were purchased from Cell Signaling Technology (CST, USA). And primary antibodies for glyceraldehyde-3-phosphate dehydrogenase (GAPDH, AP0066), inhibitor of NF-κB (IκB, BS3601) and cytochrome oxidase subunit 2 (COX2, BS1076) and ELISA kits for IL-1β (CEK1788), IL-6 (CEK1785) and TNF-α (CEK1783) were obtained from Bioworld Technology (USA). Inducible nitric oxide synthase (iNOS, 610328) from BD Bioscience (USA), TNF-α (ab1793), ionized calcium-binding adaptor molecule 1 (Iba1, ab5076), and cluster of differentiation 68 (CD68, ab53444) from Abcam (United Kingdom), and the primary antibody for IL-1β (AB-401-NA) from Bio-Techne (China). The PCR primers were obtained from Tsingke Biotech (China). Cell Counting Kit-8 (CCK8) was purchased from Dojindo Laboratories (Japan). 2.2 Animals Animals used in this experiment, purchased from Hangzhou Ziyuan Experimental Animal Technology Co (China), were 2-month-old SPF-grade C57BL/6J male mice, weighing about 22 g-24 g, and were kept in SPF-grade animal laboratories with appropriate temperature (20℃-26℃) and light duration (12 hours), adequate food and water. 2.3 tMCAO and thymol treatment Mice were numbered numerically on their ears in advance and randomly divided into sham-operated (SHAM), control tMCAO (CON) and thymol-treated tMCAO (Thy) groups. The tMCAO was prepared as previously established [ 25 ]. Briefly, after anesthetized with 2.5% Avertin (Sigma-Aldrich, USA; 100 µl/10 g, ip), the mouse was inserted with a silicone wire bolt (Doccol, USA) into the initiation site of the middle cerebral artery. After approximately 60 minutes, the bolt was removed for blood reperfusion. The SHAM group was treated as the tMCAO group but not inserted with the wire bolt. The CON and Thy groups were treated with control solution and thymol solution at 4.5 hours, 24 hours, and 48 hours after reperfusion. Considering the therapeutic doses of thymol is mostly set at 20 and 40 mg/kg in other studies and the anti-inflammatory effect is better at 40 mg/kg [ 26 – 28 ], the dose for our experiment was set at 40 mg/kg. 2.4 Neurological and motor function assess All tests followed the double-blind trial. The following tests were performed to assess the effects of thymol treatment on neurological damage and motor function at the third day after tMCAO. 2.4.1 Rotating rod test Mice were trained on the rotating rod device (RWD Life Sciences, China) twice a day for three days prior to tMCAO modeling. During training, the speed of the rotating rod was set to 20 rpm, 30 rpm, and 40 rpm, and the training lasted for 5 minutes at each speed. During the test, the mice were placed on the rotating rod which was set to 40 rpm for 5 minutes. The latency of fall was recorded. If the mouse did not fall, the time was recorded as 300 s. 2.4.2 Foot fault test The mice were also trained twice a day for three days before tMCAO. The mice were placed on a wire mesh grid and acclimated to walk on the grid for 5 minutes each training session. During the test session, the movement of each mouse on the grid was recorded, and the results were expressed as a percentage of the fault steps within total 50 steps. 2.4.3 Grip Strength The mouse was lifted by the tail so that its two front paws simultaneously grasped the crossbar of the monitoring device (GS3, Bioseb, France). The strength value of two front paws was recorded when its tail was pulled backward, and the maximal value among triple tests was recorded. The hind limbs should be avoided to touch the crossbar during this test. 2.4.4 mNSS scores The Modified Neurological Severity Score (mNSS) was used to assess the degree of neurological impairment at 3 days after tMCAO. The scores range from 0 to 12, and higher scores indicating more severe neurological deficiencies. 2.5 TTC and cerebral infarct volume measurement After 3 days of tMCAO, the mice were anesthetized with 2.5% Avertin. Their intact brains were removed and cut into 2-mm-thick slices and then soaked in the 2% TTC (2,3,5-Triphenyltetrazolium chloride, Sigma-Aldrich) solution. The white part was the infarct area, while the pink part was the ischemic penumbra. The brain sections were arranged neatly, photographed and then analyzed by using ImageJ software (the National Institutes of Health, USA, version 1.8.0_112). The results were presented as percentage: infarct size = (volume of the contralateral side - volume of no infarct on ipsilateral side) / (2 × volume of the contralateral side) × 100%. 2.6 Cell Culture and treatment Primary microglia were obtained from neonatal C57BL/6J mice [ 29 , 30 ] and cultured in DMEM medium (Bio-Channel, China) containing 10% fetal bovine serum (FBS, Gibco, USA) and 1% antibiotics (100 U/ml penicillin and 100 µg/ml streptomycin, Gibco) for 10–12 days, until a sufficient number of microglia were visible under the microscope. Then the culture flasks were shaken and the microglia were collected, re-cultured in the dishes and incubated at 37°C in a humidified incubator (Thermo, USA) containing 5% CO 2 for subsequent experiments. Primary microglia were divided into control (CON) group, LPS-treated (LPS) group, and LPS and thymol co-treatment (LPS + Thy) group. The dose of LPS was 100 ng/ml, and for the LPS + Thy group, thymol pretreated 1 hour. 2.7 CCK8 cell viability assay The primary microglia were re-cultured uniformly in 96-well plates, and treated with different concentrations of thymol (100 nM-1 mM). The CON group was treated with an equal volume of DMSO. The cells were incubated for 24 hours and then changed with medium with 10% CCK8. After 2 hours incubation, the optical density (OD) of each well was measured at 450 nm with microplate reader (TECAN-Spark, Switzerland). The cell viability ratio was presented as: (OD of the treated group — mean OD of the blank group) / (mean OD of the control group — mean OD of the blank group). 2.8 Total mRNA isolation and qRT-PCR The samples were obtained ischemic penumbra according to TTC staining in vivo , and the samples of primary microglia were collected after 3 hours LPS stimulation in vitro . The total mRNA of tissue and cell samples were extracted with Trizol reagent (Accurate Biology, China), and then cDNA was reverse transcribed by using a PrimeScript RT reagent kit (Vazyme Biotech, China). The qRT-PCR was performed on a Step One Plus PCR system (Applied Biosystems) with a SYBR green kit (Vazyme Biotech). Gene expression was quantified and normalized to Gapdh . The primer sequences are shown in Table 1 . Table 1 Primer sequences used in qRT-PCR Gene Forward Primer (5′ to 3′) Reverse Primer (5′ to 3′) Il1b AAGCCTCGTGCTGTCGGACC TGAGGCCCAAGGCCACAGG Il6 GACAAAGCCAGAGTCCTTCAGAGAG CTAGGTTTGCCGAGTAGATCTC Tnfa CCAAGGGACAAGGCTGCCCCG GCAGGGGCTCTTGACGGCAG Cox2 TGCTGGTGGAAAAACCTCGT AAAACCCACTTCGCCTCCAA Nos2 TCTAGTGAAGCAAAGCCCAACA GGCCTTGTGGTGAAGAGTGT Gapdh GCCAAGGCTGTGGGCAAGGT TCTCCAGGCGGCACGTCAGA 2.9 Western blot Total proteins from tissues of ischemic penumbra and primary microglia were extracted with RIPA lysis buffer (Keygen Biotech, China) containing 1% protease inhibitor (Keygen Biotech). The concentration of each sample was equalized by BCA Protein Assay Kit (Bioworld). The protein samples were separated by 10% SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis, Epizyme) and transferred to PVDF (polyvinylidene fluoride) membranes (Bio-Rad, USA). Primary antibodies were incubated overnight at 4°C and then incubated with the corresponding secondary antibodies (Bioworld) for 1.5 hours at room temperature. Protein bands on the membrane were visualized with enhanced chemiluminescence solution (Tanon, China) by Gel-Pro system (Tanon), and quantified with ImageJ. 2.10 ELISA After mice were anesthetized with Avertin, PBS buffer (phosphate buffered saline, Servicebio, China) was perfused through the left ventricle until the mouse liver turned gray, and then the infarcted side was prepared as a tissue homogenate. In addition, the supernatant of primary microglia treated with LPS for 24 hours was collected. Then the protein levels of inflammatory factors in the tissue samples and the cell supernatants were measured by IL-1β, IL-6 and TNF-α ELISA kits according to the manufacturer’s protocol. Finally, the OD were measured at 450 nm by using a microplate reader and the protein concentrations were analyzed according to standard curves. 2.11 Immunofluorescence staining After anesthetized with Avertin, mice were perfused with PBS and 4% paraformaldehyde (PFA). Then the intact brains were stripped and immersed in the tubes containing 4% PFA. After dehydration with 15% and 30% sucrose solutions, they were cut into 20 µm slices with a frozen sectioning machine (Thermo) and affixed to slides for immunofluorescence staining together with primary microglia treated with LPS for 1 hour. Primary microglia need to be treated with 4% PFA for 15 minutes, then brain slices and cells were ruptured in 0.25% Triton X-100 for 20 minutes. And next, incubating with 2% BSA (bovine serum albumin, BioFroxx, China) for 1.5 hours at room temperature. Lastly, primary antibodies were incubated overnight at 4°C. The next day, incubation with fluorescent secondary antibodies (Invitrogen) for 2 hours and then DAPI (Bioworld) for 20 minutes. The brain slices and cell samples were sealed with fluorescent anti-fade solution (Beyotime, China). The images were obtained by confocal laser scanning microscopy (Olympus, FV3000, Japan). The skeletonization and quantitative analysis of microglia were obtained by ImageJ [ 31 ]. 2.12 Statistical analysis The experimental data were all expressed as mean ± standard error of mean (mean ± SEM) and analyzed by GraphPad Prism 8.0.2 software (GraphPad Software, USA). The statistical significance of the differences between two groups was determined by t-test, and the statistical significance of the differences between three or more groups was determined by one-way ANOVA, followed by Bonferroni post hoc multiple comparisons. P ༜0.05 was considered statistically significant. 3 Results 3.1 Thymol reduced cerebral infarct volume and improved neurological impairment after cerebral ischemia We investigated the effect of thymol (Fig. 1 A) on ischemic stroke following the experimental procedure (Fig. 1 B). TTC staining showed that thymol administration significantly decreased the infarct volume compared with the CON group at 3 days after tMCAO (Fig. 1 C, D). In addition, a series of behavioral tests (mNSS, rotating rod, foot fault, grip strength) were used to assess neurological deficits. Thymol treatment could improve neurological function, lower mNSS score and foot-fault rate, prolong the latency of fall and strengthen grip strength (Fig. 1 E-H). All these results indicated that thymol treatment could attenuate ischemic brain injury and motor dysfunctions in tMCAO mice. 3.2 Thymol suppressed the inflammatory response in ischemic penumbra Microglia-mediated neuroinflammation could exacerbate post-stroke brain injury [ 7 , 32 ]. We firstly examined the mRNA expression of pro-inflammatory factors in ischemic penumbra at 3 days after tMCAO. The result showed that thymol significantly reduced the expression of Il1b , Il6 , Tnfα , Cox2 , and Nos2 (Fig. 2 A-C and Fig. S1 A, B). Next, we assessed the concentration of IL-1β, IL-6 and TNF-α in the infarcted hemisphere by ELISA (Fig. 2 D-F), and the protein levels of iNOS, COX-2, IL-1β and TNF-α by western blot (Fig. S1 C-G) (Fig. S1 C showed cropped blots and the full-length blots were presented in the Additional file). Those results showed that thymol treatment could significantly reduce the post-stroke inflammation. 3.3 Thymol inhibited over-activation and inflammatory reaction of microglia in ischemic penumbra Over-activated microglia are correlated with the excessive inflammatory response after cerebral ischemia [ 33 , 34 ]. Therefore, we investigated whether thymol could inhibit microglial inflammation after tMCAO by immunofluorescence staining. The mean fluorescence intensity (MFI) of TNF-α in microglia was significantly reduced after thymol treatment (Fig. 3 A, B). Then the activated microglia were labelled with Iba1 and CD68 [ 35 – 37 ] (Fig. 3 C). The mean size and MFI of Iba1, density and MFI of CD68 in microglia (Iba1 + cells) was all decreased in the Thy group (Fig. 3 D-G). Besides, we skeletonized microglia with ImageJ, and found the microglia in thymol-treated mice had higher number of endpoints and longer branch lengths than tMCAO-CON group (Fig. 3 H, I). All of those results suggested that thymol inhibited inflammation and activation of microglia in ischemic penumbra. 