Development of a CRISPR-Cas9-Based Cellular Model for SGCB Gene Mutation: A Platform for Investigating Gene Therapy Strategies in LGMD2E | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Development of a CRISPR-Cas9-Based Cellular Model for SGCB Gene Mutation: A Platform for Investigating Gene Therapy Strategies in LGMD2E Zahra Farshchian Yazdi, Shahrzad RoshanNezhad, Atieh Eslahi Eslahi, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-9220253/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Limb-Girdle Muscular Dystrophy Type 2E (LGMD2E) is one of the most prevalent phenotypes within the limb-girdle muscular dystrophies (LGMDs). This myopathy is caused by pathogenic mutations in the SGCB gene, which encodes β-type sarcoglycan. LGMD2E is recognized as the most prevalent sarcoglycanopathy among the Iranian population specially within the Baloch ethnic group. To develop innovative gene therapy strategies based on accessible gene delivery and gene editing techniques, it is essential to have a cell line harboring genomic mutations in the SGCB gene. These cell models are crucial for the preliminary evaluation of the efficacy of gene-editing-based methods. In this study, we utilized the clustered regularly interspaced short palindromic repeats (CRISPR) system and the approach of inducing indel mutations to generate an HEK-293T cell model harboring a frameshift mutation in SGCB gene. Methods Two distinct SGCB exon 2 targeting single guide RNAs (sgRNAs) were cloned into PX458 plasmids containing spCas9, and recombinant plasmids were transduced into HEK293T cells. The mutagenesis efficiency was evaluated using the TIDE program on Sanger sequencing data of transduced cells. Mutated cell clones were obtained through serial dilution techniques. Results Our results demonstrated the substantial efficacy of the CRISPR-Cas9 system in inducing mutations within the SGCB gene. This capability presents significant potential for precise editing of the SGCB gene in muscular cells, thereby establishing a robust cellular model for LGMD2E gene-editing strategies. Conclusions The application of CRISPR-Cas9 technology in this study highlights its potential for targeted gene editing in LGMD2E research. These findings pave the way for further investigations into the development of precision therapy for LGMD2E, ultimately contributing to the development of effective therapeutic strategies. LGMD2E SGCB Gene editing CRISPR cellular model Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Sarcoglycanopathies are the most prevalent subtype of LGMDs, making approximately 20–25% of patients and 40–65% of cases with infant onset ( 1 , 2 ). Mutations in the genes encoding the four types of membrane glycoproteins (α-, β-, γ-, and δ-sarcoglycan) are responsible for sarcoglycanopathy. These glycoproteins form a tetrameric complex within the cell membrane of skeletal and cardiac muscle cells, playing a critical role in maintaining skeletal muscle cell membrane stability ( 3 ). Clinically, these diseases are characterized by progressive proximal muscle weakness preferentially affecting the shoulder and pelvic girdles, leading to impaired ambulation, difficulty ascending stairs, the presence of Gower's sign, and eventual loss of independent mobility necessitating wheelchair use. Advanced disease stages are marked by profound muscle weakness, skeletal muscle tissue fibrosis, joint contractures, scoliosis, severe cardiac dysfunction, respiratory insufficiency, and ultimately, premature mortality due to cardiorespiratory failure, typically occurring by the fourth decade ( 4 ). Current treatments for LGMDs predominantly offer supportive care through multifaceted approaches. Managing LGMDs requires a comprehensive approach involving a multidisciplinary team of specialists, such as cardiologists, pulmonologists, rehabilitation experts, and nutritionists, along with necessary medical equipment. Unfortunately, access to and coordination of these services often fall short of adequately addressing the complex needs and expectations of patients and their families, placing a significant burden on them ( 5 ). Pharmacological approaches for LGMDs, including the use of corticosteroids, have so far demonstrated limited and inconsistent efficacy. Additionally, strategies aimed at promoting muscle growth, such as growth hormone-facilitated muscle cell transfer and myostatin inhibition, have proven to be ineffective. While these interventions aim to preserve muscle function, there remains a significant need for therapies that can actively enhance muscle strength and address the underlying disease mechanisms ( 6 ). Despite the huge effort for developing effective therapeutic interventions, Locus and allelic heterogeneity, the varying effects of different pathogenic variants on protein expression levels and activity, challenges in delivering therapeutic tools to the entire muscle mass, and the continuous proliferation of muscle cells have posed challenges for the development of gene delivery-based therapies ( 7 ). Gene editing has emerged as a promising therapeutic avenue for LGMDs, with recent studies highlighting the potential of the CRISPR-associated protein 9 (CRISPR-Cas9) system. This technology allows for mutation-specific correction, potentially leading to improved efficacy and long-lasting therapeutic benefits. The inherent advantages and versatility of CRISPR-Cas9 have fueled a significant revolution in gene editing and regulation since its groundbreaking discovery in 2012 ( 8 , 9 ). One of the most prevalent forms of LGMD, LGMD2E, is an autosomal recessive disorder characterized by mutations in both alleles of the SGCB gene, as first described by Bönnemann and Lim ( 10 , 11 ). LGMD2E is frequently characterized as a severe variant of LGMD, with some individuals manifesting symptoms prior to the age of eight and experiencing loss of ambulation by their second decade of life ( 12 ). The clinical symptoms of this disease include progressive muscle weakness, cardiac and respiratory issues, and loss of mobility, which significantly affect patients' daily activities. Early diagnosis of these symptoms can lead to more effective therapeutic interventions and improve patients' quality of life ( 13 , 14 ). The SGCB gene spans 13.5 KB and comprises six exons which encodes the β-sarcoglycan protein, which is integral to the dystrophin-glycoprotein complex (DGC), essential for maintaining the integrity of the muscle membrane and facilitating the connection between the cytoskeleton and the extracellular matrix ( 15 , 16 ). The molecular pathogenesis of LGMD2E is linked to a wide spectrum of mutations within SGCB , including missense, nonsense, splice-site, and frameshift mutations, as well as large deletions and partial duplications ( 14 , 17 , 18 ). This condition is the most prevalent Sarcoglycanopathy among Iranians especially in Baloch ethnic group, who settled in the border regions of Afghanistan, Pakistan, and Iran. A significantly frequent founder mutation in this area has been found, homozygous exon 2 deletion mutation in the SGCB gene. in-frame deletion caused by this mutation results in a shorter SGCB protein that has 70 fewer amino acids than the original protein; thus, it is predicted that the disease will occur more frequently than previously thought in this region ( 19 , 20 ). Gene therapy approach for LGMD2, utilizing in vivo delivery of an optimized SGCB coding sequence via adeno-associated virus (AAV) vectors, is presently undergoing Phase III clinical evaluation ( 21 ). While this strategy holds significant promise, several challenges remain, including the need for precise regulation of gene expression, the potential for insertional mutagenesis associated with the delivered viral vector, and the possibly limited duration of therapeutic benefit. These limitations underscore the urgent need for the development of more sustainable and inherently safer therapeutic interventions. CRISPR-Cas9 systems have emerged as a groundbreaking technology for targeted genome editing, particularly in complex organisms like humans, fundamentally transforming the field of genetics ( 22 ). Since its initial development in 2013, these systems have garnered significant recognition, including the 2020 Nobel Prize, owing to their exceptional capabilities and transformative potential. The ease of design using RNA-DNA heteroduplex complementary, coupled with high precision and cost-effectiveness, has fueled the rapid adoption of CRISPR-Cas technology in clinical applications, most notably in the treatment of genetic diseases ( 23 ). The CRISPR-Cas9 system initiates targeted double-strand breaks (DSBs) at specific genomic loci, thereby triggering cellular DNA repair pathways ( 24 ). In eukaryotic cells, the predominant DSB repair mechanisms are non-homologous end joining (NHEJ) and homology-directed repair (HDR), which compete for the processing of Cas9-induced breaks ( 25 ). The NHEJ pathway repairs DSBs through direct ligation or by introducing insertions or deletions (indels) at the break site. This repair mechanism is inherently error-prone, frequently leading to the insertion or deletion of DNA base pairs ( 25 ). Consequently, NHEJ can disrupt the targeted gene via frameshift mutations, potentially resulting in loss-of-function alleles ( 26 , 27 , 28 ). NHEJ can occur at any stage of the cell cycle. In contrast to NHEJ, HDR is predominantly active during the late S and G2 phases of the cell cycle, when sister chromatids are available as repair templates. Successful HDR, leading to accurate base substitutions or insertions at the target locus, requires the presence of a homologous donor DNA sequence derived from a sister chromatid or an exogenously introduced template ( 29 , 30 ). The CRISPR-Cas9 system has been widely applied to both disease modeling and gene therapy research for Duchenne muscular dystrophy (DMD) ( 31 ). In contrast, the use of CRISPR-Cas9 in studies of LGMD has been less extensive, although there is a growing interest in leveraging this technology for these conditions ( 32 ). Notably, CRISPR-based modeling studies have successfully generated mouse and pig models of LGMD R1 by targeting the CAPN3 gene, which encodes the calpain 3 protein ( 33 , 34 ). Similarly, mouse and zebrafish models of LGMD2C have been generated, targeting the SGCG gene, which encodes gamma-sarcoglycan. These models provide valuable tools for investigating the disease mechanisms underlying LGMD2C ( 35 ). Beyond the generation of cellular models, CRISPR-Cas9 has also been explored as a gene correction tool for LGMDs. For example, CRISPR-Cas9-mediated gene editing has been used to correct mutations responsible for LGMD types 2B, 2C, and 2D in induced pluripotent stem cells (iPSCs), demonstrating the potential of this technology for therapeutic applications ( 36 , 37 ). In cellular models of LGMD2D, genetic manipulation of the TNPO3 gene has been achieved