Preliminary phylogenetic insights into Japanese willows (Salix L.) using low-copy nuclear genes, with emphasis on endemic species

preprint OA: closed
Full text JSON View at publisher
Full text 176,107 characters · extracted from preprint-html · click to expand
Preliminary phylogenetic insights into Japanese willows (Salix L.) using low-copy nuclear genes, with emphasis on endemic species | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Preliminary phylogenetic insights into Japanese willows (Salix L.) using low-copy nuclear genes, with emphasis on endemic species Satoshi Kikuchi, Suzuki Setsuko, Teruyoshi Nagamitsu, Wajiro Suzuki This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8303889/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 5 You are reading this latest preprint version Abstract In this study, we aimed to reveal the phylogenetic relationships of Salix species in Japan, with particular emphasis on the speciation process of endemic species. We performed molecular phylogenetic analyses of all available native species using multilocus datasets of low-copy nuclear genes and chloroplast sequences. Although gene-tree incongruence and basal reticulation were evident—implying the need for future genome-scale analyses— our analyses still provided sufficient resolution to clarify the phylogenetic structure of the Japanese Salix flora and to offer meaningful insights into its diversification. The integrated analyses identified three major lineages within the Japanese subg. Vetrix, revealed the polyphyly of the subg. Chamaetia, and clarified the phylogenetic context of several key endemic species. For example, S. hukaoana of the monotypic section Hukaoana and S. futura were inferred to be relicts of ancient lineages that diverged during the Mid to Late Miocene, whereas the species of sect. Hastatae (i.e., S. rupifraga, S. shiraii, and S. japonica) were suggested to be neoendemics derived from S. vulpina. Moreover, intraspecific taxa such as S. miyabeana and S. nakamurana showed signs of hybridization, suggesting that interspecific hybridization and introgression may contribute in lineage differentiation. Salix low-copy nuclear genes chloroplast phylogenetic networks divergence time estimation Japanese Archipelago Figures Figure 1 Figure 2 Figure 3 Introduction The genus Salix L. (Salicaceae) comprises approximately 400 tree species that are mainly distributed in the temperate, boreal, and Arctic regions of the Northern Hemisphere (Argus 1997). They are present in diverse ecological niches, including wetlands, riparian vegetation, uplands, and alpine/arctic tundra (Dickmann and Kuzovkina 2014; Newsholme 1992), and have diverse economic and ecological uses, including biomass production, ecological restoration, and various wood products (Pučka and Lazdiņa 2013). A comprehensive classification of Salix has been attempted by many taxonomists; however, this has proven to be difficult because of its dimorphic sexual system, simple flowers, large phenotypic variations, frequent hybridization, and polyploidization of this genus (Argus 1997; Cronk et al. 2015). The current classification of Salix is based on several authoritative taxonomic opinions proposed for each region (Argus 1997; Dickmann and Kuzovkina 2014; Fang et al. 1999; Ohashi 2001; Skvortsov 1999). Many molecular phylogenetic studies have been conducted to untangle the taxonomic and systematic complexity of willows (Acar et al. 2022; Azuma et al. 2000; Barkalov and Kozyrenko 2014a,b; Chen et al. 2010; Hardig et al. 2010; He et al. 2021; Lauron-Moreau et al. 2015; Sanderson et al. 2023; Wagner et al. 2018, 2021): early studies based on chloroplast and nuclear ribosomal genes revealed key evolutionary trends in the genus Salix and contributed to proposed taxonomic rearrangements at subgenus levels. In particular, evidence confirmed that Salix subgenera Vetrix Dumortier and Chamaetia (Dumortier) Nasarov formed a mixed clade, suggesting their recent diversification and the repeated evolution of dwarf arctic/alpine willows (subg. Chamaetia ) (Acar et al. 2022; Azuma et al. 2000; Barkalov and Kozyrenko 2014a; Chen et al. 2010; Hardig et al. 2010; Lauron-Moreau et al. 2015; Sanderson et al. 2023). Recent advances in genomic sequencing have enabled the high-throughput phylogenetic analysis of willows, thereby revealing the complex evolutionary history of this clade at lower taxonomic levels, particularly within the Vetrix-Chamaetia complex (Chen et al. 2025; He et al. 2021; Ogutcen et al. 2024; Sanderson et al. 2023; Wagner et al. 2018, 2021). Salix species in the Japanese Archipelago have been well described: The most updated classification of Salix by Ohashi (2001) classified the genus into six subgenera, namely, Salix, Protitea , Pleuradenia , Chosenia , Chamaetia and Vetrix , and describes 27 native species (Table 1), of which the majority (17) belong to subg. Vetrix (further classified into 9 sections), with three alpine dwarf willows included in the subg. Chamaetia (3 sections) . Although they apparently have links with continental East Asia, including Northeast China, the Korean Peninsula, Far Eastern Russia, and—in rare cases—Europe, they also show a moderate level of endemism (30%), harboring seven endemic species and two subspecies. However, phylogenetic research on Salix has not progressed in Japan since the earlier classical studies (Azuma et al. 2000), and the systematic origins of these species remain unclear. In the present study, we aim to reveal the phylogenetic distinctiveness and affinity among Japanese Salix taxa. We particularly focus on several endemic taxa within the subg. Vetrix-Chamaetia complex and assess hypotheses concerning their systematic origins, as inferred from their distributional patterns and present taxonomic assignment: One examples of such endemic species is S. hukaoana Kimura, which was first discovered in 1972 (Kimura 1973), and currently known as a major component of the mountainous riparian forests of northern Honshu Island (Kikuchi and Suzuki 2010). It was once considered to be related to Salix sect. Daphnella , but was soon given a novel monotypic section Hukaoana on its unique morphological traits (Kimura 1973, 1974). We developed hypothesis of the hybrid origin of S. hukaoana ( S. gracilistyla Miq. × S. rorida ), based on its intermediate morphological traits and distribution: (1) connate stamens in male flowers shared with S. gracilistyla (and sect. Helix ); (2) the yellow inner bark shared with sect. Daphnella (including S. rorida ); (3) sympatric occurrence and hybrid formation with S. gracilistyla ; and (4) parapatric distribution with S. rorida , sharing similar ecological niches as tall trees constituting upper mountainous riparian forests in northern Japan (Kikuchi and Suzuki 2010). Another example comprises three local endemic species— S. rupifraga Koidz. , S. shiraii Seemen , and S. japonica Thunb. Their taxonomic assignment to Salix sect. Hastatae (Fries) A. Kerner indicates close phylogenetic relationships with exotic consectional species. However, their localized distributions to narrow volcanic areas (Ohashi and Yonekura 2006) may suggest recent speciation (e.g., Sciandrello et al. 2020). Furthermore, this study addressed some intraspecific taxa, including two subspecies of S. miyabeana Seemen and three of S. nakamurana Koidz., which are sometimes regarded as distinct species by some taxonomists. Here we acquired multilocus sequences from low-copy nuclear genes (Sang 2002), and conducted a phylogenetic network analysis and divergence time estimation to reveal the divergence patterns and time scales of the focal species. Low copy genes are convenient and still informative phylogenetic tools and are expected to serve a preliminary insight into the phylogenetic origins of Japanese willows preceding future genomic researches. Materials and Methods Data collection This study covered all willow species native to Japan (Table 1, Online Resource 1), along with 18 foreign willows and five (two native and three foreign) poplars ( Populus L.) as outgroups. Leaf samples were collected from botanical gardens, herbarium specimens, and individuals in the field (Table 1). DNA was extracted from leaves using a DNeasy Plant Mini Kit (Qiagen, Maryland, USA) and diluted to a concentration of ~1 ng µL −1 . We obtained sequences from three chloroplast intergenic regions ( trnL - trnF , trnR - trnN , and atpB - rbcL ) and three low-copy nuclear (COS) genes (chloroplast-expressed glutamine synthetase ( ncpGS ), glucose-6-phosphate isomerase ( PGI ), and 6-phosphogluconate dehydrogenase ( 6PG )). Universal primers (Suyama et al. 2000; Taberlet et al. 1991; Terachi 1993) were used to amplify the chloroplast regions, whereas specific primers for the amplification of nuclear genes were designed to target the exonal regions (Table 2) using OLIGO version 6.65 (Molecular Biology Insights, Inc.). These primers were designed for the target sequence of Populus trichocarpa Torr. & Gray retrieved from the JGI PhycoCosm database (Grigoriev et al. 2021; https://phycocosm.jgi.doe.gov/phycocosm/home). PCR was performed using a PerkinElmer 9700 Thermocycler in 10µL reaction mixtures. These consisted of ~0.5 ng template DNA, 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 2.0 mM MgCl 2 , 0.2 mM of each dNTP, 0.15 µm of each primer and 0.25 U Taq polymerase. The PCR conditions were as follows: 94°C for 3 min, followed by 35–40 cycles of 94°C for 1 min, 55°C for 1 min and 72°C for 2 min, with a final extension of 72°C for 5 min. PCR products were then purified (ExoSAP -IT, Amersham Biosciences) before being subjected to cycle sequencing using an ABI Big Dye™ Terminator Cycle Sequencing Kit version 3.1 (Applied Biosystems, Foster City, USA), and finally analyzed on an ABI 3100 automated sequencer (Applied Biosystems). Sequences were read in both directions using forward and reverse amplification primers; if needed, we also used internal sequencing primers designed for this study (Table 2). Sequence editing and assembly were performed using the CodonCode Aligner version 3.7.1 (CodonCode Corporation) to generate consensus sequences. Heterozygous substitutions in the nuclear genes were coded using IUPAC ambiguity codes. Sequences with multiple heterozygous indels were not successfully assembled and excluded from further analyses. All assembled sequences are registered in the DNA Data Bank of Japan (Online Resource 1). Multiple sequence alignments were performed using the ClustalW2 algorithm, as implemented in the SeaView alignment editor (Gouy et al. 2010). Nuclear sequences were then phased into haplotypes using the PHASE algorithm as implemented in DnaSP version 6 (Librado and Rozas 2009) and used to compute haplotype diversity ( Hd ), nucleotide diversity ( Pi ), and Tajima’s D (Tajima 1989) to test the neutral evolution hypothesis. Phylogenetic reconstruction Gene trees were constructed for four loci—one chloroplast region and three nuclear genes—based on the successfully assembled data (Online Resource 1). For the three nuclear loci, both unphased and phased datasets were prepared and analyzed. The sequences were collapsed into unique haplotypes/genotypes using DnaSP to generate reduced datasets. Populus species, and if not available, S. chaenomeloides Kimura, was used as the outgroup. Phylogenetic reconstruction was performed using maximum likelihood (ML) and Bayesian inference (BI) methods. Prior to analysis, exonic regions of the nuclear ncpGS and PGI genes were identified via the JGI PhycoCosm database and removed, whereas the 6PG gene, which is entirely exonic, was analyzed without modification. ML trees were constructed using RAxML version 8.2.10 (Stamatakis 2014) with a raxmlGUI 2 (Edler et al. 2021) graphical interface, and the bootstrap confidence values of the nodes were evaluated by generating one thousand bootstrap replicates. The BI method was executed using MrBayes version 3.2.7 (Ronquist et al. 2012). Two independent runs containing four Markov chain Monte Carlo chains (one hot and three cold) were performed until the average standard deviation of the split frequencies fell below 0.01. Trees were saved every 500 generations and the first 10% were discarded as burn-in. The optimal substitution models were selected using jModelTest version 2.1.10 (Posada 2008) for the chloroplast and phased ncpGS and PGI gene sequences, and the alternative supported models were employed in MrBayes and RAxML analyses. For the other data sets (including the unphased nuclear genes and the phased sequences of the 6PG gene), we ran a reversible-jump MCMC (rjMCMC) implemented in MrBayes and applied a GTR + Γ + I model in RAxML. Moreover, evolutionary relationships within the genus Salix were visualized using phylogenetic network analysis. A combined data matrix was generated for the 68 samples associated with a complete dataset by concatenating the unphased sequences of all genes, including both exonic and intronic sequences. A phylogenetic network was constructed using the NeighborNet algorithm based on the uncorrected P distance, as implemented in SplitsTree 6.6.1 (Huson and Bryant 2006). Split support values were computed using 1,000 bootstrap replicates. Additionally, phylogenetic network analysis was performed to test for the hybrid origin of species and for the ncpGS and PGI genes separately, as the focal species suspected of a hybrid had an incomplete dataset. This analysis incorporated partially assembled sequences of the focal species, that is, the ncsGS sequence from S. nakamurana subsp. nakamurana and the PGI sequence of S. miyabeana subsp. miyabeana . Divergence time estimation The divergence time was estimated using a Bayesian inference method implemented in BEAST version 2.6.7 (Drummond and Rambaut 2007). We performed species tree analysis using StarBEAST3 and estimated posterior mean values and 95% highest posterior density (HPD) intervals of divergence time for all nodes. We used a Yule speciation prior and applied a species tree relaxed clock model and HKY substitution model. Molecular dating was calibrated using fossil records as follows (Wu et al. 2015). The first calibration point was set at 48 Ma (normal distribution, SD = 0.3) for the root node of Salicaceae sensu strict. This was based on an approximately 48-million-year-old fossil from the early Eocene in North America ( “Populus tidwellii” ), which most likely represents the stem lineage leading to Populus and Salix (Manchester et al. 2006). The second calibration was set at 23 Ma (normal distribution, SD = 0.3) for the root node of the Vetrix-Chamaetia clade based on the earliest reliable Salix fossils from Late Oligocene deposits (23 Ma) in Alaska, which were found to be affiliated with subg. Vetrix (Wolfe 1987). This method of calibration differed from that used in previous studies (He et al. 2021; Wu et al. 2015), which used the age of the earliest “Vetrix” fossils to calibrate the nodes for the divergence between Vetrix and Chamaetia . Instead, we performed fossil calibration of the most recent common ancestor of the Vetrix-Chamaetia clade, since subg. Chamaetia was found to be polyphyletic. We ran the MCMC chains for 100,000,000 generations, sampling every 50,000 th generation, using Tracer to ensure that the runs converged and had ESS values of >200. Consensus trees were calculated after discarding the first 10% of trees as burn-in. Only the highly variable intronic (unphased) sequences of the ncpGS and PGI genes were subjected to this analysis because preliminary multispecies coalescent runs that incorporated all four loci failed to converge despite extended MCMC chains. Results Sequences containing multiple heterozygous indels were often detected in nuclear ncpGS and PGI genes, particularly in the polyploid species of the Populus and Salix subg. Salix species (Table 1). After omitting these, we obtained 711 assembled sequences with a total of 5,428 aligned base pairs (bp) from the chloroplasts and three nucleotide genes (GenBank accession numbers LC757833-758526 and LC859069-859110, Online Resource 1). Based on the phased nuclear and haplotypic chloroplast sequences, the loci differed markedly in their levels of polymorphism, with parsimony-informative sites ranging from 94 in the chloroplast regions to 181 in PGI ( ncpGS : 162) and nucleotide diversity (π) ranging from 0.00517 (chloroplast) to 0.02752 ( ncpGS ). These patterns indicate that the nuclear intronic loci ( ncpGS and PGI ) contain substantially greater phylogenetically informative variation than the exon-dominated 6PG gene or the chloroplast regions. Summary statistics are presented in Table 3. The best-fit models of nucleotide substitutions for nuclear intronic sequences in the ncpGS and PGI genes and the chloroplast atpB-rbcL , trnR-trnN , and trnL-trnF intergenic regions were the TPM2uf+G, HKY+G, TPM3uf, F81+I, and HKY+G models, respectively. Gene trees Figure 1(a-d) shows Bayesian trees based on the chloroplast sequences and unphased sequences of the nuclear genes, with the bootstrap values of ML indicated. Those for the phased nuclear sequences are provided in Online Resources 2(a-c). The data used to construct each gene tree are listed in Online Resource 1. The tree topologies obtained using the Bayesian and ML methods were mostly congruent, except for the 6PG gene, for which only the major clades were supported by both methods. The chloroplast phylogeny (Fig. 1a) indicates two diverging clades in Salix . One comprises subg. Salix (except S. triandra L.) and Salix subg. Protitea Kimura, and the other includes subg. Vetrix-Chamaetia , with S. triandra as the first diverging clade, followed by S. arbutifolia Pall ( Salix subg. Chosenia (Nakai) H.Ohashi ), and S. cardiophylla Trautv. & Mey. ( Salix subg. Pleuradenia Kimura). The phylogenetic relationships at lower taxonomic levels were not resolved, except that S. hukaoana was located within a single lineage with some S. rorida Lacksch. specimens. The exonic sequences of 6 PG also provided poorly resolved phylogenies (Fig. 1b and Online Resource 2a). Unphased data confirmed the early divergence of subg. Protitea and the subgenera Chosenia and Pleuradenia . (Fig. 1b). In contrast, gene genealogy based on phased data identified one allele from the subg. Salix (except for S. triandra ) within the early diverging clades (Online Resource 2a). The phylogenetic relationships within the Vetrix-Chamaetia clade were not resolved, except that S. triandra was shown to be monophyletic. Intronic sequences in nuclear COS genes (i.e., ncpGS and PGI ) provided highly resolved phylogenetic trees, although the low success of sequence assembly reduced the number of analyzed taxa, particularly for polyploid species of sect. Sieboldianae C. K. Schneid. ( S. sieboldiana Blume and S. reinii Seemen) along with subg. Salix (i.e., S. eriocarpa Franch. & Sav., and S. jessoensis Seemen; Table 1). The major clade comprising subg. Vetrix-Chamaetia together with S. arbutifolia, S. cardiophylla , and S. triandra was maintained in both trees, although S. arbutifolia and S. cardiophylla were nested within the Vetrix-Chamaetia clade in the ncpGS gene tree (Fig. 1c-d and Online Resource 2b-c). Although a common pattern was observed between the two nuclear loci regarding the internal structure of subg. Vetrix – Chamaetia m, in which one lineage consistently grouped Salix sects. Hukaoana Kimura, Daphnella Seringe, Subviminales C. K. Schneid., and Helix