3.4 Thymol inhibited LPS-induced microglial inflammatory response To validate anti-inflammation effect of thymol on microglia, LPS stimulation was introduced to primary microglia in vitro . Based on the result of CCK8 assay, thymol showed no cytotoxicity below 500 µM (Fig. S2A). Considering the therapeutic dosage of thymol is mostly among 25 to 120 µM in other researches and thymol showed the best therapeutic efficiency at 100 uM [ 19 , 38 , 39 ], we set the concentration at 100 µM for our next in vitro experiments. Thymol treatment significantly reduced the mRNA expression of Il1b , Il6 , Tnfa , Cox2 and Nos2 after LPS stimulating (Fig. 4 A-C and Fig. S2B, C). Meanwhile, the protein levels of IL-1β, IL-6 and TNF-α in cell supernatants, measured by ELISA, were also significant reduced in the Thy group (Fig. 4 D-F). Our results showed that the mean size of microglia and MFI of Iba1 were increased after LPS stimulating, and reversed by thymol treatment (Fig. 4 G-I). Besides, thymol-treated microglia had more endpoints and longer branches (Fig. 4 J, K), indicating that thymol could suppress the activation of LPS-treated microglia. In this section, we confirmed that thymol could inhibit microglial activation and inflammatory effect in vitro . 3.5 Thymol inhibited microglia-mediated neuroinflammation by inhibiting NF-κB activation To investigate how thymol affect microglia-mediated neuroinflammation, we examined some classical pathways associated with inflammation. Firstly, we found that after LPS stimulation, thymol treatment did not affect the phosphorylation of signal transducer and activator of transcription 3 (STAT3), p38 mitogen activated protein kinase (p38 MAPK), and extracellular signal-regulated kinase (ERK) (Fig. S3A) (Fig. S3A showed cropped blots and the full-length blots were presented in the Additional file). However, thymol treatment significantly reduced the phosphorylation of IκB and NF-κB (p65) (Fig. 5 A, C, E). Then we obtained similar experimental results in ischemic penumbra at 3 days after tMCAO (Fig. 5 B, D, F) (Fig. 5 A, B showed cropped blots and the full-length blots were presented in the Additional file). Moreover, we performed immunofluorescence staining to observe the effect of thymol on p65 in primary microglia and tMCAO mice (Fig. 5 G, I). Thymol treatment could reduce the MFI of p65 in the nucleus of microglia (Fig. 5 H, J), which suggested that thymol could interfere the translocation of p65 from cytoplasm to nucleu. These data suggested that thymol could attenuate microglia-mediated neuroinflammation by inhibiting the NF-κB pathway. 3.6 Thymol suppressed microglial neuroinflammation by downregulating phosphorylation of PI3K/Akt/mTOR NF-κB signaling pathway is one of the downstream pathways of PI3K/Akt signaling pathway. The phosphorylation of PI3K, Akt and mTOR also decreased after thymol treatment in primary microglia and penumbra of tMCAO mice (Fig. 6 A-H) (Fig. 6 A, B showed cropped blots and the full-length blots were presented in the Additional file). Subsequently, primary microglia were treated with SC79, an agonist of Akt [ 40 , 41 ], to verify the relationship between anti-inflammatory effect of thymol and PI3K/Akt/mTOR pathway. We found that SC79 partially reversed the anti-inflammatory effect of thymol on microglia (Fig. 6 I-K), indicating that thymol could attenuate post-stroke inflammation by inhibiting the activation of PI3K/Akt/mTOR signaling pathway. 4 Discussion Microglia make up approximately 10%-15% of all neuroglia and are normally considered to be the resident macrophage-like innate immune cells of the CNS and the primary responders in a defense network covering the entire brain parenchyma [ 42 , 43 ]. Even in the un-activated state, microglia are highly mobile and they act like immune sentinels to maintain CNS homeostasis at all times, and this permanently motile state allows them to rapidly convert to an activated state in response to CNS changes [ 44 – 46 ]. After the onset of ischemic stroke, activated microglia have larger cytosol and shorter and fewer branches [ 31 ]. And thymol treatment reverses all these changes, suggesting that thymol has an inhibitory effect on microglia activation. Activated microglia release pro-inflammatory factors, thereby accelerate post-stroke brain injury [ 6 ]. In our study, thymol treatment resulted in a significant reduction in the production of pro-inflammatory factors (IL-1β, IL-6 and TNF-α) and an improvement in stroke injury. Therefore, we concluded that thymol ameliorated post-stroke brain injury by inhibiting the inflammatory response of microglia. NF-κB, well known for its regulation of inflammation and immunity, can be activated by stimulation of inflammatory receptors, such as TLR [ 47 ]. In the resting state, NF-κB subunit dimers are present in the cytoplasm bound by inhibitory proteins called NF-κB inhibitors (IκB). After activated, IκB is phosphorylated by IκB kinase (IKK) and its proteasome is labeled to degrade and release NF-κB subunit dimers. The released NF-κB subunit dimers further translocate to the nucleus, where they can bind to specific DNA promoter regions of various inflammatory genes (IL-1β, IL-6 and TNF-α) [ 48 , 49 ] to facilitate their transcription [ 50 , 51 ]. These inflammatory factors in turn further promote the activation of NF-κB [ 52 ]. In our experimental results, thymol exhibited an inhibitory effect on the phosphorylation of IκB, thus reducing the translocation of NF-κB to the nucleus and the subsequent release of NF-κB-induced inflammatory factors. Meanwhile, we found that the phosphorylation of PI3K, Akt and mTOR was significantly reduced under thymol treatment, suggesting that PI3K/Akt/mTOR signaling pathway is also involved in the neuroprotective effects of thymol. Akt, also known as protein kinase B (PKB), is the main downstream of PI3K [ 53 ], and mTOR is one of the downstream effectors of Akt. It has been reported that Akt and mTOR activates IKK, and subsequently promotes the phosphorylation of IκB, which in turn leads to NF-κB activation and entry into the nucleus [ 54 – 56 ]. That is, in regulating the inflammatory response, the NF-κB signaling pathway is also regulated to some extent by the PI3K/Akt/mTOR signaling pathway. To a certain extent, the NF-κB signaling pathway is regulated by the PI3K/Akt/mTOR signaling pathway. Therefore, we believe that the effect of thymol in attenuating ischemic brain injury may be achieved by modulating the cascade of PI3K/Akt/mTOR/NF-κB signaling pathway in microglia. Our results revealed for the first time that the anti-inflammatory effect of thymol in ischemic stroke and elucidate the underlying mechanisms. However, the small sample size is an undeniable shortcoming for our study. 5 Conclusions In our study, we demonstrated the neuroprotective effect of thymol on ischemic brain injury, by inhibiting the inflammatory response of over-activated microglia in the penumbra via PI3K/Akt/mTOR/NF-κB signaling pathway. Those findings revealed for the first time the neuroprotective effect of thymol in ischemic stroke and elucidate the mechanisms by which it works, and suggested that thymol is a potential therapeutic agent in the treatment of ischemic stroke. List Of Abbreviations tMCAO Transient middle cerebral artery occlusion LPS Lipopolysaccharide TTC 2,3,5-Triphenyltetrazolium chloride qRT-PCR Quantitative real-time polymerase chain reaction ELISA Enzyme-linked immunosorbent assay IL-1β Interleukin-1 beta IL-6 Interleukin-6 TNF-α Tumor necrosis factor-alpha COX2 Cytochrome oxidase subunit 2 iNOS Inducible nitric oxide synthase PI3K Phosphatidylinositol-3-kinase p-PI3K Phosphorylated phosphatidylinositol-3-kinase Akt Sink serine/threonine kinase p-Akt Phosphorylated sink serine/threonine kinase mTOR Mammalian target of rapamycin p-mTOR Phosphorylated mammalian target of rapamycin NF-κB (p65) Nuclear factor-κB p-NF-κB (p-p65) Phosphorylated nuclear factor-κB IκB Inhibitor of nuclear factor-κB p-IκB Phosphorylated inhibitor of nuclear factor-κB GAPDH Glyceraldehyde-3-phosphate dehydrogenase TLR4 Toll-like receptor 4 Iba1 Ionized calcium-binding adaptor molecule 1 CD68 Cluster of differentiation 68 CCK8 Cell Counting Kit-8 CNS Central nervous system DMSO Dimethyl sulfoxide CST Cell Signaling Technology FBS Fetal bovine serum SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel electrophoresis PVDF Polyvinylidene fluoride PBS buffer Phosphate buffered saline PFA Paraformaldehyde BSA Bovine serum albumin MIF Mean fluorescence intensity STAT3 Signal transducer and activator of transcription 3 p38 MAPK p38 mitogen activated protein kinase ERK Extracellular signal-regulated kinase IKK Inhibitor of nuclear factor-κB kinase PKB Protein kinase B Declarations Ethics approval and consent to participate The animal study was approved by the Experimental Animal Ethics Committee of Nanjing Drum Tower Hospital, the affiliated hospital of Nanjing University Medicine School (2023AE01015). Consent for publication Not applicable. Availability of data and materials All data generated or analysed during this study are included in this published article and its supplementary information files. All other data are available from the corresponding author upon reasonable request. Competing interests The authors declare that they have no competing interests. Funding This study was funded by the National Natural Science Foundation of China (82130036, 81920108017, 82071304), the STI2030-Major Projects-2022ZD0211800. Jiangsu Provincial Medical Key Discipline (ZDXK202216). Authors' Contributions Y.X. designed the study and critically reviewed manuscript. C.Z. and L.S. performed experiments, analyzed data and wrote the paper. Y.Z. and X.S. analyzed the data and prepared figures. Z.Z., Y.H. and J.L. helped to revise the paper. S.X., H.Y. and X.B. helped to perform the experiments. All authors read and approved the final manuscript. Acknowledgements The authors thank the financial support of the National Natural Science Foundation of China (82130036, 81920108017, 82071304), the STI2030-Major Projects-2022ZD0211800. Jiangsu Provincial Medical Key Discipline (ZDXK202216). References Campbell BCV, Khatri P, Stroke. Lancet. 2020;396(10244):129–42. Marugg JE, van den Bergh C, Tromp M, van der Marel GA, van Zoest WJ, van Boom JH. Synthesis of phosphorothioate-containing DNA fragments by a modified hydroxybenzotriazole phosphotriester approach. Nucleic Acids Res. 1984;12(23):9095–110. Han B, Jiang W, Cui P, Zheng K, Dang C, Wang J, et al. Microglial PGC-1alpha protects against ischemic brain injury by suppressing neuroinflammation. Genome Med. 2021;13(1):47. Chamorro A, Hallenbeck J. The harms and benefits of inflammatory and immune responses in vascular disease. Stroke. 2006;37(2):291–3. Xu S, Lu J, Shao A, Zhang JH, Zhang J. Glial Cells: Role of the Immune Response in Ischemic Stroke. Front Immunol. 2020;11:294. Qin C, Zhou LQ, Ma XT, Hu ZW, Yang S, Chen M, et al. Dual Functions of Microglia in Ischemic Stroke. Neurosci Bull. 2019;35(5):921–33. Yenari MA, Kauppinen TM, Swanson RA. Microglial activation in stroke: therapeutic targets. Neurotherapeutics. 2010;7(4):378–91. Amantea D, Nappi G, Bernardi G, Bagetta G, Corasaniti MT. Post-ischemic brain damage: pathophysiology and role of inflammatory mediators. FEBS J. 2009;276(1):13–26. Candelario-Jalil E, Dijkhuizen RM, Magnus T, Neuroinflammation. Stroke, Blood-Brain Barrier Dysfunction, and Imaging Modalities. Stroke. 2022;53(5):1473–86. Yenari MA, Xu L, Tang XN, Qiao Y, Giffard RG. Microglia potentiate damage to blood-brain barrier constituents: improvement by minocycline in vivo and in vitro. Stroke. 2006;37(4):1087–93. Var SR, Shetty AV, Grande AW, Low WC, Cheeran MC. Microglia and Macrophages in Neuroprotection, Neurogenesis, and Emerging Therapies for Stroke. Cells. 2021;10(12). Marchese A, Orhan IE, Daglia M, Barbieri R, Di Lorenzo A, Nabavi SF, et al. Antibacterial and antifungal activities of thymol: A brief review of the literature. Food Chem. 2016;210:402–14. Tsai ML, Lin CC, Lin WC, Yang CH. Antimicrobial, antioxidant, and anti-inflammatory activities of essential oils from five selected herbs. Biosci Biotechnol Biochem. 