using CRISPR-Cas9 technology ( 38 ). CRISPR-Cas9 system has also demonstrated efficacy in repairing the CAPN3 gene in cellular models of LGMD2A ( 39 , 40 ). A critical initial step in designing and evaluating CRISPR-based therapeutic strategies toward LGMD2E is the establishment of cell lines harboring the pathogenic mutations in SGCB gene. Generating such cell lines directly from patients with LGMD2E presents complex technical and ethical challenges. Consequently, the generation of mutant cell lines through alternative methods has garnered considerable attention from researchers. To investigate the potential of CRISPR-Cas9 for generating SGCB mutant cell lines, we targeted exon 2 of the SGCB gene in HEK293T cells using CRISPR-Cas9. This approach was designed to introduce targeted mutations within this critical region of the gene. Examination of the manipulated cell population demonstrates a significant success rate in CRISPR- mediated SGCB mutagenesis. The results from this study may pave the way for creating a cellular model for LGMD2E disease. This model could serve as a valuable resource for gene-editing therapies and a useful platform for identifying potential drugs aimed at treating LGMD2E. Material and Methods sgRNA design The SGCB reference sequence (NG_008891.1) was retrieved from the NCBI database. To identify effective sgRNAs targeting exon 2 of the SGCB gene, we utilized the online CRISPR design tools CRISPOR, CHOPCHOP, and GT-Scan, which allowed us to predict on-target activity and potential off-target effects. sgRNA-encoding oligonucleotides were chemically synthesized, and double-stranded oligonucleotides were generated by hybridizing 100 pmol of sense and antisense oligonucleotides. The resulting sgRNAs were named according to their position within exon 2 ( e.g. , sgRNA103 and sgRNA133). The sequences of sgRNAs designed and utilized in this study are presented in Table 1 . CRISPR plasmid production Following BbsI digestion of the pSpCas9(BB)-2A-GFP plasmid (PX458; Addgene, Cat #48138), hybridized sgRNA was ligated into the vector using T4 DNA ligase. The ligation reaction was performed in a 20 µl volume containing 50 ng of digested plasmid, 50 pmol of hybridized sgRNA, 10 units of T4 DNA ligase, and 1X T4 ligation buffer, incubated at 16°C overnight. The ligation product was then transformed into competent DH5α Escherichia coli cells via heat shock standard protocol. Recombinant colonies were selected, and plasmid DNA was isolated using the SimEx plasmid miniprep kit (Simbiolab, Iran). Insertion of the sgRNA sequence into the plasmid was confirmed by both PCR (polymerase chain reaction) amplification and Sanger sequencing using U6 universal primers (Table 1 ). Cell culture and transfection HEK293T cells were maintained in high-glucose Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1X penicillin-streptomycin in a humidified incubator at 37°C with 5% CO2. For transfection experiments, HEK293T cells were trypsinized and plated at a density of 250,000 cells per well in 6-well plates 48 hours prior to transfection. To ensure optimal transfection efficiency, cells were synchronized by overnight serum starvation once they reached 60% confluency. Cells were then transfected with 3 µg of sgRNA-expressing vector per well using LTR reagent, according to the manufacturer's instructions. Following transfection, the medium was replaced with complete DMEM supplemented with 10% FBS, but without penicillin-streptomycin. Transfection efficiency was determined by fluorescence microscopy 48 hours after transfection. Genomic DNA extraction and mutation analysis Genomic DNA was isolated from transfected cells using the SimEx blood DNA kit (Simbiolab, Iran). To amplify a 157 bp region flanking the CRISPR-Cas9 target site and identify potential frameshift mutations, PCR was performed using specifically designed primers (Table 1 ). The 20 µl PCR reaction mixture consisted of 250 µM of each primer, and 100 ng of template DNA. The PCR program was as follows: initial denaturation at 95°C for 5 minutes, followed by 35 cycles of denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, and extension at 72°C for 30 seconds, with a final extension step at 72°C for 5 minutes. The resulting PCR amplicons were subjected to Sanger sequencing for mutation analysis. Mutation Detection and Mutagenesis Efficiency Assay To assess the frequency and spectrum of indel mutations, Sanger sequencing results were analyzed using the TIDE (Tracking of Indels by Decomposition) online software ( 41 ). Sequence decompositions with a p-value less than 0.01 were considered statistically significant. Single-cell clone preparation A clonal selection strategy involving limiting dilution was used to obtain a pure population of SGCB -mutated HEK293T cells. Cells were serially diluted to achieve a statistical distribution of 0.5 cells per 200 µl in complete medium. This suspension was then plated into 96-well plates to achieve single-cell seeding. After 4–5 days of incubation, wells containing single, isolated colonies were identified. Genomic DNA was extracted from each well exhibiting a single colony, and PCR followed by Sanger sequencing was performed to confirm homozygous SGCB mutations. Colony genotyping To screen for homozygous SGCB -mutated clones, five single clones were selected at random. Genomic DNA was extracted from each of these clones, and the targeted region was amplified by PCR using the primers described earlier. The resulting PCR products were then subjected to Sanger sequencing to identify clones carrying the desired homozygous mutation. Table 1 The table present the sgRNA sequences and primers utilized in this research. The gRNAs were specifically designed to target the exon 2 of the SGCB gene sequence. Primer name Primer sequence TM GC Product length (bp) Colony primer Forward primer(U6) GAGGGCCTATTTCCCATGATT 54 47 274 bp Reverse primer (sgRNA antisense) sgRNA133 antisense AAACTGTTTTGTGGAGACGATCTTC 55 40 sgRNA103 antisense AAACATTGATGAAGATCGTCTCCAC 55 40 PCR primers Forward primer CCTGTAAAGAAGTCCATGCGT 58 47 157 bp Reverse primer AAGTCTGAGTGAGTCCCTGG 56 42 sgRNA name sgRNA sequence (5´→ 3´) Score sg133 AAGATCGTCTCCACAAAACA sg103 TGGAGACGATCTTCATCAAT Results CRISPR-Cas9 plasmid preparation for SGCB gene targeting Two pairs of sgRNAs were designed, considering factors such as predicted on-target efficacy, potential off-target effects, GC content (45–60%), the absence of stable secondary structures (hairpin loops with Tm -10 kcal/mol). Those sgRNAs with the most favorable predicted profiles were selected and cloned into the PX458 plasmid. To ensure the correct insertion of the sgRNA, a two-step validation process was employed. First, PCR was performed on plasmid DNA to confirm the presence of the sgRNA insert (Fig. 1 a). Second, Sanger sequencing was carried out to verify the precise sgRNA sequence within the PX458 vector (Fig. 1 b). Examining the SGCB gene alterations in the HEK293T cell line The efficiency of transfection, as assessed by eGFP expression 48 hours after transfection, was greater than 50% (Fig. 2 ). To determine the frequency of indel mutations induced by sgRNAs, genomic DNA was extracted from cells treated with either sgRNA133 or sgRNA103. The targeted region was amplified via PCR, and Sanger sequencing was performed on the resulting amplicons (Fig. 3 ). These Sanger sequencing results were then analyzed using the TIDE algorithm to quantify indel frequencies. TIDE analysis revealed that sgRNA133 induced a higher percentage of indels (25.1%) compared to sgRNA103. Furthermore, the composite sequence generated by TIDE analysis initiated at the predicted Cas9 cleavage site, providing evidence for accurate on-target cleavage (Fig. 4 ). In Figs. 4 a and 4 b, derived from sample analysis conducted with TIDE software following Sanger sequencing, the majority of cells are identified as wild-type, indicating a lack of mutations in the SGCB gene. In sample sg103 (Fig. 4 a), approximately 7.7% of the cells exhibit mutations, predominantly consisting of deletion mutations. Conversely, in sample sg133 (Fig. 4 b), the percentage of mutated cells increases to about 25.1%, with the majority representing insertion mutations. Single cell clone preparation To isolate individual mutated clones with distinct characteristics, we employed a serial limiting dilution technique. After selecting five clones, we extracted genomic DNA and performed PCR using specific primers. The resulting 157 bp PCR products, obtained from single-cell cloning, were subjected to Sanger sequencing, with the outcomes presented in Fig. 5 . Figure 5 a illustrates the wild-type sample, while Fig. 5 b depicts the mutated sample. The highlighted regions in both figures correspond to the sgRNA133 sequence, which is clearly visible in the wild-type sample. In contrast, the mutated sample (Fig. 5 b) reveals only a truncated portion of the sgRNA133 sequence (11 nucleotides). We also analyzed sanger sequencing of our mutant single clone by Tide algorithm (Fig. 6 ). The results confirms that the mutant clone is compound heterozygous. One allele exhibits a deletion of nine nucleotides, while the other allele shows an insertion of two nucleotides. Notably, there is no evidence of the normal allele (mutation = 0) in the results. Following CRISPR-Cas9 cleavage, indels were generated via the NHEJ repair pathway, resulting in a disruption of the sgRNA133 sequence within the gene and its reading frame. Among the sequenced clones, one clone exhibited a compound heterozygous mutation that altered the reading frame, potentially impacting gene translation and the function of the resulting protein. Discussion LGMD2E poses a significant health challenge in Iran due to its high prevalence. While LGMD2E may not be a primary focus in other geographical regions, its status as the most common sarcoglycanopathy in the Iranian population necessitates prioritization of treatment and research efforts ( 18 , 19 ). Despite this critical need, LGMD2E has historically received insufficient attention. The particularly high prevalence of LGMD2E within the Baloch ethnic group, coupled with the geographic distribution of Baloch communities across the border regions of Iran, Pakistan, and Afghanistan, suggests that the overall disease burden may be underestimated. Furthermore, the high frequency of a homozygous exon 2 deletion mutation in the SGCB gene among affected patients points to a founder effect specific to this region. Therefore, further research for developing potential therapeutic agents are crucial to improving the quality of life for affected individuals and reducing the burden of LGMD2E. While gene therapy research for sarcoglycanopathies and LGMDs, including LGMD2E, is currently limited, promising avenues are being explored. For example, Pozsgai et al. conducted comprehensive gene therapy studies in LGMD2E mice, using the AAVrh74 vector to deliver a normal SGCB