Dumortier, the gene trees exhibited substantial topological incongruence. Our analyses also indicated that S. miyabeana (sect. Helix ) is polyphyletic, with subsp. miyabeana located distantly from subsp. gymnolepis (H. Lév. et Vaniot) H. Ohashi et Yonek. and instead closely related with S. schwerinii E. Wolf (sect. Viminella Seringe). Phylogenetic network NeighborNet analysis involved 67 samples from 24 species for which successfully assembled sequences of all genes were available, and therefore lacked some native species (i.e., S. subopposita Miq., S. sieboldiana , S. reinii , and S. taraikensis Kimura). Nevertheless, the phylogenetic network (Fig. 2) effectively resolved the species-level relationships within subg. Vetrix-Chamaetia . It represented three major lineage groups (Groups I-III) in which the Japanese species of subg. Vetrix evolved into, showing some basal reticulation. The first group (Group I) comprised sects. Subviminales , Daphnella , Helix , and Hukaoana . Within this group, S. hukaoana (sect. Hukaoana ) showed distinct divergence without evidence of recent reticulation events, while the species of sect. Helix were placed near a peripheral reticulation. The second group (Group II) almost exclusively consisted of sect. Viminella with the exception of S. miyabeana subsp. miyabeana , positioned distantly from subsp. gymnolepis . This group further divides into two sublineages ( S. udensis and the others), whose terminal branches are connected via peripheral reticulations. The third group (Group III) included Salix sects. Cinerella Seringe, Hastatae and Incubaceae A.Kerner. Notably, sects. Cinerella and Hastatae showed progenitor-derivative relationships, where the species of sect. Hastatae (i.e., S. japonica , S. rupifraga , and S. shiraii , all endemic species) descended from S. vulpina Andersson. In contrast, S. futura Seemen, another endemic species, diverged from the roots of this group, sharing a reticulation with S. vulpina . In contrast, the alpine dwarf willows (subg. Chamaetia ) branched from the bases of the phylogenetic network, with S. nummularia Andersson at the base of Group II, S. nakamurana subsp. nakamurana at the base of Group III, while the others located at the intermediated positions. The gene phylogenetic networks (Online Resource 3a,b) were less resolved but helped to detect the occurrence of hybridization. While the phased PGI sequences of S. miyabeana subsp. miyabeana (A) were positioned close to those of S. schwerinii , those of the sample (B) fell into separate positions, one close to the sect. Viminella and another close to subsp. gymnolepis. At the 14 heterozygous sites recognized from this sample, one sequence variant matched S. miyabeana subsp. gilgiana , whereas the other matched multiple potential species including S. schwerinii , S. vulpina , S. udensis , S. caprea , S. nummularia , S. nakamurana , and S. reinii (Online Resource 4). The phased ncpGS sequences of S. nakamurana subsp. nakamurana (B) also showed signs of hybridization, with one grouped with subsp. kurilensis and the other falling close to sect. Viminella . At most (not all) of the 13 heterozygous sites, one sequence variant matched S. nakamurana subsp. kurilensis , whereas the other matched multiple potential species including S. nakamurana subsp. yezoalpina , S. nummularia , S. miyabeana subsp. gymnolepis (Online Resource 4). Divergent time estimation The estimated divergence times at the representative nodes are presented in Fig. 3 and summarized in Table 4. They suggest that the Helix/Daphnella/Hukaoana/Subviminales lineage group was diversified at 13.4 Ma, followed by the divergence of S. hukaoana at 12.2 Ma. The divergence of S. futura was estimated to have occurred approximately 9.4 Ma, whereas the endemic species group (classified as sect. Hastatae ) was estimated to have diverged 5.2 Ma, with diversification starting around 4.4 Ma and speciation of the alpine-adapted species S. rupifraga at 2.7 Ma. Discussion Recently, low-copy nuclear genes have become more widely used (Sang 2002; Zimmer and Wen 2013) as tools for robust phylogenetic reconstruction and taxonomic resolution. Although they have some disadvantages such as difficulties in isolating orthologous alleles and potential discordance due to incomplete lineage sorting and interspecific hybridization (Sang 2002, Small et al. 2004), phylogenetic inference based on multi-locus nuclear genes has proven to be a robust tool for addressing evolutionary relationships (Huson and Scornavacca 2011). In our study, several sources of phylogenetic uncertainty were evident. Polyploid species, particularly those in subg. Salix (except S. triandra ), often failed to assemble successfully or yielded divergent phased sequences (Fig. 1b, S1a), suggesting the presence of paralogs associated with gene duplication or polyploidization. None of the individual loci provided sufficient resolution at species or sectional levels: the chloroplast markers and the exonic 6PG gene exhibited low variability and did not resolve relationships within subg. Vetrix – Chamaetia (Fig. 1a,b; Online Resource 2a), whereas the intronic regions of ncpGS and PGI were more informative but still generated topological incongruence among gene trees (Fig. 1c,d; Online Resources 2b,c). In line with these patterns, the NeighborNet analysis revealed basal reticulation among the major lineages of the Vetrix–Chamaetia complex (Fig. 2), indicating that early diversification in Salix involved reticulate evolutionary processes that cannot be fully resolved using a limited number of loci likely reflecting incomplete lineage sorting and historical hybridization/introgression (Degnan and Rosenberg 2009). Collectively, these findings underscore the limitations of single- or few-locus datasets for reconstructing deep relationships in Salix and highlight the need for future genome-scale analyses to disentangle gene discordance, detect ancient hybridization, and clarify lineage diversification among Japanese Salix species. Nevertheless, analysis based on the combined dataset—particularly the NeighborNet network—provided a certain level of phylogenetic resolution, most notably within subg. Vetrix-Chamaetia (Fig. 2) and yielded valuable insights into the systematic origins of key endemic species, as discussed below. In parallel with the network analysis, divergence-time estimation using BEAST allowed us to place these phylogenetic patterns within a temporal framework. Previous studies have estimated divergence times in Salix (He et al. 2021; Marinček et al. 2024; Sanderson et al. 2023; Wu et al. 2015), although only a few have incorporated multiple fossil calibration points. By adopting a comparable calibration strategy, our estimates for major nodes (e.g., nodes B,C,F, and I and the divergence between S. arbutifolia and S. cardiophylla ; Fig. 3) closely match those of earlier studies, thereby supporting the robustness of our dating results. Ancient origin of S. hukaoana and S. futura Previous studies proposed that sects. Helix, Daphnella , and Subviminales have a high degree of relatedness. (He et al. 2021; Wagner et al. 2018, 2021). We observed that S. hukaoana (sect. Hukaoana ) belongs to this group (Group I). This group harbors morphologically diverse species, ranging from shrubs and tall trees, with lanceolate to elliptical leaves and opposite to alternate leaves. Although no obvious synapomorphies were observed, several traits were partially shared. This lineage likely emerged during the early evolutionary stage of subg. Vetrix-Chamaetia and diverged into variable sections by the Middle Miocene (Table 3). This finding is congruent with fossil records from the late Middle Miocene in Japan, which are thought to reflect extant species from sects. Helix and Subviminales (Narita et al. 2020). Within this group, S. hukaoana was distinctly diverged from the other sections without recent reticulations, which disconfirms the recent hybrid-speciation hypothesis of S. hukaoana based on its intermediate traits and distribution (see Introduction). Therefore, our results indicate that the traits of S. hukaoana are not a by-product of recent hybrid speciation, but rather a combination of apomorphic and plesiomorphic characters (which may have stemmed from ancient reticulate evolution). Moreover, there still remains a possibility of secondary hybridization and introgression between S. hukaoana and S. rorida , as indicated by the presence of shared haplotypes/genotypes in the chloroplast and PGI genes (Fig. 1a; Online Resource 2b). The divergence time of S. hukaoana from other species examined in this study is estimated to be in the late Middle Miocene (ca. 12 Ma). Given that its closest extant relative known to date is S. baileyi C.K. Schneider, a shrub endemic to central and eastern China, S. hukaoana was regarded as a relict of ancient origin. The other endemic species of ancient origin was S. futura (Group III, further discussed below), which was estimated to have split from the S. vulpina lineage a bit later (9 Ma) in the Late Miocene. These periods are characterized by a global cooling trend after the Middle Miocene Climatic Optimum (Pavlyutkin et al. 2016), and the megafossil flora in North Japan shows a dominance of Fagus species, suggesting an expansion of beech forests around that time. S. futura may be a relic lineage of early cool-temperate flora in Japan, which persisted despite the presence of derived species. Evidence of interspecific hybridization in S. miyabeana subsp. miyabeana Subg. Vetrix of Group II was composed of narrow-leaved riparian species, and almost exclusively comprised of the sect. Viminella, which is a phylogenetic group well supported by the recent genomic studies (Wagner et al. 2018; 2020, He et al. 2021), with the exception of S. miyabeana subsp . miyabeana (sect. Helix ). S. miyabeana subsp. miyabeana is the type subspecies, distinguished from subsp. gymnolepis only by subtle morphological characters, including more elongated leaves, shorter styles, and nearly sessile ovary stipes. In addition, although subsp. gymnolepis typically bears a single connate stamen in each male flower, subsp. miyabeana occasionally produces male flowers with two stamens within the same inflorescence . In our study, the only sample with full data set was shown to be distantly related to subsp. gymnolepis (Group I) and the most closely related to S. schwerinii , whereas another individual with incomplete data set (the sample B) showed the evidence of hybrid origin (Online Resource 3a, 4). S. miyabeana subsp. miyabeana is distributed more northerly (i.e., Hokkaido Island) than subsp. gymnolepis (i.e., the southern tip of Hokkaido to Honshu) and has a greater opportunity to grow sympatrically with S. schwerinii (northern Japan). These results suggested that S. miyabeana subsp . miyabeana was, at least, not phylogenetically homogeneous with subsp. gymnolepis and was likely subject to some degree of genetic introgression from S. schweriniii . We can hypothesize that intersectional hybridization with S. schwerinii has driven subspecies differentiation in S. miyabeana , however, clarifying the details of hybridization status—including the extent of hybridization/introgression and the occurrence of polyploidization in hybrids—will require examining a larger sample size and more extensive genetic data in future studies. Radiative speciation of local endemic species of “sect. Hastatae ” Subg. Vetrix in Group III comprises the round-leaved hillside willows of sects. Cinerella and Hastatae . Uncovered by the NeighborNet analysis, the placement of S. taraikensis (sect. Cinerella ) remains unclear. Available evidence from the PGI tree suggests a close but distinct relationship with other Cinerella species (Fig. 1c; Online Resource 2c). This is noteworthy, as previous studies have identified early divergence in S. starkeana Willd. (Wagner et al. 2020, 2021) , which was classified together with S. taraikensis as the subsect. Substriatae Goerz by Eurasian taxonomists (Skvortsov 1999). Group III represents an ancestor-descendant relationship between S. vulpina (subg. Cinerella ) and the Japanese species of sect. Hastatae , with the latter being a derived monophyletic lineage that diverged from S. vulpina around 5.2 Ma and subsequently diversified at 4.4–2.7 Ma into three species (Fig. 3, Table 4). the Japanese members of sect. Hastatae require taxonomic reevaluation. Previous studies (Wagner et al. 2021; Marinček et al. 2024) have suggested that sect. Hastatae is polyphyletic, no previous study has documented its members being nested within sect. Cinerella as found in our study. These findings imply that the Japanese members of sect. Hastatae at least require taxonomic reevaluation. More notably, our results may provide significant insight into the plant speciation process within the Japanese Archipelago. These three willow species are local endemics belonging to the so-called “Fossa Magna element,” a biogeographic group restricted to the Fuji Volcanic Zone, extending from the Izu Islands to central Honshu. The endemism of the Fossa Magna element is generally interpreted as having evolved through adaptation to volcanic environments (Takahashi 1971), which were created by the emergence of volcanic islands and repeated collisions with central Honshu since the Miocene (Maruyama et al. 1997; Takagi et al. 1993). Consistent with this scenario, the estimated divergence times of these endemic willows coincide with major volcanic episodes in this region and closely match that of Rubus trifidus Thunb. (6.9 Ma), another representative member of the Fossa Magna element (Kikuchi et al. 2022). Moreover, these willows exhibit striking ecological and morphological diversification—from hillside shrubs to alpine dwarf forms (Ohashi and Yonekura 2006)—suggesting that they have undergone adaptive radiation within this dynamic geological setting. Taken together, these findings may highlight volcanic and tectonic activity as key drivers of plant speciation in the Japanese Archipelago. However, this scenario warrants cautious interpretation, as neither the present study nor previous investigations has yet produced a comprehensive phylogenetic framework for Salix . Given the substantial number of species that remain unexamined, it is possible that unsampled lineages may have played a role in the origin of the Japanese species of sect. Hastatae . Polyphyly and ancient divergence of subg. Chamaetia The findings on subg. Chamaetia species in Japan obtained in this study—such as the polyphyly of this subgenus and the placement of S. nummularia and S. fuscencens at the basal position near sect. Viminella and near sect. Cinerella , respectively—are consistent with the results of previous studies (Lauron-Moreau et al. 2015; Wagner et al. 2018, 2021; Marinček et al. 2024). In contrast, the phylogenetic position of S. nakamurana does not allow a clear interpretation: our results showed distinct divergence between subsp. kurilensis and subsp. yezoalpina (Fig. 3). Moreover, the nuclear genes of subsp. nakamurana show heterozygosity for divergent alleles, a pattern consistent with either hybridization between subsp. kurilensis and subsp. yezoalpina or interspecific hybridization with an unidentified species (Online Resource 3b,4). However, the current data are insufficient to distinguish between these possibilities. Nevertheless, our analyses clearly demonstrate that the nuclear genes of S. nakamurana harbor alleles that are differentiated among its subspecies. Such differentiation may indicate polyphyly of S. nakamurana , subspecific lineage divergence driven by geographic isolation, incomplete lineage sorting of divergent alleles, or the influence of interspecific hybridization. Future genomic analyses will be required to evaluate these alternative scenarios. Finally, our divergence-time estimates suggest that the origin and diversification of Japanese Chamaetia species—including S. nakamurana , S. nummularia , and S. fuscescens —date back to the Miocene (Fig. 3; Table 4). This timing corresponds to major climatic transitions, beginning with the warm Middle Miocene followed by global cooling and Antarctic ice sheet expansion (Herbert et al. 2016), and agrees with fossil evidence (Wolfe 1987) as well as recent estimates indicating that the radiation of shrub willows began in the Miocene (Marinček et al. 2024). Conclusion Despite the methodological limitations of Sanger sequencing, phylogenetic analyses using nuclear COS genes and chloroplast sequences in this study provide significant insights into the evolutionary relationships and timescale of diversification of Salix species in Japan. In particular, the results clarified the origins of several endemic taxa through a range of speciation processes, identifying ancient relicts ( S. hukaoana and S. futura ) and recently derived neoendemics ( S. japonica , S. shiraii and S. rupifraga ), and possible cases of lineage differentiation influenced by interspecific/intraspecific hybridization ( S. miyabeana subsp. miyabeana and S. nakamurana subsp. nakamurana ). These findings underscore the complexity of evolutionary dynamics within the Japanese willow flora, highlighting the need for future genome-scale studies to test these hypotheses and clarify the speciation mechanisms of Japanese Salix . Declarations Acknowledgements We are grateful to Tohoku University Botanical Gardens (Sendai City, Miyagi Prefecture, Japan) and Mitsuo Yashima for their support in obtaining samples from the Salix collection, to Prof. Ken Sato in obtaining alpine willows in Hokkaido, and to Dr. Hiroshi Yoshimaru, Kensuke Yoshimura, and Yasuko Kawamata for providing DNA samples from the DNA-barcoding project. We also thank Etsuko Ihara and Akiko Takazawa for their support and contribution to the laboratory work. Finally, we thank Prof. Hiroyoshi Ohashi, Prof. Mineaki Aizawa and Mr. Wataru Fukaya for providing valuable comments on the taxonomy and phylogeny of Salix . This study was financially supported by the Japanese Society for the Promotion of Science (JSPS KAKENHI; grant numbers 20248017, 25292098, 24770081, and 24K02090). Competing Interests : The authors declare that they have no conflicts of interest. References Acar P, Değirmenci FÖ, Duman H, Kaya Z (2022) Molecular phylogenetic analysis resolving the taxonomic discrepancies among Salix L. species naturally found in Turkey. Dendrobiology 87:13–26. https://doi.org/10.12657/denbio.087.002 Argus GW (1997) Infrageneric Classification of Salix (Salicaceae) in the New World. Syst Bot Monogr 52:1. https://doi.org/10.2307/25096638 Azuma T, Kajita T, Yokoyama J, Hiroyoshi O (2000) Phylogenetic relationships of Salix (Salicaceae) based on rbcL sequence data. Am J Bot 87:67–75 Barkalov VY, Kozyrenko MM (2014a) Phylogenetic analysis of the Far Eastern Salix (Salicaceae) based on sequence data from chloroplast DNA regions and ITS of nuclear ribosomal DNA. Bot Pac 3: 3-19 Barkalov VY, Kozyrenko MM (2014b). Phylogenetic relationships of Salix L. subg. Salix species (Salicaceae) according to sequencing data of intergenic spacers of the chloroplast genome and ITS rDNA. Russ J Genet 50: 828-837 Chen J, Sun H, Wen J, Yang Y (2010) Molecular phylogeny of Salix L.