2011;75(10):1977–83. Chaieb K, Hajlaoui H, Zmantar T, Kahla-Nakbi AB, Rouabhia M, Mahdouani K, et al. The chemical composition and biological activity of clove essential oil, Eugenia caryophyllata (Syzigium aromaticum L. Myrtaceae): a short review. Phytother Res. 2007;21(6):501–6. Kachur K, Suntres Z. The antibacterial properties of phenolic isomers, carvacrol and thymol. Crit Rev Food Sci Nutr. 2020;60(18):3042–53. Sampaio LA, Pina LTS, Serafini MR, Tavares DDS, Guimaraes AG. Antitumor Effects of Carvacrol and Thymol: A Systematic Review. Front Pharmacol. 2021;12:702487. Zhou E, Fu Y, Wei Z, Yu Y, Zhang X, Yang Z. Thymol attenuates allergic airway inflammation in ovalbumin (OVA)-induced mouse asthma. Fitoterapia. 2014;96:131–7. El-Marasy SA, El Awdan SA, Hassan A, Abdallah HMI. Cardioprotective effect of thymol against adrenaline-induced myocardial injury in rats. Heliyon. 2020;6(7):e04431. Dou X, Yan D, Liu S, Gao L, Shan A. Thymol Alleviates LPS-Induced Liver Inflammation and Apoptosis by Inhibiting NLRP3 Inflammasome Activation and the AMPK-mTOR-Autophagy Pathway. Nutrients. 2022;14(14). Nagoor Meeran MF, Javed H, Al Taee H, Azimullah S, Ojha SK. Pharmacological Properties and Molecular Mechanisms of Thymol: Prospects for Its Therapeutic Potential and Pharmaceutical Development. Front Pharmacol. 2017;8:380. Knowland D, Arac A, Sekiguchi KJ, Hsu M, Lutz SE, Perrino J, et al. Stepwise recruitment of transcellular and paracellular pathways underlies blood-brain barrier breakdown in stroke. Neuron. 2014;82(3):603–17. Huang L, Wong S, Snyder EY, Hamblin MH, Lee JP. Human neural stem cells rapidly ameliorate symptomatic inflammation in early-stage ischemic-reperfusion cerebral injury. Stem Cell Res Ther. 2014;5(6):129. Sommer CJ. Ischemic stroke: experimental models and reality. Acta Neuropathol. 2017;133(2):245–61. Zhao SC, Ma LS, Chu ZH, Xu H, Wu WQ, Liu F. Regulation of microglial activation in stroke. Acta Pharmacol Sin. 2017;38(4):445–58. Pan J, Jin JL, Ge HM, Yin KL, Chen X, Han LJ, et al. Malibatol A regulates microglia M1/M2 polarization in experimental stroke in a PPARgamma-dependent manner. J Neuroinflammation. 2015;12:51. Saravanan S, Pari L. Role of thymol on hyperglycemia and hyperlipidemia in high fat diet-induced type 2 diabetic C57BL/6J mice. Eur J Pharmacol. 2015;761:279–87. Wang Q, Qi G, Zhou H, Cheng F, Yang X, Liu X, et al. Protective effect of thymol on glycerol-induced acute kidney injury. Ren Fail. 2023;45(1):2227728. FangFang, Li H, Qin T, Li M, Ma S. Thymol improves high-fat diet-induced cognitive deficits in mice via ameliorating brain insulin resistance and upregulating NRF2/HO-1 pathway. Metab Brain Dis. 2017;32(2):385–93. Giulian D, Baker TJ. Characterization of ameboid microglia isolated from developing mammalian brain. J Neurosci. 1986;6(8):2163–78. Lin L, Desai R, Wang X, Lo EH, Xing C. Characteristics of primary rat microglia isolated from mixed cultures using two different methods. J Neuroinflammation. 2017;14(1):101. Young K, Morrison H. Quantifying Microglia Morphology from Photomicrographs of Immunohistochemistry Prepared Tissue Using ImageJ. J Vis Exp. 2018(136). Plastira I, Bernhart E, Goeritzer M, Reicher H, Kumble VB, Kogelnik N, et al. 1-Oleyl-lysophosphatidic acid (LPA) promotes polarization of BV-2 and primary murine microglia towards an M1-like phenotype. J Neuroinflammation. 2016;13(1):205. Subedi L, Gaire BP. Phytochemicals as regulators of microglia/macrophages activation in cerebral ischemia. Pharmacol Res. 2021;165:105419. Zou X, Gao S, Li J, Li C, Wu C, Cao X, et al. A monoamine oxidase B inhibitor ethyl ferulate suppresses microglia-mediated neuroinflammation and alleviates ischemic brain injury. Front Pharmacol. 2022;13:1004215. Hu L, Si L, Dai X, Dong H, Ma Z, Sun Z, et al. Exosomal miR-409-3p secreted from activated mast cells promotes microglial migration, activation and neuroinflammation by targeting Nr4a2 to activate the NF-kappaB pathway. J Neuroinflammation. 2021;18(1):68. Chen ML, Hong CG, Yue T, Li HM, Duan R, Hu WB, et al. Inhibition of miR-331-3p and miR-9-5p ameliorates Alzheimer's disease by enhancing autophagy. Theranostics. 2021;11(5):2395–409. van den Bosch AMR, Hummert S, Steyer A, Ruhwedel T, Hamann J, Smolders J, et al. Ultrastructural Axon-Myelin Unit Alterations in Multiple Sclerosis Correlate with Inflammation. Ann Neurol. 2023;93(4):856–70. Palabiyik SS, Karakus E, Halici Z, Cadirci E, Bayir Y, Ayaz G, et al. The protective effects of carvacrol and thymol against paracetamol-induced toxicity on human hepatocellular carcinoma cell lines (HepG2). Hum Exp Toxicol. 2016;35(12):1252–63. Krishnan M, Kim DK, Gie Kim S, Kang SC. Thymol exposure mediates pro-oxidant shift by regulating Nrf2 and apoptotic events in zebrafish (Danio rerio) embryos. Environ Toxicol Pharmacol. 2019;65:1–8. Mehmood T, Pichyangkura R, Muanprasat C. Chitosan Oligosaccharide Promotes Junction Barrier through Modulation of PI3K/AKT and ERK Signaling Intricate Interplay in T84 Cells. Polym (Basel). 2023;15(7). Gu L, Xie C, Peng Q, Zhang J, Li J, Tang Z. Arecoline suppresses epithelial cell viability through the Akt/mTOR signaling pathway via upregulation of PHLPP2. Toxicology. 2019;419:32–9. Zhang Y, Xie Y, Cheng Z, Zhang Y, Wang W, Guo B, et al. Mechanism of action and therapeutic targeting of microglia in autism spectrum disorder. Adv Neurol. 2022;1(3):167. Nayak D, Roth TL, McGavern DB. Microglia development and function. Annu Rev Immunol. 2014;32:367–402. Chen Z, Trapp BD. Microglia and neuroprotection. J Neurochem. 2016;136(Suppl 1):10–7. Nimmerjahn A, Kirchhoff F, Helmchen F. Resting microglial cells are highly dynamic surveillants of brain parenchyma in vivo. Science. 2005;308(5726):1314–8. Prinz M, Jung S, Priller J. Microglia Biology: One Century of Evolving Concepts. Cell. 2019;179(2):292–311. Nennig SE, Schank JR. The Role of NFkB in Drug Addiction: Beyond Inflammation. Alcohol Alcohol. 2017;52(2):172–9. Hayden MS, Ghosh S. Signaling to NF-kappaB. Genes Dev. 2004;18(18):2195–224. Oeckinghaus A, Ghosh S. The NF-kappaB family of transcription factors and its regulation. Cold Spring Harb Perspect Biol. 2009;1(4):a000034. Woodruff TM, Thundyil J, Tang SC, Sobey CG, Taylor SM, Arumugam TV. Pathophysiology, treatment, and animal and cellular models of human ischemic stroke. Mol Neurodegener. 2011;6(1):11. Okun E, Griffioen KJ, Mattson MP. Toll-like receptor signaling in neural plasticity and disease. Trends Neurosci. 2011;34(5):269–81. Zinatizadeh MR, Schock B, Chalbatani GM, Zarandi PK, Jalali SA, Miri SR. The Nuclear Factor Kappa B (NF-kB) signaling in cancer development and immune diseases. Genes Dis. 2021;8(3):287–97. Liu Y, Deng S, Zhang Z, Gu Y, Xia S, Bao X, et al. 6-Gingerol attenuates microglia-mediated neuroinflammation and ischemic brain injuries through Akt-mTOR-STAT3 signaling pathway. Eur J Pharmacol. 2020;883:173294. Shi ZM, Han YW, Han XH, Zhang K, Chang YN, Hu ZM, et al. Upstream regulators and downstream effectors of NF-kappaB in Alzheimer's disease. J Neurol Sci. 2016;366:127–34. Alexaki VI, Fodelianaki G, Neuwirth A, Mund C, Kourgiantaki A, Ieronimaki E, et al. DHEA inhibits acute microglia-mediated inflammation through activation of the TrkA-Akt1/2-CREB-Jmjd3 pathway. Mol Psychiatry. 2018;23(6):1410–20. Torrealba N, Vera R, Fraile B, Martinez-Onsurbe P, Paniagua R, Royuela M. TGF-beta/PI3K/AKT/mTOR/NF-kB pathway. Clinicopathological features in prostate cancer. Aging Male. 2020;23(5):801–11. Additional Declarations No competing interests reported. Supplementary Files Additionalfile.docx Cite Share Download PDF Status: Published Journal Publication published 30 Jun, 2024 Read the published version in Brain Research Bulletin → Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3836157","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":266211089,"identity":"c0f128f9-146a-44cd-b549-4ad2014d30b4","order_by":0,"name":"Chenchen Zhao","email":"","orcid":"","institution":"Nanjing Drum Tower Hospital Clinical College of Traditional Chinese and Western Medicine, Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Chenchen","middleName":"","lastName":"Zhao","suffix":""},{"id":266211090,"identity":"c211fd23-ec36-453c-a5e0-b81a4e7dfe7a","order_by":1,"name":"Liang Sun","email":"","orcid":"","institution":"Nanjing Drum Tower Hospital Clinical College of Traditional Chinese and Western Medicine, Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Liang","middleName":"","lastName":"Sun","suffix":""},{"id":266211091,"identity":"8f20180e-3f99-44b5-98e7-e5c65c74310f","order_by":2,"name":"Yuxin Zhang","email":"","orcid":"","institution":"Nanjing Drum Tower Hospital Clinical College of Traditional Chinese and Western Medicine, Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Yuxin","middleName":"","lastName":"Zhang","suffix":""},{"id":266211092,"identity":"db70ae4c-5655-4a89-beea-922902f8810b","order_by":3,"name":"Xin Shu","email":"","orcid":"","institution":"Nanjing Drum Tower Hospital Clinical College of Traditional Chinese and Western Medicine, Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Xin","middleName":"","lastName":"Shu","suffix":""},{"id":266211093,"identity":"69c297d6-d46c-403e-bb8a-436f12fe8d02","order_by":4,"name":"Yujie Hu","email":"","orcid":"","institution":"Nanjing Drum Tower Hospital, Nanjing University","correspondingAuthor":false,"prefix":"","firstName":"Yujie","middleName":"","lastName":"Hu","suffix":""},{"id":266211094,"identity":"894e8d4a-c816-44b8-9091-088118878ddd","order_by":5,"name":"Zhi Zhang","email":"","orcid":"","institution":"Nanjing Drum Tower Hospital, Nanjing University","correspondingAuthor":false,"prefix":"","firstName":"Zhi","middleName":"","lastName":"Zhang","suffix":""},{"id":266211095,"identity":"3e683632-dd2f-465c-8fde-68694f1f34b2","order_by":6,"name":"Shengnan Xia","email":"","orcid":"","institution":"Nanjing Drum Tower Hospital, Nanjing University","correspondingAuthor":false,"prefix":"","firstName":"Shengnan","middleName":"","lastName":"Xia","suffix":""},{"id":266211096,"identity":"32ffe5e2-5fe4-4065-aa72-cabe81c422d3","order_by":7,"name":"Haiyan Yang","email":"","orcid":"","institution":"Nanjing Drum Tower Hospital, Nanjing University","correspondingAuthor":false,"prefix":"","firstName":"Haiyan","middleName":"","lastName":"Yang","suffix":""},{"id":266211097,"identity":"8c27c727-19d8-47a4-bff5-8a63b8c6922b","order_by":8,"name":"Xinyu Bao","email":"","orcid":"","institution":"Nanjing Drum Tower Hospital, Nanjing University","correspondingAuthor":false,"prefix":"","firstName":"Xinyu","middleName":"","lastName":"Bao","suffix":""},{"id":266211098,"identity":"7f8ec25c-8546-43ce-a089-11672696ba22","order_by":9,"name":"Jingwei Li","email":"","orcid":"","institution":"Nanjing Drum Tower Hospital Clinical College of Traditional Chinese and Western Medicine, Nanjing University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Jingwei","middleName":"","lastName":"Li","suffix":""},{"id":266211099,"identity":"697bda7f-7169-48f6-aad1-e8cbfd3c4a7f","order_by":10,"name":"Yun Xu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABB0lEQVRIiWNgGAWjYNCCCgkexvbGhgMJFQwybMRpOWMjx9xz+OCDB2cYeIjTwtiWZsw+Iy3Z8GEbAw9B1QY3csykC9gOJ/Y25JhJJM6z4+GTyDF7wFBjE41Li+QMoJYZPIcTZzacAWrZlszDJpFjbsBwLC23AYcWfqCZ0jwShxM3NvaAtDCDtJhJMDYcxqmFDazF4HDi/sM8QC1z6glrgdiSkGbM2MaWbJDYcJiwFsmeZ8XWPAds5Bh7mA8+SDh2nIeN51mZRAIevxgcT954m/cfMCrnP2w4+KOmWk6+PXmbxIcaG5xaGBg4DNAEBBIYGBJwKgcB9gfo3juAV/0oGAWjYBSMPAAA1SxVbZm635wAAAAASUVORK5CYII=","orcid":"","institution":"Nanjing Drum Tower Hospital Clinical College of Traditional Chinese and Western Medicine, Nanjing University of Chinese Medicine","correspondingAuthor":true,"prefix":"","firstName":"Yun","middleName":"","lastName":"Xu","suffix":""}],"badges":[],"createdAt":"2024-01-05 04:14:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3836157/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3836157/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1016/j.brainresbull.2024.111029","type":"published","date":"2024-07-01T00:18:13+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":49463783,"identity":"55339232-40ce-4035-8bca-5afef6cabfc9","added_by":"auto","created_at":"2024-01-11 09:05:11","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":66559,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThymol reduced cerebral infarct volume and improved neurological impairment after cerebral ischemia\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Chemical structural formula of thymol. (B) The procedure of animal experiments. (C) TTC staining of brain sections. (D) Cerebral infarct volume of TTC staining. (E) The result of mNSS score. (F) The result of foot fault test. (G) The result of grip strength. (H) The result of rotating rod test. The values were presented as mean ± SEM. *, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **,\u003cem\u003e P\u003c/em\u003e\u0026lt;0.01 and ***,\u003cem\u003e P\u003c/em\u003e\u0026lt;0.001 versus the CON group.