Transcriptomic profiles of Crandell-Rees feline kidney cells infected with Varicellovirus felidalpha-1 (FHV-1) field and vaccine strains | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Transcriptomic profiles of Crandell-Rees feline kidney cells infected with Varicellovirus felidalpha-1 (FHV-1) field and vaccine strains Emily Kwan, Alistair R. Legione, Carol A. Hartley, Joanne M. Devlin This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5965961/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 16 Apr, 2025 Read the published version in Virology Journal → Version 1 posted 9 You are reading this latest preprint version Abstract Background Varicellovirus felidalpha-1 (FHV-1, previously Felid alphaherpesvirus-1 ) is a significant cause of upper respiratory tract disease in feline populations. Cats infected with FHV-1 show clinical signs that vary in severity. This can be due to differences in host responses and virus strain virulence. Investigating the gene transcription profiles during infections using FHV-1 strains could inform our understanding of host and viral factors contributing to disease outcomes. This study characterised the transcriptomes of Crandell–Rees feline kidney (CRFK) cells infected with field or vaccine FHV-1 strains to better understand the host response during infection. Methods Crandell–Rees feline kidney cells were infected with either the FHV-1 Feligen vaccine strain or the 384/75 field strain associated with severe disease. The transcriptomes were characterised using RNA-sequencing. To determine the host cellular transcription profile, the total transcripts were mapped to the cat genome and compared to uninfected cells. To characterise the viral transcription profile, the total reads were mapped to each FHV-1 strain. The differentially expressed host genes between infection strains were compared and further analysed using the PANTHER database to examine host pathway regulation. Results The findings in this study show the differential host gene expressions induced by FHV-1 compared to uninfected CRFK cells. Genes encoding histone proteins were upregulated, while genes involved in cell adhesion and migration processes were downregulated during infections with FHV-1. Comparative analysis between field and vaccine strains showed similarities and differences in host gene expressions. Notably, upregulated genes unique to the field strain were associated with regulatory proteins involved in the cell cycle, while downregulated host genes in field and vaccine strains showed distinct host gene and pathway expressions involved in immune activation. Conclusions This study demonstrates the host and viral gene expressions during FHV-1 infection shows the distinct host responses to field and vaccine strains using an in vitro model. These findings provide a foundation for future transcriptomic investigations in other cell types, including ex-vivo explants systems, to enhance our understanding of host-pathogen interactions and viral pathogenesis that may inform future vaccine attenuation studies. feline herpesvirus-1 upper respiratory tract disease feline viral rhinotracheitis transcriptomics virus-host interaction molecular pathogenesis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Background Feline viral rhinotracheitis (FVR) is a highly infectious upper respiratory tract disease (URTD) in cats caused by Varicellovirus felidalpha-1 (FHV-1, previously Felid alphaherpesvirus-1 ). Primary FHV-1 replication occurs in the mucosae of the eyes and upper respiratory tract, which results in clinical signs such as rhinitis, conjunctivitis, and ocular ulcerations. In severe infections, FHV-1 can cause blindness ( 1 ), pneumonia ( 2 ) and nonsuppurative meningoencephalitis ( 3 ). The presence of other viruses such a Feline calicivirus (FCV) can change FHV-1 infection outcomes, resulting in severe infections that can lead to euthanasia ( 4 – 7 ). Host factors such as age, immune status and vaccination history can influence the host response to FHV-1 and disease outcome. Characterising the transcriptomic response during FHV-1 infection allows investigation of host and viral factors contributing to viral pathogenesis. Herpesviruses are enveloped DNA viruses that are classified into three subfamilies, Alphaherpesvirinae, Betaherpesvirinae and Gammaherpesvirinae . Varicellovirus felidalpha-1 (FHV-1) is a member of the Alphaherpesvirinae subfamily and the Varicellovirus genus ( 8 ). The FHV-1 genome is 134 kbp, which encodes 78 open reading frames (ORFs) and 74 proteins ( 9 , 10 ). Alphaherpesviruses can establish latent infections in the trigeminal ganglion, which can occur after primary FHV-1 infection ( 11 ). Cats do not present clinical signs or shed the virus during latency. Viral reactivation can occur spontaneously, and lead to viral shedding, with or without clinical signs ( 5 , 10 ). Current FHV-1 vaccines are modified live-attenuated or inactivated forms of the F2 strain. These vaccines can minimise the severity of clinical signs but do not prevent infection or the establishment of latent infections ( 10 , 12 ). Vaccinated domestic cat populations show effective protection against FHV-1 clinical signs. However, the impairment of the immune response by FHV-1 can increase the susceptibility to secondary infections and severe diseases ( 4 ). Investigating the host and viral gene expressions during FHV-1 infections using strains that differ in virulence could shed light on variations in disease outcomes and inform future