(Salicaceae) inferred from three chloroplast datasets and its systematic implications. Taxon 59:29–37 Chen K, Wang J, Xiang R, Yang X, Yun Q, Huang Y, Sun H, Chen J (2025). Backbone phylogeny of Salix based on genome skimming data. Plant Diversity 47: 178-188. Cronk Q, Ruzzier E, Belyaeva I, Percy D (2015) Salix transect of Europe: Latitudinal patterns in willow diversity from Greece to arctic Norway. Biodivers Data J 3:1–29. https://doi.org/10.3897/BDJ.3.e6258 Degnan JH, Rosenberg NA (2009) Gene tree discordance, phylogenetic inference and the multispecies coalescent. Trends Ecol Evol 24: 332-340. Dickmann DI, Kuzovkina J (2014) Poplars and willows of the world, with emphasis on silviculturally important species. In: Poplars and willows: Trees for society and the environment. CAB International Rome, pp 8–91 Drummond AJ, Rambaut A (2007) BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evol Biol 7:214. https://doi.org/10.1186/1471-2148-7-214 Edler D, Klein J, Antonelli A, Silvestro D (2021) raxmlGUI 2.0: A graphical interface and toolkit for phylogenetic analyses using RAxML. Methods Ecol Evol 12:373–377. https://doi.org/10.1111/2041-210X.13512 Fang CF, Zhao SD, Skvortsov AK (1999) Salicaceae. Flora of China (4: 139-274). In: Wu Z-Y, Raven PH (eds) Flora of China, vol. 4. Science Press; Missouri Botanical Garden Press, Beijing; St Louis, pp 139–274 Gouy M, Guindon S, Gascuel O (2010) SeaView version 4: A multiplatform graphical user interface for sequence alignment and phylogenetic tree building. Mol Biol Evol 27:221–224. https://doi.org/10.1093/molbev/msp259 Grigoriev I V., Hayes RD, Calhoun S, et al (2021) PhycoCosm, a comparative algal genomics resource. Nucleic Acids Res 49:D1004–D1011. https://doi.org/10.1093/nar/gkaa898 Gulyaev S, Cai XJ, Guo FY, et al (2022) The phylogeny of Salix revealed by whole genome re-sequencing suggests different sex-determination systems in major groups of the genus. Ann Bot 129:485–498. https://doi.org/10.1093/aob/mcac012 Hardig TM, Anttila CK, Brunsfeld SJ (2010) A Phylogenetic Analysis of Salix (Salicaceae) Based on matK and Ribosomal DNA Sequence Data. J Bot 2010:1–12. https://doi.org/10.1155/2010/197696 He L, Wagner ND, Hörandl E (2021) Restriction-site associated DNA sequencing data reveal a radiation of willow species (Salix L., Salicaceae) in the Hengduan Mountains and adjacent areas. J Syst Evol 59:44–57. https://doi.org/10.1111/jse.12593 Herbert TD, Lawrence KT, Tzanova A, Peterson LC, Caballero-Gill RP, Kelly CS (2016) Late Miocene global cooling and the rise of modern ecosystems. Nat Geosci 9:843–847. Huson DH, Bryant D (2006) Application of phylogenetic networks in evolutionary studies. Mol Biol Evol 23:254–67. https://doi.org/10.1093/molbev/msj030 Huson DH, Scornavacca C (2011) A survey of combinatorial methods for phylogenetic networks. Genome Biol Evol 3:23–35. https://doi.org/10.1093/gbe/evq077 Kikuchi S, Mimura M, Naruhashi N, et al (2022) Phylogenetic inferences using nuclear ribosomal ITS and chloroplast sequences provide insights into the biogeographic origins, diversification timescales and trait evolution of Rubus in the Japanese Archipelago. Plant Syst Evol 308: 20. https://doi.org/10.1007/s00606-022-01810-6 Kikuchi S, Suzuki W (2010) Distribution of an endangered willow, Salix hukaoana, on the Japan Sea side of northeastern Honshu. Japanese J Conserv Ecol 15:89–99 Kimura A (1973) Salicis nava species ex regione Okutonensi in Japonia. J Jpn Bot 48:321–326 Kimura A (1974) De Salicis Hukaoanae Kimura systematico positu. J Jpn Bot 49:46 Lauron-Moreau A, Pitre FE, Argus GW, et al (2015) Phylogenetic relationships of American Willows (Salix L., Salicaceae). PLoS One 10: e0121965. https://doi.org/10.1371/journal.pone.0121965 Librado P, Rozas J (2009) DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25:1451–1452. https://doi.org/10.1093/bioinformatics/btp187 Manchester SR, Judd WS, Handley B (2006) Foliage and fruits of early poplars (Salicaceae: Populus) from the eocene of Utah, Colorado, and Wyoming. Int J Plant Sci 167:897–908. https://doi.org/10.1086/503918 Marinček P, Léveillé‐Bourret É, Heiduk F, Leong J, Bailleul SM, Volf M, Wagner ND. 2024. Challenge accepted: Evolutionary lineages versus taxonomic classification of North American shrub willows (Salix). Am J Bot, 111: e16361. Maruyama S, Isozaki Y, Kimura G, Terabayashi M (1997) Paleogeographic maps of the Japanese Islands: Plate tectonic synthesis from 750 Ma to the present. Isl Arc 6:121–142. https://doi.org/10.1111/j.1440-1738.1997.tb00043.x Narita A, Yabe A, Uemura K, Matsumoto M (2020) Late middle Miocene Konan flora from northern Hokkaido, Japan. Acta Palaeobot 60:259–295. https://doi.org/10.35535/acpa-2020-0012 Newsholme C (1992) Willows: the genus Salix. Timber Press, Inc. Ogutcen E, de Lima Ferreira P, Wagner ND, Marinček P, Leong JV, Aubona G, Jeannine GB, Michálek J, Schroeder L, Sedio BE, Vašut RJ, Volf M (2024). Phylogenetic insights into the Salicaceae: the evolution of willows and beyond. Mol Phylogenet Evol 199: 108161. Ohashi H (2000) A systematic enumeration of Japanese Salix (Salicaceae). J Japanese Bot 75:1–41 Ohashi H (2001) Salicaceae of Japan. Sci Rep Toboku Univ 4th Ser Biol 40:269–396 Ohashi H, Yonekura K (2006) Additions and corrections for Salicaceae of Japan 2. J Japanese Bot 81:75–90 Pavlyutkin BI, Yabe A, GolozoubovVV, Simanenko LF (2016) Miocene floral changes in the circum-Japan Sea areas—their implications in the climatic changes and the time of Japan Sea Opening. Mem Natl Mus Nat Sci, Tokyo 51:109–123 Posada D (2008) jModelTest: phylogenetic model averaging. Mol Biol Evol 25:1253–6. https://doi.org/10.1093/molbev/msn083 Pučka I, Lazdiņa D (2013) Review about investigations of Salix spp. in Europe. Res Rural Dev 2:13–19 Sang T (2002) Utility of low-copy nuclear gene sequences in plant phylogenetics. Crit Rev Biochem Mol Biol 37:121–147 Sanderson BJ, Gambhir D, Feng G, Hu N, Cronk QC, Percy DM, Freaner FM, Johnson MG, Smart LB, Keefover-Ring K, Yin T, Ma T, DiFazio SP, Liu J, Olson MS. 2023. Phylogenomics reveals patterns of ancient hybridization and differential diversification that contribute to phylogenetic conflict in willows, poplars, and close relatives. Syst Biol 72: 1220-1232. Sciandrello S, Minissale P, Del Galdo GG (2020) Vascular plant species diversity of Mt. Etna (Sicily): endemicity, insularity and spatial patterns along the altitudinal gradient of the highest active volcano in Europe. PeerJ 8:e9875 Skvortsov AK (1999) Willows of Russia and Adjacent Countries: Taxonomical and Geographical Revision (transl. from: Skvortsov AK (1968) Willows of the USSR: Taxonomic and Geographic Revision. Nauka, Moscow). Joensuu Univ Joensuu Small RL, Cronn RC, Wendel JF (2004) Use of nuclear genes for phylogeny reconstruction in plants. Australian Syst Bot 17:145–170. Stamatakis A (2014) RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 30:1312–1313. https://doi.org/10.1093/bioinformatics/btu033 Suda Y (1964) Cytotaxonomical studies on the subfamily Salicoideae of the Salicaceae. PhD Thesis. Tohoku University (in Japanese). Suda Y, Argus GW (1969) Chromosome numbers of some North American arctic and boreal Salix. Can J Bot 47: 859-862. Suyama Y, Yoshimaru H, Tsumura Y (2000) Molecular phylogenetic position of Japanese Abies (Pinaceae) based on chloroplast DNA sequences. Mol Phylogenet Evol 16:271–277. https://doi.org/10.1006/mpev.2000.0795 Taberlet P, Gielly L, Pautou G, Bouvet J (1991) Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol Biol 17:1105–9 Tajima F (1989) Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123:585–595 Takagi K, Aoike K, Koyama M (1993) What happened on the northern tip of the Izu-Bonin arc during 15-10 Ma?. J Geog 102: 252–263 (in Japanese with English abstract). Takahashi H (1971) Fossa Magna element plants. Res Rep Kanagawa Prefect Museum Nat Hist 2:1–63 Terachi T (1993) Structural Alterations of Chloroplast Genome and Their Significance to the Higher Plant Evolution. Bull Inst Natl L Util Dev Kyoto Sangyo Univ 14:138–148 Wagner ND, Gramlich S, Hörandl E (2018) RAD sequencing resolved phylogenetic relationships in European shrub willows (Salix L. subg. Chamaetia and subg. Vetrix) and revealed multiple evolution of dwarf shrubs. Ecol Evol 8243–8255. https://doi.org/10.1002/ece3.4360 Wagner ND, He L, Hörandl E (2021) The evolutionary history, diversity, and ecology of willows (Salix l.) in the european alps. Diversity 13:1–16. https://doi.org/10.3390/d13040146 Wagner ND, He L, Hörandl E (2020) Phylogenomic Relationships and Evolution of Polyploid Salix Species Revealed by RAD Sequencing Data. Front Plant Sci 11:1–15. https://doi.org/10.3389/fpls.2020.01077 Wolfe JA (1987) An Overview of the Origins of the Modern Vegetation and Flora of the Northern Rocky Mountains. Ann Missouri Bot Gard 74:785. https://doi.org/10.2307/2399450 Wu J, Nyman T, Wang D-C, et al (2015) Phylogeny of Salix subgenus Salix s.l. (Salicaceae): delimitation, biogeography, and reticulate evolution. BMC Evol Biol 15:31. https://doi.org/10.1186/s12862-015-0311-7 Zimmer EA, Wen J (2013) Reprint of: Using nuclear gene data for plant phylogenetics: Progress and prospects. Mol Phylogenet Evol 66:539–550. https://doi.org/10.1016/j.ympev.2013.01.005 Tables Table 1. List of Salix species native to Japan and their taxonomic status (Ohashi 2001), along with the number of samples analyzed in this study. Ploidy levels are based on the previous reports including Suda Y (1964), Suda and Argus (1969) and Wagner et al. (2020). Subgenus Section Species Ploidy N Comments Pleuradenia Kimura Salix cardiophylla Trautv. & Mey. 2X 3 Chosenia (Nakai) H.Ohashi Salix arbutifolia Pall. 2X 1 Protitea Kimura Salix chaenomeloides Kimura 2X 4 Chamaetia (Dumortier) Nasarov Herbella Seringe Salix nummularia Andersson 2X 2 Myrtilloides (Borrer) Andersson Salix fuscescens Andersson 2X 3 Glaucae (Fries) Andersson Salix nakamurana Koidz. subsp. nakamurana unknown 2 Endemic to Japan subsp. yezoalpina (Koidz.) H.Ohashi unknown 3 Endemic to Japan subsp. kurilensis (Koidz.) H.Ohashi unknown 1 Salix L. Triandrae Dumortier Salix triandra L. 2X 3 Subalbae Koidz. Salix eriocarpa Franch. & Sav. 4X,5X 1 Salix pierotii Miq. 4X 2 Salix jessoensis Seemen 4X,6X 5 Endemic to Japan Vetrix Dumortier Hastatae (Fries) A.Kerner Salix japonica Thunb. 2X 2 Endemic to Japan Salix shiraii Seemen 2X 1 Endemic to Japan Salix rupifraga Koidz. 2X 2 Sieboldianae C.K.Schneid. Salix sieboldiana Blume 2X 4 Endemic to Japan Salix reinii Seemen 8X 2 Helix Dumortier Salix miyabeana Seemen subsp. miyabeana 4X 2 subsp. gymnolepis (H.Lév. et Vaniot) H.Ohashi et Yonek. 4X 2 Salix integra Thunb. 2X 2 Incubaceae A.Kerner Salix subopposita Miq. 2X 1 Subviminales C.K.Schneid. Salix gracilistyla Miq. 2X 7 Including one sample from Korea. Hukaoana Kimura Salix hukaoana Kimura unknown 15 Endemic to Japan Daphnella Seringe Salix rorida Lacksch. 2X 9 Including f. pendula Kimura (1) and f. roridaeformis (Nakai) Kimura ex H.Ohashi (1) Viminella Seringe Salix schwerinii E. Wolf 2X 4 Salix udensis Trautv. & Mey. 2X 13 Cinerella Seringe Salix taraikensis Kimura unknown 1 Salix caprea L. 2X 11 Including samples from Korea (2) and European subspecies subsp. coaetanea (Hartm.) Hiitonen (1) Salix futura Seemen 3X 2 Endemic to Japan Salix vulpina Andersson 2X 4 Table 2. List of the amplifying and reading primers developed for this study. Gene Type Primer Name Sequence (5′-3′) Location PGI glucose-6-phosphate isomerase amplifying/reading primer (Forward) Poptr_PGI + 2151 AAATGTAGATCCTATTGATGTTG CDS(exon) amplifying/reading primer (Reverse) Poptr_PGI − 2976 GCTGATCAATGCTTGATGCTCC CDS(exon) internal primer (Reverse) Poptr_PGI − 3442 TTGTTAGGATCAATGCCAAACT CDS(exon) ncpGS glutamine synthetase leaf isozyme amplifying/reading primer (Forward) Poptr_ncpGS + 1490 GATGCACATTATAAGGCTTG CDS(exon) amplifying/reading primer (Reverse) Poptr_ncpGS − 2449 AATGTGTTCCTTATGGCGAAG CDS(exon) internal reading primer (Reverse) Poptr_ncpGS − 2252 GGTGTGGCATCCAGCACC CDS(exon) internal reading primer (Forward) specific for subg. Vetrix-Chamaetia Poptr_ncpGS + 1848 CAGTATCCTTGTCAAAGATTTG intron 6PG 6-phosphogluconate dehydrogenase amplifying/reading primer (Forward) Poptr_6PG + 67 GCCCTTAATATCGCAGAG CDS(exon) amplifying/reading primer (Reverse) Poptr_6PG − 1195 TGGCAAGATCAGGATTCCTATCA CDS(exon) Table 3. Summary of sequence characteristics and genetic diversity statistics for the four loci ( 6PG , ncpGS , PGI , and chloroplast sequences). Values shown include the number of phased/haplotypic sequences, aligned sequence length, numbers of variable and parsimony-informative sites, nucleotide diversity (π), haplotype diversity ( Hd) , and Tajima’s D with associated significance levels. Measure 6PG ncpGS PGI Chloroplast (concatenated) Number of phased/haplotypic sequences 266 188 160 134 Aligned sequence length 957 721 905 2724 Variable sites 143 173 199 121 Parsimony infomative sites 115 162 181 94 π: nucleotide diversity (per site) 0.01017 0.02752 0.02285 0.00517 Hd : haplotype (gene) diversity 0.9387 0.962 0.955 0.894 Tajima's D -1.94209 -1.56752 -1.5044 -1.51405 Statistical significance P P > 0.05 P > 0.10 P > 0.10 Table 4. Mean divergence time estimates (Mya) of representative nodes (i.e., lettered nodes in Fig. 3) for Japanese native Salix species and lineage based on nuclear intronic sequences of the ncpGS and PGI genes. The 95% highest posterior density (HPD) interval is shown in parentheses. Node Event Mean Divergence Time (95% HPD) (Ma) A Root node of Salicaceae * 48.03 (46.09–49.99) B Divergence of S. triandra 34.80 (25.76 –44.87) C Divergence of S. arbutifollia/cardiophylla (Divergence of Vetrix-Chamaetia ) 30.54 (22.71–39.00) D Crown age of sugb. Vetrix-Chamaetia * 22.79 (20.85–24.72) E Divergence of subg. Chamaetia ( S. fuscescens ) 16.96 (8.34–24.57) F Divergence of subg. Chamaetia ( S. nakamurana / nummularia ) 13.74 (7.08–23.04) G Crown age of the Daphnella – Subviminalis – Helix – Hukaoana clade 13.42 (7.92- 18.85) H Divergence of S. hukaoana 12.21 (6.88–17.76) I Divergence between sects. Subviminalis and Helix 10.68 (4.96–16.49) J Divergence of S. futura 9.43 (3.37–16.50) K Divergence of Fossa-Magna element (endemic species of subg. Hastatae ) 5.21 (1.86–9.16) L Crown age of endemic species of subg. Hastatae 4.36 (0.84–8.21) M Divergence of S. rupifraga 2.72 (0–6.57) * Calibrated nodes Supplementary Files OnlineResource2.pptx OnlineResource3.pptx OnlineResource4.pptx OnlineResourceCaption.docx OnlineResources1.xlsx Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Minor revision 08 Feb, 2026 Reviewers agreed at journal 07 Jan, 2026 Reviewers invited by journal 07 Jan, 2026 Editor assigned by journal 10 Dec, 2025 First submitted to journal 07 Dec, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8303889","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":571146663,"identity":"05b76a39-8132-4378-8f3c-db6d6883d31b","order_by":0,"name":"Satoshi Kikuchi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABLElEQVRIie2RsWrDMBCGzwjkxUHrCZfmFWw8tJ7yKg6GTsnUpVMjCMhLQ9fsfYJO9WgTyCTI6qlgDJ3r0VslmwzBjulYir/pP6QP3ekAJib+IEgogCWwq3Qgiy3Jvp8AnO58VCFtsD1bLvdqTIFWgbMCzHOUb5Sr8IQ+YJPewzw55aUO7h2uapGnnzfA3jII057iEnrkO4XgqZgEM4VBuF+/i1w9OoBfEfD+e7fElq4ltQIxNSGGYv1R1TLSivKAy+vK/LWivJG4EcWqFPmIYhprFShiijOJxFPK6hT2MqjwLY3DnWmsqILAKDyRvp4lcijSKBuYBU9Hv2jks25sWZY6EEaIbiyNFowd8or3f+zMRlyUZlMUIzhwMXR7iHa5LAOr/rUyMTEx8X/5ASEhZ5HI5oSgAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0003-2858-9681","institution":"Forestry and Forest Products Research Institute: Shinrin Sogo Kenkyujo","correspondingAuthor":true,"prefix":"","firstName":"Satoshi","middleName":"","lastName":"Kikuchi","suffix":""},{"id":571146664,"identity":"d956e787-c665-4207-aa42-9c1c83de0ecb","order_by":1,"name":"Suzuki Setsuko","email":"","orcid":"","institution":"Forestry and Forest Products Research Institute: Shinrin Sogo Kenkyujo","correspondingAuthor":false,"prefix":"","firstName":"Suzuki","middleName":"","lastName":"Setsuko","suffix":""},{"id":571146665,"identity":"46592a85-8cd2-48f9-8780-9f2ef7f5157b","order_by":2,"name":"Teruyoshi Nagamitsu","email":"","orcid":"","institution":"Forestry and Forest Products Research Institute: Shinrin Sogo Kenkyujo","correspondingAuthor":false,"prefix":"","firstName":"Teruyoshi","middleName":"","lastName":"Nagamitsu","suffix":""},{"id":571146666,"identity":"7811e9f3-d6b6-482d-b590-8a44675002bb","order_by":3,"name":"Wajiro Suzuki","email":"","orcid":"","institution":"Tadami Beech Center","correspondingAuthor":false,"prefix":"","firstName":"Wajiro","middleName":"","lastName":"Suzuki","suffix":""}],"badges":[],"createdAt":"2025-12-08 05:45:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8303889/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8303889/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":99862466,"identity":"24c6a4ee-8e5a-48e9-b6b7-5d44d12b1a61","added_by":"auto","created_at":"2026-01-09 07:18:02","extension":"pptx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":164798,"visible":true,"origin":"","legend":"","description":"","filename":"Fig1genetree.pptx","url":"https://assets-eu.researchsquare.com/files/rs-8303889/v1/bb2af8ab271008978e14684f.pptx"},{"id":99862463,"identity":"a55a4f9f-53ea-468b-a717-0d943cf09b81","added_by":"auto","created_at":"2026-01-09 07:18:02","extension":"pptx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":58552,"visible":true,"origin":"","legend":"","description":"","filename":"Fig2NeighborNet.pptx","url":"https://assets-eu.researchsquare.com/files/rs-8303889/v1/a2187f5d071fab0d4ae394c6.pptx"},{"id":99862472,"identity":"a3a10154-6e76-4d31-b108-f7ec99bf6e99","added_by":"auto","created_at":"2026-01-09 07:18:02","extension":"pptx","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":64739,"visible":true,"origin":"","legend":"","description":"","filename":"Fig3divergencetime.pptx","url":"https://assets-eu.researchsquare.com/files/rs-8303889/v1/674a73ed6d039f91fa82b028.pptx"},{"id":99862471,"identity":"38a3048a-d2a7-40ec-9418-0ba2a71b3942","added_by":"auto","created_at":"2026-01-09 07:18:02","extension":"xml","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10447,"visible":true,"origin":"","legend":"","description":"","filename":"jpreJPRED2501213.xml","url":"https://assets-eu.researchsquare.com/files/rs-8303889/v1/6fa6aaae7112e8182a5f243a.xml"},{"id":100358112,"identity":"3b81b4da-9f9f-4ff8-81ae-32fbc4550856","added_by":"auto","created_at":"2026-01-16 07:20:39","extension":"xml","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1448,"visible":true,"origin":"","legend":"","description":"","filename":"JPRED250121317246.go.xml","url":"https://assets-eu.researchsquare.com/files/rs-8303889/v1/dfe7858bdc7c728427183931.xml"},{"id":99862467,"identity":"946d9d14-f4d6-4607-a9ca-5caa82f7e86a","added_by":"auto","created_at":"2026-01-09 07:18:02","extension":"xml","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":849,"visible":true,"origin":"","legend":"","description":"","filename":"JPRED2501213Import.xml","url":"https://assets-eu.researchsquare.com/files/rs-8303889/v1/4172f17f041e668e5ccdf930.xml"},{"id":99862462,"identity":"26218f61-2641-40e6-b53d-0463feaacb01","added_by":"auto","created_at":"2026-01-09 07:18:02","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":310767,"visible":true,"origin":"","legend":"\u003cp\u003ePhylogenetic trees (gene trees) based on (a) chloroplast, (b) nuclear 6\u003cem\u003ePG\u003c/em\u003e, (c) \u003cem\u003ePGI\u003c/em\u003e, and (d) \u003cem\u003encpGS\u003c/em\u003e gene sequences were reconstructed using the Bayesian inference (BI) method. Sequences were collapsed into unique haplotypes/genotypes using DnaSP to form reduced datasets. The numbers above the branches represent Bayesian posterior probability and MP bootstrap values. “–“ indicates that the node was not supported in MP analysis\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-8303889/v1/5ca9e7ac95661863e71121a1.png"},{"id":99862465,"identity":"decb923a-8cf9-49ec-9575-3d128604fda7","added_by":"auto","created_at":"2026-01-09 07:18:02","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":87069,"visible":true,"origin":"","legend":"\u003cp\u003eNeighborNet network of \u003cem\u003eSalix\u003c/em\u003e, focusing on Japanese native species of the subg. \u003cem\u003eVetrix-Chamaetia\u003c/em\u003ecomplex. The network was constructed using uncorrected P distances based on concatenated sequences of chloroplast and three nuclear genes. Splits with bootstrap support \u0026gt;50% and \u0026gt;80% were shown using increasingly thicker line weights.