\u003c/p\u003e","description":"","filename":"Figure11.png","url":"https://assets-eu.researchsquare.com/files/rs-3836157/v1/393921e44275b12114137c82.png"},{"id":49463784,"identity":"8dce4df2-fc14-4cbf-a40c-d3d43e2a3ba7","added_by":"auto","created_at":"2024-01-11 09:05:11","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":35320,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThymol suppressed the inflammatory response in ischemic penumbra\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A-C) Gene expression of pro-inflammatory cytokines in the penumbra region, normalised to \u003cem\u003eGapdh\u003c/em\u003e and expressed as a fold change, with the SHAM group taken from tissues in the corresponding regions. (A) \u003cem\u003eIl1b \u003c/em\u003emRNA expression. (B) \u003cem\u003eIl6 \u003c/em\u003emRNA expression. (C) \u003cem\u003eTnfa \u003c/em\u003emRNA expression. (D-F) The concentration of pro-inflammatory cytokines in the infarcted side hemisphere, and the SHAM group was taken the corresponding lateral cerebral hemisphere. (D) Concentration of IL-1β. (E) Concentration of IL-6. (F) Concentration of TNF-α. These values were expressed as the mean ± SEM. *, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **,\u003cem\u003e P\u003c/em\u003e\u0026lt;0.01 and ***,\u003cem\u003e P\u003c/em\u003e\u0026lt;0.001 versus the CON group.\u003c/p\u003e","description":"","filename":"Figure21.png","url":"https://assets-eu.researchsquare.com/files/rs-3836157/v1/2b6417295d595164fa5397d0.png"},{"id":49463976,"identity":"80719371-eec2-4d70-859d-5c42bd977427","added_by":"auto","created_at":"2024-01-11 09:13:11","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":443468,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThymol inhibited over-activation and inflammatory reaction of microglia in ischemic penumbra\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Immunofluorescence staining plots of microglia in brain sections with TNF-α (red), Iba1 (green) and DAPI (blue), scale bar = 50 μm. (B) MFI of TNF-α in Iba1\u003csup\u003e+\u003c/sup\u003e cells. These were used to assess the pro-inflammatory levels of microglia. (C) Immunofluorescence staining plots of microglia in brain sections with CD68 (red), Iba1 (green) and DAPI (blue), scale bar = 50 μm. (D) Mean size of Iba1\u003csup\u003e+\u003c/sup\u003e cells. (E) MFI of Iba1. (F) Number of CD68\u003csup\u003e+\u003c/sup\u003e and Iba1\u003csup\u003e+\u003c/sup\u003e cells/mm\u003csup\u003e2\u003c/sup\u003e. (G) MFI of CD68 in Iba1\u003csup\u003e+\u003c/sup\u003e cells. (H) Number of endpoints/cell of skeletonized microglia. (I) Branch length/cell of skeletonized microglia. These were used to indicate the degree of microglia activation. These values were expressed as the mean ± SEM. *, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **,\u003cem\u003e P\u003c/em\u003e\u0026lt;0.01 and ***,\u003cem\u003e P\u003c/em\u003e\u0026lt;0.001 versus the CON group.\u003c/p\u003e","description":"","filename":"Figure31.png","url":"https://assets-eu.researchsquare.com/files/rs-3836157/v1/a0ea43c1d95e5090b1323c49.png"},{"id":49463785,"identity":"708bea72-359c-4133-9ffe-9cf88ae4f596","added_by":"auto","created_at":"2024-01-11 09:05:11","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":154616,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThymol inhibited LPS-induced microglial inflammatory response\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A-C) Gene expression of pro-inflammatory cytokines after LPS and Thy treatment, normalised to \u003cem\u003eGapdh\u003c/em\u003e and expressed as a fold change. (A) \u003cem\u003eIl1b \u003c/em\u003emRNA expression. (B) \u003cem\u003eIl6 \u003c/em\u003emRNA expression. (C) \u003cem\u003eTnfa \u003c/em\u003emRNA expression. (D-F) Concentration of pro-inflammatory cytokines in cell supernatants. (D) Concentration of IL-1β. (E) Concentration of IL-6. (F) Concentration of TNF-α. (G) Immunofluorescence staining of primary microglia sections with Iba1 (green) and DAPI (blue), scale bar = 50 μm. (H) Mean size of Iba1\u003csup\u003e+\u003c/sup\u003e cells. (I) MFI of Iba1. (J) Number of endpoints/cell of microglia after skeletonization. (K) Branch lengths/cell of microglia after skeletonization. These values were expressed as the mean ± SEM. *, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **,\u003cem\u003e P\u003c/em\u003e\u0026lt;0.01 and ***,\u003cem\u003e P\u003c/em\u003e\u0026lt;0.001 versus the LPS group.\u003c/p\u003e","description":"","filename":"Figure41.png","url":"https://assets-eu.researchsquare.com/files/rs-3836157/v1/3c9fcae5ca158cf18a458a1b.png"},{"id":49463978,"identity":"0e5226a8-b8e6-4dc0-a42d-053121942d61","added_by":"auto","created_at":"2024-01-11 09:13:12","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":560688,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThymol inhibited microglia-mediated neuroinflammation by inhibiting NF-κB activation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A-F) The protein levels of p-NF-κB (p-p65), NF-κB (p65), p-IκB and IκB in both primary microglia after LPS and Thy treatment and microglia in ischemic penumbra, and gray values in the blot were quantified by ImageJ software and normalized to the value of total form and expressed as a fold change. (A, B) Protein blotting strip chart. These blots were cropped and the full-length blots were presented in Fig. S6 and Fig. S7 of the Additional file. (C, E) Relative expression of p-p65/p65. (D, F) Relative expression of p-IκB/IκB. (G) Immunofluorescence staining of primary microglia with p65 (green) and DAPI (blue), scale bar = 50 μm. (H) MFI of p65. (I) Immunofluorescence staining plots of microglia in brain sections with p65 (red), Iba1 (green) and DAPI (blue), scale bar = 50 μm. (J) MFI of p65 in Iba1\u003csup\u003e+\u003c/sup\u003e cell. These values were expressed as the mean ± SEM. *, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **,\u003cem\u003e P\u003c/em\u003e\u0026lt;0.01 and ***,\u003cem\u003e P\u003c/em\u003e\u0026lt;0.001 versus the LPS group.\u003c/p\u003e","description":"","filename":"Figure51.png","url":"https://assets-eu.researchsquare.com/files/rs-3836157/v1/925f661d9ce166f26aee66e6.png"},{"id":49464848,"identity":"f78a6676-18c6-4659-8aa8-40d847665ba3","added_by":"auto","created_at":"2024-01-11 09:21:11","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":142330,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThymol suppressed microglial neuroinflammation by downregulating phosphorylation of PI3K/Akt/mTOR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A-H) The protein levels of p-PI3K, PI3K, p-Akt, Akt, p-mTOR, mTOR in both primary microglia after LPS and Thy treatment and microglia in ischemic penumbra, and gray values in the blot were quantified by ImageJ software and normalized to the value of total form and expressed as a fold change, and the SHAM group was taken from the corresponding regions of tissue. (A, B) Protein blotting strip chart. These blots were cropped and the full-length blots were presented in Fig. S8 and Fig. S9 of the Additional file. (C, F) Relative expression of p-PI3K/PI3K. (D, G) Relative expression of p-Akt/Akt. (E, H) Relative expression of p-mTOR/mTOR. (I-K) Gene expression of pro-inflammatory cytokines after treatment with LPS, Thy, and SC79, normalised to \u003cem\u003eGapdh\u003c/em\u003e and expressed as a fold change. (I) \u003cem\u003eIl1b \u003c/em\u003emRNA expression. (J) \u003cem\u003eIl6 \u003c/em\u003emRNA expression. (K) \u003cem\u003eTnfa \u003c/em\u003emRNA expression. These values were expressed as the mean ± SEM. *, \u003cem\u003eP\u003c/em\u003e\u0026lt;0.05, **,\u003cem\u003e P\u003c/em\u003e\u0026lt;0.01 and ***,\u003cem\u003e P\u003c/em\u003e\u0026lt;0.001 versus the LPS group.\u003c/p\u003e","description":"","filename":"Figure61.png","url":"https://assets-eu.researchsquare.com/files/rs-3836157/v1/24d714cb6c377bae36ae4679.png"},{"id":60451436,"identity":"736035d5-6e55-42a9-b99a-c5fe6ee70687","added_by":"auto","created_at":"2024-07-17 00:18:18","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2232583,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3836157/v1/7d3c034b-13ad-4de4-b1bd-02b12c53b19b.pdf"},{"id":49463789,"identity":"de1b9d20-764c-4ec0-ab6a-e3fd1b16b2d7","added_by":"auto","created_at":"2024-01-11 09:05:11","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1424644,"visible":true,"origin":"","legend":"","description":"","filename":"Additionalfile.docx","url":"https://assets-eu.researchsquare.com/files/rs-3836157/v1/b61f9558ff6df1299207209c.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Thymol improves ischemic brain injury by inhibiting microglia-mediated neuroinflammation","fulltext":[{"header":"1 Background","content":"\u003cp\u003eIschemic stroke, with high prevalence, recurrence, is a major cause of disability and mortality [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. However, thrombolytic therapy which is commonly used for clinical treatment has a high risk and benefits a small population [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Therefore, a safe and effective drug for ischemic stroke, especially in the early stage, is urgently needed.\u003c/p\u003e \u003cp\u003eMicroglia-mediated neuroinflammation plays an essential role in pathophysiology of ischemic stroke [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. As the resident immune cells in the central nervous system (CNS), microglia can be rapidly activated after the onset of brain injury [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Meanwhile, microglial pro-inflammatory cytokines such as tumor necrosis factor-alpha (TNF-α), interleukin-1 beta (IL-1β), and interleukin-6 (IL-6), would cause inflammatory cascade, and further exacerbating secondary brain injury [\u003cspan additionalcitationids=\"CR7\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Therefore, inhibiting microglia-mediated inflammation is an increasingly attractive therapeutic target for ischemic stroke [\u003cspan additionalcitationids=\"CR10\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThymol, chemically known as 2-isopropyl-5-methylphenol, has a molecular weight of 150.22. It is one of the major constituents of the essential oils isolated from \u003cem\u003eLabiatae\u003c/em\u003e, \u003cem\u003eVerbenaceae\u003c/em\u003e, \u003cem\u003eGenicaceae\u003c/em\u003e, \u003cem\u003eButtercup\u003c/em\u003e, \u003cem\u003eUmbelliferae\u003c/em\u003e and other plants [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Thymol is a monoterpene phenol with various biological activities including antioxidant, gastroprotection, antimicrobial and anti-tumor [\u003cspan additionalcitationids=\"CR14 CR15\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Recently, researches have also described that thymol can alleviate bronchitis, myocardial injury and liver toxicity by inhibiting inflammation [\u003cspan additionalcitationids=\"CR18\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Meanwhile, thymol has been found to be protective in multiple neurological disease models, such as Alzheimer's disease, epilepsy, depression and anxiety \u003csup\u003e[20]\u003c/sup\u003e. However, its effect on ischemic stroke has not been clarified.\u003c/p\u003e \u003cp\u003eIn this study, transient middle cerebral artery occlusion (tMCAO) was established to validate the modulatory effect of thymol on the post-stroke injury [\u003cspan additionalcitationids=\"CR22\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Moreover, toll-like receptor 4 (TLR4)/ nuclear factor kappa-B (NF-κB) pathway would be upregulated in microglia after the onset of ischemic stroke [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Therefore, lipopolysaccharide (LPS), an agonist of TLR4, was used to stimulate microglia-mediated neuroinflammation \u003cem\u003ein vitro\u003c/em\u003e experiment.