gene to affected muscles ( 42 ). This resulted in the expression of the normal gene, reconstitution of the dystrophin-associated protein complex (DAPC), improved muscle function and effectively reduced fibrosis and restored strength in LGMD2E mice ( 42 ). Furthermore Intravenous administration of scAAV.MHCK7. Hsgcb resulted in 98.1% gene expression across all muscles, along with reductions in serum creatine kinase levels and spinal kyphoscoliosis ( 43 ). Overally, this intervention markedly improved muscle function in the mice. These promising results has led to emerging of clinical trials focused on AAV vectors based gene delivery in humans. This clinical trial is currently underway and has yielded promising results. However, the temporary nature of these treatments and the inherent possibility of insertional mutagenesis of viral vectors, along with concerns about immunological reactions to these vectors, further highlight the need to use gene editing technologies to rescue the endogenous SGCB gene function. Present study focused on evaluating sgRNA efficiency and selecting an effective sgRNA to providing an LGMD2E cellular model. the HEK293T cell line was an optimal in vitro model due to its easy accessibility, robust growth, human origin, high transfection efficiency, and stable genetic background. Using this platform, we aimed to identify a highly efficient sgRNA capable of inducing significant mutagenesis in the SGCB gene using the CRISPR-Cas9 system, representing an initial step towards CRISPR-based gene therapy for LGMD2E. We identified two sgRNA variants targeting exon 2 of the SGCB gene, sgRNA103 and sgRNA133, and found that sgRNA133 exhibited a significantly higher mutagenesis rate (25.1%) compared to sgRNA103 (7.7%). This highlights the critical role of sgRNA design in optimizing CRISPR applications and suggests that sgRNA133 may be more suitable for future therapeutic strategies aimed at correcting mutations in the SGCB gene. This achievement brings us closer to establishing a stable muscle cell line for LGMD2E, a crucial advancement for developing therapeutic interventions. To our knowledge, this is the first report of an LGMD2E cell model created using CRISPR-Cas technology. Conclusion We successfully introduced a compound heterozygous mutation into the SGCB gene in HEK293T cells, setting the stage for establishing a cellular model for LGMD2E disease. This mutated cell line offers considerable promise for various applications related to this disease. Our findings highlight the effectiveness of CRISPR-Cas9 as a precise gene-editing tool capable of accurately modifying the SGCB gene. This technology presents significant potential as a prospective therapy for LGMD2E in the future. Abbreviations AAV adeno-associated virus CRISPR clustered regularly interspaced short palindromic repeats CRISPR-Cas9 CRISPR-associated protein 9 DAPC dystrophin-associated protein complex DGC dystrophin-glycoprotein complex DMD Duchenne muscular dystrophy DMEM Dulbecco's Modified Eagle Medium DSB double-strand break FBS fetal bovine serum HDR homology-directed repair Indels insertions or deletions iPSCs induced pluripotent stem cells LGMD limb-girdle muscular dystrophy LGMD2E Limb-Girdle Muscular Dystrophy Type 2E NHEJ non-homologous end joining PCR polymerase chain reaction sgRNA single guide RNA TIDE Tracking of Indels by Decomposition Declarations Ethics approval and consent to participate Not applicable Consent for publication Not applicable Competing interests The authors declare that they have no competing interests. Funding This research received no external funding. Author Contribution Conceptualization, M.M.; methodology, Z.F., S.R., F.A., and S.F.; investigation, Z.F. and A.E.; writing—original draft preparation, Z.F.; discussed and commented on the manuscript, M.S., A.E., and A.E.; editing article, M.M.; supervision, M.M.; project administration, F.A.; all authors have read and agreed to the published version of the manuscript. Acknowledgments Not applicable. Availability of data and materials All data generated or analyzed during this study are included in this manuscript. References Vainzof M, Passos-Bueno MR, Pavanello R, Marie SKN, Oliveira A, Zatz M (1998) Sarcoglycanopathies are responsible for 68% of severe autosomal recessive limb-girdle muscular dystrophy. Neuromuscul Disord. ;8(3/4) Fanin M, Nascimbeni A, Aurino S, Tasca E, Pegoraro E, Nigro V et al (2009) Frequency of LGMD gene mutations in Italian patients with distinct clinical phenotypes. Neurology 72(16):1432–1435 Sandona D, Betto R (2009) Sarcoglycanopathies: molecular pathogenesis and therapeutic prospects. Expert Rev Mol Med 11:e28 Mathur P, Kaur A, Vijay U, Gupta A, Agarwal K, Agrawal L (2025) Limb-Girdle Muscular Dystrophies (LGMD): Clinical features, diagnosis and genetic variability through next generation sequencing. Glob Med Genet 12(1):100035 Bouchard C, Tremblay JP (2023) Limb-Girdle Muscular Dystrophies Classification and Therapies. J Clin Med. ;12(14) Sahin IO, Ozkul Y, Dundar M (2021) Current and Future Therapeutic Strategies for Limb Girdle Muscular Dystrophy Type R1: Clinical and Experimental Approaches. Pathophysiology 28(2):238–249 Okada T, Takeda S (2013) Current Challenges and Future Directions in Recombinant AAV-Mediated Gene Therapy of Duchenne Muscular Dystrophy. Pharmaceuticals (Basel) 6(7):813–836 Chemello F, Bassel-Duby R, Olson EN (2020) Correction of muscular dystrophies by CRISPR gene editing. J Clin Invest 130(6):2766–2776 Eslahi A, Alizadeh F, Avan A, Ferns GA, Moghbeli M, Reza Abbaszadegan M et al (2023) New advancements in CRISPR based gene therapy of Duchenne muscular dystrophy. Gene 867:147358 Bonnemann CG, Passos-Bueno MR, McNally EM, Vainzof M, de Sa Moreira E, Marie SK et al (1996) Genomic screening for beta-sarcoglycan gene mutations: missense mutations may cause severe limb-girdle muscular dystrophy type 2E (LGMD 2E). Hum Mol Genet 5(12):1953–1961 Lim LE, Duclos F, Broux O, Bourg N, Sunada Y, Allamand V et al (1995) Beta-sarcoglycan: characterization and role in limb-girdle muscular dystrophy linked to 4q12. Nat Genet 11(3):257–265 Bönnemann CG, Modi R, Noguchi S, Mizuno Y, Yoshida M, Gussoni E et al (1995) β–sarcoglycan (A3b) mutations cause autosomal recessive muscular dystrophy with loss of the sarcoglycan complex. Nat Genet 11(3):266–273 Sveen M-L, Thune JJ, Køber L, Vissing J (2008) Cardiac involvement in patients with limb-girdle muscular dystrophy type 2 and Becker muscular dystrophy. Arch Neurol 65(9):1196–1201 Semplicini C, Vissing J, Dahlqvist JR, Stojkovic T, Bello L, Witting N et al (2015) Clinical and genetic spectrum in limb-girdle muscular dystrophy type 2E. Neurology 84(17):1772–1781 Boito CA, Melacini P, Vianello A, Prandini P, Gavassini BF, Bagattin A et al (2005) Clinical and molecular characterization of patients with limb-girdle muscular dystrophy type 2I. Arch Neurol 62(12):1894–1899 Ervasti JM, Campbell KP (1991) Membrane organization of the dystrophin-glycoprotein complex. Cell 66(6):1121–1131 Trabelsi M, Kavian N, Daoud F, Commere V, Deburgrave N, Beugnet C et al (2008) Revised spectrum of mutations in sarcoglycanopathies. Eur J Hum Genet 16(7):793–803 Ghafouri-Fard S, Hashemi-Gorji F, Fardaei M, Miryounesi M (2017) Limb girdle muscular dystrophy type 2E due to a novel large deletion in SGCB gene. Iran J child Neurol 11(3):57 Alavi A, Esmaeili S, Nilipour Y, Nafissi S, Tonekaboni SH, Zamani G et al (2017) LGMD2E is the most common type of sarcoglycanopathies in the Iranian population. J Neurogenet 31(3):161–169 Ghafouri-Fard S, Hashemi-Gorji F, Fardaei M, Miryounesi M (2017) Limb Girdle Muscular Dystrophy Type 2E Due to a Novel Large Deletion in SGCB Gene. Iran J Child Neurol 11(3):57–60 Mendell JR, Chicoine LG, Al-Zaidy SA, Sahenk Z, Lehman K, Lowes L et al (2019) Gene Delivery for Limb-Girdle Muscular Dystrophy Type 2D by Isolated Limb Infusion. Hum Gene Ther 30(7):794–801 Jinek M, East A, Cheng A, Lin S, Ma E, Doudna J (2013) RNA-programmed genome editing in human cells. Elife 2:e00471 Chaikind B, Bessen JL, Thompson DB, Hu JH, Liu DR (2016) A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res 44(20):9758–9770 Hackley CR (2021) A Novel Set of Cas9 Fusion Proteins to Stimulate Homologous Recombination: Cas9-HRs. CRISPR J 4(2):253–263 Haapaniemi E, Botla S, Persson J, Schmierer B, Taipale J (2018) CRISPR–Cas9 genome editing induces a p53-mediated DNA damage response. Nat Med 24(7):927–930 Lino CA, Harper JC, Carney JP, Timlin JA (2018) Delivering CRISPR: a review of the challenges and approaches. Drug Delivery 25(1):1234–1257 Musunuru K (2017) The hope and hype of CRISPR-Cas9 genome editing: a review. JAMA Cardiol 2(8):914–919 Román-Rodríguez FJ, Ugalde L, Álvarez L, Díez B, Ramírez MJ, Risueño C et al (2019) NHEJ-mediated repair of CRISPR-Cas9-induced DNA breaks efficiently corrects mutations in HSPCs from patients with fanconi anemia. Cell Stem Cell 25(5):607–621 e7 Lin S, Staahl BT, Alla RK, Doudna JA (2014) Enhanced homology-directed human genome engineering by controlled timing of CRISPR/Cas9 delivery. elife 3:e04766 Branzei D, Foiani M (2008) Regulation of DNA repair throughout the cell cycle. Nat Rev Mol Cell Biol 9(4):297–308 Alizadeh F, Abraghan YJ, Farrokhi S, Yousefi Y, Mirahmadi Y, Eslahi A et al (2024) Production of Duchenne muscular dystrophy cellular model using CRISPR-Cas9 exon deletion strategy. Mol Cell Biochem 479(5):1027–1040 Taheri F, Taghizadeh E, Pour MJR, Rostami D, Renani PG, Rastgar-Moghadam A et al (2020) Limb-girdle Muscular Dystrophy and Therapy: Insights into Cell and Gene-based Approaches. Curr Gene Ther 19(6):386–394 Navarro-Serna S, Dehesa-Etxebeste M, Piñeiro-Silva C, Romar R, Lopes JS, López de Munaín A et al (2022) Generation of Calpain-3 knock-out porcine embryos by CRISPR-Cas9 electroporation and intracytoplasmic microinjection of oocytes before insemination. Theriogenology 186:175–184 Ma HS, Gong XL, Li WX, Cai Q, Chen YW, Guo XB et al (2023) Missense mutation of c.635 T > C in CAPN3 impairs muscle injury repair in a Limb-Girdel Muscular Dystropy Model. Clin Genet 103(6):663–671 Dalla Barba F, Soardi M, Mouhib L, Risato G, Akyürek EE, Lucon-Xiccato T et al (2023) Modeling Sarcoglycanopathy in Danio rerio. Int J Mol Sci. ;24(16) Turan S, Farruggio AP, Srifa W, Day JW, Calos MP (2016) Precise correction of disease mutations in induced pluripotent stem cells derived from patients with limb girdle muscular dystrophy. Mol Ther 24(4):685–696 Kim EY, Page P, Dellefave-Castillo LM, McNally EM, Wyatt EJ (2016) Direct reprogramming of urine-derived cells with inducible MyoD for modeling human muscle disease. Skelet Muscle 6(1):1–16 Poyatos-García J, Blázquez-Bernal Á, Selva-Giménez M, Bargiela A, Espinosa-Espinosa J, Vázquez-Manrique RP et al (2023) CRISPR-Cas9 editing of a TNPO3 mutation in a muscle cell model of limb-girdle muscular dystrophy type D2. Mol Ther Nucleic Acids 31:324–338 Selvaraj S, Dhoke NR, Kiley