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-8303889/v1/4fc3da6206a0dfadce557c12.png"},{"id":100357319,"identity":"f1d6291d-544e-4a1e-b29a-7c559e4cf178","added_by":"auto","created_at":"2026-01-16 07:19:39","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":41509,"visible":true,"origin":"","legend":"\u003cp\u003eBayesian divergence time estimates of Japanese native \u003cem\u003eSalix\u003c/em\u003e species in millions of years ago (Mya), based on nuclear intronic sequences of the \u003cem\u003encpGS\u003c/em\u003e and \u003cem\u003ePGI\u003c/em\u003e genes. Pink bars at each node indicate the 95% highest posterior density (HPD) interval of divergence time. Mean divergence time and 95% HPD for lettered nodes (A–N) are listed in Table 4. Node support is given by Bayesian posterior probabilities shown to the left of each node. Abbreviation of the periods: Pl—Pliocene, IV—Quaternary\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-8303889/v1/f0dc6658030e72b4f4b5ee6c.png"},{"id":100376942,"identity":"5e62c7b0-3253-4358-b4c5-525778ff9e99","added_by":"auto","created_at":"2026-01-16 08:46:25","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1342796,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8303889/v1/33004f1a-3087-4bf0-9cab-3283f5982333.pdf"},{"id":100357501,"identity":"f7dbf75d-4f75-4d68-be3e-2c7cde0ea50d","added_by":"auto","created_at":"2026-01-16 07:19:56","extension":"pptx","order_by":10,"title":"","display":"","copyAsset":false,"role":"supplement","size":163709,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineResource2.pptx","url":"https://assets-eu.researchsquare.com/files/rs-8303889/v1/dab7b7a74682732d55bf1983.pptx"},{"id":100357940,"identity":"f801c96d-7422-49f9-9c7d-0c5f6346d5d2","added_by":"auto","created_at":"2026-01-16 07:20:30","extension":"pptx","order_by":11,"title":"","display":"","copyAsset":false,"role":"supplement","size":74577,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineResource3.pptx","url":"https://assets-eu.researchsquare.com/files/rs-8303889/v1/af699e3c3ecc95d5f1458b38.pptx"},{"id":99862475,"identity":"b7dfa67c-f2a5-40e6-927e-b13ee62e6f93","added_by":"auto","created_at":"2026-01-09 07:18:02","extension":"pptx","order_by":12,"title":"","display":"","copyAsset":false,"role":"supplement","size":61125,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineResource4.pptx","url":"https://assets-eu.researchsquare.com/files/rs-8303889/v1/ff83e1ea9b6bf0e4e16b83c2.pptx"},{"id":99862469,"identity":"24c5323b-d1da-4152-9046-f2ace331ef7b","added_by":"auto","created_at":"2026-01-09 07:18:02","extension":"docx","order_by":13,"title":"","display":"","copyAsset":false,"role":"supplement","size":16622,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineResourceCaption.docx","url":"https://assets-eu.researchsquare.com/files/rs-8303889/v1/6d6512dfb2b53c1b7a05c52c.docx"},{"id":99862473,"identity":"76040e04-a3d0-4881-a072-0ad4bed68a7b","added_by":"auto","created_at":"2026-01-09 07:18:02","extension":"xlsx","order_by":14,"title":"","display":"","copyAsset":false,"role":"supplement","size":26618,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineResources1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8303889/v1/d84fcbc5dd44fc1e57b52b8c.xlsx"}],"financialInterests":"","formattedTitle":"Preliminary phylogenetic insights into Japanese willows (Salix L.) using low-copy nuclear genes, with emphasis on endemic species","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe genus \u003cem\u003eSalix\u003c/em\u003e L. (Salicaceae) comprises approximately 400 tree species that are mainly distributed in the temperate, boreal, and Arctic regions of the Northern Hemisphere (Argus 1997). They are present in diverse ecological niches, including wetlands, riparian vegetation, uplands, and alpine/arctic tundra (Dickmann and Kuzovkina 2014; Newsholme 1992), and have diverse economic and ecological uses, including biomass production, ecological restoration, and various wood products (Pučka and Lazdiņa 2013).\u003c/p\u003e\n\u003cp\u003eA comprehensive classification of\u0026nbsp;\u003cem\u003eSalix\u003c/em\u003e has been attempted by many taxonomists; however, this has proven to be difficult because of its dimorphic sexual system, simple flowers, large phenotypic variations, frequent hybridization, and polyploidization of this genus (Argus 1997; Cronk et al. 2015). The current classification of \u003cem\u003eSalix\u003c/em\u003e is based on several authoritative taxonomic opinions proposed for each region (Argus 1997; Dickmann and Kuzovkina 2014; Fang et al. 1999; Ohashi 2001; Skvortsov 1999).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eMany molecular phylogenetic studies have been conducted to untangle the taxonomic and systematic complexity of willows (Acar et al. 2022; Azuma et al. 2000; Barkalov and Kozyrenko 2014a,b; Chen et al. 2010; Hardig et al. 2010; He et al. 2021; Lauron-Moreau et al. 2015; Sanderson et al. 2023; Wagner et al. 2018, 2021): early studies based on chloroplast and nuclear ribosomal genes revealed key evolutionary trends in the genus \u003cem\u003eSalix\u003c/em\u003e and contributed to proposed taxonomic rearrangements at subgenus levels. In particular, evidence confirmed that \u003cem\u003eSalix\u0026nbsp;\u003c/em\u003esubgenera \u003cem\u003eVetrix\u0026nbsp;\u003c/em\u003eDumortier and \u003cem\u003eChamaetia\u003c/em\u003e (Dumortier) Nasarov formed a mixed clade, suggesting their recent diversification and the repeated evolution of dwarf arctic/alpine willows (subg. \u003cem\u003eChamaetia\u003c/em\u003e) (Acar et al. 2022; Azuma et al. 2000; Barkalov and Kozyrenko 2014a; Chen et al. 2010; Hardig et al. 2010; Lauron-Moreau et al. 2015; Sanderson et al. 2023). Recent advances in genomic sequencing have enabled the high-throughput phylogenetic analysis of willows, thereby revealing the complex evolutionary history of this clade at lower taxonomic levels, particularly within the \u003cem\u003eVetrix-Chamaetia\u003c/em\u003e complex (Chen et al. 2025; He et al. 2021; Ogutcen et al. 2024; Sanderson et al. 2023; Wagner et al. 2018, 2021).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eSalix\u003c/em\u003e species in the Japanese Archipelago have been well described: The most updated classification of \u003cem\u003eSalix\u003c/em\u003e by Ohashi (2001) classified the genus into six subgenera, namely, \u003cem\u003eSalix, Protitea\u003c/em\u003e, \u003cem\u003ePleuradenia\u003c/em\u003e,\u003cem\u003e\u0026nbsp;Chosenia\u003c/em\u003e,\u003cem\u003e\u0026nbsp;Chamaetia\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;Vetrix\u003c/em\u003e, and describes 27 native species (Table 1), of which the majority (17) belong to subg. \u003cem\u003eVetrix\u0026nbsp;\u003c/em\u003e(further classified into 9 sections), with three alpine dwarf willows included in the subg. \u003cem\u003eChamaetia\u003c/em\u003e (3 sections)\u003cem\u003e.\u003c/em\u003e Although they apparently have links with continental East Asia, including Northeast China, the Korean Peninsula, Far Eastern Russia, and\u0026mdash;in rare cases\u0026mdash;Europe, they also show a moderate level of endemism (30%), harboring seven endemic species and two subspecies. However, phylogenetic research on \u003cem\u003eSalix\u003c/em\u003e has not progressed in Japan since the earlier classical studies (Azuma et al. 2000), and the systematic origins of these species remain unclear.\u003c/p\u003e\n\u003cp\u003eIn the present study, we aim to reveal the phylogenetic distinctiveness and affinity among Japanese \u003cem\u003eSalix\u003c/em\u003e taxa. We particularly focus on several endemic taxa within the subg. \u003cem\u003eVetrix-Chamaetia\u003c/em\u003e complex and assess hypotheses concerning their systematic origins, as inferred from their distributional patterns and present taxonomic assignment: One examples of such endemic species is\u003cem\u003e\u0026nbsp;S. hukaoana\u003c/em\u003e Kimura, which was first discovered in 1972 (Kimura 1973), and currently known as a major component of the mountainous riparian forests of northern Honshu Island (Kikuchi and Suzuki 2010). It was once considered to be related to\u0026nbsp;\u003cem\u003eSalix\u003c/em\u003e sect. \u003cem\u003eDaphnella\u003c/em\u003e, but was soon given a novel monotypic section \u003cem\u003eHukaoana\u003c/em\u003e on its unique morphological traits (Kimura 1973, 1974). We developed hypothesis of the hybrid origin of \u003cem\u003eS. hukaoana\u003c/em\u003e (\u003cem\u003eS. gracilistyla\u003c/em\u003e Miq. \u0026times; \u003cem\u003eS. rorida\u003c/em\u003e), based on its intermediate morphological traits and distribution: (1) connate stamens in male flowers shared with \u003cem\u003eS. gracilistyla\u003c/em\u003e (and sect. \u003cem\u003eHelix\u003c/em\u003e); (2) the yellow inner bark shared with sect. \u003cem\u003eDaphnella\u003c/em\u003e (including \u003cem\u003eS. rorida\u003c/em\u003e); (3) sympatric occurrence and hybrid formation with \u003cem\u003eS. gracilistyla\u003c/em\u003e; and (4) parapatric distribution with \u003cem\u003eS. rorida\u003c/em\u003e, sharing similar ecological niches as tall trees constituting upper mountainous riparian forests in northern Japan (Kikuchi and Suzuki 2010).\u003c/p\u003e\n\u003cp\u003eAnother example comprises three local endemic species\u0026mdash;\u003cem\u003eS. rupifraga\u003c/em\u003e Koidz.\u003cem\u003e, S. shiraii\u0026nbsp;\u003c/em\u003eSeemen\u003cem\u003e,\u0026nbsp;\u003c/em\u003eand \u003cem\u003eS. japonica\u0026nbsp;\u003c/em\u003eThunb. Their taxonomic assignment to \u003cem\u003eSalix\u003c/em\u003e sect. \u003cem\u003eHastatae\u003c/em\u003e (Fries) A. Kerner indicates close phylogenetic relationships with exotic consectional species. However, their localized distributions to narrow volcanic areas (Ohashi and Yonekura 2006)\u0026nbsp;may suggest recent speciation (e.g., Sciandrello et al. 2020). Furthermore, this study addressed some intraspecific taxa, including two subspecies of \u003cem\u003eS. miyabeana\u003c/em\u003e Seemen and three of \u003cem\u003eS. nakamurana\u0026nbsp;\u003c/em\u003eKoidz., which are sometimes regarded as distinct species by some taxonomists.\u003c/p\u003e\n\u003cp\u003eHere we acquired multilocus sequences from low-copy nuclear genes (Sang 2002), and conducted a phylogenetic network analysis and divergence time estimation to reveal the divergence patterns and time scales of the focal species. Low copy genes are convenient and still informative phylogenetic tools and are expected to serve a preliminary insight into the phylogenetic origins of Japanese willows preceding future genomic researches.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cstrong\u003eData collection\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study covered all willow species native to Japan (Table 1, Online Resource 1), along with 18 foreign willows and five (two native and three foreign) poplars (\u003cem\u003ePopulus\u003c/em\u003e L.) as outgroups. Leaf samples were collected from botanical gardens, herbarium specimens, and individuals in the field (Table 1). DNA was extracted from leaves using a DNeasy Plant Mini Kit (Qiagen, Maryland, USA) and diluted to a concentration of ~1 ng \u0026micro;L\u003csup\u003e\u0026minus;1\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eWe obtained sequences from three chloroplast intergenic regions ( \u003cem\u003etrnL\u003c/em\u003e-\u003cem\u003etrnF\u003c/em\u003e, \u003cem\u003etrnR\u003c/em\u003e-\u003cem\u003etrnN\u003c/em\u003e, and \u003cem\u003eatpB\u003c/em\u003e-\u003cem\u003erbcL\u003c/em\u003e) and three low-copy nuclear (COS) genes (chloroplast-expressed glutamine synthetase (\u003cem\u003encpGS\u003c/em\u003e), glucose-6-phosphate isomerase (\u003cem\u003ePGI\u003c/em\u003e), and 6-phosphogluconate dehydrogenase (\u003cem\u003e6PG\u003c/em\u003e)). Universal primers (Suyama et al. 2000; Taberlet et al. 1991; Terachi 1993) were used to amplify the chloroplast regions, whereas specific primers for the amplification of nuclear genes were designed to target the exonal regions (Table 2) using OLIGO version 6.65 (Molecular Biology Insights, Inc.). These primers were designed for the target sequence of \u003cem\u003ePopulus trichocarpa\u003c/em\u003e Torr. \u0026amp; Gray retrieved from the JGI PhycoCosm database (Grigoriev et al. 2021;\u0026nbsp;https://phycocosm.jgi.doe.gov/phycocosm/home).\u003c/p\u003e\n\u003cp\u003ePCR was performed using a\u0026nbsp;PerkinElmer 9700 Thermocycler in 10\u0026micro;L reaction mixtures. These consisted of\u0026nbsp;~0.5 ng\u0026nbsp;template DNA, 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 2.0 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 0.2 mM of each dNTP, 0.15 \u0026micro;m of each primer and 0.25 U \u003cem\u003eTaq\u003c/em\u003e polymerase. The PCR conditions were as follows: 94\u0026deg;C for 3 min, followed by 35\u0026ndash;40 cycles of 94\u0026deg;C for 1 min, 55\u0026deg;C for 1 min and 72\u0026deg;C for 2 min, with a final extension of 72\u0026deg;C for 5 min. \u003cem\u003ePCR products were then purified (ExoSAP\u003c/em\u003e-IT, Amersham Biosciences) before being subjected to cycle sequencing using an ABI Big Dye\u0026trade; Terminator Cycle Sequencing Kit version 3.1 (Applied Biosystems, Foster City, USA), and finally analyzed on an ABI 3100 automated sequencer (Applied Biosystems). Sequences were read in both directions using forward and reverse amplification primers; if needed, we also used internal sequencing primers designed for this study (Table 2).\u003c/p\u003e\n\u003cp\u003eSequence editing and assembly were performed using the CodonCode Aligner version 3.7.1 (CodonCode Corporation) to generate consensus sequences. Heterozygous substitutions in the nuclear genes were coded using IUPAC ambiguity codes. Sequences with multiple heterozygous indels were not successfully assembled and excluded from further analyses. All assembled sequences are registered in the DNA Data Bank of Japan (Online Resource 1). Multiple sequence alignments were performed using the ClustalW2 algorithm, as implemented in the SeaView alignment editor (Gouy et al. 2010). Nuclear sequences were then phased into haplotypes using the PHASE algorithm as implemented in DnaSP version 6 (Librado and Rozas 2009) and used to compute haplotype diversity (\u003cem\u003eHd\u003c/em\u003e), nucleotide diversity (\u003cem\u003ePi\u003c/em\u003e), and Tajima\u0026rsquo;s \u003cem\u003eD\u003c/em\u003e (Tajima 1989) to test the neutral evolution hypothesis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePhylogenetic reconstruction\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGene trees were constructed for four loci\u0026mdash;one chloroplast region and three nuclear genes\u0026mdash;based on the successfully assembled data (Online Resource 1). For the three nuclear loci, both unphased and phased datasets were prepared and analyzed. The sequences were collapsed into unique haplotypes/genotypes using DnaSP to generate reduced datasets. \u003cem\u003ePopulus\u003c/em\u003e species, and if not available,\u0026nbsp;\u003cem\u003eS. chaenomeloides\u003c/em\u003e Kimura, was used as the outgroup.\u003c/p\u003e\n\u003cp\u003ePhylogenetic reconstruction was performed using maximum likelihood (ML) and Bayesian inference (BI) methods. Prior to analysis, exonic regions of the nuclear \u003cem\u003encpGS\u003c/em\u003e and \u003cem\u003ePGI\u003c/em\u003e genes were identified via the JGI PhycoCosm database and removed, whereas the \u003cem\u003e6PG\u003c/em\u003e gene, which is entirely exonic, was analyzed without modification. ML trees were constructed using RAxML version 8.2.10 (Stamatakis 2014) with a raxmlGUI 2 (Edler et al. 2021) graphical interface, and the bootstrap confidence values of the nodes were evaluated by generating one thousand bootstrap replicates. The BI method was executed using MrBayes version 3.2.7 (Ronquist et al. 2012). Two independent runs containing four Markov chain Monte Carlo chains (one hot and three cold) were performed until the average standard deviation of the split frequencies fell below 0.01. Trees were saved every 500 generations and the first 10% were discarded as burn-in.\u003c/p\u003e\n\u003cp\u003eThe optimal substitution models were selected using jModelTest version 2.1.10 (Posada 2008) for the chloroplast and phased \u003cem\u003encpGS\u003c/em\u003e and \u003cem\u003ePGI\u003c/em\u003e gene sequences, and the alternative supported models were employed in MrBayes and RAxML analyses. For the other data sets (including the unphased nuclear genes and the phased sequences of the \u003cem\u003e6PG\u003c/em\u003e gene), we ran a reversible-jump MCMC (rjMCMC) implemented in MrBayes and applied a GTR +\u0026nbsp;\u0026Gamma;\u0026nbsp;+ I model in RAxML.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eMoreover, evolutionary relationships within the genus \u003cem\u003eSalix\u003c/em\u003e were visualized using phylogenetic network analysis. A combined data matrix was generated for the 68 samples associated with a complete dataset by concatenating the unphased sequences of all genes, including both exonic and intronic sequences. A phylogenetic network was constructed using the NeighborNet algorithm based on the uncorrected P distance, as implemented in SplitsTree 6.6.1 (Huson and Bryant 2006). Split support values were computed using 1,000 bootstrap replicates.\u003c/p\u003e\n\u003cp\u003eAdditionally, phylogenetic network analysis was performed to test for the hybrid origin of species and for the \u003cem\u003encpGS\u003c/em\u003e and \u003cem\u003ePGI\u003c/em\u003e genes separately, as the focal species suspected of a hybrid had an incomplete dataset. This analysis incorporated partially assembled sequences of the focal species, that is, the \u003cem\u003encsGS\u003c/em\u003e sequence from\u003cem\u003e\u0026nbsp;S. nakamurana\u003c/em\u003e subsp. \u003cem\u003enakamurana\u003c/em\u003e and the \u003cem\u003ePGI\u003c/em\u003e sequence of \u003cem\u003eS. miyabeana\u003c/em\u003e subsp. \u003cem\u003emiyabeana\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDivergence time estimation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe divergence time was estimated using a Bayesian inference method implemented in BEAST version 2.6.7 (Drummond and Rambaut 2007).\u0026nbsp;We performed species tree analysis using StarBEAST3 and estimated posterior mean values and 95% highest posterior density (HPD) intervals of divergence time for all nodes. We used a Yule speciation prior and applied a species tree relaxed clock model and HKY substitution model.