\u003c/p\u003e"},{"header":"2 Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Reagents\u003c/h2\u003e \u003cp\u003eThymol (Thy, purity: 99.90%) and SC79, purchased from the Med Chem Express (MCE, China), was dissolved in dimethyl sulfoxide (DMSO, Biosharp Life Science, China). LPS (Escherichia coli 055: B5) was purchased from the Aladdin Biochemical Technology (China). The primary antibodies of phosphatidylinositol-3-kinase (PI3K, 4257S), phosphorylated PI3K (p-PI3K, 4228S), sink serine/threonine kinase (Akt, 4685S), phosphorylated Akt (p-Akt, 4060S), mammalian target of rapamycin (mTOR, 2972S), phosphorylated mTOR (p-mTOR, 2971S), NF-κB (p65, 8242S), phosphorylated NF-κB (p-p65, 3033S) and phosphorylated inhibitor of NF-κB (p-IκB, 2859S) were purchased from Cell Signaling Technology (CST, USA). And primary antibodies for glyceraldehyde-3-phosphate dehydrogenase (GAPDH, AP0066), inhibitor of NF-κB (IκB, BS3601) and cytochrome oxidase subunit 2 (COX2, BS1076) and ELISA kits for IL-1β (CEK1788), IL-6 (CEK1785) and TNF-α (CEK1783) were obtained from Bioworld Technology (USA). Inducible nitric oxide synthase (iNOS, 610328) from BD Bioscience (USA), TNF-α (ab1793), ionized calcium-binding adaptor molecule 1 (Iba1, ab5076), and cluster of differentiation 68 (CD68, ab53444) from Abcam (United Kingdom), and the primary antibody for IL-1β (AB-401-NA) from Bio-Techne (China). The PCR primers were obtained from Tsingke Biotech (China). Cell Counting Kit-8 (CCK8) was purchased from Dojindo Laboratories (Japan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Animals\u003c/h2\u003e \u003cp\u003eAnimals used in this experiment, purchased from Hangzhou Ziyuan Experimental Animal Technology Co (China), were 2-month-old SPF-grade C57BL/6J male mice, weighing about 22 g-24 g, and were kept in SPF-grade animal laboratories with appropriate temperature (20℃-26℃) and light duration (12 hours), adequate food and water.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 tMCAO and thymol treatment\u003c/h2\u003e \u003cp\u003eMice were numbered numerically on their ears in advance and randomly divided into sham-operated (SHAM), control tMCAO (CON) and thymol-treated tMCAO (Thy) groups. The tMCAO was prepared as previously established [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Briefly, after anesthetized with 2.5% Avertin (Sigma-Aldrich, USA; 100 \u0026micro;l/10 g, ip), the mouse was inserted with a silicone wire bolt (Doccol, USA) into the initiation site of the middle cerebral artery. After approximately 60 minutes, the bolt was removed for blood reperfusion. The SHAM group was treated as the tMCAO group but not inserted with the wire bolt.\u003c/p\u003e \u003cp\u003eThe CON and Thy groups were treated with control solution and thymol solution at 4.5 hours, 24 hours, and 48 hours after reperfusion. Considering the therapeutic doses of thymol is mostly set at 20 and 40 mg/kg in other studies and the anti-inflammatory effect is better at 40 mg/kg [\u003cspan additionalcitationids=\"CR27\" citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], the dose for our experiment was set at 40 mg/kg.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Neurological and motor function assess\u003c/h2\u003e \u003cp\u003eAll tests followed the double-blind trial. The following tests were performed to assess the effects of thymol treatment on neurological damage and motor function at the third day after tMCAO.\u003c/p\u003e \u003cdiv id=\"Sec7\" class=\"Section3\"\u003e \u003ch2\u003e2.4.1 Rotating rod test\u003c/h2\u003e \u003cp\u003eMice were trained on the rotating rod device (RWD Life Sciences, China) twice a day for three days prior to tMCAO modeling. During training, the speed of the rotating rod was set to 20 rpm, 30 rpm, and 40 rpm, and the training lasted for 5 minutes at each speed. During the test, the mice were placed on the rotating rod which was set to 40 rpm for 5 minutes. The latency of fall was recorded. If the mouse did not fall, the time was recorded as 300 s.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section3\"\u003e \u003ch2\u003e2.4.2 Foot fault test\u003c/h2\u003e \u003cp\u003eThe mice were also trained twice a day for three days before tMCAO. The mice were placed on a wire mesh grid and acclimated to walk on the grid for 5 minutes each training session. During the test session, the movement of each mouse on the grid was recorded, and the results were expressed as a percentage of the fault steps within total 50 steps.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e \u003ch2\u003e2.4.3 Grip Strength\u003c/h2\u003e \u003cp\u003eThe mouse was lifted by the tail so that its two front paws simultaneously grasped the crossbar of the monitoring device (GS3, Bioseb, France). The strength value of two front paws was recorded when its tail was pulled backward, and the maximal value among triple tests was recorded. The hind limbs should be avoided to touch the crossbar during this test.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section3\"\u003e \u003ch2\u003e2.4.4 mNSS scores\u003c/h2\u003e \u003cp\u003eThe Modified Neurological Severity Score (mNSS) was used to assess the degree of neurological impairment at 3 days after tMCAO. The scores range from 0 to 12, and higher scores indicating more severe neurological deficiencies.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.5 TTC and cerebral infarct volume measurement\u003c/h2\u003e \u003cp\u003eAfter 3 days of tMCAO, the mice were anesthetized with 2.5% Avertin. Their intact brains were removed and cut into 2-mm-thick slices and then soaked in the 2% TTC (2,3,5-Triphenyltetrazolium chloride, Sigma-Aldrich) solution. The white part was the infarct area, while the pink part was the ischemic penumbra. The brain sections were arranged neatly, photographed and then analyzed by using ImageJ software (the National Institutes of Health, USA, version 1.8.0_112). The results were presented as percentage: infarct size = (volume of the contralateral side - volume of no infarct on ipsilateral side) / (2 \u0026times; volume of the contralateral side) \u0026times; 100%.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Cell Culture and treatment\u003c/h2\u003e \u003cp\u003ePrimary microglia were obtained from neonatal C57BL/6J mice [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e] and cultured in DMEM medium (Bio-Channel, China) containing 10% fetal bovine serum (FBS, Gibco, USA) and 1% antibiotics (100 U/ml penicillin and 100 \u0026micro;g/ml streptomycin, Gibco) for 10\u0026ndash;12 days, until a sufficient number of microglia were visible under the microscope. Then the culture flasks were shaken and the microglia were collected, re-cultured in the dishes and incubated at 37\u0026deg;C in a humidified incubator (Thermo, USA) containing 5% CO\u003csub\u003e2\u003c/sub\u003e for subsequent experiments.\u003c/p\u003e \u003cp\u003ePrimary microglia were divided into control (CON) group, LPS-treated (LPS) group, and LPS and thymol co-treatment (LPS\u0026thinsp;+\u0026thinsp;Thy) group. The dose of LPS was 100 ng/ml, and for the LPS\u0026thinsp;+\u0026thinsp;Thy group, thymol pretreated 1 hour.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.7 CCK8 cell viability assay\u003c/h2\u003e \u003cp\u003eThe primary microglia were re-cultured uniformly in 96-well plates, and treated with different concentrations of thymol (100 nM-1 mM). The CON group was treated with an equal volume of DMSO. The cells were incubated for 24 hours and then changed with medium with 10% CCK8. After 2 hours incubation, the optical density (OD) of each well was measured at 450 nm with microplate reader (TECAN-Spark, Switzerland). The cell viability ratio was presented as: (OD of the treated group \u0026mdash; mean OD of the blank group) / (mean OD of the control group \u0026mdash; mean OD of the blank group).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Total mRNA isolation and qRT-PCR\u003c/h2\u003e \u003cp\u003eThe samples were obtained ischemic penumbra according to TTC staining \u003cem\u003ein vivo\u003c/em\u003e, and the samples of primary microglia were collected after 3 hours LPS stimulation \u003cem\u003ein vitro\u003c/em\u003e. The total mRNA of tissue and cell samples were extracted with Trizol reagent (Accurate Biology, China), and then cDNA was reverse transcribed by using a PrimeScript RT reagent kit (Vazyme Biotech, China). The qRT-PCR was performed on a Step One Plus PCR system (Applied Biosystems) with a SYBR green kit (Vazyme Biotech). Gene expression was quantified and normalized to \u003cem\u003eGapdh\u003c/em\u003e. The primer sequences are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences used in qRT-PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward Primer (5\u0026prime; to 3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse Primer (5\u0026prime; to 3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eIl1b\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAGCCTCGTGCTGTCGGACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGAGGCCCAAGGCCACAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eIl6\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGACAAAGCCAGAGTCCTTCAGAGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTAGGTTTGCCGAGTAGATCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTnfa\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCAAGGGACAAGGCTGCCCCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCAGGGGCTCTTGACGGCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCox2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGCTGGTGGAAAAACCTCGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAAACCCACTTCGCCTCCAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eNos2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCTAGTGAAGCAAAGCCCAACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGCCTTGTGGTGAAGAGTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGapdh\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCCAAGGCTGTGGGCAAGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCTCCAGGCGGCACGTCAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Western blot\u003c/h2\u003e \u003cp\u003eTotal proteins from tissues of ischemic penumbra and primary microglia were extracted with RIPA lysis buffer (Keygen Biotech, China) containing 1% protease inhibitor (Keygen Biotech). The concentration of each sample was equalized by BCA Protein Assay Kit (Bioworld).\u003c/p\u003e \u003cp\u003eThe protein samples were separated by 10% SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis, Epizyme) and transferred to PVDF (polyvinylidene fluoride) membranes (Bio-Rad, USA). Primary antibodies were incubated overnight at 4\u0026deg;C and then incubated with the corresponding secondary antibodies (Bioworld) for 1.5 hours at room temperature. Protein bands on the membrane were visualized with enhanced chemiluminescence solution (Tanon, China) by Gel-Pro system (Tanon), and quantified with ImageJ.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e2.10 ELISA\u003c/h2\u003e \u003cp\u003eAfter mice were anesthetized with Avertin, PBS buffer (phosphate buffered saline, Servicebio, China) was perfused through the left ventricle until the mouse liver turned gray, and then the infarcted side was prepared as a tissue homogenate. In addition, the supernatant of primary microglia treated with LPS for 24 hours was collected. Then the protein levels of inflammatory factors in the tissue samples and the cell supernatants were measured by IL-1β, IL-6 and TNF-α ELISA kits according to the manufacturer\u0026rsquo;s protocol. Finally, the OD were measured at 450 nm by using a microplate reader and the protein concentrations were analyzed according to standard curves.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e2.11 Immunofluorescence staining\u003c/h2\u003e \u003cp\u003eAfter anesthetized with Avertin, mice were perfused with PBS and 4% paraformaldehyde (PFA). Then the intact brains were stripped and immersed in the tubes containing 4% PFA. After dehydration with 15% and 30% sucrose solutions, they were cut into 20 \u0026micro;m slices with a frozen sectioning machine (Thermo) and affixed to slides for immunofluorescence staining together with primary microglia treated with LPS for 1 hour. Primary microglia need to be treated with 4% PFA for 15 minutes, then brain slices and cells were ruptured in 0.25% Triton X-100 for 20 minutes. And next, incubating with 2% BSA (bovine serum albumin, BioFroxx, China) for 1.5 hours at room temperature. Lastly, primary antibodies were incubated overnight at 4\u0026deg;C. The next day, incubation with fluorescent secondary antibodies (Invitrogen) for 2 hours and then DAPI (Bioworld) for 20 minutes. The brain slices and cell samples were sealed with fluorescent anti-fade solution (Beyotime, China).