J, Mateos-Aierdi AJ, Tungtur S, Mondragon-Gonzalez R et al (2019) Gene Correction of LGMD2A Patient-Specific iPSCs for the Development of Targeted Autologous Cell Therapy. Mol Ther 27(12):2147–2157 Müthel S, Marg A, Ignak B, Kieshauer J, Escobar H, Stadelmann C et al (2023) Cas9-induced single cut enables highly efficient and template-free repair of a muscular dystrophy causing founder mutation. Mol Ther Nucleic Acids 31:494–511 Brinkman EK, Chen T, Amendola M, Van Steensel B (2014) Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res 42(22):e168–e Pozsgai ER, Griffin DA, Heller KN, Mendell JR, Rodino-Klapac LR (2016) beta-Sarcoglycan gene transfer decreases fibrosis and restores force in LGMD2E mice. Gene Ther 23(1):57–66 Pozsgai ER, Griffin DA, Heller KN, Mendell JR, Rodino-Klapac LR (2017) Systemic AAV-mediated β-sarcoglycan delivery targeting cardiac and skeletal muscle ameliorates histological and functional deficits in LGMD2E mice. Mol Ther 25(4):855–869 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-9220253","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":613996818,"identity":"74d2de80-428c-4851-b77c-7d74dface24a","order_by":0,"name":"Zahra Farshchian Yazdi","email":"","orcid":"","institution":"Shahid Sadoughi University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Zahra","middleName":"Farshchian","lastName":"Yazdi","suffix":""},{"id":613996819,"identity":"e7c8b709-f766-4084-86e9-fa1da2235466","order_by":1,"name":"Shahrzad RoshanNezhad","email":"","orcid":"","institution":"Islamic Azad University, Mashhad","correspondingAuthor":false,"prefix":"","firstName":"Shahrzad","middleName":"","lastName":"RoshanNezhad","suffix":""},{"id":613996820,"identity":"6e2eaaf7-143c-4e99-9ef1-55bc751c939f","order_by":2,"name":"Atieh Eslahi Eslahi","email":"","orcid":"","institution":"Mashhad University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Atieh","middleName":"Eslahi","lastName":"Eslahi","suffix":""},{"id":613996821,"identity":"5fcdc0f5-2d39-443d-8dc3-a120399e80ea","order_by":3,"name":"Farzaneh Alizadeh","email":"","orcid":"","institution":"Mashhad University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Farzaneh","middleName":"","lastName":"Alizadeh","suffix":""},{"id":613996822,"identity":"d344c565-e204-45d7-b3a2-d007df83f993","order_by":4,"name":"Shima Farrokhi","email":"","orcid":"","institution":"Mashhad University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Shima","middleName":"","lastName":"Farrokhi","suffix":""},{"id":613996823,"identity":"415cea53-ef19-4873-bee4-50d3f0ffa47b","order_by":5,"name":"Mohammad Hasan Sheikhha","email":"","orcid":"","institution":"Shahid Sadoughi University of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Mohammad","middleName":"Hasan","lastName":"Sheikhha","suffix":""},{"id":613996824,"identity":"44a5472d-7a9a-406e-b2a6-774eaa52bebe","order_by":6,"name":"Majid Mojarrad","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABBklEQVRIiWNgGAWjYHCChAM8DAzMYCaPgYQciD7wgHgtBRbGYC0JhOzhgTM+VCQ2gI3Bo1q3/cDDA29zbNj5Z599+OGNgUT6/LDDD4G22MnpNmDXYnYmIeHg3G1pzBLn0o0l5xhI5G68nWYA1JJsbHYAh5YDCQmHebcdZmY4w8YgzQPSMjsBpOVA4jZcWs4/gGiRP8PG/BuoJd1wdvoH/FpuQG0xOMPGBrIlQV46h4AtNx5A/GII1GIJ9IvhBumcggMJBnj8cj4n+cPbbTbJckCH3Xjzp05efnb65g8fKuzkcGkBxkUCiEyG8w3AKg1wKQcBdrASOzhfvgGf6lEwCkbBKBiJAAApcGRosRgvXAAAAABJRU5ErkJggg==","orcid":"","institution":"Mashhad University of Medical Sciences","correspondingAuthor":true,"prefix":"","firstName":"Majid","middleName":"","lastName":"Mojarrad","suffix":""}],"badges":[],"createdAt":"2026-03-25 08:24:44","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-9220253/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-9220253/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":105811885,"identity":"7985b54a-9b81-4cf6-9dd3-52163bd2d77b","added_by":"auto","created_at":"2026-03-31 11:33:25","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":112930,"visible":true,"origin":"","legend":"\u003cp\u003eVerification of sgRNA Insertion into the PX458 Plasmid Using PCR and Sanger Sequencing. a) Confirmation of sgRNA integration into the PX458 plasmid was performed using a PCR reaction. The PCR utilized the U6 forward primer and an antisense sgRNA oligonucleotide, resulting in the amplification of a 274 bp product. The samples were resolved on a 2% agarose gel with the following lane assignments: Lanes 1-3: Colonies from the sg103 sample, Lane 4: Negative control for the sg103 sample, Lane 5: 100 bp DNA ladder, Lanes 6-8: Colonies from the sg133 sample, Lane 9: Negative control for the sg133 sample, b) Successful integration of the sgRNA103 and sgRNA133 sequences into the PX458 plasmid backbone was further validated through Sanger sequencing.\u003c/p\u003e","description":"","filename":"1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9220253/v1/18f07bd8d7a626ff33bef625.jpg"},{"id":105811886,"identity":"42552a02-593b-4449-94f8-095aba2fb6f4","added_by":"auto","created_at":"2026-03-31 11:33:26","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":171383,"visible":true,"origin":"","legend":"\u003cp\u003eTransfection of Cells with the PX458 Plasmid Carrying sg103 (a) and sg133 (b) Using LTR. The images on the left display fluorescence microscopy results, while the corresponding images on the right show visible light microscopy.\u003c/p\u003e","description":"","filename":"2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9220253/v1/3dafb0376c95ba06114b2f09.jpg"},{"id":105904484,"identity":"671c7338-2aa8-4643-887f-ce7bb325dadd","added_by":"auto","created_at":"2026-04-01 10:08:57","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":166430,"visible":true,"origin":"","legend":"\u003cp\u003eSanger Sequencing Results of Manipulated HEK-293 Cells Panels (a) and (b) depict the outcomes of treating HEK-293 cells with plasmids carrying sg103 and sg133, respectively.\u003c/p\u003e","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9220253/v1/1f2c00b70007fb0d3701ac83.jpg"},{"id":105904433,"identity":"8f65ce36-2467-4a78-a06d-0153d7cccff9","added_by":"auto","created_at":"2026-04-01 10:08:30","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":56638,"visible":true,"origin":"","legend":"\u003cp\u003eSuccess Rate of the Designed CRISPR System in \u003cem\u003eSGCB\u003c/em\u003eGene Exon 2: The designed CRISPR system achieved a success rate of 7.7% in \u003cem\u003eSGCB\u003c/em\u003egene exon 2 for cell mixtures treated with sg103 (Figure a) and 25.1% for cell mixtures treated with sg133 (Figure b).\u003c/p\u003e","description":"","filename":"4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9220253/v1/be90497ee89e5ee6d9c4d8f1.jpg"},{"id":105811887,"identity":"d6d8edad-4942-4a0b-8aba-71d6d5aec871","added_by":"auto","created_at":"2026-03-31 11:33:26","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":217355,"visible":true,"origin":"","legend":"\u003cp\u003eSanger Sequencing Results of a Mutant Single Clone: The mutant sample was analyzed and compared to the normal sequence. The complete sgRNA sequence could not be detected in the mutant due to NHEJ and a frameshift mutation at the sgRNA binding site, which led to both nucleotide deletions and insertions. The frameshift becomes apparent beyond the hatched region in the mutant cells, introducing the potential for a compound heterozygous mutation.\u003c/p\u003e","description":"","filename":"5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9220253/v1/628d0a471ab7d12fa0c09b32.jpg"},{"id":105904249,"identity":"f84be53a-bad9-4af3-937d-a4c6438610ee","added_by":"auto","created_at":"2026-04-01 10:06:46","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":44991,"visible":true,"origin":"","legend":"\u003cp\u003eSequencing Results from the TIDE algorithm.\u003c/p\u003e","description":"","filename":"6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-9220253/v1/34f9a3976ea81f30ed2efd62.jpg"},{"id":106868138,"identity":"a04dce6c-2d0e-4043-9a28-982a9e12ef65","added_by":"auto","created_at":"2026-04-14 09:27:52","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1577550,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-9220253/v1/b63c65e1-2bfe-4dae-bc22-e0c2a4d85a01.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Development of a CRISPR-Cas9-Based Cellular Model for SGCB Gene Mutation: A Platform for Investigating Gene Therapy Strategies in LGMD2E","fulltext":[{"header":"Introduction","content":"\u003cp\u003eSarcoglycanopathies are the most prevalent subtype of LGMDs, making approximately 20\u0026ndash;25% of patients and 40\u0026ndash;65% of cases with infant onset (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). Mutations in the genes encoding the four types of membrane glycoproteins (α-, β-, γ-, and δ-sarcoglycan) are responsible for sarcoglycanopathy.\u003c/p\u003e \u003cp\u003eThese glycoproteins form a tetrameric complex within the cell membrane of skeletal and cardiac muscle cells, playing a critical role in maintaining skeletal muscle cell membrane stability (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eClinically, these diseases are characterized by progressive proximal muscle weakness preferentially affecting the shoulder and pelvic girdles, leading to impaired ambulation, difficulty ascending stairs, the presence of Gower's sign, and eventual loss of independent mobility necessitating wheelchair use. Advanced disease stages are marked by profound muscle weakness, skeletal muscle tissue fibrosis, joint contractures, scoliosis, severe cardiac dysfunction, respiratory insufficiency, and ultimately, premature mortality due to cardiorespiratory failure, typically occurring by the fourth decade (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eCurrent treatments for LGMDs predominantly offer supportive care through multifaceted approaches. Managing LGMDs requires a comprehensive approach involving a multidisciplinary team of specialists, such as cardiologists, pulmonologists, rehabilitation experts, and nutritionists, along with necessary medical equipment. Unfortunately, access to and coordination of these services often fall short of adequately addressing the complex needs and expectations of patients and their families, placing a significant burden on them (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePharmacological approaches for LGMDs, including the use of corticosteroids, have so far demonstrated limited and inconsistent efficacy. Additionally, strategies aimed at promoting muscle growth, such as growth hormone-facilitated muscle cell transfer and myostatin inhibition, have proven to be ineffective. While these interventions aim to preserve muscle function, there remains a significant need for therapies that can actively enhance muscle strength and address the underlying disease mechanisms (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eDespite the huge effort for developing effective therapeutic interventions, Locus and allelic heterogeneity, the varying effects of different pathogenic