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eMolecular dating was calibrated using fossil records as follows (Wu et al. 2015). The first calibration point was set at 48 Ma (normal distribution, SD = 0.3) for the root node of Salicaceae \u003cem\u003esensu strict.\u003c/em\u003e This was based on an approximately 48-million-year-old fossil from the early Eocene in North America (\u003cem\u003e\u0026ldquo;Populus tidwellii\u0026rdquo;\u003c/em\u003e), which most likely represents the stem lineage leading to \u003cem\u003ePopulus\u003c/em\u003e and \u003cem\u003eSalix\u003c/em\u003e (Manchester et al. 2006). The second calibration was set at 23 Ma (normal distribution, SD = 0.3) for the root node of the \u003cem\u003eVetrix-Chamaetia\u003c/em\u003e clade based on the earliest reliable \u003cem\u003eSalix\u003c/em\u003e fossils from Late Oligocene deposits (23 Ma) in Alaska, which were found to be affiliated with subg. \u003cem\u003eVetrix\u003c/em\u003e (Wolfe 1987). This method of calibration differed from that used in previous studies (He et al. 2021; Wu et al. 2015), which used the age of the earliest \u003cem\u003e\u0026ldquo;Vetrix\u0026rdquo;\u003c/em\u003e fossils to calibrate the nodes for the divergence between \u003cem\u003eVetrix\u003c/em\u003e and \u003cem\u003eChamaetia\u003c/em\u003e. Instead, we performed fossil calibration of the most recent common ancestor of the \u003cem\u003eVetrix-Chamaetia\u003c/em\u003e clade, since subg. \u003cem\u003eChamaetia\u003c/em\u003e was found to be polyphyletic. We ran the MCMC chains for 100,000,000 generations, sampling every 50,000 th generation, using Tracer to ensure that the runs converged and had ESS values of \u0026gt;200. Consensus trees were calculated after discarding the first 10% of trees as burn-in. Only the highly variable intronic (unphased) sequences of the \u003cem\u003encpGS\u003c/em\u003e and \u003cem\u003ePGI\u003c/em\u003e genes were subjected to this analysis because preliminary multispecies coalescent runs that incorporated all four loci failed to converge despite extended MCMC chains.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eSequences containing multiple heterozygous indels were often detected in nuclear \u003cem\u003encpGS\u003c/em\u003e and \u003cem\u003ePGI\u003c/em\u003e genes, particularly in the polyploid species of the \u003cem\u003ePopulus\u003c/em\u003e and \u003cem\u003eSalix\u003c/em\u003e subg. \u003cem\u003eSalix\u003c/em\u003e species (Table 1). After omitting these, we obtained 711 assembled sequences with a total of 5,428 aligned base pairs (bp) from the chloroplasts and three nucleotide genes (GenBank accession numbers LC757833-758526 and LC859069-859110, Online Resource 1). Based on the phased nuclear and haplotypic chloroplast sequences, the loci differed markedly in their levels of polymorphism, with parsimony-informative sites ranging from 94 in the chloroplast regions to 181 in \u003cem\u003ePGI\u003c/em\u003e (\u003cem\u003encpGS\u003c/em\u003e: 162) and nucleotide diversity (\u0026pi;) ranging from 0.00517 (chloroplast) to 0.02752 (\u003cem\u003encpGS\u003c/em\u003e). These patterns indicate that the nuclear intronic loci (\u003cem\u003encpGS\u003c/em\u003e and \u003cem\u003ePGI\u003c/em\u003e) contain substantially greater phylogenetically informative variation than the exon-dominated \u003cem\u003e6PG\u003c/em\u003e gene or the chloroplast regions. Summary statistics are presented in Table 3. The best-fit models of nucleotide substitutions for nuclear intronic sequences in the \u003cem\u003encpGS\u003c/em\u003e and \u003cem\u003ePGI\u003c/em\u003e genes and the chloroplast \u003cem\u003eatpB-rbcL\u003c/em\u003e, \u003cem\u003etrnR-trnN\u003c/em\u003e, and\u003cem\u003e\u0026nbsp;trnL-trnF\u003c/em\u003e intergenic regions were the TPM2uf+G, HKY+G, TPM3uf, F81+I, and HKY+G models, respectively.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGene trees\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFigure 1(a-d) shows Bayesian trees based on the chloroplast sequences and unphased sequences of the nuclear genes, with the bootstrap values of ML indicated. Those for the phased nuclear sequences are provided in Online Resources 2(a-c). The data used to construct each gene tree are listed in Online Resource 1. The tree topologies obtained using the Bayesian and ML methods were mostly congruent, except for the \u003cem\u003e6PG\u003c/em\u003e gene, for which only the major clades were supported by both methods.\u003c/p\u003e\n\u003cp\u003eThe chloroplast phylogeny (Fig. 1a) indicates two diverging clades in \u003cem\u003eSalix\u003c/em\u003e. One comprises subg. \u003cem\u003eSalix\u003c/em\u003e (except \u003cem\u003eS. triandra\u003c/em\u003e L.) and\u003cem\u003e\u0026nbsp;Salix\u003c/em\u003e subg.\u003cem\u003e\u0026nbsp;Protitea\u0026nbsp;\u003c/em\u003eKimura, and the other includes subg. \u003cem\u003eVetrix-Chamaetia\u003c/em\u003e, with \u003cem\u003eS. triandra\u003c/em\u003e as the first diverging clade, followed by \u003cem\u003eS. arbutifolia\u003c/em\u003e Pall (\u003cem\u003eSalix\u003c/em\u003e subg. \u003cem\u003eChosenia\u0026nbsp;\u003c/em\u003e(Nakai) \u003cu\u003eH.Ohashi\u003c/u\u003e), and \u003cem\u003eS. cardiophylla\u003c/em\u003e Trautv. \u0026amp; Mey. (\u003cem\u003eSalix\u003c/em\u003e subg. \u003cem\u003ePleuradenia\u0026nbsp;\u003c/em\u003eKimura). The phylogenetic relationships at lower taxonomic levels were not resolved, except that \u003cem\u003eS. hukaoana\u003c/em\u003e was located within a single lineage with some \u003cem\u003eS. rorida\u003c/em\u003e Lacksch. specimens.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe exonic sequences of 6\u003cem\u003ePG\u003c/em\u003e also provided poorly resolved phylogenies (Fig. 1b and Online Resource 2a). Unphased data confirmed the early divergence of subg. \u003cem\u003eProtitea\u003c/em\u003e and the subgenera \u003cem\u003eChosenia\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;Pleuradenia\u003c/em\u003e. (Fig. 1b). In contrast, gene genealogy based on phased data identified one allele from the subg. \u003cem\u003eSalix\u003c/em\u003e (except for \u003cem\u003eS. triandra\u003c/em\u003e) within the early diverging clades (Online Resource 2a). The phylogenetic relationships within the \u003cem\u003eVetrix-Chamaetia\u003c/em\u003e clade were not resolved, except that \u003cem\u003eS. triandra\u003c/em\u003e was shown to be monophyletic.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIntronic sequences in nuclear COS genes (i.e., \u003cem\u003encpGS\u003c/em\u003e and \u003cem\u003ePGI\u003c/em\u003e) provided highly resolved phylogenetic trees, although the low success of sequence assembly reduced the number of analyzed taxa, particularly for polyploid species of sect. \u003cem\u003eSieboldianae\u003c/em\u003e C. K. Schneid. (\u003cem\u003eS. sieboldiana\u003c/em\u003e Blume and\u003cem\u003e\u0026nbsp;S. reinii\u0026nbsp;\u003c/em\u003eSeemen) along with subg. \u003cem\u003eSalix\u0026nbsp;\u003c/em\u003e(i.e., \u003cem\u003eS. eriocarpa\u003c/em\u003e Franch. \u0026amp; Sav., and \u003cem\u003eS. jessoensis\u0026nbsp;\u003c/em\u003eSeemen; Table 1). The major clade comprising subg. \u003cem\u003eVetrix-Chamaetia\u0026nbsp;\u003c/em\u003etogether\u003cem\u003e\u0026nbsp;\u003c/em\u003ewith \u003cem\u003eS. arbutifolia,\u003c/em\u003e \u003cem\u003eS. cardiophylla\u003c/em\u003e, and \u003cem\u003eS. triandra\u003c/em\u003e was maintained in both trees, although \u003cem\u003eS. arbutifolia\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;S. cardiophylla\u0026nbsp;\u003c/em\u003ewere nested within the \u003cem\u003eVetrix-Chamaetia\u0026nbsp;\u003c/em\u003eclade\u003cem\u003e\u0026nbsp;\u003c/em\u003ein the \u003cem\u003encpGS\u003c/em\u003e gene tree (Fig. 1c-d and Online Resource 2b-c). Although a common pattern was observed between the two nuclear loci regarding the internal structure of subg. \u003cem\u003eVetrix\u003c/em\u003e\u0026ndash;\u003cem\u003eChamaetia\u003c/em\u003em, in which one lineage consistently grouped \u003cem\u003eSalix\u003c/em\u003e sects. \u003cem\u003eHukaoana\u003c/em\u003e Kimura, \u003cem\u003eDaphnella\u003c/em\u003e Seringe, \u003cem\u003eSubviminales\u003c/em\u003e C. K. Schneid., and \u003cem\u003eHelix\u003c/em\u003e Dumortier, the gene trees exhibited substantial topological incongruence. Our analyses also indicated that \u003cem\u003eS. miyabeana\u003c/em\u003e (sect. \u003cem\u003eHelix\u003c/em\u003e) is polyphyletic, with subsp. \u003cem\u003emiyabeana\u003c/em\u003e located distantly from subsp. \u003cem\u003egymnolepis\u003c/em\u003e (H. L\u0026eacute;v. et Vaniot) H. Ohashi et Yonek. and instead closely related with \u003cem\u003eS. schwerinii\u0026nbsp;\u003c/em\u003eE. Wolf (sect. \u003cem\u003eViminella\u003c/em\u003e Seringe).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePhylogenetic network\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNeighborNet analysis involved 67 samples from 24 species for which successfully assembled sequences of all genes were available, and therefore lacked some native species (i.e., \u003cem\u003eS. subopposita\u003c/em\u003e Miq., \u003cem\u003eS. sieboldiana\u003c/em\u003e, \u003cem\u003eS. reinii\u003c/em\u003e, and \u003cem\u003eS. taraikensis\u003c/em\u003e Kimura). Nevertheless, the phylogenetic network (Fig. 2) effectively resolved the species-level relationships within subg. \u003cem\u003eVetrix-Chamaetia\u003c/em\u003e. It represented three major lineage groups (Groups I-III) in which the Japanese species of subg. \u003cem\u003eVetrix\u003c/em\u003e evolved into, showing some basal reticulation. The first group (Group I) comprised sects. \u003cem\u003eSubviminales\u003c/em\u003e, \u003cem\u003eDaphnella\u003c/em\u003e, \u003cem\u003eHelix\u003c/em\u003e, and \u003cem\u003eHukaoana\u003c/em\u003e. Within this group, \u003cem\u003eS. hukaoana\u003c/em\u003e (sect. \u003cem\u003eHukaoana\u003c/em\u003e) showed distinct divergence without evidence of recent reticulation events, while the species of sect. \u003cem\u003eHelix\u003c/em\u003e were placed near a peripheral reticulation.\u003c/p\u003e\n\u003cp\u003eThe second group (Group II) almost exclusively consisted of sect. \u003cem\u003eViminella\u003c/em\u003e with the exception of \u003cem\u003eS. miyabeana\u003c/em\u003e subsp. \u003cem\u003emiyabeana\u003c/em\u003e, positioned distantly from subsp. \u003cem\u003egymnolepis\u003c/em\u003e. This group further divides into two sublineages (\u003cem\u003eS. udensis\u003c/em\u003e and the others), whose terminal branches are connected via peripheral reticulations.\u003c/p\u003e\n\u003cp\u003eThe third group (Group III) included \u003cem\u003eSalix\u003c/em\u003e sects. \u003cem\u003eCinerella\u003c/em\u003e Seringe, \u003cem\u003eHastatae\u003c/em\u003e and \u003cem\u003eIncubaceae\u003c/em\u003e A.Kerner. Notably, sects. \u003cem\u003eCinerella\u003c/em\u003e and \u003cem\u003eHastatae\u003c/em\u003e showed progenitor-derivative relationships, where the species of sect. \u003cem\u003eHastatae\u003c/em\u003e (i.e., \u003cem\u003eS. japonica\u003c/em\u003e, \u003cem\u003eS. rupifraga\u003c/em\u003e, and \u003cem\u003eS. shiraii\u003c/em\u003e, all endemic species) descended from \u003cem\u003eS. vulpina\u0026nbsp;\u003c/em\u003eAndersson. In contrast, \u003cem\u003eS. futura\u003c/em\u003e Seemen, another endemic species, diverged from the roots of this group, sharing a reticulation with \u003cem\u003eS. vulpina\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003eIn contrast, the alpine dwarf willows (subg. \u003cem\u003eChamaetia\u003c/em\u003e) branched from the bases of the phylogenetic network, with \u003cem\u003eS. nummularia\u0026nbsp;\u003c/em\u003eAndersson at the base of Group II, \u003cem\u003eS. nakamurana\u003c/em\u003e subsp. \u003cem\u003enakamurana\u003c/em\u003e at the base of Group III, while\u003cem\u003e\u0026nbsp;\u003c/em\u003ethe others located at the intermediated positions.\u003c/p\u003e\n\u003cp\u003eThe gene phylogenetic networks (Online Resource 3a,b) were less resolved but helped to detect the occurrence of hybridization. While the phased \u003cem\u003ePGI\u003c/em\u003e sequences of \u003cem\u003eS. miyabeana\u003c/em\u003e subsp. \u003cem\u003emiyabeana\u003c/em\u003e (A) were positioned close to \u003cem\u003ethose of S. schwerinii\u003c/em\u003e, those of the sample (B) fell into separate positions, one close to the sect. \u003cem\u003eViminella\u003c/em\u003e and another close to subsp. \u003cem\u003egymnolepis.\u0026nbsp;\u003c/em\u003eAt the 14 heterozygous sites recognized from this sample, one sequence variant matched \u003cem\u003eS. miyabeana\u003c/em\u003e subsp. \u003cem\u003egilgiana\u003c/em\u003e, whereas the other matched multiple potential species including \u003cem\u003eS. schwerinii\u003c/em\u003e, \u003cem\u003eS. vulpina\u003c/em\u003e, \u003cem\u003eS. udensis\u003c/em\u003e, \u003cem\u003eS. caprea\u003c/em\u003e, \u003cem\u003eS. nummularia\u003c/em\u003e, \u003cem\u003eS. nakamurana\u003c/em\u003e, and \u003cem\u003eS. reinii\u003c/em\u003e (Online Resource 4). The phased \u003cem\u003encpGS\u003c/em\u003e sequences of S. \u003cem\u003enakamurana\u003c/em\u003e subsp. \u003cem\u003enakamurana\u003c/em\u003e (B) also showed signs of hybridization, with one grouped with subsp. \u003cem\u003ekurilensis\u003c/em\u003e and the other falling close to sect. \u003cem\u003eViminella\u003c/em\u003e. At most (not all) of the 13 heterozygous sites, one sequence variant matched \u003cem\u003eS. nakamurana\u003c/em\u003e subsp. \u003cem\u003ekurilensis\u003c/em\u003e, whereas the other matched multiple potential species including \u003cem\u003eS. nakamurana\u003c/em\u003e subsp. \u003cem\u003eyezoalpina\u003c/em\u003e, \u003cem\u003eS. nummularia\u003c/em\u003e, \u003cem\u003eS. miyabeana\u003c/em\u003e subsp. \u003cem\u003egymnolepis\u0026nbsp;\u003c/em\u003e(Online Resource 4).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDivergent time estimation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe estimated divergence times at the representative nodes are presented in Fig. 3 and summarized in Table 4. They suggest that the \u003cem\u003eHelix/Daphnella/Hukaoana/Subviminales\u003c/em\u003e lineage group was diversified at 13.4 Ma, followed by the divergence of \u003cem\u003eS. hukaoana\u003c/em\u003e at 12.2 Ma. The divergence of \u003cem\u003eS. futura\u003c/em\u003e was estimated to have occurred approximately 9.4 Ma, whereas the endemic species group (classified as sect. \u003cem\u003eHastatae\u003c/em\u003e) was estimated to have diverged 5.2 Ma, with diversification starting around 4.4 Ma and speciation of the alpine-adapted species \u003cem\u003eS. rupifraga\u003c/em\u003e at 2.7 Ma.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eRecently, low-copy nuclear genes have become more widely used (Sang 2002; Zimmer and Wen 2013) as tools for robust phylogenetic reconstruction and taxonomic resolution. Although they have some disadvantages such as difficulties in isolating orthologous alleles and potential discordance due to incomplete lineage sorting and interspecific hybridization (Sang 2002, Small et al. 2004), phylogenetic inference based on multi-locus nuclear genes has proven to be a robust tool for addressing evolutionary relationships (Huson and Scornavacca 2011).\u003c/p\u003e\n\u003cp\u003eIn our study, several sources of phylogenetic uncertainty were evident. Polyploid species, particularly those in subg. \u003cem\u003eSalix\u003c/em\u003e (except \u003cem\u003eS. triandra\u003c/em\u003e), often failed to assemble successfully or yielded divergent phased sequences (Fig. 1b, S1a), suggesting the presence of paralogs associated with gene duplication or polyploidization. None of the individual loci provided sufficient resolution at species or sectional levels: the chloroplast markers and the exonic \u003cem\u003e6PG\u003c/em\u003e gene exhibited low variability and did not resolve relationships within subg. \u003cem\u003eVetrix\u003c/em\u003e\u0026ndash;\u003cem\u003eChamaetia\u003c/em\u003e (Fig. 1a,b; Online Resource 2a), whereas the intronic regions of \u003cem\u003encpGS\u003c/em\u003e and \u003cem\u003ePGI\u003c/em\u003e were more informative but still generated topological incongruence among gene trees (Fig. 1c,d; Online Resources 2b,c). In line with these patterns, the NeighborNet analysis revealed basal reticulation among the major lineages of the \u003cem\u003eVetrix\u0026ndash;Chamaetia\u003c/em\u003e complex (Fig. 2), indicating that early diversification in \u003cem\u003eSalix\u003c/em\u003e involved reticulate evolutionary processes that cannot be fully resolved using a limited number of loci\u0026nbsp;likely reflecting incomplete lineage sorting and historical hybridization/introgression (Degnan and Rosenberg 2009).\u003c/p\u003e\n\u003cp\u003eCollectively, these findings underscore the limitations of single- or few-locus datasets for reconstructing deep relationships in \u003cem\u003eSalix\u003c/em\u003e and highlight the need for future genome-scale analyses to disentangle gene discordance, detect ancient hybridization, and clarify lineage diversification among Japanese \u003cem\u003eSalix\u003c/em\u003e species. Nevertheless, analysis based on the combined dataset\u0026mdash;particularly the NeighborNet network\u0026mdash;provided a certain level of phylogenetic resolution, most notably within subg. \u003cem\u003eVetrix-Chamaetia\u003c/em\u003e (Fig. 2) and yielded valuable insights into the systematic origins of key endemic species, as discussed below.\u003c/p\u003e\n\u003cp\u003eIn parallel with the network analysis, divergence-time estimation using BEAST allowed us to place these phylogenetic patterns within a temporal framework. Previous studies have estimated divergence times in \u003cem\u003eSalix\u003c/em\u003e (He et al. 2021; Marinček et al. 2024; Sanderson et al. 2023; Wu et al. 2015), although only a few have incorporated multiple fossil calibration points. By adopting a comparable calibration strategy, our estimates for major nodes (e.g., nodes B,C,F, and I and the divergence between \u003cem\u003eS. arbutifolia\u003c/em\u003e and\u003cem\u003e\u0026nbsp;S. cardiophylla\u003c/em\u003e; Fig. 3) closely match those of earlier studies, thereby supporting the robustness of our dating results.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAncient origin of \u003cem\u003eS. hukaoana\u003c/em\u003e and \u003cem\u003eS. futura\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePrevious studies proposed that sects. \u003cem\u003eHelix, Daphnella\u003c/em\u003e, and \u003cem\u003eSubviminales\u003c/em\u003e have a high degree of relatedness. (He et al. 2021; Wagner et al. 2018, 2021). We observed that \u003cem\u003eS. hukaoana\u003c/em\u003e (sect. \u003cem\u003eHukaoana\u003c/em\u003e) belongs to this group (Group I). This group harbors morphologically diverse species, ranging from shrubs and tall trees, with lanceolate to elliptical leaves and opposite to alternate leaves. Although no obvious synapomorphies were observed, several traits were partially shared. This lineage likely emerged during the early evolutionary stage of subg. \u003cem\u003eVetrix-Chamaetia\u003c/em\u003e and diverged into variable sections by the Middle Miocene (Table 3). This finding is congruent with fossil records from the late Middle Miocene in Japan, which are thought to reflect extant species from sects. \u003cem\u003eHelix\u003c/em\u003e and \u003cem\u003eSubviminales\u003c/em\u003e (Narita et al. 2020).