vaccine studies. This study investigates the transcriptomes of Crandell-Rees feline kidney (CRFK) cells infected with FHV-1 field or vaccine strains using an in vitro model to better understand host responses to FHV-1. Methods Virus selection and cell culture Archived FHV-1 isolates of the F2 vaccine strain Feligen (Virbac New Zealand Ltd) and field strains that had been collected from cats with URTD were selected based on clinical signs and disease severity (Table 3 ) (Vaz et al., 2016). These isolates had 99.3% genetic identity using MAFFT whole genome alignment ( 13 ). Monolayers of CRFK cells ( 14 ) were grown at 37°C in a humidified atmosphere of 5% v/v CO 2 in growth media containing Dulbecco’s Modified Eagle basal media (DMEM, Sigma), 5% v/v foetal bovine serum (FBS, Sigma), 10 mM N-2-hydroxyethylpiperazine-N’-2- ethanesulfonic acid (HEPES) (pH 7.7) and antimicrobials (50 mg/mL ampicillin, 5 mg/mL amphotericin B). Viral growth kinetics One-step growth kinetics of each strain were determined in triplicate 6-well plates of CRFK cells. Uninfected cell monolayers at approximately 75% confluency were separately inoculated with each strain at a multiplicity of infection (M.O.I.) of 5 TCID 50 per cell. Uninfected control monolayers were mock inoculated with growth media only. After 1 hour of incubation at 37°C, the cell monolayers were washed twice with phosphate-buffered saline solution (PBS, pH 7.4, 137 mM NaCl, 8.2 mM Na 2 HPO 4 , 2.7 mM KCl) to remove the residual inoculum. Maintenance media containing DMEM with 1% v/v FBS, 10 mM HEPES pH 7.7 buffer solution and antimicrobials (50 mg/mL ampicillin, 5 mg/mL amphotericin B) were then added to each well. Samples were collected at six timepoints; 1-, 3-, 9-, 12-, 18- and 24-hours post-infection (h.p.i.) by freezing the plates at − 80°C. The material in each well was stored in 1 mL aliquots and used to determine the viral titres in CRFK cells by TCID 50 titration assays ( 17 ). Statistical analysis of viral titres between FHV-1 strains at each time point was performed using Student’s t-test, with P-values < 0.05 considered significant. Sample preparation for RNA sequencing Inoculations of the Feligen vaccine strain and field strain 384/75 at an M.O.I. of 5 TCID 50 per cell were performed in 6-well plates of CRFK cells in triplicate and harvested at 6 h.p.i. for RNA isolation and sequencing. The supernatant was collected from the cell monolayers and stored in 1 mL aliquots at -80°C. These samples were used to quantify viral titres by TCID 50 titration assays ( 17 ). The cell monolayers were scraped from the wells and centrifuged at 300 × g for 5 minutes to remove the remaining supernatant. The pelleted material was resuspended in RLT Plus buffer (RNeasy Mini Kit, Qiagen) with 1% v/v b-mercaptoethanol and stored at − 80°C. The total RNA was extracted using the RNeasy Plus mini kit (Qiagen), according to the manufacturer’s instructions. The quality of RNA in each sample was quantified using the Agilent 4200 Tapestation system (Agilent Technologies, Santa Clara, CA). All samples showed RNA integrity numbers (RIN) > 8 and were used for Illumina RNA-sequencing. Illumina RNA sequencing Libraries of cDNA were constructed and sequenced at the Australian Genome Research Facility (AGRF, Melbourne). Briefly, the TruSeq stranded mRNA library preparation kit (Illumina Inc., San Diego) was used to construct cDNA libraries. Samples with the correct fragment size (~ 260 bp) were normalised to a sequencing depth of 20 million reads on the NextSeq 500 sequencing platform (Illumina Inc, San Diego) to produce libraries of 150 bp paired-end reads. Quality control and processing of RNA-seq reads Raw sequence reads were uploaded to the Galaxy web platform and analysed on the public server usegalaxy.org to assess the read quality using FastQC version 0.11.8 ( 18 , 19 ). Adapter sequences and low-quality reads were trimmed using CutAdapt ( 20 , 21 ). The high-quality reads were mapped to the annotated domestic cat genome 126 version 1 ( 22 ) (general feature format and FASTA format), obtained from the NCBI database (Genbank accession no. GCF_018350175.1), to determine host transcription. The total reads from each library were also mapped to the FHV-1 field strain 384/75 genome ( 15 ) (Genbank Accession No. KR381782) to compare viral transcripts between field and vaccine strains. Both host and viral read mapping was performed using RNAstar ( 23 ). Differential gene expression analysis The host and viral counts per gene were normalised and converted to log 2 counts per million (CPM) on the interactive RNA-seq analysis platform Degust using Voom/Limma version 4.2 ( 24 – 26 ). Significant changes to gene expression were filtered in the RStudio environment version 2023.06.1 + 524 using the log 2 fold changes (LFC) that met the following conditions: (i) genes must have greater than 10 CPM reads in at least one treatment group, (ii) the LFC must be greater than 2 (or less than − 2), and (iii) the false discovery rate (FDR) of genes must be < 0.05. Analyses of viral gene expression were performed on Geneious Prime 2023.0.1 Categorisation of host genes with gene ontology Differential host gene expression was further analysed on the online PANTHER database version 17.0 to identify enriched gene ontology (GO) terms that were retrieved from the Uniprot database ( 27 ). The protein-encoding genes of the cat were extracted, indexed and linked to the differentially expressed host genes to analyse pathway regulation by biological