variants on protein expression levels and activity, challenges in delivering therapeutic tools to the entire muscle mass, and the continuous proliferation of muscle cells have posed challenges for the development of gene delivery-based therapies (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eGene editing has emerged as a promising therapeutic avenue for LGMDs, with recent studies highlighting the potential of the CRISPR-associated protein 9 (CRISPR-Cas9) system. This technology allows for mutation-specific correction, potentially leading to improved efficacy and long-lasting therapeutic benefits. The inherent advantages and versatility of CRISPR-Cas9 have fueled a significant revolution in gene editing and regulation since its groundbreaking discovery in 2012 (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eOne of the most prevalent forms of LGMD, LGMD2E, is an autosomal recessive disorder characterized by mutations in both alleles of the \u003cem\u003eSGCB\u003c/em\u003e gene, as first described by B\u0026ouml;nnemann and Lim (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). LGMD2E is frequently characterized as a severe variant of LGMD, with some individuals manifesting symptoms prior to the age of eight and experiencing loss of ambulation by their second decade of life (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). The clinical symptoms of this disease include progressive muscle weakness, cardiac and respiratory issues, and loss of mobility, which significantly affect patients' daily activities. Early diagnosis of these symptoms can lead to more effective therapeutic interventions and improve patients' quality of life (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eSGCB\u003c/em\u003e gene spans 13.5 KB and comprises six exons which encodes the β-sarcoglycan protein, which is integral to the dystrophin-glycoprotein complex (DGC), essential for maintaining the integrity of the muscle membrane and facilitating the connection between the cytoskeleton and the extracellular matrix (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e). The molecular pathogenesis of LGMD2E is linked to a wide spectrum of mutations within \u003cem\u003eSGCB\u003c/em\u003e, including missense, nonsense, splice-site, and frameshift mutations, as well as large deletions and partial duplications (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThis condition is the most prevalent Sarcoglycanopathy among Iranians especially in Baloch ethnic group, who settled in the border regions of Afghanistan, Pakistan, and Iran. A significantly frequent founder mutation in this area has been found, homozygous exon 2 deletion mutation in the \u003cem\u003eSGCB\u003c/em\u003e gene. in-frame deletion caused by this mutation results in a shorter \u003cem\u003eSGCB\u003c/em\u003e protein that has 70 fewer amino acids than the original protein; thus, it is predicted that the disease will occur more frequently than previously thought in this region (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eGene therapy approach for LGMD2, utilizing in vivo delivery of an optimized \u003cem\u003eSGCB\u003c/em\u003e coding sequence via adeno-associated virus (AAV) vectors, is presently undergoing Phase III clinical evaluation (\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e). While this strategy holds significant promise, several challenges remain, including the need for precise regulation of gene expression, the potential for insertional mutagenesis associated with the delivered viral vector, and the possibly limited duration of therapeutic benefit. These limitations underscore the urgent need for the development of more sustainable and inherently safer therapeutic interventions.\u003c/p\u003e \u003cp\u003eCRISPR-Cas9 systems have emerged as a groundbreaking technology for targeted genome editing, particularly in complex organisms like humans, fundamentally transforming the field of genetics (\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e). Since its initial development in 2013, these systems have garnered significant recognition, including the 2020 Nobel Prize, owing to their exceptional capabilities and transformative potential. The ease of design using RNA-DNA heteroduplex complementary, coupled with high precision and cost-effectiveness, has fueled the rapid adoption of CRISPR-Cas technology in clinical applications, most notably in the treatment of genetic diseases (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). The CRISPR-Cas9 system initiates targeted double-strand breaks (DSBs) at specific genomic loci, thereby triggering cellular DNA repair pathways (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e). In eukaryotic cells, the predominant DSB repair mechanisms are non-homologous end joining (NHEJ) and homology-directed repair (HDR), which compete for the processing of Cas9-induced breaks (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e). The NHEJ pathway repairs DSBs through direct ligation or by introducing insertions or deletions (indels) at the break site. This repair mechanism is inherently error-prone, frequently leading to the insertion or deletion of DNA base pairs (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e). Consequently, NHEJ can disrupt the targeted gene via frameshift mutations, potentially resulting in loss-of-function alleles (\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e). NHEJ can occur at any stage of the cell cycle. In contrast to NHEJ, HDR is predominantly active during the late S and G2 phases of the cell cycle, when sister chromatids are available as repair templates. Successful HDR, leading to accurate base substitutions or insertions at the target locus, requires the presence of a homologous donor DNA sequence derived from a sister chromatid or an exogenously introduced template (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe CRISPR-Cas9 system has been widely applied to both disease modeling and gene therapy research for Duchenne muscular dystrophy (DMD) (\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). In contrast, the use of CRISPR-Cas9 in studies of LGMD has been less extensive, although there is a growing interest in leveraging this technology for these conditions (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e). Notably, CRISPR-based modeling studies have successfully generated mouse and pig models of LGMD R1 by targeting the \u003cem\u003eCAPN3\u003c/em\u003e gene, which encodes the calpain 3 protein (\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e). Similarly, mouse and zebrafish models of LGMD2C have been generated, targeting the \u003cem\u003eSGCG\u003c/em\u003e gene, which encodes gamma-sarcoglycan. These models provide valuable tools for investigating the disease mechanisms underlying LGMD2C (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e). Beyond the generation of cellular models, CRISPR-Cas9 has also been explored as a gene correction tool for LGMDs. For example, CRISPR-Cas9-mediated gene editing has been used to correct mutations responsible for LGMD types 2B, 2C, and 2D in induced pluripotent stem cells (iPSCs), demonstrating the potential of this technology for therapeutic applications (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e). In cellular models of LGMD2D, genetic manipulation of the \u003cem\u003eTNPO3\u003c/em\u003e gene has been achieved using CRISPR-Cas9 technology (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e). CRISPR-Cas9 system has also demonstrated efficacy in repairing the \u003cem\u003eCAPN3\u003c/em\u003e gene in cellular models of LGMD2A (\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eA critical initial step in designing and evaluating CRISPR-based therapeutic strategies toward LGMD2E is the establishment of cell lines harboring the pathogenic mutations in \u003cem\u003eSGCB\u003c/em\u003e gene. Generating such cell lines directly from patients with LGMD2E presents complex technical and ethical challenges. Consequently, the generation of mutant cell lines through alternative methods has garnered considerable attention from researchers.\u003c/p\u003e \u003cp\u003eTo investigate the potential of CRISPR-Cas9 for generating \u003cem\u003eSGCB\u003c/em\u003e mutant cell lines, we targeted exon 2 of the \u003cem\u003eSGCB\u003c/em\u003e gene in HEK293T cells using CRISPR-Cas9. This approach was designed to introduce targeted mutations within this critical region of the gene.\u003c/p\u003e \u003cp\u003eExamination of the manipulated cell population demonstrates a significant success rate in CRISPR- mediated \u003cem\u003eSGCB\u003c/em\u003e mutagenesis. The results from this study may pave the way for creating a cellular model for LGMD2E disease. This model could serve as a valuable resource for gene-editing therapies and a useful platform for identifying potential drugs aimed at treating LGMD2E.\u003c/p\u003e"},{"header":"Material and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003esgRNA design\u003c/h2\u003e \u003cp\u003eThe \u003cem\u003eSGCB\u003c/em\u003e reference sequence (NG_008891.1) was retrieved from the NCBI database. To identify effective sgRNAs targeting exon 2 of the \u003cem\u003eSGCB\u003c/em\u003e gene, we utilized the online CRISPR design tools CRISPOR, CHOPCHOP, and GT-Scan, which allowed us to predict on-target activity and potential off-target effects. sgRNA-encoding oligonucleotides were chemically synthesized, and double-stranded oligonucleotides were generated by hybridizing 100 \u003cem\u003epmol\u003c/em\u003e of sense and antisense oligonucleotides. The resulting sgRNAs were named according to their position within exon 2 (\u003cem\u003ee.g.\u003c/em\u003e, sgRNA103 and sgRNA133). The sequences of sgRNAs designed and utilized in this study are presented in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eCRISPR plasmid production\u003c/h3\u003e\n\u003cp\u003eFollowing \u003cem\u003eBbsI\u003c/em\u003e digestion of the pSpCas9(BB)-2A-GFP plasmid (PX458; Addgene, Cat #48138), hybridized sgRNA was ligated into the vector using T4 DNA ligase. The ligation reaction was performed in a 20\u003cem\u003e\u0026micro;l\u003c/em\u003e volume containing 50\u003cem\u003eng\u003c/em\u003e of digested plasmid, 50 \u003cem\u003epmol\u003c/em\u003e of hybridized sgRNA, 10 units of T4 DNA ligase, and 1X T4 ligation buffer, incubated at 16\u0026deg;C overnight. The ligation product was then transformed into competent DH5α \u003cem\u003eEscherichia coli\u003c/em\u003e cells via heat shock standard protocol. Recombinant colonies were selected, and plasmid DNA was isolated using the SimEx plasmid miniprep kit (Simbiolab, Iran). Insertion of the sgRNA sequence into the plasmid was confirmed by both PCR (polymerase chain reaction) amplification and Sanger sequencing using U6 universal primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\n\u003ch3\u003eCell culture and transfection\u003c/h3\u003e\n\u003cp\u003eHEK293T cells were maintained in high-glucose Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1X penicillin-streptomycin in a humidified incubator at 37\u0026deg;C with 5% CO2. For transfection experiments, HEK293T cells were trypsinized and plated at a density of 250,000 cells per well in 6-well plates 48 hours prior to transfection. To ensure optimal transfection efficiency, cells were synchronized by overnight serum starvation once they reached 60% confluency. Cells were then transfected with 3 \u0026micro;g of sgRNA-expressing vector per well using LTR reagent, according to the manufacturer's instructions. Following transfection, the medium was replaced with complete DMEM supplemented with 10% FBS, but without penicillin-streptomycin. Transfection efficiency was determined by fluorescence microscopy 48 hours after transfection.