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWithin this group, \u003cem\u003eS. hukaoana\u003c/em\u003e was distinctly diverged from the other sections without recent reticulations, which disconfirms the recent hybrid-speciation hypothesis of \u003cem\u003eS. hukaoana\u003c/em\u003e based on its intermediate traits and distribution (see Introduction). Therefore, our results indicate that the traits of\u003cem\u003e\u0026nbsp;S. hukaoana\u003c/em\u003e are not a by-product of recent hybrid speciation, but rather a combination of apomorphic and plesiomorphic characters (which may have stemmed from ancient reticulate evolution). Moreover, there still remains a possibility of secondary hybridization and introgression between \u003cem\u003eS. hukaoana\u003c/em\u003e and \u003cem\u003eS. rorida\u003c/em\u003e, as indicated by the presence of shared haplotypes/genotypes in the chloroplast and \u003cem\u003ePGI\u003c/em\u003e genes (Fig. 1a; Online Resource 2b).\u003cem\u003e\u0026nbsp;\u003c/em\u003eThe divergence time of \u003cem\u003eS. hukaoana\u003c/em\u003e from other species examined in this study is estimated to be in the late Middle Miocene (ca. 12 Ma). Given that its closest extant relative known to date is S. baileyi C.K. Schneider, a shrub endemic to central and eastern China, \u003cem\u003eS. hukaoana\u003c/em\u003e was regarded as a relict of ancient origin.\u003c/p\u003e\n\u003cp\u003eThe other endemic species of ancient origin was\u003cem\u003e\u0026nbsp;S. futura\u003c/em\u003e (Group III, further discussed below), which was estimated to have split from the \u003cem\u003eS. vulpina\u0026nbsp;\u003c/em\u003elineage a bit later (9 Ma) in the Late Miocene. These periods are characterized by a global cooling trend after the Middle Miocene Climatic Optimum (Pavlyutkin et al. 2016), and the megafossil flora in North Japan shows a dominance of \u003cem\u003eFagus\u003c/em\u003e species, suggesting an expansion of beech forests around that time.\u003cem\u003e\u0026nbsp;S. futura\u003c/em\u003e may be a relic lineage of early cool-temperate flora in Japan, which persisted despite the presence of derived species.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEvidence of interspecific hybridization in \u003cem\u003eS. miyabeana\u003c/em\u003e subsp. \u003cem\u003emiyabeana\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSubg. \u003cem\u003eVetrix\u003c/em\u003e of Group II was composed of narrow-leaved riparian species, and almost exclusively comprised of the sect. \u003cem\u003eViminella,\u0026nbsp;\u003c/em\u003ewhich is a phylogenetic group well supported by the recent genomic studies (Wagner et al. 2018; 2020, He et al. 2021), with the exception of \u003cem\u003eS. miyabeana\u0026nbsp;\u003c/em\u003esubsp\u003cem\u003e. miyabeana\u0026nbsp;\u003c/em\u003e(sect. \u003cem\u003eHelix\u003c/em\u003e).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eS. miyabeana\u003c/em\u003e subsp. \u003cem\u003emiyabeana\u003c/em\u003e is the type subspecies, distinguished from subsp. \u003cem\u003egymnolepis\u003c/em\u003e only by subtle morphological characters, including more elongated leaves, shorter styles, and nearly sessile ovary stipes. In addition, although subsp. \u003cem\u003egymnolepis\u003c/em\u003e typically bears a single connate stamen in each male flower, subsp. \u003cem\u003emiyabeana\u003c/em\u003e occasionally produces male flowers with two stamens within the same inflorescence\u003cem\u003e.\u0026nbsp;\u003c/em\u003eIn our study, the only sample with full data set was shown to be distantly related to subsp. \u003cem\u003egymnolepis\u0026nbsp;\u003c/em\u003e(Group I) and the most closely related to \u003cem\u003eS.\u003c/em\u003e \u003cem\u003eschwerinii\u003c/em\u003e, whereas another individual with incomplete data set (the sample B) showed the evidence of hybrid origin (Online Resource 3a, 4).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eS. miyabeana\u003c/em\u003e subsp.\u003cem\u003e\u0026nbsp;miyabeana\u003c/em\u003e is distributed more northerly (i.e., Hokkaido Island) than subsp.\u003cem\u003e\u0026nbsp;gymnolepis\u003c/em\u003e (i.e., the southern tip of Hokkaido to Honshu) and has a greater opportunity to grow sympatrically with \u003cem\u003eS. schwerinii\u003c/em\u003e (northern Japan). These results suggested that \u003cem\u003eS. miyabeana\u0026nbsp;\u003c/em\u003esubsp\u003cem\u003e. miyabeana\u003c/em\u003e was, at least, not phylogenetically homogeneous with subsp. \u003cem\u003egymnolepis\u003c/em\u003e and was likely subject to some degree of genetic introgression from \u003cem\u003eS. schweriniii\u003c/em\u003e. We can hypothesize that intersectional hybridization with \u003cem\u003eS. schwerinii\u003c/em\u003e has driven subspecies differentiation in \u003cem\u003eS. miyabeana\u003c/em\u003e, however, clarifying the details of hybridization status\u0026mdash;including the extent of hybridization/introgression and the occurrence of polyploidization in hybrids\u0026mdash;will require examining a larger sample size and more extensive genetic data in future studies.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRadiative speciation of local endemic species of \u0026ldquo;sect. \u003cem\u003eHastatae\u003c/em\u003e\u0026rdquo;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSubg. \u003cem\u003eVetrix\u003c/em\u003e in Group III comprises the round-leaved hillside willows of sects. \u003cem\u003eCinerella\u003c/em\u003e and \u003cem\u003eHastatae\u003c/em\u003e. Uncovered by the NeighborNet analysis, the placement of \u003cem\u003eS. taraikensis\u003c/em\u003e (sect. \u003cem\u003eCinerella\u003c/em\u003e) remains unclear. Available evidence from the \u003cem\u003ePGI\u003c/em\u003e tree suggests a close but distinct relationship with other \u003cem\u003eCinerella\u003c/em\u003e species (Fig. 1c; Online Resource 2c). This is noteworthy, as previous studies have identified early divergence in \u003cem\u003eS. starkeana\u003c/em\u003e Willd. (Wagner et al. 2020, 2021)\u003cem\u003e,\u003c/em\u003e which was classified together with\u003cem\u003e\u0026nbsp;S. taraikensis\u003c/em\u003e as the subsect. \u003cem\u003eSubstriatae\u003c/em\u003e Goerz by Eurasian taxonomists (Skvortsov 1999).\u003c/p\u003e\n\u003cp\u003eGroup III represents an ancestor-descendant relationship between \u003cem\u003eS. vulpina\u003c/em\u003e (subg. \u003cem\u003eCinerella\u003c/em\u003e) and the Japanese species of sect. \u003cem\u003eHastatae\u003c/em\u003e, with the latter being a derived monophyletic lineage that diverged from \u003cem\u003eS. vulpina\u003c/em\u003e around 5.2 Ma and subsequently diversified at 4.4\u0026ndash;2.7 Ma into three species (Fig. 3, Table 4). the Japanese members of sect. \u003cem\u003eHastatae\u003c/em\u003e require taxonomic reevaluation. Previous studies (Wagner et al. 2021; Marinček et al. 2024) have suggested that sect. \u003cem\u003eHastatae\u003c/em\u003e is polyphyletic, no previous study has documented its members being nested within sect. \u003cem\u003eCinerella\u003c/em\u003e as found in our study. These findings imply that the Japanese members of sect. \u003cem\u003eHastatae\u003c/em\u003e at least require taxonomic reevaluation.\u003c/p\u003e\n\u003cp\u003eMore notably, our results may provide significant insight into the plant speciation process within the Japanese Archipelago. These three willow species are local endemics belonging to the so-called \u0026ldquo;Fossa Magna element,\u0026rdquo; a biogeographic group restricted to the Fuji Volcanic Zone, extending from the Izu Islands to central Honshu. The endemism of the Fossa Magna element is generally interpreted as having evolved through adaptation to volcanic environments (Takahashi 1971), which were created by the emergence of volcanic islands and repeated collisions with central Honshu since the Miocene (Maruyama et al. 1997; Takagi et al. 1993). Consistent with this scenario, the estimated divergence times of these endemic willows coincide with major volcanic episodes in this region and closely match that of \u003cem\u003eRubus trifidus\u0026nbsp;\u003c/em\u003eThunb. (6.9 Ma), another representative member of the Fossa Magna element (Kikuchi et al. 2022). Moreover, these willows exhibit striking ecological and morphological diversification\u0026mdash;from hillside shrubs to alpine dwarf forms (Ohashi and Yonekura 2006)\u0026mdash;suggesting that they have undergone adaptive radiation within this dynamic geological setting. Taken together, these findings may highlight volcanic and tectonic activity as key drivers of plant speciation in the Japanese Archipelago.\u003c/p\u003e\n\u003cp\u003eHowever, this scenario warrants cautious interpretation, as neither the present study nor previous investigations has yet produced a comprehensive phylogenetic framework for \u003cem\u003eSalix\u003c/em\u003e. Given the substantial number of species that remain unexamined, it is possible that unsampled lineages may have played a role in the origin of the Japanese species of sect. \u003cem\u003eHastatae\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePolyphyly and ancient divergence of subg. \u003cem\u003eChamaetia\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe findings on subg. \u003cem\u003eChamaetia\u003c/em\u003e species in Japan obtained in this study\u0026mdash;such as the polyphyly of this subgenus and the placement of\u0026nbsp;\u003cem\u003eS. nummularia\u003c/em\u003e and \u003cem\u003eS. fuscencens\u003c/em\u003e at the basal position near sect. \u003cem\u003eViminella\u003c/em\u003e and near sect. \u003cem\u003eCinerella\u003c/em\u003e, respectively\u0026mdash;are consistent with the results of previous studies (Lauron-Moreau et al. 2015; Wagner et al. 2018, 2021;\u0026nbsp;Marinček et al. 2024).\u003c/p\u003e\n\u003cp\u003eIn contrast, the phylogenetic position of\u0026nbsp;\u003cem\u003eS. nakamurana\u003c/em\u003e does not allow a clear interpretation: our results showed distinct divergence between subsp.\u0026nbsp;\u003cem\u003ekurilensis\u003c/em\u003e and subsp.\u0026nbsp;\u003cem\u003eyezoalpina\u003c/em\u003e (Fig. 3). Moreover, the nuclear genes of subsp.\u0026nbsp;\u003cem\u003enakamurana\u003c/em\u003e show heterozygosity for divergent alleles, a pattern consistent with either hybridization between subsp.\u0026nbsp;\u003cem\u003ekurilensis\u003c/em\u003e and subsp.\u0026nbsp;\u003cem\u003eyezoalpina\u003c/em\u003e or interspecific hybridization with an unidentified species (Online Resource 3b,4). However, the current data are insufficient to distinguish between these possibilities. Nevertheless, our analyses clearly demonstrate that the nuclear genes of\u0026nbsp;\u003cem\u003eS. nakamurana\u003c/em\u003e harbor alleles that are differentiated among its subspecies. Such differentiation may indicate polyphyly of\u0026nbsp;\u003cem\u003eS. nakamurana\u003c/em\u003e, subspecific lineage divergence driven by geographic isolation, incomplete lineage sorting of divergent alleles, or the influence of interspecific hybridization. Future genomic analyses will be required to evaluate these alternative scenarios.\u003c/p\u003e\n\u003cp\u003eFinally, our divergence-time estimates suggest that the origin and diversification of Japanese \u003cem\u003eChamaetia\u003c/em\u003e species\u0026mdash;including \u003cem\u003eS. nakamurana\u003c/em\u003e, \u003cem\u003eS. nummularia\u003c/em\u003e, and \u003cem\u003eS. fuscescens\u003c/em\u003e\u0026mdash;date back to the Miocene (Fig. 3; Table 4). This timing corresponds to major climatic transitions, beginning with the warm Middle Miocene followed by global cooling and Antarctic ice sheet expansion (Herbert et al. 2016), and agrees with fossil evidence (Wolfe 1987) as well as recent estimates indicating that the radiation of shrub willows began in the Miocene (Marinček et al. 2024).\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eDespite the methodological limitations of Sanger sequencing, phylogenetic analyses using nuclear COS genes and chloroplast sequences in this study provide significant insights into the evolutionary relationships and timescale of diversification of \u003cem\u003eSalix\u003c/em\u003e species in Japan. In particular, the results clarified the origins of several endemic taxa through a range of speciation processes, identifying ancient relicts (\u003cem\u003eS. hukaoana\u003c/em\u003e and \u003cem\u003eS. futura\u003c/em\u003e) and recently derived neoendemics (\u003cem\u003eS. japonica\u003c/em\u003e, \u003cem\u003eS. shiraii\u003c/em\u003e and \u003cem\u003eS. rupifraga\u003c/em\u003e), and possible cases of lineage differentiation influenced by interspecific/intraspecific hybridization (\u003cem\u003eS. miyabeana\u003c/em\u003e subsp. \u003cem\u003emiyabeana\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;S. nakamurana\u0026nbsp;\u003c/em\u003esubsp.\u003cem\u003e\u0026nbsp;nakamurana\u003c/em\u003e). These findings underscore the complexity of evolutionary dynamics within the Japanese willow flora, highlighting the need for future genome-scale studies to test these hypotheses and clarify the speciation mechanisms of Japanese \u003cem\u003eSalix\u003c/em\u003e.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe are grateful to Tohoku University Botanical Gardens (Sendai City, Miyagi Prefecture, Japan) and Mitsuo Yashima for their support in obtaining samples from the \u003cem\u003eSalix\u003c/em\u003e collection, to Prof. Ken Sato in obtaining alpine willows in Hokkaido, and to Dr. Hiroshi Yoshimaru, Kensuke Yoshimura, and Yasuko Kawamata for providing DNA samples from the DNA-barcoding project. We also thank Etsuko Ihara and Akiko Takazawa for their support and contribution to the laboratory work. Finally, we thank Prof. Hiroyoshi Ohashi, Prof. Mineaki Aizawa and Mr. Wataru Fukaya for providing valuable comments on the taxonomy and phylogeny of \u003cem\u003eSalix\u003c/em\u003e. This study was financially supported by the Japanese Society for the Promotion of Science (JSPS KAKENHI; grant numbers 20248017, 25292098, 24770081, and 24K02090).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e:\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no conflicts of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eAcar P, Değirmenci F\u0026Ouml;, Duman H, Kaya Z (2022) Molecular phylogenetic analysis resolving the taxonomic discrepancies among Salix L. species naturally found in Turkey. Dendrobiology 87:13\u0026ndash;26. https://doi.org/10.12657/denbio.087.002\u003c/li\u003e\n \u003cli\u003eArgus GW (1997) Infrageneric Classification of Salix (Salicaceae) in the New World. Syst Bot Monogr 52:1. https://doi.org/10.2307/25096638\u003c/li\u003e\n \u003cli\u003eAzuma T, Kajita T, Yokoyama J, Hiroyoshi O (2000) Phylogenetic relationships of Salix (Salicaceae) based on rbcL sequence data. Am J Bot 87:67\u0026ndash;75\u003c/li\u003e\n \u003cli\u003eBarkalov VY, Kozyrenko MM (2014a) Phylogenetic analysis of the Far Eastern Salix (Salicaceae) based on sequence data from chloroplast DNA regions and ITS of nuclear ribosomal DNA. Bot Pac 3: 3-19\u003c/li\u003e\n \u003cli\u003eBarkalov VY, Kozyrenko MM (2014b). Phylogenetic relationships of Salix L. subg. Salix species (Salicaceae) according to sequencing data of intergenic spacers of the chloroplast genome and ITS rDNA. Russ J Genet 50: 828-837\u003c/li\u003e\n \u003cli\u003eChen J, Sun H, Wen J, Yang Y (2010) Molecular phylogeny of Salix L.(Salicaceae) inferred from three chloroplast datasets and its systematic implications. Taxon 59:29\u0026ndash;37\u003c/li\u003e\n \u003cli\u003eChen K, Wang J, Xiang R, Yang X, Yun Q, Huang Y, Sun H, Chen J (2025). Backbone phylogeny of Salix based on genome skimming data. Plant Diversity 47: 178-188.\u003c/li\u003e\n \u003cli\u003eCronk Q, Ruzzier E, Belyaeva I, Percy D (2015) Salix transect of Europe: Latitudinal patterns in willow diversity from Greece to arctic Norway. Biodivers Data J 3:1\u0026ndash;29. https://doi.org/10.3897/BDJ.3.e6258\u003c/li\u003e\n \u003cli\u003eDegnan JH, Rosenberg NA (2009) Gene tree discordance, phylogenetic inference and the multispecies coalescent. Trends Ecol Evol 24: 332-340.\u003c/li\u003e\n \u003cli\u003eDickmann DI, Kuzovkina J (2014) Poplars and willows of the world, with emphasis on silviculturally important species. In: Poplars and willows: Trees for society and the environment. CAB International Rome, pp 8\u0026ndash;91\u003c/li\u003e\n \u003cli\u003eDrummond AJ, Rambaut A (2007) BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evol Biol 7:214. https://doi.org/10.1186/1471-2148-7-214\u003c/li\u003e\n \u003cli\u003eEdler D, Klein J, Antonelli A, Silvestro D (2021) raxmlGUI 2.0: A graphical interface and toolkit for phylogenetic analyses using RAxML. Methods Ecol Evol 12:373\u0026ndash;377. https://doi.org/10.1111/2041-210X.13512\u003c/li\u003e\n \u003cli\u003eFang CF, Zhao SD, Skvortsov AK (1999) Salicaceae. Flora of China (4: 139-274). In: Wu Z-Y, Raven PH (eds) Flora of China, vol. 4. Science Press; Missouri Botanical Garden Press, Beijing; St Louis, pp 139\u0026ndash;274\u003c/li\u003e\n \u003cli\u003eGouy M, Guindon S, Gascuel O (2010) SeaView version 4: A multiplatform graphical user interface for sequence alignment and phylogenetic tree building. Mol Biol Evol 27:221\u0026ndash;224. https://doi.org/10.1093/molbev/msp259\u003c/li\u003e\n \u003cli\u003eGrigoriev I V., Hayes RD, Calhoun S, et al (2021) PhycoCosm, a comparative algal genomics resource. Nucleic Acids Res 49:D1004\u0026ndash;D1011. https://doi.org/10.1093/nar/gkaa898\u003c/li\u003e\n \u003cli\u003eGulyaev S, Cai XJ, Guo FY, et al (2022) The phylogeny of Salix revealed by whole genome re-sequencing suggests different sex-determination systems in major groups of the genus. Ann Bot 129:485\u0026ndash;498. https://doi.org/10.1093/aob/mcac012\u003c/li\u003e\n \u003cli\u003eHardig TM, Anttila CK, Brunsfeld SJ (2010) A Phylogenetic Analysis of Salix (Salicaceae) Based on matK and Ribosomal DNA Sequence Data. J Bot 2010:1\u0026ndash;12. https://doi.org/10.1155/2010/197696\u003c/li\u003e\n \u003cli\u003eHe L, Wagner ND, H\u0026ouml;randl E (2021) Restriction-site associated DNA sequencing data reveal a radiation of willow species (Salix L., Salicaceae) in the Hengduan Mountains and adjacent areas. J Syst Evol 59:44\u0026ndash;57. https://doi.org/10.1111/jse.12593\u003c/li\u003e\n \u003cli\u003eHerbert TD, Lawrence KT, Tzanova A, Peterson LC, Caballero-Gill RP, Kelly CS (2016) Late Miocene global cooling and the rise of modern ecosystems. Nat Geosci 9:843\u0026ndash;847.