\u003c/p\u003e \u003cp\u003eThe images were obtained by confocal laser scanning microscopy (Olympus, FV3000, Japan). The skeletonization and quantitative analysis of microglia were obtained by ImageJ [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e2.12 Statistical analysis\u003c/h2\u003e \u003cp\u003eThe experimental data were all expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of mean (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM) and analyzed by GraphPad Prism 8.0.2 software (GraphPad Software, USA). The statistical significance of the differences between two groups was determined by t-test, and the statistical significance of the differences between three or more groups was determined by one-way ANOVA, followed by Bonferroni post hoc multiple comparisons. \u003cem\u003eP\u003c/em\u003e༜0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"3 Results","content":"\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Thymol reduced cerebral infarct volume and improved neurological impairment after cerebral ischemia\u003c/h2\u003e \u003cp\u003eWe investigated the effect of thymol (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA) on ischemic stroke following the experimental procedure (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). TTC staining showed that thymol administration significantly decreased the infarct volume compared with the CON group at 3 days after tMCAO (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, D). In addition, a series of behavioral tests (mNSS, rotating rod, foot fault, grip strength) were used to assess neurological deficits. Thymol treatment could improve neurological function, lower mNSS score and foot-fault rate, prolong the latency of fall and strengthen grip strength (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE-H). All these results indicated that thymol treatment could attenuate ischemic brain injury and motor dysfunctions in tMCAO mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.2 Thymol suppressed the inflammatory response in ischemic penumbra\u003c/h2\u003e \u003cp\u003eMicroglia-mediated neuroinflammation could exacerbate post-stroke brain injury [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. We firstly examined the mRNA expression of pro-inflammatory factors in ischemic penumbra at 3 days after tMCAO. The result showed that thymol significantly reduced the expression of \u003cem\u003eIl1b\u003c/em\u003e, \u003cem\u003eIl6\u003c/em\u003e, \u003cem\u003eTnfα\u003c/em\u003e, \u003cem\u003eCox2\u003c/em\u003e, and \u003cem\u003eNos2\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-C and Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA, B). Next, we assessed the concentration of IL-1β, IL-6 and TNF-α in the infarcted hemisphere by ELISA (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD-F), and the protein levels of iNOS, COX-2, IL-1β and TNF-α by western blot (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eC-G) (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eC showed cropped blots and the full-length blots were presented in the Additional file). Those results showed that thymol treatment could significantly reduce the post-stroke inflammation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Thymol inhibited over-activation and inflammatory reaction of microglia in ischemic penumbra\u003c/h2\u003e \u003cp\u003eOver-activated microglia are correlated with the excessive inflammatory response after cerebral ischemia [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Therefore, we investigated whether thymol could inhibit microglial inflammation after tMCAO by immunofluorescence staining. The mean fluorescence intensity (MFI) of TNF-α in microglia was significantly reduced after thymol treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, B). Then the activated microglia were labelled with Iba1 and CD68 [\u003cspan additionalcitationids=\"CR36\" citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e] (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). The mean size and MFI of Iba1, density and MFI of CD68 in microglia (Iba1\u003csup\u003e+\u003c/sup\u003e cells) was all decreased in the Thy group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD-G). Besides, we skeletonized microglia with ImageJ, and found the microglia in thymol-treated mice had higher number of endpoints and longer branch lengths than tMCAO-CON group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH, I). All of those results suggested that thymol inhibited inflammation and activation of microglia in ischemic penumbra.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003e3.4 Thymol inhibited LPS-induced microglial inflammatory response\u003c/h2\u003e \u003cp\u003eTo validate anti-inflammation effect of thymol on microglia, LPS stimulation was introduced to primary microglia \u003cem\u003ein vitro\u003c/em\u003e. Based on the result of CCK8 assay, thymol showed no cytotoxicity below 500 \u0026micro;M (Fig. S2A). Considering the therapeutic dosage of thymol is mostly among 25 to 120 \u0026micro;M in other researches and thymol showed the best therapeutic efficiency at 100 uM [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e], we set the concentration at 100 \u0026micro;M for our next in vitro experiments. Thymol treatment significantly reduced the mRNA expression of \u003cem\u003eIl1b\u003c/em\u003e, \u003cem\u003eIl6\u003c/em\u003e, \u003cem\u003eTnfa\u003c/em\u003e, \u003cem\u003eCox2\u003c/em\u003e and \u003cem\u003eNos2\u003c/em\u003e after LPS stimulating (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-C and Fig. S2B, C). Meanwhile, the protein levels of IL-1β, IL-6 and TNF-α in cell supernatants, measured by ELISA, were also significant reduced in the Thy group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD-F). Our results showed that the mean size of microglia and MFI of Iba1 were increased after LPS stimulating, and reversed by thymol treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG-I). Besides, thymol-treated microglia had more endpoints and longer branches (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eJ, K), indicating that thymol could suppress the activation of LPS-treated microglia. In this section, we confirmed that thymol could inhibit microglial activation and inflammatory effect \u003cem\u003ein vitro\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003e3.5 Thymol inhibited microglia-mediated neuroinflammation by inhibiting NF-κB activation\u003c/h2\u003e \u003cp\u003eTo investigate how thymol affect microglia-mediated neuroinflammation, we examined some classical pathways associated with inflammation. Firstly, we found that after LPS stimulation, thymol treatment did not affect the phosphorylation of signal transducer and activator of transcription 3 (STAT3), p38 mitogen activated protein kinase (p38 MAPK), and extracellular signal-regulated kinase (ERK) (Fig. S3A) (Fig. S3A showed cropped blots and the full-length blots were presented in the Additional file). However, thymol treatment significantly reduced the phosphorylation of IκB and NF-κB (p65) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, C, E). Then we obtained similar experimental results in ischemic penumbra at 3 days after tMCAO (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB, D, F) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, B showed cropped blots and the full-length blots were presented in the Additional file). Moreover, we performed immunofluorescence staining to observe the effect of thymol on p65 in primary microglia and tMCAO mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eG, I). Thymol treatment could reduce the MFI of p65 in the nucleus of microglia (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eH, J), which suggested that thymol could interfere the translocation of p65 from cytoplasm to nucleu. These data suggested that thymol could attenuate microglia-mediated neuroinflammation by inhibiting the NF-κB pathway.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec25\" class=\"Section2\"\u003e \u003ch2\u003e3.6 Thymol suppressed microglial neuroinflammation by downregulating phosphorylation of PI3K/Akt/mTOR\u003c/h2\u003e \u003cp\u003eNF-κB signaling pathway is one of the downstream pathways of PI3K/Akt signaling pathway. The phosphorylation of PI3K, Akt and mTOR also decreased after thymol treatment in primary microglia and penumbra of tMCAO mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA-H) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA, B showed cropped blots and the full-length blots were presented in the Additional file). Subsequently, primary microglia were treated with SC79, an agonist of Akt [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e], to verify the relationship between anti-inflammatory effect of thymol and PI3K/Akt/mTOR pathway. We found that SC79 partially reversed the anti-inflammatory effect of thymol on microglia (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eI-K), indicating that thymol could attenuate post-stroke inflammation by inhibiting the activation of PI3K/Akt/mTOR signaling pathway.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4 Discussion","content":"\u003cp\u003eMicroglia make up approximately 10%-15% of all neuroglia and are normally considered to be the resident macrophage-like innate immune cells of the CNS and the primary responders in a defense network covering the entire brain parenchyma [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Even in the un-activated state, microglia are highly mobile and they act like immune sentinels to maintain CNS homeostasis at all times, and this permanently motile state allows them to rapidly convert to an activated state in response to CNS changes [\u003cspan additionalcitationids=\"CR45\" citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. After the onset of ischemic stroke, activated microglia have larger cytosol and shorter and fewer branches [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. And thymol treatment reverses all these changes, suggesting that thymol has an inhibitory effect on microglia activation.\u003c/p\u003e \u003cp\u003eActivated microglia release pro-inflammatory factors, thereby accelerate post-stroke brain injury [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. In our study, thymol treatment resulted in a significant reduction in the production of pro-inflammatory factors (IL-1β, IL-6 and TNF-α) and an improvement in stroke injury. Therefore, we concluded that thymol ameliorated post-stroke brain injury by inhibiting the inflammatory response of microglia.\u003c/p\u003e \u003cp\u003eNF-κB, well known for its regulation of inflammation and immunity, can be activated by stimulation of inflammatory receptors, such as TLR [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. In the resting state, NF-κB subunit dimers are present in the cytoplasm bound by inhibitory proteins called NF-κB inhibitors (IκB). After activated, IκB is phosphorylated by IκB kinase (IKK) and its proteasome is labeled to degrade and release NF-κB subunit dimers. The released NF-κB subunit dimers further translocate to the nucleus, where they can bind to specific DNA promoter regions of various inflammatory genes (IL-1β, IL-6 and TNF-α) [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e] to facilitate their transcription [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e, \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. These inflammatory factors in turn further promote the activation of NF-κB [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. In our experimental results, thymol exhibited an inhibitory effect on the phosphorylation of IκB, thus reducing the translocation of NF-κB to the nucleus and the subsequent release of NF-κB-induced inflammatory factors.