\u003c/p\u003e\n\u003ch3\u003eGenomic DNA extraction and mutation analysis\u003c/h3\u003e\n\u003cp\u003eGenomic DNA was isolated from transfected cells using the SimEx blood DNA kit (Simbiolab, Iran). To amplify a 157 bp region flanking the CRISPR-Cas9 target site and identify potential frameshift mutations, PCR was performed using specifically designed primers (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The 20 \u003cem\u003e\u0026micro;l\u003c/em\u003e PCR reaction mixture consisted of 250 \u003cem\u003e\u0026micro;M\u003c/em\u003e of each primer, and 100 \u003cem\u003eng\u003c/em\u003e of template DNA. The PCR program was as follows: initial denaturation at 95\u0026deg;C for 5 minutes, followed by 35 cycles of denaturation at 95\u0026deg;C for 30 seconds, annealing at 58\u0026deg;C for 30 seconds, and extension at 72\u0026deg;C for 30 seconds, with a final extension step at 72\u0026deg;C for 5 minutes. The resulting PCR amplicons were subjected to Sanger sequencing for mutation analysis.\u003c/p\u003e\n\u003ch3\u003eMutation Detection and Mutagenesis Efficiency Assay\u003c/h3\u003e\n\u003cp\u003eTo assess the frequency and spectrum of \u003cem\u003eindel\u003c/em\u003e mutations, Sanger sequencing results were analyzed using the TIDE (Tracking of Indels by Decomposition) online software (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e). Sequence decompositions with a p-value less than 0.01 were considered statistically significant.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eSingle-cell clone preparation\u003c/h2\u003e \u003cp\u003eA clonal selection strategy involving limiting dilution was used to obtain a pure population of \u003cem\u003eSGCB\u003c/em\u003e-mutated HEK293T cells. Cells were serially diluted to achieve a statistical distribution of 0.5 cells per 200 \u0026micro;l in complete medium. This suspension was then plated into 96-well plates to achieve single-cell seeding. After 4\u0026ndash;5 days of incubation, wells containing single, isolated colonies were identified. Genomic DNA was extracted from each well exhibiting a single colony, and PCR followed by Sanger sequencing was performed to confirm homozygous \u003cem\u003eSGCB\u003c/em\u003e mutations.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eColony genotyping\u003c/h3\u003e\n\u003cp\u003eTo screen for homozygous \u003cem\u003eSGCB\u003c/em\u003e-mutated clones, five single clones were selected at random. Genomic DNA was extracted from each of these clones, and the targeted region was amplified by PCR using the primers described earlier. The resulting PCR products were then subjected to Sanger sequencing to identify clones carrying the desired homozygous mutation.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe table present the sgRNA sequences and primers utilized in this research. The gRNAs were specifically designed to target the exon 2 of the \u003cem\u003eSGCB\u003c/em\u003e gene sequence.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c3\" namest=\"c1\"\u003e \u003cp\u003ePrimer name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePrimer sequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eTM\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eGC\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eProduct length (bp)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003eColony primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eForward primer(U6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eGAGGGCCTATTTCCCATGATT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e274 bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eReverse primer (sgRNA antisense)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003esgRNA133 antisense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAAACTGTTTTGTGGAGACGATCTTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003esgRNA103 antisense\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAAACATTGATGAAGATCGTCTCCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003ePCR primers\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eForward primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCCTGTAAAGAAGTCCATGCGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e157 bp\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eReverse primer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAAGTCTGAGTGAGTCCCTGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e42\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c3\" namest=\"c1\"\u003e \u003cp\u003e\u003cb\u003esgRNA name\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003esgRNA sequence (5\u0026acute;\u0026rarr; 3\u0026acute;)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c7\" namest=\"c5\"\u003e \u003cp\u003e\u003cb\u003eScore\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c3\" namest=\"c1\"\u003e \u003cp\u003esg133\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAAGATCGTCTCCACAAAACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c7\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c3\" namest=\"c1\"\u003e \u003cp\u003esg103\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTGGAGACGATCTTCATCAAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c7\" namest=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eCRISPR-Cas9 plasmid preparation for\u003c/b\u003e \u003cb\u003eSGCB\u003c/b\u003e \u003cb\u003egene targeting\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTwo pairs of sgRNAs were designed, considering factors such as predicted on-target efficacy, potential off-target effects, GC content (45\u0026ndash;60%), the absence of stable secondary structures (hairpin loops with Tm\u0026thinsp;\u0026lt;\u0026thinsp;20\u0026deg;C), and minimal self- or hetero-dimer formation (ΔG \u0026gt; -10 kcal/mol). Those sgRNAs with the most favorable predicted profiles were selected and cloned into the PX458 plasmid. To ensure the correct insertion of the sgRNA, a two-step validation process was employed. First, PCR was performed on plasmid DNA to confirm the presence of the sgRNA insert (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). Second, Sanger sequencing was carried out to verify the precise sgRNA sequence within the PX458 vector (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eExamining the\u003c/b\u003e \u003cb\u003eSGCB\u003c/b\u003e \u003cb\u003egene alterations in the HEK293T cell line\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe efficiency of transfection, as assessed by eGFP expression 48 hours after transfection, was greater than 50% (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). To determine the frequency of indel mutations induced by sgRNAs, genomic DNA was extracted from cells treated with either sgRNA133 or sgRNA103. The targeted region was amplified via PCR, and Sanger sequencing was performed on the resulting amplicons (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). These Sanger sequencing results were then analyzed using the TIDE algorithm to quantify indel frequencies. TIDE analysis revealed that sgRNA133 induced a higher percentage of indels (25.1%) compared to sgRNA103. Furthermore, the composite sequence generated by TIDE analysis initiated at the predicted Cas9 cleavage site, providing evidence for accurate on-target cleavage (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb, derived from sample analysis conducted with TIDE software following Sanger sequencing, the majority of cells are identified as wild-type, indicating a lack of mutations in the \u003cem\u003eSGCB\u003c/em\u003e gene. In sample sg103 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea), approximately 7.7% of the cells exhibit mutations, predominantly consisting of deletion mutations. Conversely, in sample sg133 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb), the percentage of mutated cells increases to about 25.1%, with the majority representing insertion mutations.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eSingle cell clone preparation\u003c/h2\u003e \u003cp\u003eTo isolate individual mutated clones with distinct characteristics, we employed a serial limiting dilution technique. After selecting five clones, we extracted genomic DNA and performed PCR using specific primers. The resulting 157 bp PCR products, obtained from single-cell cloning, were subjected to Sanger sequencing, with the outcomes presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e. Figure\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea illustrates the wild-type sample, while Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb depicts the mutated sample. The highlighted regions in both figures correspond to the sgRNA133 sequence, which is clearly visible in the wild-type sample. In contrast, the mutated sample (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb) reveals only a truncated portion of the sgRNA133 sequence (11 nucleotides). We also analyzed sanger sequencing of our mutant single clone by Tide algorithm (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). The results confirms that the mutant clone is compound heterozygous. One allele exhibits a deletion of nine nucleotides, while the other allele shows an insertion of two nucleotides. Notably, there is no evidence of the normal allele (mutation\u0026thinsp;=\u0026thinsp;0) in the results.\u003c/p\u003e \u003cp\u003eFollowing CRISPR-Cas9 cleavage, indels were generated via the NHEJ repair pathway, resulting in a disruption of the sgRNA133 sequence within the gene and its reading frame. Among the sequenced clones, one clone exhibited a compound heterozygous mutation that altered the reading frame, potentially impacting gene translation and the function of the resulting protein.