\u003c/li\u003e\n \u003cli\u003eHuson DH, Bryant D (2006) Application of phylogenetic networks in evolutionary studies. Mol Biol Evol 23:254\u0026ndash;67. https://doi.org/10.1093/molbev/msj030\u003c/li\u003e\n \u003cli\u003eHuson DH, Scornavacca C (2011) A survey of combinatorial methods for phylogenetic networks. Genome Biol Evol 3:23\u0026ndash;35. https://doi.org/10.1093/gbe/evq077\u003c/li\u003e\n \u003cli\u003eKikuchi S, Mimura M, Naruhashi N, et al (2022) Phylogenetic inferences using nuclear ribosomal ITS and chloroplast sequences provide insights into the biogeographic origins, diversification timescales and trait evolution of Rubus in the Japanese Archipelago. Plant Syst Evol 308: 20. https://doi.org/10.1007/s00606-022-01810-6\u003c/li\u003e\n \u003cli\u003eKikuchi S, Suzuki W (2010) Distribution of an endangered willow, Salix hukaoana, on the Japan Sea side of northeastern Honshu. Japanese J Conserv Ecol 15:89\u0026ndash;99\u003c/li\u003e\n \u003cli\u003eKimura A (1973) Salicis nava species ex regione Okutonensi in Japonia. J Jpn Bot 48:321\u0026ndash;326\u003c/li\u003e\n \u003cli\u003eKimura A (1974) De Salicis Hukaoanae Kimura systematico positu. J Jpn Bot 49:46\u003c/li\u003e\n \u003cli\u003eLauron-Moreau A, Pitre FE, Argus GW, et al (2015) Phylogenetic relationships of American Willows (Salix L., Salicaceae). PLoS One 10:\u0026nbsp;e0121965. https://doi.org/10.1371/journal.pone.0121965\u003c/li\u003e\n \u003cli\u003eLibrado P, Rozas J (2009) DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25:1451\u0026ndash;1452. https://doi.org/10.1093/bioinformatics/btp187\u003c/li\u003e\n \u003cli\u003eManchester SR, Judd WS, Handley B (2006) Foliage and fruits of early poplars (Salicaceae: Populus) from the eocene of Utah, Colorado, and Wyoming. Int J Plant Sci 167:897\u0026ndash;908. https://doi.org/10.1086/503918\u003c/li\u003e\n \u003cli\u003eMarinček P, L\u0026eacute;veill\u0026eacute;‐Bourret \u0026Eacute;, Heiduk F, Leong J, Bailleul SM, Volf M, Wagner ND. 2024. Challenge accepted: Evolutionary lineages versus taxonomic classification of North American shrub willows (Salix). Am J Bot, 111: e16361.\u003c/li\u003e\n \u003cli\u003eMaruyama S, Isozaki Y, Kimura G, Terabayashi M (1997) Paleogeographic maps of the Japanese Islands: Plate tectonic synthesis from 750 Ma to the present. Isl Arc 6:121\u0026ndash;142. https://doi.org/10.1111/j.1440-1738.1997.tb00043.x\u003c/li\u003e\n \u003cli\u003eNarita A, Yabe A, Uemura K, Matsumoto M (2020) Late middle Miocene Konan flora from northern Hokkaido, Japan. Acta Palaeobot 60:259\u0026ndash;295. https://doi.org/10.35535/acpa-2020-0012\u003c/li\u003e\n \u003cli\u003eNewsholme C (1992) Willows: the genus Salix. Timber Press, Inc.\u003c/li\u003e\n \u003cli\u003eOgutcen E, de Lima Ferreira P, Wagner ND, Marinček P, Leong JV, Aubona G, Jeannine GB, Mich\u0026aacute;lek J, Schroeder L, Sedio BE, Va\u0026scaron;ut RJ, Volf M (2024). Phylogenetic insights into the Salicaceae: the evolution of willows and beyond.\u0026nbsp;Mol Phylogenet Evol\u0026nbsp;199: 108161.\u003c/li\u003e\n \u003cli\u003eOhashi H (2000) A systematic enumeration of Japanese Salix (Salicaceae). J Japanese Bot 75:1\u0026ndash;41\u003c/li\u003e\n \u003cli\u003eOhashi H (2001) Salicaceae of Japan. Sci Rep Toboku Univ 4th Ser Biol 40:269\u0026ndash;396\u003c/li\u003e\n \u003cli\u003eOhashi H, Yonekura K (2006) Additions and corrections for Salicaceae of Japan 2. J Japanese Bot 81:75\u0026ndash;90\u003c/li\u003e\n \u003cli\u003ePavlyutkin BI, Yabe A, GolozoubovVV, Simanenko LF (2016) Miocene floral changes in the circum-Japan Sea areas\u0026mdash;their implications in the climatic changes and the time of Japan Sea Opening. Mem Natl Mus Nat Sci, Tokyo 51:109\u0026ndash;123\u003c/li\u003e\n \u003cli\u003ePosada D (2008) jModelTest: phylogenetic model averaging. Mol Biol Evol 25:1253\u0026ndash;6. https://doi.org/10.1093/molbev/msn083\u003c/li\u003e\n \u003cli\u003ePučka I, Lazdiņa D (2013) Review about investigations of Salix spp. in Europe. Res Rural Dev 2:13\u0026ndash;19\u003c/li\u003e\n \u003cli\u003eSang T (2002) Utility of low-copy nuclear gene sequences in plant phylogenetics. Crit Rev Biochem Mol Biol 37:121\u0026ndash;147\u003c/li\u003e\n \u003cli\u003eSanderson BJ, Gambhir D, Feng G, Hu N, Cronk QC, Percy DM, Freaner FM, Johnson MG, Smart LB, Keefover-Ring K, Yin T, Ma T, DiFazio SP, Liu J, Olson MS. 2023. Phylogenomics reveals patterns of ancient hybridization and differential diversification that contribute to phylogenetic conflict in willows, poplars, and close relatives. Syst Biol 72: 1220-1232.\u003c/li\u003e\n \u003cli\u003eSciandrello S, Minissale P, Del Galdo GG (2020) Vascular plant species diversity of Mt. Etna (Sicily): endemicity, insularity and spatial patterns along the altitudinal gradient of the highest active volcano in Europe. PeerJ 8:e9875\u003c/li\u003e\n \u003cli\u003eSkvortsov AK (1999) Willows of Russia and Adjacent Countries: Taxonomical and Geographical Revision (transl. from: Skvortsov AK (1968) Willows of the USSR: Taxonomic and Geographic Revision. Nauka, Moscow). Joensuu Univ Joensuu\u003c/li\u003e\n \u003cli\u003eSmall RL, Cronn RC, Wendel JF (2004) Use of nuclear genes for phylogeny reconstruction in plants. Australian Syst Bot 17:145\u0026ndash;170.\u003c/li\u003e\n \u003cli\u003eStamatakis A (2014) RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 30:1312\u0026ndash;1313. https://doi.org/10.1093/bioinformatics/btu033\u003c/li\u003e\n \u003cli\u003eSuda Y (1964) Cytotaxonomical studies on the subfamily Salicoideae of the Salicaceae. PhD Thesis. Tohoku University (in Japanese).\u003c/li\u003e\n \u003cli\u003eSuda Y, Argus GW (1969) Chromosome numbers of some North American arctic and boreal Salix. Can J Bot 47: 859-862.\u003c/li\u003e\n \u003cli\u003eSuyama Y, Yoshimaru H, Tsumura Y (2000) Molecular phylogenetic position of Japanese Abies (Pinaceae) based on chloroplast DNA sequences. Mol Phylogenet Evol 16:271\u0026ndash;277. https://doi.org/10.1006/mpev.2000.0795\u003c/li\u003e\n \u003cli\u003eTaberlet P, Gielly L, Pautou G, Bouvet J (1991) Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol Biol 17:1105\u0026ndash;9\u003c/li\u003e\n \u003cli\u003eTajima F (1989) Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123:585\u0026ndash;595\u003c/li\u003e\n \u003cli\u003eTakagi K, Aoike K, Koyama M (1993) What happened on the northern tip of the Izu-Bonin arc during 15-10 Ma?. J Geog 102: 252\u0026ndash;263 (in Japanese with English abstract).\u003c/li\u003e\n \u003cli\u003eTakahashi H (1971) Fossa Magna element plants. Res Rep Kanagawa Prefect Museum Nat Hist 2:1\u0026ndash;63\u003c/li\u003e\n \u003cli\u003eTerachi T (1993) Structural Alterations of Chloroplast Genome and Their Significance to the Higher Plant Evolution. Bull Inst Natl L Util Dev Kyoto Sangyo Univ 14:138\u0026ndash;148\u003c/li\u003e\n \u003cli\u003eWagner ND, Gramlich S, H\u0026ouml;randl E (2018) RAD sequencing resolved phylogenetic relationships in European shrub willows (Salix L. subg. Chamaetia and subg. Vetrix) and revealed multiple evolution of dwarf shrubs. Ecol Evol 8243\u0026ndash;8255. https://doi.org/10.1002/ece3.4360\u003c/li\u003e\n \u003cli\u003eWagner ND, He L, H\u0026ouml;randl E (2021) The evolutionary history, diversity, and ecology of willows (Salix l.) in the european alps. Diversity 13:1\u0026ndash;16. https://doi.org/10.3390/d13040146\u003c/li\u003e\n \u003cli\u003eWagner ND, He L, H\u0026ouml;randl E (2020) Phylogenomic Relationships and Evolution of Polyploid Salix Species Revealed by RAD Sequencing Data. Front Plant Sci 11:1\u0026ndash;15. https://doi.org/10.3389/fpls.2020.01077\u003c/li\u003e\n \u003cli\u003eWolfe JA (1987) An Overview of the Origins of the Modern Vegetation and Flora of the Northern Rocky Mountains. Ann Missouri Bot Gard 74:785. https://doi.org/10.2307/2399450\u003c/li\u003e\n \u003cli\u003eWu J, Nyman T, Wang D-C, et al (2015) Phylogeny of Salix subgenus Salix s.l. (Salicaceae): delimitation, biogeography, and reticulate evolution. BMC Evol Biol 15:31. https://doi.org/10.1186/s12862-015-0311-7\u003c/li\u003e\n \u003cli\u003eZimmer EA, Wen J (2013) Reprint of: Using nuclear gene data for plant phylogenetics: Progress and prospects. Mol Phylogenet Evol 66:539\u0026ndash;550. https://doi.org/10.1016/j.ympev.2013.01.005\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable 1.\u0026nbsp;\u003c/strong\u003eList of \u003cem\u003eSalix\u003c/em\u003e species native to Japan and their taxonomic status (Ohashi 2001), along with the number of samples analyzed in this study. Ploidy levels are based on the previous reports including Suda Y (1964), Suda and Argus (1969) and Wagner et al. (2020). \u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"869\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\n \u003cp\u003eSubgenus\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\n \u003cp\u003eSection\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003eSpecies\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57px;\"\u003e\n \u003cp\u003ePloidy\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003eN\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\n \u003cp\u003eComments\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\n \u003cp\u003e\u003cem\u003ePleuradenia\u003c/em\u003e Kimura\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u003cem\u003eSalix cardiophylla\u003c/em\u003e Trautv. \u0026amp; Mey.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57px;\"\u003e\n \u003cp\u003e2X\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\n \u003cp\u003e\u003cem\u003eChosenia\u003c/em\u003e (Nakai) H.Ohashi\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u003cem\u003eSalix arbutifolia\u003c/em\u003e Pall.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57px;\"\u003e\n \u003cp\u003e2X\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\n \u003cp\u003e\u003cem\u003eProtitea\u003c/em\u003e Kimura\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u003cem\u003eSalix chaenomeloides\u003c/em\u003e Kimura\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57px;\"\u003e\n \u003cp\u003e2X\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\n \u003cp\u003e\u003cem\u003eChamaetia\u003c/em\u003e (Dumortier) Nasarov\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\n \u003cp\u003e\u003cem\u003eHerbella\u003c/em\u003e Seringe\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u003cem\u003eSalix nummularia\u003c/em\u003e Andersson\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57px;\"\u003e\n \u003cp\u003e2X\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\n \u003cp\u003e\u003cem\u003eMyrtilloides\u003c/em\u003e (Borrer) Andersson\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u003cem\u003eSalix fuscescens\u003c/em\u003e Andersson\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57px;\"\u003e\n \u003cp\u003e2X\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\n \u003cp\u003e\u003cem\u003eGlaucae\u003c/em\u003e (Fries) Andersson\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u003cem\u003eSalix nakamurana\u003c/em\u003e Koidz.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 57px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 28px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 180px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; subsp. \u003cem\u003enakamurana\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57px;\"\u003e\n \u003cp\u003eunknown\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\n \u003cp\u003eEndemic to Japan\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; subsp. \u003cem\u003eyezoalpina\u0026nbsp;\u003c/em\u003e(Koidz.) H.Ohashi\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57px;\"\u003e\n \u003cp\u003eunknown\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\n \u003cp\u003eEndemic to Japan\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp; subsp. \u003cem\u003ekurilensis\u003c/em\u003e (Koidz.) H.Ohashi\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57px;\"\u003e\n \u003cp\u003eunknown\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\n \u003cp\u003e\u003cem\u003eSalix\u0026nbsp;\u003c/em\u003eL.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\n \u003cp\u003e\u003cem\u003eTriandrae\u003c/em\u003e Dumortier\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u003cem\u003eSalix triandra\u003c/em\u003e L.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57px;\"\u003e\n \u003cp\u003e2X\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\n \u003cp\u003e\u003cem\u003eSubalbae\u003c/em\u003e Koidz.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u003cem\u003eSalix eriocarpa\u0026nbsp;\u003c/em\u003eFranch. \u0026amp; Sav.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57px;\"\u003e\n \u003cp\u003e4X,5X\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u003cem\u003eSalix pierotii\u0026nbsp;\u003c/em\u003eMiq.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57px;\"\u003e\n \u003cp\u003e4X\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u003cem\u003eSalix jessoensis\u003c/em\u003e Seemen\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57px;\"\u003e\n \u003cp\u003e4X,6X\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\n \u003cp\u003eEndemic to Japan\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\n \u003cp\u003e\u003cem\u003eVetrix\u003c/em\u003e Dumortier\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\n \u003cp\u003e\u003cem\u003eHastatae\u003c/em\u003e (Fries) A.Kerner\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u003cem\u003eSalix japonica\u0026nbsp;\u003c/em\u003eThunb.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57px;\"\u003e\n \u003cp\u003e2X\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\n \u003cp\u003eEndemic to Japan\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u003cem\u003eSalix shiraii\u003c/em\u003e Seemen\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57px;\"\u003e\n \u003cp\u003e2X\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\n \u003cp\u003eEndemic to Japan\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u003cem\u003eSalix rupifraga\u003c/em\u003e Koidz.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57px;\"\u003e\n \u003cp\u003e2X\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\n \u003cp\u003e\u003cem\u003eSieboldianae\u003c/em\u003e C.K.Schneid.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u003cem\u003eSalix sieboldiana\u003c/em\u003e Blume\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57px;\"\u003e\n \u003cp\u003e2X\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\n \u003cp\u003eEndemic to Japan\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u003cem\u003eSalix reinii\u0026nbsp;\u003c/em\u003eSeemen\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57px;\"\u003e\n \u003cp\u003e8X\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\n \u003cp\u003e\u003cem\u003eHelix\u003c/em\u003e Dumortier\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u003cem\u003eSalix miyabeana\u003c/em\u003e Seemen\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 57px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 28px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp;subsp. \u003cem\u003emiyabeana\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57px;\"\u003e\n \u003cp\u003e4X\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u0026nbsp; \u0026nbsp; \u0026nbsp;subsp. \u003cem\u003egymnolepis\u003c/em\u003e (H.L\u0026eacute;v. et Vaniot) H.Ohashi et Yonek.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57px;\"\u003e\n \u003cp\u003e4X\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u003cem\u003eSalix integra\u003c/em\u003e Thunb.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57px;\"\u003e\n \u003cp\u003e2X\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\n \u003cp\u003e\u003cem\u003eIncubaceae\u003c/em\u003e A.Kerner\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u003cem\u003eSalix subopposita\u0026nbsp;\u003c/em\u003eMiq.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57px;\"\u003e\n \u003cp\u003e2X\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\n \u003cp\u003e\u003cem\u003eSubviminales\u003c/em\u003e C.K.Schneid.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u003cem\u003eSalix gracilistyla\u003c/em\u003e Miq.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57px;\"\u003e\n \u003cp\u003e2X\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\n \u003cp\u003eIncluding one sample from Korea.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\n \u003cp\u003e\u003cem\u003eHukaoana\u003c/em\u003e Kimura\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u003cem\u003eSalix hukaoana\u003c/em\u003e Kimura\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57px;\"\u003e\n \u003cp\u003eunknown\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\n \u003cp\u003eEndemic to Japan\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\n \u003cp\u003e\u003cem\u003eDaphnella\u003c/em\u003e Seringe\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u003cem\u003eSalix rorida\u003c/em\u003e Lacksch.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57px;\"\u003e\n \u003cp\u003e2X\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003e9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\n \u003cp\u003eIncluding f.\u0026nbsp;\u003cem\u003ependula\u003c/em\u003e Kimura (1) and\u0026nbsp;\u003cbr\u003ef. \u003cem\u003eroridaeformis\u003c/em\u003e (Nakai) Kimura ex H.Ohashi (1)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\n \u003cp\u003e\u003cem\u003eViminella\u003c/em\u003e Seringe\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u003cem\u003eSalix schwerinii\u003c/em\u003e E. Wolf\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57px;\"\u003e\n \u003cp\u003e2X\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u003cem\u003eSalix udensis\u0026nbsp;\u003c/em\u003eTrautv. \u0026amp; Mey.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57px;\"\u003e\n \u003cp\u003e2X\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003e13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\n \u003cp\u003e\u003cem\u003eCinerella\u003c/em\u003e Seringe\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u003cem\u003eSalix taraikensis\u003c/em\u003e Kimura\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57px;\"\u003e\n \u003cp\u003eunknown\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u003cem\u003eSalix caprea\u003c/em\u003e L.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57px;\"\u003e\n \u003cp\u003e2X\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\n \u003cp\u003eIncluding samples from Korea (2) and\u0026nbsp;\u003cbr\u003eEuropean subspecies subsp. \u003cem\u003ecoaetanea\u0026nbsp;\u003c/em\u003e(Hartm.) Hiitonen (1)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u003cem\u003eSalix futura\u0026nbsp;\u003c/em\u003eSeemen\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57px;\"\u003e\n \u003cp\u003e3X\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\n \u003cp\u003eEndemic to Japan\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 157px;\"\u003e\n \u003cp\u003e \u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 155px;\"\u003e\n \u003cp\u003e \u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e\u003cem\u003eSalix vulpina\u0026nbsp;\u003c/em\u003eAndersson\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 57px;\"\u003e\n \u003cp\u003e2X\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 28px;\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 180px;\"\u003e\n \u003cp\u003e \u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2.\u003c/strong\u003e List of the amplifying and reading primers developed for this study.