function ( 28 ). Statistical enrichment analysis on the differentially expressed genes was categorised by molecular function, cellular component, and biological processes with P-values < 0.05 considered significant ( 29 ). Sample preparation for UL32 RT-qPCR To further investigate FHV-1 UL32 expression, CRFK cells were infected and harvested as described for viral growth kinetics. At each timepoint, the cell monolayers were scraped from the wells and centrifuged at 300 × g for 5 minutes to separate and remove the supernatant. The pelleted material was resuspended in RLT buffer with 1% v/v β-mercaptoethanol and stored in 1 mL aliquots at − 80°C. The total RNA was extracted using the RNeasy Plus mini kit and converted into cDNA using the SuperScript III reverse transcriptase kit (Invitrogen), following the manufacturer’s instructions. The cDNA of each triplicate across the six timepoints was stored at − 80°C and quantified using RT-qPCR. Preparation of standards for UL32 RT-qPCR Field strain 384/75 was used to generate standard curves for UL32 RT-qPCR transcription analysis. The total RNA was extracted using the RNeasy Plus mini kit and converted into cDNA using the Superscript III reverse transcriptase, according to the manufacturer’s instructions. The concentration of cDNA was determined using the Qubit RNA Broad Range Assay kit (Invitrogen) and serially diluted 10-fold from 10 8 to 10 2 copies per µL in triplicate with nuclease-free water. FHV-1 RT-qPCR Primer sets for UL32 and UL33 genes were designed to produce 150 bp products. Each 20 µL reaction was performed in the AriaMx Real-Time PCR system (Agilent Technologies) and contained 0.17 mM of either UL32 or UL33 primers (Table 4 ), 0.2 mM of each dNTP, 2 mM MgCl 2 , GoTaq colourless buffer (Promega), 8 mM Syto 9 (Life technologies), 1 U GoTaq Flexi DNA polymerase (Promega) and 3 µL of cDNA template. Negative control reactions containing DNA-free water instead of cDNA template were included in triplicate. Initial denaturation was performed at 95°C for 3 minutes, followed by 35 cycles of denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds and extension at 72°C for 20 seconds. A melt curve was produced by heating the amplified product from 72 to 95°C, increasing by 0.2°C every second, to confirm the correct product was amplified. The genome copies in each sample were determined using the AriaMx Real-Time PCR software and the UL32 transcription was normalised to the neighbouring upstream gene UL33 at each timepoint for field and vaccine strains. The UL33 gene is conserved amongst alphaherpesviruses and transcribes independently to UL32. The relative UL32 expression in the vaccine infection group at each timepoint was compared to the field infection, using Student’s t-test with P-values < 0.05 considered significant. Results Growth kinetics of FHV-1 field and vaccine strains The growth curves of the different FHV-1 strains were similar over 24 hours (Fig. 1). Cytopathic effects (CPE) were observed in cells infected with FHV-1 from 6 h.p.i. Statistical analysis of viral titres between FHV-1 isolates showed significantly higher titres of field strain 356/75b compared to the vaccine strain at 1 and 18 h.p.i. (P = 0.04 and P = 0.02, respectively) and significantly higher titres than field isolates 571/79 (P = 0.02) and 384/75 (P = 0.02) at 3 and 24 h.p.i, respectively. Field isolate 384/75 showed significantly lower viral titres than isolate 356/75b at 12 h.p.i. (P = 0.03). No CPE was observed in the uninfected cells at any time point. Host and viral RNA are distinguishable in FHV-1 infections in vitro High-quality reads across the infection groups mapped to the domestic cat genome. In samples infected with FHV-1 field or vaccine strains, the total reads also mapped to the genome of the field strain 384/75 (Fig. 2). The principal component analysis (PCA) plot generated using the log 2 CPM values of the total reads mapped to the cat genome showed minimal variation between the triplicates of FHV-1 infection groups and a distinct difference between the infection groups and uninfected samples (Supplementary Fig. 1). The data from this study has been deposited to the NCBI BioProject database under BioProject accession number PRJNA1082348. Field and vaccine strains show minimal differences in viral gene transcription Viral reads in the FHV-1 infection groups mapped to the complete FHV-1 genome consisting of 73 viral genes. The transcript per million (TPM) of each FHV-1 gene is shown in Fig. 3. Differential viral gene expression analysis of the vaccine strain compared to the field strain showed a significant difference in UL32 gene transcription with an LFC of 2.16 (P < 0.01) (Supplementary Fig. 2). Further examination of UL32 transcription using RT-qPCR did not show significant differences in relative UL32 expression, compared to UL33, across timepoints between field and vaccine strains. The average copy numbers of UL32 and UL33 transcripts in samples infected with field or vaccine strains are shown in Fig. 4. Field and vaccine FHV-1 strains induce changes to host cellular gene expression The total host reads in the field and vaccine infection group compared to the uninfected samples showed differentially expressed host genes (Fig. 5). Cells infected with the field strain 384/75 showed a total of 1,024 differentially expressed genes compared to uninfected cells, of which 837 were upregulated and 187 were downregulated. In cells infected with the vaccine strain, 2,823 genes were differentially