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eLGMD2E poses a significant health challenge in Iran due to its high prevalence. While LGMD2E may not be a primary focus in other geographical regions, its status as the most common sarcoglycanopathy in the Iranian population necessitates prioritization of treatment and research efforts (\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). Despite this critical need, LGMD2E has historically received insufficient attention. The particularly high prevalence of LGMD2E within the Baloch ethnic group, coupled with the geographic distribution of Baloch communities across the border regions of Iran, Pakistan, and Afghanistan, suggests that the overall disease burden may be underestimated. Furthermore, the high frequency of a homozygous exon 2 deletion mutation in the \u003cem\u003eSGCB\u003c/em\u003e gene among affected patients points to a founder effect specific to this region. Therefore, further research for developing potential therapeutic agents are crucial to improving the quality of life for affected individuals and reducing the burden of LGMD2E. While gene therapy research for sarcoglycanopathies and LGMDs, including LGMD2E, is currently limited, promising avenues are being explored. For example, \u003cem\u003ePozsgai et al.\u003c/em\u003e conducted comprehensive gene therapy studies in LGMD2E mice, using the AAVrh74 vector to deliver a normal \u003cem\u003eSGCB\u003c/em\u003e gene to affected muscles (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e). This resulted in the expression of the normal gene, reconstitution of the dystrophin-associated protein complex (DAPC), improved muscle function and effectively reduced fibrosis and restored strength in LGMD2E mice (\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e). Furthermore Intravenous administration of scAAV.MHCK7.\u003cem\u003eHsgcb\u003c/em\u003e resulted in 98.1% gene expression across all muscles, along with reductions in serum creatine kinase levels and spinal kyphoscoliosis (\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e). Overally, this intervention markedly improved muscle function in the mice.\u003c/p\u003e \u003cp\u003eThese promising results has led to emerging of clinical trials focused on AAV vectors based gene delivery in humans. This clinical trial is currently underway and has yielded promising results. However, the temporary nature of these treatments and the inherent possibility of insertional mutagenesis of viral vectors, along with concerns about immunological reactions to these vectors, further highlight the need to use gene editing technologies to rescue the endogenous \u003cem\u003eSGCB\u003c/em\u003e gene function.\u003c/p\u003e \u003cp\u003ePresent study focused on evaluating sgRNA efficiency and selecting an effective sgRNA to providing an LGMD2E cellular model. the HEK293T cell line was an optimal \u003cem\u003ein vitro\u003c/em\u003e model due to its easy accessibility, robust growth, human origin, high transfection efficiency, and stable genetic background. Using this platform, we aimed to identify a highly efficient sgRNA capable of inducing significant mutagenesis in the \u003cem\u003eSGCB\u003c/em\u003e gene using the CRISPR-Cas9 system, representing an initial step towards CRISPR-based gene therapy for LGMD2E. We identified two sgRNA variants targeting exon 2 of the \u003cem\u003eSGCB\u003c/em\u003e gene, sgRNA103 and sgRNA133, and found that sgRNA133 exhibited a significantly higher mutagenesis rate (25.1%) compared to sgRNA103 (7.7%). This highlights the critical role of sgRNA design in optimizing CRISPR applications and suggests that sgRNA133 may be more suitable for future therapeutic strategies aimed at correcting mutations in the \u003cem\u003eSGCB\u003c/em\u003e gene. This achievement brings us closer to establishing a stable muscle cell line for LGMD2E, a crucial advancement for developing therapeutic interventions. To our knowledge, this is the first report of an LGMD2E cell model created using CRISPR-Cas technology.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eWe successfully introduced a compound heterozygous mutation into the \u003cem\u003eSGCB\u003c/em\u003e gene in HEK293T cells, setting the stage for establishing a cellular model for LGMD2E disease. This mutated cell line offers considerable promise for various applications related to this disease. Our findings highlight the effectiveness of CRISPR-Cas9 as a precise gene-editing tool capable of accurately modifying the \u003cem\u003eSGCB\u003c/em\u003e gene. This technology presents significant potential as a prospective therapy for LGMD2E in the future.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eAAV\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eadeno-associated virus\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eCRISPR\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eclustered regularly interspaced short palindromic repeats\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eCRISPR-Cas9\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eCRISPR-associated protein 9\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eDAPC\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003edystrophin-associated protein complex\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eDGC\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003edystrophin-glycoprotein complex\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eDMD\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eDuchenne muscular dystrophy\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eDMEM\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eDulbecco's Modified Eagle Medium\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eDSB\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003edouble-strand break\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eFBS\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003efetal bovine serum\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eHDR\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ehomology-directed repair\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eIndels\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003einsertions or deletions\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eiPSCs\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003einduced pluripotent stem cells\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eLGMD\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003elimb-girdle muscular dystrophy\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eLGMD2E\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eLimb-Girdle Muscular Dystrophy Type 2E\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eNHEJ\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003enon-homologous end joining\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003ePCR\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003epolymerase chain reaction\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003esgRNA\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003esingle guide RNA\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e\u003cb\u003eTIDE\u003c/b\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eTracking of Indels by Decomposition\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":" \u003cp\u003e \u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e \u003cp\u003eNot applicable\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eConsent for publication\u003c/strong\u003e \u003cp\u003eNot applicable\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eCompeting interests\u003c/h2\u003e \u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis research received no external funding.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eConceptualization, M.M.; methodology, Z.F., S.R., F.A., and S.F.; investigation, Z.F. and A.E.; writing\u0026mdash;original draft preparation, Z.F.; discussed and commented on the manuscript, M.S., A.E., and A.E.; editing article, M.M.; supervision, M.M.; project administration, F.A.; all authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgments\u003c/h2\u003e \u003cp\u003eNot applicable.\u003c/p\u003e\u003ch2\u003eAvailability of data and materials\u003c/h2\u003e \u003cp\u003eAll data generated or analyzed during this study are included in this manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eVainzof M, Passos-Bueno MR, Pavanello R, Marie SKN, Oliveira A, Zatz M (1998) Sarcoglycanopathies are responsible for 68% of severe autosomal recessive limb-girdle muscular dystrophy. Neuromuscul Disord. ;8(3/4)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFanin M, Nascimbeni A, Aurino S, Tasca E, Pegoraro E, Nigro V et al (2009) Frequency of LGMD gene mutations in Italian patients with distinct clinical phenotypes. Neurology 72(16):1432\u0026ndash;1435\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSandona D, Betto R (2009) Sarcoglycanopathies: molecular pathogenesis and therapeutic prospects. Expert Rev Mol Med 11:e28\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMathur P, Kaur A, Vijay U, Gupta A, Agarwal K, Agrawal L (2025) Limb-Girdle Muscular Dystrophies (LGMD): Clinical features, diagnosis and genetic variability through next generation sequencing. Glob Med Genet 12(1):100035\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBouchard C, Tremblay JP (2023) Limb-Girdle Muscular Dystrophies Classification and Therapies. J Clin Med. ;12(14)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSahin IO, Ozkul Y, Dundar M (2021) Current and Future Therapeutic Strategies for Limb Girdle Muscular Dystrophy Type R1: Clinical and Experimental Approaches. Pathophysiology 28(2):238\u0026ndash;249\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOkada T, Takeda S (2013) Current Challenges and Future Directions in Recombinant AAV-Mediated Gene Therapy of Duchenne Muscular Dystrophy. Pharmaceuticals (Basel) 6(7):813\u0026ndash;836\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChemello F, Bassel-Duby R, Olson EN (2020) Correction of muscular dystrophies by CRISPR gene editing. J Clin Invest 130(6):2766\u0026ndash;2776\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEslahi A, Alizadeh F, Avan A, Ferns GA, Moghbeli M, Reza Abbaszadegan M et al (2023) New advancements in CRISPR based gene therapy of Duchenne muscular dystrophy. Gene 867:147358\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBonnemann CG, Passos-Bueno MR, McNally EM, Vainzof M, de Sa Moreira E, Marie SK et al (1996) Genomic screening for beta-sarcoglycan gene mutations: missense mutations may cause severe limb-girdle muscular dystrophy type 2E (LGMD 2E). Hum Mol Genet 5(12):1953\u0026ndash;1961\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLim LE, Duclos F, Broux O, Bourg N, Sunada Y, Allamand V et al (1995) Beta-sarcoglycan: characterization and role in limb-girdle muscular dystrophy linked to 4q12. Nat Genet 11(3):257\u0026ndash;265\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eB\u0026ouml;nnemann CG, Modi R, Noguchi S, Mizuno Y, Yoshida M, Gussoni E et al (1995) β\u0026ndash;sarcoglycan (A3b) mutations cause autosomal recessive muscular dystrophy with loss of the sarcoglycan complex. Nat Genet 11(3):266\u0026ndash;273\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSveen M-L, Thune JJ, K\u0026oslash;ber L, Vissing J (2008) Cardiac involvement in patients with limb-girdle muscular dystrophy type 2 and Becker muscular dystrophy. Arch Neurol 65(9):1196\u0026ndash;1201\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSemplicini C, Vissing J, Dahlqvist JR, Stojkovic T, Bello L, Witting N et al (2015) Clinical and genetic spectrum in limb-girdle muscular dystrophy type 2E. Neurology 84(17):1772\u0026ndash;1781\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoito CA, Melacini P, Vianello A, Prandini P, Gavassini BF, Bagattin A et al (2005) Clinical and molecular characterization of patients with limb-girdle muscular dystrophy type 2I. Arch Neurol 62(12):1894\u0026ndash;1899\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eErvasti JM, Campbell KP (1991) Membrane organization of the dystrophin-glycoprotein complex. Cell 66(6):1121\u0026ndash;1131\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTrabelsi M, Kavian N, Daoud F, Commere V, Deburgrave N, Beugnet C et al (2008) Revised spectrum of mutations in sarcoglycanopathies. Eur J Hum Genet 16(7):793\u0026ndash;803\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGhafouri-Fard S, Hashemi-Gorji F, Fardaei M, Miryounesi M (2017) Limb girdle muscular dystrophy type 2E due to a novel large deletion in SGCB gene. Iran J child Neurol 11(3):57\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlavi A, Esmaeili S, Nilipour Y, Nafissi S, Tonekaboni SH, Zamani G et al (2017) LGMD2E is the most common type of sarcoglycanopathies in the Iranian population. J Neurogenet 31(3):161\u0026ndash;169\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGhafouri-Fard S, Hashemi-Gorji F, Fardaei M, Miryounesi M (2017) Limb Girdle Muscular Dystrophy Type 2E Due to a Novel Large Deletion in SGCB Gene. Iran J Child Neurol 11(3):57\u0026ndash;60\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMendell JR, Chicoine LG, Al-Zaidy SA, Sahenk Z, Lehman K, Lowes L et al (2019) Gene Delivery for Limb-Girdle Muscular Dystrophy Type 2D by Isolated Limb Infusion. Hum Gene Ther 30(7):794\u0026ndash;801\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJinek M, East A, Cheng A, Lin S, Ma E, Doudna J (2013) RNA-programmed genome editing in human cells. Elife 2:e00471\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChaikind B, Bessen JL, Thompson DB, Hu JH, Liu DR (2016) A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Nucleic Acids Res 44(20):9758\u0026ndash;9770\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHackley CR (2021) A Novel Set of Cas9 Fusion Proteins to Stimulate Homologous Recombination: Cas9-HRs. CRISPR J 4(2):253\u0026ndash;263\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHaapaniemi E, Botla S, Persson J, Schmierer B, Taipale J (2018) CRISPR\u0026ndash;Cas9 genome editing induces a p53-mediated DNA damage response. Nat Med 24(7):927\u0026ndash;930\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLino CA, Harper JC, Carney JP, Timlin JA (2018) Delivering CRISPR: a review of the challenges and approaches. Drug Delivery 25(1):1234\u0026ndash;1257\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMusunuru K (2017) The hope and hype of CRISPR-Cas9 genome editing: a review. JAMA Cardiol 2(8):914\u0026ndash;919\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRom\u0026aacute;n-Rodr\u0026iacute;guez FJ, Ugalde L, \u0026Aacute;lvarez L, D\u0026iacute;ez B, Ram\u0026iacute;rez MJ, Risue\u0026ntilde;o C et al (2019) NHEJ-mediated repair of CRISPR-Cas9-induced DNA breaks efficiently corrects mutations in HSPCs from patients with fanconi anemia. Cell Stem Cell 25(5):607\u0026ndash;621 e7\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLin S, Staahl BT, Alla RK, Doudna JA (2014) Enhanced homology-directed human genome engineering by controlled timing of CRISPR/Cas9 delivery. elife 3:e04766\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBranzei D, Foiani M (2008) Regulation of DNA repair throughout the cell cycle. Nat Rev Mol Cell Biol 9(4):297\u0026ndash;308\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlizadeh F, Abraghan YJ, Farrokhi S, Yousefi Y, Mirahmadi Y, Eslahi A et al (2024) Production of Duchenne muscular dystrophy cellular model using CRISPR-Cas9 exon deletion strategy. Mol Cell Biochem 479(5):1027\u0026ndash;1040\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaheri F, Taghizadeh E, Pour MJR, Rostami D, Renani PG, Rastgar-Moghadam A et al (2020) Limb-girdle Muscular Dystrophy and Therapy: Insights into Cell and Gene-based Approaches. Curr Gene Ther 19(6):386\u0026ndash;394\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNavarro-Serna S, Dehesa-Etxebeste M, Pi\u0026ntilde;eiro-Silva C, Romar R, Lopes JS, L\u0026oacute;pez de Muna\u0026iacute;n A et al (2022) Generation of Calpain-3 knock-out porcine embryos by CRISPR-Cas9 electroporation and intracytoplasmic microinjection of oocytes before insemination. Theriogenology 186:175\u0026ndash;184\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa HS, Gong XL, Li WX, Cai Q, Chen YW, Guo XB et al (2023) Missense mutation of c.635 T\u0026thinsp;\u0026gt;\u0026thinsp;C in CAPN3 impairs muscle injury repair in a Limb-Girdel Muscular Dystropy Model. Clin Genet 103(6):663\u0026ndash;671\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDalla Barba F, Soardi M, Mouhib L, Risato G, Aky\u0026uuml;rek EE, Lucon-Xiccato T et al (2023) Modeling Sarcoglycanopathy in Danio rerio. Int J Mol Sci. ;24(16)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTuran S, Farruggio AP, Srifa W, Day JW, Calos MP (2016) Precise correction of disease mutations in induced pluripotent stem cells derived from patients with limb girdle muscular dystrophy. Mol Ther 24(4):685\u0026ndash;696\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKim EY, Page P, Dellefave-Castillo LM, McNally EM, Wyatt EJ (2016) Direct reprogramming of urine-derived cells with inducible MyoD for modeling human muscle disease. Skelet Muscle 6(1):1\u0026ndash;16\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePoyatos-Garc\u0026iacute;a J, Bl\u0026aacute;zquez-Bernal \u0026Aacute;, Selva-Gim\u0026eacute;nez M, Bargiela A, Espinosa-Espinosa J, V\u0026aacute;zquez-Manrique RP et al (2023) CRISPR-Cas9 editing of a TNPO3 mutation in a muscle cell model of limb-girdle muscular dystrophy type D2. Mol Ther Nucleic Acids 31:324\u0026ndash;338\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSelvaraj S, Dhoke NR, Kiley J, Mateos-Aierdi AJ, Tungtur S, Mondragon-Gonzalez R et al (2019) Gene Correction of LGMD2A Patient-Specific iPSCs for the Development of Targeted Autologous Cell Therapy. Mol Ther 27(12):2147\u0026ndash;2157\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM\u0026uuml;thel S, Marg A, Ignak B, Kieshauer J, Escobar H, Stadelmann C et al (2023) Cas9-induced single cut enables highly efficient and template-free repair of a muscular dystrophy causing founder mutation. Mol Ther Nucleic Acids 31:494\u0026ndash;511\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrinkman EK, Chen T, Amendola M, Van Steensel B (2014) Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res 42(22):e168\u0026ndash;e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePozsgai ER, Griffin DA, Heller KN, Mendell JR, Rodino-Klapac LR (2016) beta-Sarcoglycan gene transfer decreases fibrosis and restores force in LGMD2E mice. Gene Ther 23(1):57\u0026ndash;66\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePozsgai ER, Griffin DA, Heller KN, Mendell JR, Rodino-Klapac LR (2017) Systemic AAV-mediated β-sarcoglycan delivery targeting cardiac and skeletal muscle ameliorates histological and functional deficits in LGMD2E mice. Mol Ther 25(4):855\u0026ndash;869\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"LGMD2E, SGCB, Gene editing, CRISPR, cellular model","lastPublishedDoi":"10.21203/rs.3.rs-9220253/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-9220253/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eLimb-Girdle Muscular Dystrophy Type 2E (LGMD2E) is one of the most prevalent phenotypes within the limb-girdle muscular dystrophies (LGMDs). This myopathy is caused by pathogenic mutations in the \u003cem\u003eSGCB\u003c/em\u003e gene, which encodes β-type sarcoglycan. LGMD2E is recognized as the most prevalent sarcoglycanopathy among the Iranian population specially within the Baloch ethnic group. To develop innovative gene therapy strategies based on accessible gene delivery and gene editing techniques, it is essential to have a cell line harboring genomic mutations in the \u003cem\u003eSGCB\u003c/em\u003e gene. These cell models are crucial for the preliminary evaluation of the efficacy of gene-editing-based methods. In this study, we utilized the clustered regularly interspaced short palindromic repeats (CRISPR) system and the approach of inducing indel mutations to generate an HEK-293T cell model harboring a frameshift mutation in \u003cem\u003eSGCB\u003c/em\u003e gene.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eTwo distinct \u003cem\u003eSGCB\u003c/em\u003e exon 2 targeting single guide RNAs (sgRNAs) were cloned into PX458 plasmids containing spCas9, and recombinant plasmids were transduced into HEK293T cells. The mutagenesis efficiency was evaluated using the TIDE program on Sanger sequencing data of transduced cells. Mutated cell clones were obtained through serial dilution techniques.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eOur results demonstrated the substantial efficacy of the CRISPR-Cas9 system in inducing mutations within the \u003cem\u003eSGCB\u003c/em\u003e gene. This capability presents significant potential for precise editing of the \u003cem\u003eSGCB\u003c/em\u003e gene in muscular cells, thereby establishing a robust cellular model for LGMD2E gene-editing strategies.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eThe application of CRISPR-Cas9 technology in this study highlights its potential for targeted gene editing in LGMD2E research. These findings pave the way for further investigations into the development of precision therapy for LGMD2E, ultimately contributing to the development of effective therapeutic strategies.\u003c/p\u003e","manuscriptTitle":"Development of a CRISPR-Cas9-Based Cellular Model for SGCB Gene Mutation: A Platform for Investigating Gene Therapy Strategies in LGMD2E","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-03-31 11:33:17","doi":"10.21203/rs.3.rs-9220253/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"4537e488-168e-41fb-b8ff-5f0ab868f1cd","owner":[],"postedDate":"March 31st, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-04-14T09:25:17+00:00","versionOfRecord":[],"versionCreatedAt":"2026-03-31 11:33:17","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-9220253","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-9220253","identity":"rs-9220253","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.