\u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"869\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 50px;\"\u003e\n \u003cp\u003e \u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 149px;\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 236px;\"\u003e\n \u003cp\u003eType\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 132px;\"\u003e\n \u003cp\u003ePrimer Name\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 227px;\"\u003e\n \u003cp\u003eSequence (5\u0026prime;-3\u0026prime;)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\n \u003cp\u003eLocation\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 50px;\"\u003e\n \u003cp\u003ePGI\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 149px;\"\u003e\n \u003cp\u003eglucose-6-phosphate isomerase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 236px;\"\u003e\n \u003cp\u003eamplifying/reading primer (Forward)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 132px;\"\u003e\n \u003cp\u003ePoptr_PGI + 2151\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 227px;\"\u003e\n \u003cp\u003eAAATGTAGATCCTATTGATGTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 76px;\"\u003e\n \u003cp\u003eCDS(exon)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 50px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 149px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 236px;\"\u003e\n \u003cp\u003eamplifying/reading primer (Reverse)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 132px;\"\u003e\n \u003cp\u003ePoptr_PGI \u0026minus; 2976\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 227px;\"\u003e\n \u003cp\u003eGCTGATCAATGCTTGATGCTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 76px;\"\u003e\n \u003cp\u003eCDS(exon)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 50px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 149px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 236px;\"\u003e\n \u003cp\u003einternal primer (Reverse)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 132px;\"\u003e\n \u003cp\u003ePoptr_PGI \u0026minus; 3442\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 227px;\"\u003e\n \u003cp\u003eTTGTTAGGATCAATGCCAAACT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 76px;\"\u003e\n \u003cp\u003eCDS(exon)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 50px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 149px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 236px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 132px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 227px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 76px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 50px;\"\u003e\n \u003cp\u003encpGS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 149px;\"\u003e\n \u003cp\u003eglutamine synthetase leaf isozyme\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 236px;\"\u003e\n \u003cp\u003eamplifying/reading primer (Forward)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 132px;\"\u003e\n \u003cp\u003ePoptr_ncpGS + 1490\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 227px;\"\u003e\n \u003cp\u003eGATGCACATTATAAGGCTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 76px;\"\u003e\n \u003cp\u003eCDS(exon)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 50px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 149px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 236px;\"\u003e\n \u003cp\u003eamplifying/reading primer (Reverse)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 132px;\"\u003e\n \u003cp\u003ePoptr_ncpGS \u0026minus; 2449\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 227px;\"\u003e\n \u003cp\u003eAATGTGTTCCTTATGGCGAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 76px;\"\u003e\n \u003cp\u003eCDS(exon)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 50px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 149px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 236px;\"\u003e\n \u003cp\u003einternal reading primer (Reverse)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 132px;\"\u003e\n \u003cp\u003ePoptr_ncpGS \u0026minus; 2252\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 227px;\"\u003e\n \u003cp\u003eGGTGTGGCATCCAGCACC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 76px;\"\u003e\n \u003cp\u003eCDS(exon)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 50px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 149px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 236px;\"\u003e\n \u003cp\u003einternal reading primer (Forward) specific for subg. Vetrix-Chamaetia\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 132px;\"\u003e\n \u003cp\u003ePoptr_ncpGS + 1848\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 227px;\"\u003e\n \u003cp\u003eCAGTATCCTTGTCAAAGATTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 76px;\"\u003e\n \u003cp\u003eintron\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 50px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 149px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 236px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 132px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 227px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 76px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 50px;\"\u003e\n \u003cp\u003e6PG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 149px;\"\u003e\n \u003cp\u003e6-phosphogluconate dehydrogenase\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 236px;\"\u003e\n \u003cp\u003eamplifying/reading primer (Forward)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 132px;\"\u003e\n \u003cp\u003ePoptr_6PG + 67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 227px;\"\u003e\n \u003cp\u003eGCCCTTAATATCGCAGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 76px;\"\u003e\n \u003cp\u003eCDS(exon)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 50px;\"\u003e\n \u003cp\u003e \u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 149px;\"\u003e\n \u003cp\u003e \u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 236px;\"\u003e\n \u003cp\u003eamplifying/reading primer (Reverse)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 132px;\"\u003e\n \u003cp\u003ePoptr_6PG \u0026minus; 1195\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 227px;\"\u003e\n \u003cp\u003eTGGCAAGATCAGGATTCCTATCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 76px;\"\u003e\n \u003cp\u003eCDS(exon)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 3.\u003c/strong\u003e Summary of sequence characteristics and genetic diversity statistics for the four loci (\u003cem\u003e6PG\u003c/em\u003e, \u003cem\u003encpGS\u003c/em\u003e, \u003cem\u003ePGI\u003c/em\u003e, and chloroplast sequences). Values shown include the number of phased/haplotypic sequences, aligned sequence length, numbers of variable and parsimony-informative sites, nucleotide diversity (\u0026pi;), haplotype diversity (\u003cem\u003eHd)\u003c/em\u003e, and Tajima\u0026rsquo;s \u003cem\u003eD\u003c/em\u003e with associated significance levels. \u0026nbsp;\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"775\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003eMeasure\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003e\u003cem\u003e6PG\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 101px;\"\u003e\n \u003cp\u003e\u003cem\u003encpGS\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 84px;\"\u003e\n \u003cp\u003e\u003cem\u003ePGI\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 203px;\"\u003e\n \u003cp\u003eChloroplast (concatenated)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003eNumber of phased/haplotypic sequences\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003e266\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 101px;\"\u003e\n \u003cp\u003e188\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 84px;\"\u003e\n \u003cp\u003e160\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 203px;\"\u003e\n \u003cp\u003e134\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003eAligned sequence length\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003e957\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 101px;\"\u003e\n \u003cp\u003e721\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 84px;\"\u003e\n \u003cp\u003e905\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 203px;\"\u003e\n \u003cp\u003e2724\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003eVariable sites\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003e143\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 101px;\"\u003e\n \u003cp\u003e173\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 84px;\"\u003e\n \u003cp\u003e199\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 203px;\"\u003e\n \u003cp\u003e121\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003eParsimony infomative sites\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003e115\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 101px;\"\u003e\n \u003cp\u003e162\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 84px;\"\u003e\n \u003cp\u003e181\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 203px;\"\u003e\n \u003cp\u003e94\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003e\u0026pi;: nucleotide diversity (per site)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003e0.01017\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 101px;\"\u003e\n \u003cp\u003e0.02752\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 84px;\"\u003e\n \u003cp\u003e0.02285\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 203px;\"\u003e\n \u003cp\u003e0.00517\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003e\u003cem\u003eHd\u003c/em\u003e: haplotype (gene) diversity\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003e0.9387\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 101px;\"\u003e\n \u003cp\u003e0.962\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 84px;\"\u003e\n \u003cp\u003e0.955\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 203px;\"\u003e\n \u003cp\u003e0.894\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003eTajima\u0026apos;s \u003cem\u003eD\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003e-1.94209\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 101px;\"\u003e\n \u003cp\u003e-1.56752\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 84px;\"\u003e\n \u003cp\u003e-1.5044\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 203px;\"\u003e\n \u003cp\u003e-1.51405\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 267px;\"\u003e\n \u003cp\u003eStatistical significance\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 120px;\"\u003e\n \u003cp\u003eP \u0026lt; 0.05\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 101px;\"\u003e\n \u003cp\u003e0.10 \u0026gt; P \u0026gt; 0.05\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 84px;\"\u003e\n \u003cp\u003eP \u0026gt; 0.10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 203px;\"\u003e\n \u003cp\u003eP \u0026gt; 0.10\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003e\u003cbr\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 4.\u0026nbsp;\u003c/strong\u003eMean divergence time estimates (Mya) of representative nodes (i.e., lettered nodes in Fig. 3) for Japanese native \u003cem\u003eSalix\u003c/em\u003e species and lineage based on nuclear intronic sequences of the \u003cem\u003encpGS\u003c/em\u003e and \u003cem\u003ePGI\u003c/em\u003e genes. The 95% highest posterior density (HPD) interval is shown in parentheses.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"869\" class=\"fr-table-selection-hover\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 72px;\"\u003e\n \u003cp\u003eNode\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 504px;\"\u003e\n \u003cp\u003eEvent\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003eMean Divergence Time (95% HPD) (Ma)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 72px;\"\u003e\n \u003cp\u003eA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 504px;\"\u003e\n \u003cp\u003eRoot node of Salicaceae *\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e48.03 (46.09\u0026ndash;49.99)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 72px;\"\u003e\n \u003cp\u003eB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 504px;\"\u003e\n \u003cp\u003eDivergence of \u003cem\u003eS. triandra\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e34.80 (25.76 \u0026ndash;44.87)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 72px;\"\u003e\n \u003cp\u003eC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 504px;\"\u003e\n \u003cp\u003eDivergence of \u003cem\u003eS. arbutifollia/cardiophylla\u003c/em\u003e (Divergence of \u003cem\u003eVetrix-Chamaetia\u003c/em\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e30.54 (22.71\u0026ndash;39.00)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 72px;\"\u003e\n \u003cp\u003eD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 504px;\"\u003e\n \u003cp\u003eCrown age of sugb. \u003cem\u003eVetrix-Chamaetia\u003c/em\u003e *\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e22.79 (20.85\u0026ndash;24.72)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 72px;\"\u003e\n \u003cp\u003eE\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 504px;\"\u003e\n \u003cp\u003eDivergence of subg. \u003cem\u003eChamaetia\u003c/em\u003e (\u003cem\u003eS. fuscescens\u003c/em\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e16.96 (8.34\u0026ndash;24.57)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 72px;\"\u003e\n \u003cp\u003eF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 504px;\"\u003e\n \u003cp\u003eDivergence of subg. \u003cem\u003eChamaetia\u003c/em\u003e (\u003cem\u003eS. nakamurana\u003c/em\u003e/\u003cem\u003enummularia\u003c/em\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e13.74 (7.08\u0026ndash;23.04)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 72px;\"\u003e\n \u003cp\u003eG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 504px;\"\u003e\n \u003cp\u003eCrown age of the \u003cem\u003eDaphnella\u003c/em\u003e\u0026ndash;\u003cem\u003eSubviminalis\u003c/em\u003e\u0026ndash;\u003cem\u003eHelix\u003c/em\u003e\u0026ndash;\u003cem\u003eHukaoana\u003c/em\u003e clade\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e13.42 (7.92- 18.85)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 72px;\"\u003e\n \u003cp\u003eH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 504px;\"\u003e\n \u003cp\u003eDivergence of \u003cem\u003eS. hukaoana\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e12.21 (6.88\u0026ndash;17.76)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 72px;\"\u003e\n \u003cp\u003eI\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 504px;\"\u003e\n \u003cp\u003eDivergence between sects. \u003cem\u003eSubviminalis\u0026nbsp;\u003c/em\u003eand\u003cem\u003e\u0026nbsp;Helix\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e10.68 (4.96\u0026ndash;16.49)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 72px;\"\u003e\n \u003cp\u003eJ\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 504px;\"\u003e\n \u003cp\u003eDivergence of \u003cem\u003eS. futura\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e9.43 (3.37\u0026ndash;16.50)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 72px;\"\u003e\n \u003cp\u003eK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 504px;\"\u003e\n \u003cp\u003eDivergence of Fossa-Magna element (endemic species of subg. \u003cem\u003eHastatae\u003c/em\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e5.21 (1.86\u0026ndash;9.16)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 72px;\"\u003e\n \u003cp\u003eL\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 504px;\"\u003e\n \u003cp\u003eCrown age of endemic species of subg. \u003cem\u003eHastatae\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e4.36 (0.84\u0026ndash;8.21)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 72px;\"\u003e\n \u003cp\u003eM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 504px;\"\u003e\n \u003cp\u003eDivergence of\u003cem\u003e\u0026nbsp;S. rupifraga\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\n \u003cp\u003e2.72 (0\u0026ndash;6.57)\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd style=\"width: 72px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003ctd style=\"width: 504px;\"\u003e\n \u003cp\u003e* Calibrated nodes\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 293px;\"\u003e\u003cbr\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"journal-of-plant-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jpre","sideBox":"Learn more about [Journal of Plant Research](http://link.springer.com/journal/10265)","snPcode":"10265","submissionUrl":"https://www.editorialmanager.com/jpre/default2.aspx","title":"Journal of Plant Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Salix, low-copy nuclear genes, chloroplast, phylogenetic networks, divergence time estimation, Japanese Archipelago","lastPublishedDoi":"10.21203/rs.3.rs-8303889/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8303889/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"In this study, we aimed to reveal the phylogenetic relationships of Salix species in Japan, with particular emphasis on the speciation process of endemic species. We performed molecular phylogenetic analyses of all available native species using multilocus datasets of low-copy nuclear genes and chloroplast sequences. Although gene-tree incongruence and basal reticulation were evident—implying the need for future genome-scale analyses— our analyses still provided sufficient resolution to clarify the phylogenetic structure of the Japanese Salix flora and to offer meaningful insights into its diversification. The integrated analyses identified three major lineages within the Japanese subg. Vetrix, revealed the polyphyly of the subg. Chamaetia, and clarified the phylogenetic context of several key endemic species. For example, S. hukaoana of the monotypic section Hukaoana and S. futura were inferred to be relicts of ancient lineages that diverged during the Mid to Late Miocene, whereas the species of sect. Hastatae (i.e., S. rupifraga, S. shiraii, and S. japonica) were suggested to be neoendemics derived from S. vulpina. Moreover, intraspecific taxa such as S. miyabeana and S. nakamurana showed signs of hybridization, suggesting that interspecific hybridization and introgression may contribute in lineage differentiation.","manuscriptTitle":"Preliminary phylogenetic insights into Japanese willows (Salix L.) using low-copy nuclear genes, with emphasis on endemic species","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-01-09 07:17:53","doi":"10.21203/rs.3.rs-8303889/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Minor revision","date":"2026-02-08T22:04:55+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2026-01-08T01:52:43+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-01-08T01:43:04+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-12-10T06:14:56+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of Plant Research","date":"2025-12-08T00:45:03+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"journal-of-plant-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jpre","sideBox":"Learn more about [Journal of Plant Research](http://link.springer.com/journal/10265)","snPcode":"10265","submissionUrl":"https://www.editorialmanager.com/jpre/default2.aspx","title":"Journal of Plant Research","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"aa391b13-16be-485d-8f88-dfa11758ad79","owner":[],"postedDate":"January 9th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-09T00:37:24+00:00","versionOfRecord":[],"versionCreatedAt":"2026-01-09 07:17:53","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8303889","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8303889","identity":"rs-8303889","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00