expressed. Of these 2,500 genes were upregulated and 323 genes were downregulated. Differentially expressed host genes between field and vaccine strains A comparison of the differentially expressed host genes in the field and vaccine infection groups showed 795 genes that were identified in both infection groups (Fig. 6). Of these, 682 were upregulated and 113 were downregulated. The remaining genes differentially expressed in each infection group showed the vaccine infection group with ten times more differentially expressed genes than the field infection group. The top 10 commonly up- and downregulated genes showed greater changes in host gene expression in the vaccine infection group than in the field infection group, compared to uninfected cells (Table 1 ). Genes encoding histone proteins dominated the top 10 upregulated gene, accounting for eight upregulated genes in both infection groups. The top 10 downregulated genes common to both infection strains dysregulated cell surface and pattern recognition receptors, as well as genes regulating cell adhesion, migration and division processes associated with immune responses. Host gene expressions can differ between field and vaccine FHV-1 strains The top 10 up- and downregulated genes unique to each infection group showed similar changes in LFC expression levels (Table 2 ). The LFC values of these genes were generally lower than the genes common between the infection groups described in Table 1 . The highest upregulated genes uniquely differentially expressed in the field infection group were associated with tRNA species and regulatory proteins involved in the cell cycle. The characterised downregulated genes were involved in the expression of transmembrane proteins, binding proteins, and regulators of the immune response. The greatest upregulated genes uniquely differentially expressed in samples infected with the vaccine strain were small non-coding RNA. The most downregulated genes were associated with kinase expression, transmembrane cell signalling protein, cellular metabolism, and inflammatory responses. Field and vaccine FHV-1 strains enriched genes with different host functions The significant differentially expressed host genes in the FHV-1 infection groups were linked to GO terms that categorise the differentially expressed genes based on their roles in cellular components, molecular functions, and biological processes. The enriched GO terms in field and vaccine infection groups showed differences within each functional group category and more enriched GO terms in cells infected with the field strain compared to the vaccine strain (Fig. 7). Infections using the vaccine strain may induce more host gene and pathway changes than the field strain but fewer enriched host pathways. Independent enrichment analysis of the upregulated and downregulated genes in samples with FHV-1 infections did not show significantly enriched GO terms across most functional categories. The upregulated genes in samples infected with the field strain were an exception, with 27 genes overrepresented in the DNA binding molecular function. Field and vaccine FHV-1 strains regulated different host pathways The differentially expressed host genes in samples infected with the vaccine strain regulated more host proteins and pathways than cells infected with the field strain. Infections with the vaccine strain contributed to 224 protein-encoding genes which regulated 76 pathways, compared to 93 genes in the field strain regulating 48 pathways. In samples infected with the vaccine strain, the expression of 34 unique protein-encoding genes contributed to 24 dysregulated pathways (Fig. 8). Discussion In this study, infections of CRFK cells with field and vaccine FHV-1 strains induced significant changes to host gene expression when compared to uninfected cells. Histone genes were strongly represented in the top 10 upregulated genes while genes associated with cell adhesion and immune activation were downregulated in CRFK cells infected with field or vaccine strains. Between the two infection strains, host genes associated with immunoregulation differed in expression. Infections using the field strain induced fewer differentially expressed host genes compared to the vaccine strain, which resulted in less host proteins and pathways differentially regulated. However, pathway enrichment analysis showed more enriched host pathways during infections using the field strain than the vaccine strain. These findings compare the gene expression patterns during infections using field or vaccine strains, demonstrating the different host responses to FHV-1 associated with viral strain virulence. Observable CPE induced by FHV-1 strains in CRFK cells demonstrated viral replication, which indicated the presence of viral and cellular mRNA in the infected cell cultures. These epithelial cells are highly susceptible to FHV-1 infections and do not contain immune cells. This allowed this study to characterise the host and viral transcription profiles during FHV-1 infections in a homogenous population of cells from the natural host. Genes encoding histones and proteins associated with adaptive immune activation showed similar expression patterns between field and vaccine strains, consistent with previous in vitro and in vivo FHV-1 studies using RT-qPCR ( 30 , 31 ). The consistencies between this in vitro study and past in vivo studies suggests the findings from this study are relevant to the host response in cats with FHV-1. Histone