\u003c/p\u003e \u003cp\u003eMeanwhile, we found that the phosphorylation of PI3K, Akt and mTOR was significantly reduced under thymol treatment, suggesting that PI3K/Akt/mTOR signaling pathway is also involved in the neuroprotective effects of thymol. Akt, also known as protein kinase B (PKB), is the main downstream of PI3K [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e], and mTOR is one of the downstream effectors of Akt. It has been reported that Akt and mTOR activates IKK, and subsequently promotes the phosphorylation of IκB, which in turn leads to NF-κB activation and entry into the nucleus [\u003cspan additionalcitationids=\"CR55\" citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. That is, in regulating the inflammatory response, the NF-κB signaling pathway is also regulated to some extent by the PI3K/Akt/mTOR signaling pathway. To a certain extent, the NF-κB signaling pathway is regulated by the PI3K/Akt/mTOR signaling pathway. Therefore, we believe that the effect of thymol in attenuating ischemic brain injury may be achieved by modulating the cascade of PI3K/Akt/mTOR/NF-κB signaling pathway in microglia.\u003c/p\u003e \u003cp\u003eOur results revealed for the first time that the anti-inflammatory effect of thymol in ischemic stroke and elucidate the underlying mechanisms. However, the small sample size is an undeniable shortcoming for our study.\u003c/p\u003e"},{"header":"5 Conclusions","content":"\u003cp\u003eIn our study, we demonstrated the neuroprotective effect of thymol on ischemic brain injury, by inhibiting the inflammatory response of over-activated microglia in the penumbra via PI3K/Akt/mTOR/NF-κB signaling pathway. Those findings revealed for the first time the neuroprotective effect of thymol in ischemic stroke and elucidate the mechanisms by which it works, and suggested that thymol is a potential therapeutic agent in the treatment of ischemic stroke.\u003c/p\u003e"},{"header":"List Of Abbreviations","content":" \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003etMCAO\u003c/div\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eTransient middle cerebral artery occlusion\u003c/div\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eLPS\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eLipopolysaccharide\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eTTC\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003e2,3,5-Triphenyltetrazolium chloride\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eqRT-PCR\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eQuantitative real-time polymerase chain reaction\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eELISA\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eEnzyme-linked immunosorbent assay\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eIL-1β\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eInterleukin-1 beta\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eIL-6\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eInterleukin-6\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eTNF-α\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eTumor necrosis factor-alpha\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eCOX2\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eCytochrome oxidase subunit 2\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eiNOS\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eInducible nitric oxide synthase\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003ePI3K\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003ePhosphatidylinositol-3-kinase\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003ep-PI3K\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003ePhosphorylated phosphatidylinositol-3-kinase\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eAkt\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eSink serine/threonine kinase\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003ep-Akt\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003ePhosphorylated sink serine/threonine kinase\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003emTOR\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eMammalian target of rapamycin\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003ep-mTOR\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003ePhosphorylated mammalian target of rapamycin\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eNF-κB (p65)\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eNuclear factor-κB\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003ep-NF-κB (p-p65)\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003ePhosphorylated nuclear factor-κB\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eIκB\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eInhibitor of nuclear factor-κB\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003ep-IκB\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003ePhosphorylated inhibitor of nuclear factor-κB\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eGAPDH\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eGlyceraldehyde-3-phosphate dehydrogenase\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eTLR4\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eToll-like receptor 4\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eIba1\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eIonized calcium-binding adaptor molecule 1\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eCD68\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eCluster of differentiation 68\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eCCK8\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eCell Counting Kit-8\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eCNS\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eCentral nervous system\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eDMSO\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eDimethyl sulfoxide\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eCST\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eCell Signaling Technology\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eFBS\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eFetal bovine serum\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eSDS-PAGE\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eSodium dodecyl sulfate polyacrylamide gel electrophoresis\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003ePVDF\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003ePolyvinylidene fluoride\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003ePBS buffer\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003ePhosphate buffered saline\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003ePFA\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eParaformaldehyde\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eBSA\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eBovine serum albumin\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eMIF\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eMean fluorescence intensity\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eSTAT3\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eSignal transducer and activator of transcription 3\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003ep38 MAPK\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003ep38 mitogen activated protein kinase\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eERK\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eExtracellular signal-regulated kinase\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003eIKK\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eInhibitor of nuclear factor-κB kinase\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cdiv class=\"SimplePara\"\u003ePKB\u003c/div\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cdiv class=\"SimplePara\"\u003eProtein kinase B\u003c/div\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003cbr/\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe animal study was approved by the Experimental Animal Ethics Committee of Nanjing Drum Tower Hospital, the affiliated hospital of Nanjing University Medicine School (2023AE01015).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analysed during this study are included in this published article and its supplementary information files. All other data are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was funded by the National Natural Science Foundation of China (82130036, 81920108017, 82071304), the STI2030-Major Projects-2022ZD0211800. Jiangsu Provincial Medical Key Discipline (ZDXK202216).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eY.X. designed the study and critically reviewed manuscript. C.Z. and L.S. performed experiments, analyzed data and wrote the paper. Y.Z. and X.S. analyzed the data and prepared figures. Z.Z., Y.H. and J.L. helped to revise the paper. S.X., H.Y. and X.B. helped to perform the experiments. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors thank the financial support of the National Natural Science Foundation of China (82130036, 81920108017, 82071304), the STI2030-Major Projects-2022ZD0211800. Jiangsu Provincial Medical Key Discipline (ZDXK202216).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eCampbell BCV, Khatri P, Stroke. Lancet. 2020;396(10244):129\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarugg JE, van den Bergh C, Tromp M, van der Marel GA, van Zoest WJ, van Boom JH. Synthesis of phosphorothioate-containing DNA fragments by a modified hydroxybenzotriazole phosphotriester approach. Nucleic Acids Res. 1984;12(23):9095\u0026ndash;110.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan B, Jiang W, Cui P, Zheng K, Dang C, Wang J, et al. Microglial PGC-1alpha protects against ischemic brain injury by suppressing neuroinflammation. Genome Med. 2021;13(1):47.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChamorro A, Hallenbeck J. The harms and benefits of inflammatory and immune responses in vascular disease. Stroke. 2006;37(2):291\u0026ndash;3.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu S, Lu J, Shao A, Zhang JH, Zhang J. Glial Cells: Role of the Immune Response in Ischemic Stroke. Front Immunol. 2020;11:294.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQin C, Zhou LQ, Ma XT, Hu ZW, Yang S, Chen M, et al. Dual Functions of Microglia in Ischemic Stroke. Neurosci Bull. 2019;35(5):921\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYenari MA, Kauppinen TM, Swanson RA. Microglial activation in stroke: therapeutic targets. Neurotherapeutics. 2010;7(4):378\u0026ndash;91.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmantea D, Nappi G, Bernardi G, Bagetta G, Corasaniti MT. Post-ischemic brain damage: pathophysiology and role of inflammatory mediators. FEBS J. 2009;276(1):13\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCandelario-Jalil E, Dijkhuizen RM, Magnus T, Neuroinflammation. Stroke, Blood-Brain Barrier Dysfunction, and Imaging Modalities. Stroke. 2022;53(5):1473\u0026ndash;86.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYenari MA, Xu L, Tang XN, Qiao Y, Giffard RG. Microglia potentiate damage to blood-brain barrier constituents: improvement by minocycline in vivo and in vitro. Stroke. 2006;37(4):1087\u0026ndash;93.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVar SR, Shetty AV, Grande AW, Low WC, Cheeran MC. Microglia and Macrophages in Neuroprotection, Neurogenesis, and Emerging Therapies for Stroke. Cells. 2021;10(12).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMarchese A, Orhan IE, Daglia M, Barbieri R, Di Lorenzo A, Nabavi SF, et al. Antibacterial and antifungal activities of thymol: A brief review of the literature. Food Chem. 2016;210:402\u0026ndash;14.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTsai ML, Lin CC, Lin WC, Yang CH. Antimicrobial, antioxidant, and anti-inflammatory activities of essential oils from five selected herbs. Biosci Biotechnol Biochem. 2011;75(10):1977\u0026ndash;83.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChaieb K, Hajlaoui H, Zmantar T, Kahla-Nakbi AB, Rouabhia M, Mahdouani K, et al. The chemical composition and biological activity of clove essential oil, Eugenia caryophyllata (Syzigium aromaticum L. Myrtaceae): a short review. Phytother Res. 2007;21(6):501\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKachur K, Suntres Z. The antibacterial properties of phenolic isomers, carvacrol and thymol. Crit Rev Food Sci Nutr. 2020;60(18):3042\u0026ndash;53.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSampaio LA, Pina LTS, Serafini MR, Tavares DDS, Guimaraes AG. Antitumor Effects of Carvacrol and Thymol: A Systematic Review. Front Pharmacol. 2021;12:702487.