genes were upregulated during FHV-1 infections, compared to uninfected cells, which is consistent with previous studies using herpes simplex virus type 1 (HSV-1) ( 32 – 34 ). Histones are structural proteins that package DNA within the cell nucleus and form the nucleoprotein complex, chromatin. The upregulation of histone genes in this study highlights the interactions between histones and the viral genome, which are well-characterised in alphaherpesviruses ( 35 ). Upon viral entry into the nucleus, herpesvirus DNA binds to histones to induce modifications to the structure of host chromatin and trigger the expression of precursor histones. Host repair factors and DNA damage responses are associated with chromatin modifications, suggesting host DNA repair pathways may be activated during herpesvirus infection ( 36 ). Cell surface receptors and growth factors associated with innate immune activity were downregulated during FHV-1 infections compared to uninfected cells. This finding is consistent with previous HSV-1 transcription studies in epithelial cells which observed changes in host pathways regulating cell adhesion and migration, and immune activation ( 37 ). Cell surface and pattern recognition receptors have roles regulating cell adhesion and migration, including the recruitment of leukocytes, such as macrophages and T-cells ( 38 , 39 ). Additionally, cellular growth factors involved in cell injury responses can influence cell differentiation and division processes that contribute to inflammation and repair. Previous in vitro studies have demonstrated FHV-1 can downregulate the surface expression of major histocompatibility complex (MHC) class II proteins, which suggests FHV-1 influences immunoregulation ( 40 ). While MHC class I proteins can activate cytotoxic T-cells to directly kill infected cells, MHC class II proteins can induce T-helper cells to activate antiviral immune responses ( 41 ). The downregulation of MHC class II proteins alongside genes which regulate cell surface receptors and growth factors is consistent with FHV-1 altering the differentiation and recruitment of immune cells during infection, potentially contributing to suppressed host responses. Comparative analysis between field and vaccine strains showed distinct host pathways regulations associated with cell migration, T-cell activation and innate immunity during infections using the vaccine strain. While the vaccine strain induced more host gene changes, the field strain affected a broader range of host pathways. The similarities and differences in host gene and pathway expression associated with immune cell regulation, between field and vaccine strains, suggests the magnitude of gene expression changes may influence the host response. The vaccine strain may induce more targeted changes in specific host pathways to activate a more targeted immune response. However, the field strain could influence more host functions, resulting in a broader impact on immune responses. These findings demonstrate how different host responses between viral strain virulence and genetics may contribute to altered disease outcomes. Viral transcripts of the late gene UL32 in the field and vaccine FHV-1 strains showed conflicting results between RNA-sequencing and RT-qPCR analysis. While RNA-sequencing identified potential differences in UL32 transcription, this was not confirmed by RT-qPCR. Transcriptomic analysis using RT-qPCR allows high specificity and sensitivity when analysing gene transcripts of low target numbers ( 42 – 44 ). This suggests the absence of differences in FHV-1 gene transcription between field and vaccine strains in this study indicates that factors beyond viral gene transcription may contribute to differences in viral virulence between field and vaccine strains. Viral growth kinetics between FHV-1 field and vaccine strains were similar and previous studies analysing the genome sequences of clinical and vaccine FHV-1 isolates observed 99% homogeneity and no changes in virulence factors ( 15 , 45 ). The viral gene UL32 is conserved amongst herpesviruses and is required for the cleavage and packaging of viral DNA. Previous transcriptomic studies of HSV-1 have shown differences in viral gene expression and protein levels between strains in epithelial and neuronal cells ( 37 ). These findings suggest future studies that explores viral gene expression at various timepoint across the viral replication cycle or in other cell types could shed light on differences between FHV-1 strains that could contribute to phenotypes of FHV-1 infections. Conclusions The findings in this study demonstrated the host and viral transcriptomic profiles of FHV-1 infections in vitro . Host gene expression of CRFK cells infected with field and vaccine strains showed many consistencies to previous transcriptomic analyses of herpesviruses and FHV-1 infections in vivo . The differential expression of histones and inflammatory genes identified in this study may contribute to immune responses and pathogenesis involved in FHV-1 infections. Future transcriptomic studies in other systems, such as respiratory tissue explant systems or in vivo infections, will be needed to provide a comprehensive understanding of host responses to FHV-1 and enhance our understanding of herpesvirus pathogenesis. Abbreviations AGRF Australian Genome Research Facility CPE Cytopathic effects CPM Counts per million CRFK Crandell- Rees feline kidney DMEM Dulbecco’s Modified Eagle basal media FBS Foetal bovine serum FCV Feline calicivirus FDR False discovery rate FHV-1 Varivellovirus felidalpha-1 FVR Feline viral rhinotracheitis GO Gene ontology HEPES N-2-hydroxyethylpiperazine-N’-2- ethanesulfonic acid HSV-1 Herpes simplex virus type 1 h.p.i. Hours post-infection LFC Log 2 fold change MHC Major histocompatibility complex M.O.I. Multiplicity of infection N/A Not applicable ORFs Open reading frames PBS Phosphate-buffered saline solution PCA Principal component analysis RIN RNA integrity numbers TCID 50 Median tissue culture infective dose TPM Transcripts per million URTD Upper respiratory tract disease Declarations Ethics approval Not applicable Availability of data and materials The datasets generated during the current study are available in the GenBank repository BioProject accession number PRJNA1082348 https://www.ncbi.nlm.nih.gov/bioproject/PRJNA1082348/ Competing interests The authors declare the research was conducted in the absence of any commercial or financial relationships that could be considered as potential conflict of interest. Funding No funding. Authors contributions EK performed the experiments, bioinformatics and analysed the transcriptomic data in this study. ARL, CAH and JMD designed the project and offered laboratory advice. ARL provided the cells used in this study. All authors contributed to the editing and approved the final manuscripts. Acknowledgments The authors would like to acknowledge Paola Vaz for providing the FHV-1 isolates for this study and the Asia-Pacific Centre for Animal Health research group for supporting this project. References Gould D. Feline herpesvirus-1: ocular manifestations, diagnosis and treatment options. J Feline Med Surg. 2011;13(5):333–46. Monne Rodriguez JM, Leeming G, Kohler K, Kipar A. Feline Herpesvirus Pneumonia: Investigations Into the Pathogenesis. Vet Pathol. 2017;54(6):922–32. Hora AS, Tonietti PO, Guerra JM, Leme MC, Pena HF, Maiorka PC, et al. Felid herpesvirus 1 as a causative agent of severe nonsuppurative meningoencephalitis in a domestic cat. J Clin Microbiol. 2013;51(2):676–9. Fernandez M, Manzanilla EG, Lloret A, León M, Thibault JC. Prevalence of feline herpesvirus-1, feline calicivirus, Chlamydophila felis and Mycoplasma felis DNA and associated risk factors in cats in Spain with upper respiratory tract disease, conjunctivitis and/or gingivostomatitis. J Feline Med Surg. 2017;19(4):461–9. Thiry E, Addie D, Belak S, Boucraut-Baralon C, Egberink H, Frymus T, et al. Feline herpesvirus infection. ABCD guidelines on prevention and management. J Feline Med Surg. 2009;11(7):547–55. Monne Rodriguez J, Kohler K, Kipar A. Calicivirus co-infections in herpesvirus pneumonia in kittens. Vet J. 2018;236:1–3. Najafi H, Madadgar O, Jamshidi S, Ghalyanchi Langeroudi A, Darzi Lemraski M. Molecular and clinical study on prevalence of feline herpesvirus type 1 and calicivirus in correlation with feline leukemia and immunodeficiency viruses. Veterinary Res Forum. 2014;5(4):255–61. Gatherer D, Depledge DP, Hartley CA, Szpara ML, Vaz PK, Benkő M et al. ICTV Virus Taxonomy Profile: Herpesviridae 2021. J Gen Virol. 2021;102(10). Rota PA, Maes RK, Ruyechan WT. Physical characterization of the genome of feline herpesvirus-1. Virology. 1986;154(1):168–79. Maes R. Felid herpesvirus type 1 infection in cats: a natural host model for alphaherpesvirus pathogenesis. ISRN Veterinary Sci. 2012;2012:495830. Gaskell RM, Dennis PE, Goddard LE, Cocker FM, Wills JM. Isolation of felid herpesvirus I from the trigeminal ganglia of latently infected cats. J Gen Virol. 1985;66(Pt 2):391–4. Richter M, Schudel L, Tobler K, Matheis F, Vogtlin A, Vanderplasschen A, et al. Clinical, virological, and immunological parameters associated with superinfection of latently with FeHV-1 infected cats. Vet Microbiol. 2009;138(3–4):205–16. Katoh K, Standley DM. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol Biol Evol. 2013;30(4):772–80. Crandell RA, Fabricant CG, Nelson-Rees WA. Development, characterization, and viral susceptibility of a feline (Felis catus) renal cell line (CRFK). Vitro. 1973;9(3):176–85. Vaz PK, Job N, Horsington J, Ficorilli N, Studdert MJ, Hartley CA, et al. Low genetic diversity among historical and contemporary clinical isolates of felid herpesvirus 1. BMC Genomics. 2016;17:704. Bittle JL, Rubic WJ. Immunogenic and protective effects of the F-2 strain of feline viral rhinotracheitis virus. Am J Vet Res. 1975;36(1):89–91. Smither SJ, Lear-Rooney C, Biggins J, Pettitt J, Lever MS, Olinger GG. Jr. Comparison of the plaque assay and 50% tissue culture infectious dose assay as methods for measuring filovirus infectivity. J Virol Methods. 2013;193(2):565–71. Afgan E, Baker D, van den Beek M, Blankenberg D, Bouvier D, Čech M, et al. The Galaxy platform for accessible, reproducible and collaborative biomedical analyses: 2016 update. Nucleic Acids Res. 2016;44(W1):W3–10. Blankenberg D, Von Kuster G, Bouvier E, Baker D, Afgan E, Stoler N, et al. Dissemination of scientific software with Galaxy ToolShed. Genome Biol. 2014;15(2):403. Jalili V, Afgan E, Gu Q, Clements D, Blankenberg D, Goecks J, et al. The Galaxy platform for accessible, reproducible and collaborative biomedical analyses: 2020 update. Nucleic Acids Res. 2020;48(W1):W395–402. Martin M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnetjournal. 2011;17(1):10. Lopez JV, Cevario S, O'Brien SJ. Complete nucleotide sequences of the domestic cat (Felis catus) mitochondrial genome and a transposed mtDNA tandem repeat (Numt) in the nuclear genome. Genomics. 