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou E, Fu Y, Wei Z, Yu Y, Zhang X, Yang Z. Thymol attenuates allergic airway inflammation in ovalbumin (OVA)-induced mouse asthma. Fitoterapia. 2014;96:131\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEl-Marasy SA, El Awdan SA, Hassan A, Abdallah HMI. Cardioprotective effect of thymol against adrenaline-induced myocardial injury in rats. Heliyon. 2020;6(7):e04431.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDou X, Yan D, Liu S, Gao L, Shan A. Thymol Alleviates LPS-Induced Liver Inflammation and Apoptosis by Inhibiting NLRP3 Inflammasome Activation and the AMPK-mTOR-Autophagy Pathway. Nutrients. 2022;14(14).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNagoor Meeran MF, Javed H, Al Taee H, Azimullah S, Ojha SK. Pharmacological Properties and Molecular Mechanisms of Thymol: Prospects for Its Therapeutic Potential and Pharmaceutical Development. Front Pharmacol. 2017;8:380.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKnowland D, Arac A, Sekiguchi KJ, Hsu M, Lutz SE, Perrino J, et al. Stepwise recruitment of transcellular and paracellular pathways underlies blood-brain barrier breakdown in stroke. Neuron. 2014;82(3):603\u0026ndash;17.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang L, Wong S, Snyder EY, Hamblin MH, Lee JP. Human neural stem cells rapidly ameliorate symptomatic inflammation in early-stage ischemic-reperfusion cerebral injury. Stem Cell Res Ther. 2014;5(6):129.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSommer CJ. Ischemic stroke: experimental models and reality. Acta Neuropathol. 2017;133(2):245\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao SC, Ma LS, Chu ZH, Xu H, Wu WQ, Liu F. Regulation of microglial activation in stroke. Acta Pharmacol Sin. 2017;38(4):445\u0026ndash;58.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePan J, Jin JL, Ge HM, Yin KL, Chen X, Han LJ, et al. Malibatol A regulates microglia M1/M2 polarization in experimental stroke in a PPARgamma-dependent manner. J Neuroinflammation. 2015;12:51.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaravanan S, Pari L. Role of thymol on hyperglycemia and hyperlipidemia in high fat diet-induced type 2 diabetic C57BL/6J mice. Eur J Pharmacol. 2015;761:279\u0026ndash;87.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Q, Qi G, Zhou H, Cheng F, Yang X, Liu X, et al. Protective effect of thymol on glycerol-induced acute kidney injury. Ren Fail. 2023;45(1):2227728.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFangFang, Li H, Qin T, Li M, Ma S. Thymol improves high-fat diet-induced cognitive deficits in mice via ameliorating brain insulin resistance and upregulating NRF2/HO-1 pathway. Metab Brain Dis. 2017;32(2):385\u0026ndash;93.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGiulian D, Baker TJ. Characterization of ameboid microglia isolated from developing mammalian brain. J Neurosci. 1986;6(8):2163\u0026ndash;78.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin L, Desai R, Wang X, Lo EH, Xing C. Characteristics of primary rat microglia isolated from mixed cultures using two different methods. J Neuroinflammation. 2017;14(1):101.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYoung K, Morrison H. Quantifying Microglia Morphology from Photomicrographs of Immunohistochemistry Prepared Tissue Using ImageJ. J Vis Exp. 2018(136).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePlastira I, Bernhart E, Goeritzer M, Reicher H, Kumble VB, Kogelnik N, et al. 1-Oleyl-lysophosphatidic acid (LPA) promotes polarization of BV-2 and primary murine microglia towards an M1-like phenotype. J Neuroinflammation. 2016;13(1):205.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSubedi L, Gaire BP. Phytochemicals as regulators of microglia/macrophages activation in cerebral ischemia. Pharmacol Res. 2021;165:105419.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZou X, Gao S, Li J, Li C, Wu C, Cao X, et al. A monoamine oxidase B inhibitor ethyl ferulate suppresses microglia-mediated neuroinflammation and alleviates ischemic brain injury. Front Pharmacol. 2022;13:1004215.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu L, Si L, Dai X, Dong H, Ma Z, Sun Z, et al. Exosomal miR-409-3p secreted from activated mast cells promotes microglial migration, activation and neuroinflammation by targeting Nr4a2 to activate the NF-kappaB pathway. J Neuroinflammation. 2021;18(1):68.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen ML, Hong CG, Yue T, Li HM, Duan R, Hu WB, et al. Inhibition of miR-331-3p and miR-9-5p ameliorates Alzheimer's disease by enhancing autophagy. Theranostics. 2021;11(5):2395\u0026ndash;409.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evan den Bosch AMR, Hummert S, Steyer A, Ruhwedel T, Hamann J, Smolders J, et al. Ultrastructural Axon-Myelin Unit Alterations in Multiple Sclerosis Correlate with Inflammation. Ann Neurol. 2023;93(4):856\u0026ndash;70.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePalabiyik SS, Karakus E, Halici Z, Cadirci E, Bayir Y, Ayaz G, et al. The protective effects of carvacrol and thymol against paracetamol-induced toxicity on human hepatocellular carcinoma cell lines (HepG2). Hum Exp Toxicol. 2016;35(12):1252\u0026ndash;63.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKrishnan M, Kim DK, Gie Kim S, Kang SC. Thymol exposure mediates pro-oxidant shift by regulating Nrf2 and apoptotic events in zebrafish (Danio rerio) embryos. Environ Toxicol Pharmacol. 2019;65:1\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMehmood T, Pichyangkura R, Muanprasat C. Chitosan Oligosaccharide Promotes Junction Barrier through Modulation of PI3K/AKT and ERK Signaling Intricate Interplay in T84 Cells. Polym (Basel). 2023;15(7).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGu L, Xie C, Peng Q, Zhang J, Li J, Tang Z. Arecoline suppresses epithelial cell viability through the Akt/mTOR signaling pathway via upregulation of PHLPP2. Toxicology. 2019;419:32\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Xie Y, Cheng Z, Zhang Y, Wang W, Guo B, et al. Mechanism of action and therapeutic targeting of microglia in autism spectrum disorder. Adv Neurol. 2022;1(3):167.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNayak D, Roth TL, McGavern DB. Microglia development and function. Annu Rev Immunol. 2014;32:367\u0026ndash;402.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen Z, Trapp BD. Microglia and neuroprotection. J Neurochem. 2016;136(Suppl 1):10\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNimmerjahn A, Kirchhoff F, Helmchen F. Resting microglial cells are highly dynamic surveillants of brain parenchyma in vivo. Science. 2005;308(5726):1314\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePrinz M, Jung S, Priller J. Microglia Biology: One Century of Evolving Concepts. Cell. 2019;179(2):292\u0026ndash;311.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNennig SE, Schank JR. The Role of NFkB in Drug Addiction: Beyond Inflammation. Alcohol Alcohol. 2017;52(2):172\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHayden MS, Ghosh S. Signaling to NF-kappaB. Genes Dev. 2004;18(18):2195\u0026ndash;224.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOeckinghaus A, Ghosh S. The NF-kappaB family of transcription factors and its regulation. Cold Spring Harb Perspect Biol. 2009;1(4):a000034.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWoodruff TM, Thundyil J, Tang SC, Sobey CG, Taylor SM, Arumugam TV. Pathophysiology, treatment, and animal and cellular models of human ischemic stroke. Mol Neurodegener. 2011;6(1):11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOkun E, Griffioen KJ, Mattson MP. Toll-like receptor signaling in neural plasticity and disease. Trends Neurosci. 2011;34(5):269\u0026ndash;81.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZinatizadeh MR, Schock B, Chalbatani GM, Zarandi PK, Jalali SA, Miri SR. The Nuclear Factor Kappa B (NF-kB) signaling in cancer development and immune diseases. Genes Dis. 2021;8(3):287\u0026ndash;97.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Y, Deng S, Zhang Z, Gu Y, Xia S, Bao X, et al. 6-Gingerol attenuates microglia-mediated neuroinflammation and ischemic brain injuries through Akt-mTOR-STAT3 signaling pathway. Eur J Pharmacol. 2020;883:173294.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi ZM, Han YW, Han XH, Zhang K, Chang YN, Hu ZM, et al. Upstream regulators and downstream effectors of NF-kappaB in Alzheimer's disease. J Neurol Sci. 2016;366:127\u0026ndash;34.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlexaki VI, Fodelianaki G, Neuwirth A, Mund C, Kourgiantaki A, Ieronimaki E, et al. DHEA inhibits acute microglia-mediated inflammation through activation of the TrkA-Akt1/2-CREB-Jmjd3 pathway. Mol Psychiatry. 2018;23(6):1410\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTorrealba N, Vera R, Fraile B, Martinez-Onsurbe P, Paniagua R, Royuela M. TGF-beta/PI3K/AKT/mTOR/NF-kB pathway. Clinicopathological features in prostate cancer. Aging Male. 2020;23(5):801\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"thymol, ischemic stroke, microglia, neuroinflammation","lastPublishedDoi":"10.21203/rs.3.rs-3836157/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3836157/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eMicroglia-mediated inflammation is one of the key aggravating factors in the development of ischemic stroke. Therefore, ameliorating microglial over-activation is a potential therapeutic target for ischemic injury. Thymol is a monophenol isolated from plant essential oil, which has various beneficial biological activities including anti-inflammatory and antioxidant, and protective effects in many disease models. However, its effects on ischemic stroke or microglial inflammation have not been reported.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eRodent transient middle cerebral artery occlusion (tMCAO) model was established to simulate ischemic stroke. TTC, modified neurological function score (mNSS) and behavioral tests were used to assess the severity of neurological damage. Then immunofluorescence staining and cytoskeleton analysis were used to determine activation of microglia. Lipopolysaccharide (LPS) was utilized to induce the inflammatory response of primary microglia \u003cem\u003ein vitro\u003c/em\u003e. Quantitative real-time polymerase chain reaction (qRT-PCR), western blot and enzyme-linked immunosorbent assay (ELISA) were performed to exam the expression of inflammatory cytokines. And western blot was used to investigate the mechanism of the anti-inflammatory effect of thymol.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eIn this study, we found that thymol treatment could ameliorate post-stroke neurological impairment and reduce infarct volume by reducing microglial activation and pro-inflammatory response (IL-1β, IL-6 and TNF-α). Mechanically, thymol could inhibit the phosphorylation of phosphatidylinositol-3-kinase (PI3K), sink serine/threonine kinase (Akt) and mammalian target of rapamycin (mTOR), and suppress the activation of nuclear factor-κB (NF-κB).\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eOur study demonstrated that thymol could reduce the microglial inflammation by targeting PI3K/Akt/mTOR/NF-κB signaling pathway, and further alleviate ischemic brain injury, suggesting that thymol is a promising candidate as a neuroprotective agent against ischemic stroke.\u003c/p\u003e","manuscriptTitle":"Thymol improves ischemic brain injury by inhibiting microglia-mediated neuroinflammation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-11 09:05:07","doi":"10.21203/rs.3.rs-3836157/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b1c359fe-52f2-491b-8267-05cf301ad2d4","owner":[],"postedDate":"January 11th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-07-17T00:18:13+00:00","versionOfRecord":{"articleIdentity":"rs-3836157","link":"https://doi.org/10.1016/j.brainresbull.2024.111029","journal":{"identity":"brain-research-bulletin","isVorOnly":true,"title":"Brain Research Bulletin"},"publishedOn":"2024-07-01 00:18:13","publishedOnDateReadable":"July 1st, 2024"},"versionCreatedAt":"2024-01-11 09:05:07","video":"","vorDoi":"10.1016/j.brainresbull.2024.111029","vorDoiUrl":"https://doi.org/10.1016/j.brainresbull.2024.111029","workflowStages":[]},"version":"v1","identity":"rs-3836157","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3836157","identity":"rs-3836157","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00