1996;33(2):229–46. Widmann J, Stombaugh J, McDonald D, Chocholousova J, Gardner P, Iyer MK, et al. RNASTAR: an RNA STructural Alignment Repository that provides insight into the evolution of natural and artificial RNAs. RNA J. 2012;18(7):1319–27. Powell D. drpowell/degust 4.1.1 (4.1.1). Zenodo. 2019 [Available from: https://doi.org/10.5281/zenodo.3501067 Ritchie ME, Phipson B, Wu D, Hu Y, Law CW, Shi W, et al. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015;43(7):47. Law CW, Chen Y, Shi W, Smyth GK. voom: precision weights unlock linear model analysis tools for RNA-seq read counts. Genome Biol. 2014;15(2):R29. Thomas PD, Ebert D, Muruganujan A, Mushayahama T, Albou L-P, Mi H. PANTHER: Making genome-scale phylogenetics accessible to all. Protein Sci. 2022;31(1):8–22. Mi H, Thomas P. PANTHER pathway: an ontology-based pathway database coupled with data analysis tools. Methods Mol Biology. 2009;563:123–40. Mi H, Muruganujan A, Huang X, Ebert D, Mills C, Guo X, et al. Protocol Update for large-scale genome and gene function analysis with the PANTHER classification system (v.14.0). Nat Protoc. 2019;14(3):703–21. Johnson LR, Maggs DJ. Feline herpesvirus type-1 transcription is associated with increased nasal cytokine gene transcription in cats. Vet Microbiol. 2005;108(3–4):225–33. Ansari MA, Dutta S, Veettil MV, Dutta D, Iqbal J, Kumar B, et al. Herpesvirus Genome Recognition Induced Acetylation of Nuclear IFI16 Is Essential for Its Cytoplasmic Translocation, Inflammasome and IFN-β Responses. PLoS Pathog. 2015;11(7):1005019. Gao C, Chen L, Tang SB, Long QY, He JL, Zhang NA, et al. The epigenetic landscapes of histone modifications on HSV-1 genome in human THP-1 cells. Antiviral Res. 2020;176:104730. Conn KL, Hendzel MJ, Schang LM. The differential mobilization of histones H3.1 and H3.3 by herpes simplex virus 1 relates histone dynamics to the assembly of viral chromatin. PLoS Pathog. 2013;9(10):1003695. Cliffe AR, Knipe DM. Herpes Simplex Virus ICP0 Promotes both Histone Removal and Acetylation on Viral DNA during Lytic Infection. J Virol. 2008;82(24):12030–8. Van Opdenbosch N, Favoreel H, Van de Walle GR. Histone modifications in herpesvirus infections. Biol Cell. 2012;104(3):139–64. Wilkinson DE, Weller SK. Recruitment of cellular recombination and repair proteins to sites of herpes simplex virus type 1 DNA replication is dependent on the composition of viral proteins within prereplicative sites and correlates with the induction of the DNA damage response. J Virol. 2004;78(9):4783–96. Mangold CA, Rathbun MM, Renner DW, Kuny CV, Szpara ML. Viral infection of human neurons triggers strain-specific differences in host neuronal and viral transcriptomes. PLoS Pathog. 2021;17(3):1009441. Vyas D, Patel M, Wairkar S. Strategies for active tumor targeting-an update. Eur J Pharmacol. 2022;915:174512. Wang J, Wang S, Chen L, Tan J. SCARA5 suppresses the proliferation and migration, and promotes the apoptosis of human retinoblastoma cells by inhibiting the PI3K/AKT pathway. Mol Med Rep. 2021;23(3):202. Montagnaro S, Longo M, Pacilio M, Indovina P, Roberti A, De Martino L, et al. Feline herpesvirus-1 down-regulates MHC class I expression in an homologous cell system. J Cell Biochem. 2009;106(1):179–85. Rosendahl Huber S, van Beek J, de Jonge J, Luytjes W, van Baarle D. T cell responses to viral infections - opportunities for Peptide vaccination. Front Immunol. 2014;5:171. Litster A, Wu CC, Leutenegger CM. Detection of feline upper respiratory tract disease pathogens using a commercially available real-time PCR test. Vet J. 2015;206(2):149–53. Yang D-K, Kim H-H, Park Y-R, Yoo JY, Choi S-S, Park Y, et al. Isolation and Molecular Characterization of Feline Herpesvirus 1 from Naturally Infected Korean Cats. J Bacteriol Virol. 2020;50(4):263–72. Mazzei M, Vascellari M, Zanardello C, Melchiotti E, Vannini S, Forzan M, et al. Quantitative real time polymerase chain reaction (qRT-PCR) and RNAscope in situ hybridization (RNA-ISH) as effective tools to diagnose feline herpesvirus-1-associated dermatitis. Vet Dermatol. 2019;30(6):491–147. Lewin AC, Coghill LM, McLellan GJ, Bentley E, Kousoulas KG. Genomic analysis for virulence determinants in feline herpesvirus type-1 isolates. Virus Genes. 2020;56(1):49–57. Tables Table 1 The top 10 commonly up- and downregulated genes in both field (384/75) and vaccine (Feligen) infections in CRFK cells. The functions of characterised genes are shown alongside the gene expression levels, which are represented by log 2 fold change (LFC) and are shown in order of expression in field infection samples. Up regulated Gene ID Gene function 384/75 Vaccine FDR 1 LFC 2 FDR 1 LFC 2 H4C16 Histone < 0.01 7.48 < 0.01 7.16 H4C13 Histone < 0.01 7.48 < 0.01 6.92 H2BC3 Histone < 0.01 7.32 < 0.01 7.32 H3C11 Histone < 0.01 7.21 < 0.01 7.80 LOC123386069 – < 0.01 7.20 < 0.01 7.80 LOC111559230 – < 0.01 6.98 < 0.01 8.68 H3C6 Histone 0.01 6.86 < 0.01 6.94 Histone H4 Histone < 0.01 6.81 < 0.01 7.48 Histone H4 Histone < 0.01 6.78 < 0.01 6.62 Histone H3.1 Histone < 0.01 6.77 < 0.01 6.71 Down regulated COL8A1 Cell homeostasis < 0.01 -5.87 < 0.01 -5.63 ATP6V0D2 Cell adhesion < 0.01 -5.63 < 0.01 -4.00 ADAMDEC1 Cell migration 0.03 -5.22 0.01 -4.37 FGF7 Growth factor 0.01 -5.13 < 0.01 -5.72 VCAM1 Cell surface receptor 0.00 -5.13 < 0.01 -6.10 SCARA5 Pattern recognition receptor 0.04 -5.11 0.01 -5.54 REG4 Cell homeostasis 0.01 -5.06 < 0.01 -4.73 CB1H4orf36 – 0.02 -4.63 0.01 -2.20 MHC class II Cell surface receptor 0.01 -4.58 < 0.01 -2.17 TMEM100 Cell homeostasis < 0.01 -4.56 < 0.01 -5.14 1 The false discovery rate (FDR) is shown 2 P-values 2 for upregulated or < -2 for downregulated genes were considered significant. Table 2 Top 10 up- and downregulated genes unique to FHV-1 field (384/75) and vaccine (Feligen) infections in CRFK cells. Gene expression levels are represented by log 2 fold change (LFC) and were compared to uninfected samples across triplicates. Up regulated Gene ID 384/75 Gene ID Vaccine FDR 1 LFC 2 FDR 1 LFC 2 LOC111560238 0.04 4.29 SNORD58 < 0.01 5.71 LOC109499602 0.02 3.47 SNORA3/45 < 0.01 5.52 TRNAW-CCA_8 0.04 3.44 LOC123384631 < 0.01 5.47 TRNAF-GAA_10 0.01 3.43 SNORD14 < 0.01 5.45 LOC109491671 0.02 3.42 LOC109502106 < 0.01 5.45 LOC109500935 0.01 3.38 LOC111561262 < 0.01 5.35 LOC101088630 0.02 3.29 LOC111561932 < 0.01 5.32 SFN 0.05 3.22 SNORD22 < 0.01 5.18 LOC111560944 0.01 3.19 LOC123385372 < 0.01 5.13 LOC109493372 < 0.01 3.19 LOC109501215 < 0.01 5.10 Down regulated TMEM26 0.02 -3.77 TRIB3 0.01 -4.35 INHBE 0.01 -3.49 LOC109503125 0.01 -4.13 FABP7 0.03 -3.30 LOC101096785 0.01 -4.00 LOC109491403 0.01 -3.20 XPNPEP2 0.05 -3.65 LOC123380486 0.02 -3.11 LOC111556196 0.01 -3.56 LOC111558401 0.01 -3.10 EDNRA 0.01 -3.42 LOC123383220 0.01 -3.08 DUOX2 < 0.01 -3.42 LOC109503254 0.02 -2.99 LOC102899057 < 0.01 -3.40 LOC123383127 0.01 -2.98 HLF < 0.01 -3.34 LOC109500446 0.03 -2.95 LOC101085945 < 0.01 -3.31 1 The false discovery rate (FDR) is shown 2 P-values 2 for upregulated and LFC < -2 for downregulated were considered significant Table 3 FHV-1 isolates used in this study Virus ID Year of isolation Genbank Acc. No. Disease Site 384/75 1975 KR381782 ( 15 ) Pneumonia Lung 356/75b 1975 KR381784 ( 15 ) URTD 1 N/A 2 Feligen 1975 KR296657 ( 16 ) N/A 2 Vaccine 571/79 1979 KR381785 ( 15 ) Conjunctivitis Eye swab 1 URTD = Upper respiratory tract disease 2 N/A = Not applicable Table 4 Primers used for UL32 FHV-1 RT-qPCR. Primer Direction Sequence (5’ → 3’) Binding site (nt) 1 UL32 Forward CCATACCACTCTGTGCCACC 46,212–46,231 Reverse GAACGCCCCCACCAAAGTAA 46,318–46,299 UL33 Forward AACGTGATTTTTGCGTGGCC 45,525–45,544 Reverse TTATCATATACCCAGCGACTCG 45,624–45,603 1 Nucleotide numbers of the binding site relate to the alignment of the FHV-1 F2 vaccine strain (Feligen) (Genbank Accession No. KR296657) Additional Declarations No competing interests reported. Supplementary Files Supplementaryfigure1.png Supplementary figure 1. Principal component analysis (PCA) plot of host transcription profiles in CRFK cells infected with field strain 384/75 (green), Feligen vaccine strain (yellow) or uninfected (purple). Each data point shows the biological replicates of each group with 95% confidence ellipses. Supplementaryfigure2.png Supplementary figure 2. Volcano plot of FHV-1 genes in CRFK cells infected with Feligen vaccine strain compared to the 384/75 field strain. The log 2 fold-change (log 2 FC) of FHV-1 gene expression is shown with the statistical significance (–log 10 (adjusted P-value)) indicated by the dotted line at P= –0.05 (or –log 10 P = 1.30). The differentially expressed gene UL32 is labelled. Cite Share Download PDF Status: Published Journal Publication published 16 Apr, 2025 Read the published version in Virology Journal → Version 1 posted Editorial decision: Revision requested 06 Mar, 2025 Reviews received at journal 04 Mar, 2025 Reviews received at journal 03 Mar, 2025 Reviewers agreed at journal 23 Feb, 2025 Reviewers agreed at journal 20 Feb, 2025 Reviewers invited by journal 17 Feb, 2025 Editor assigned by journal 06 Feb, 2025 Submission checks completed at journal 06 Feb, 2025 First submitted to journal 05 Feb, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5965961","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":412256164,"identity":"fde51b7f-4ee7-43f1-b5c5-05a8f7be6c06","order_by":0,"name":"Emily Kwan","email":"","orcid":"","institution":"The University of Melbourne","correspondingAuthor":false,"prefix":"","firstName":"Emily","middleName":"","lastName":"Kwan","suffix":""},{"id":412256165,"identity":"3497f279-22a0-41e4-9d5e-29d81873bff7","order_by":1,"name":"Alistair R. Legione","email":"","orcid":"","institution":"The University of Melbourne","correspondingAuthor":false,"prefix":"","firstName":"Alistair","middleName":"R.","lastName":"Legione","suffix":""},{"id":412256166,"identity":"2c46f14d-0fb9-4add-b5f7-a8ee93019808","order_by":2,"name":"Carol A. Hartley","email":"","orcid":"","institution":"The University of Melbourne","correspondingAuthor":false,"prefix":"","firstName":"Carol","middleName":"A.","lastName":"Hartley","suffix":""},{"id":412256168,"identity":"b777c242-48c1-457a-9c01-37b3955e5109","order_by":3,"name":"Joanne M. Devlin","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8UlEQVRIie3NuwrCMBSA4VMEXWpdLYi+whEfwFdpEeyi4CQODooYl7rrW9TNMSLoEpwrFqRLJgdHBQWTKm69jIL5h9zIxwFQqX4xChq1IF8F0EYAPSqerFQCkjTeBLMSsdmj6JaFGHsXabg2HO80mXpXDKBU6CDcSTwxGUNqs3zXCzbkuEAOpntBbZ5A0G9b1CaC+DY56bgVL2JKMYmceUQclOQhSFMQ7Zk4JUclsSICckq5g7mkKSZrRaS+FOToItfLjPe2lUM8MfabcXgnu5rhO9y/DYJqadZahZd+PPm0+550udBUADDM8EelUqn+thf37GE5u6XTiwAAAABJRU5ErkJggg==","orcid":"","institution":"The University of Melbourne","correspondingAuthor":true,"prefix":"","firstName":"Joanne","middleName":"M.","lastName":"Devlin","suffix":""}],"badges":[],"createdAt":"2025-02-05 13:08:28","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5965961/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5965961/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12985-025-02722-w","type":"published","date":"2025-04-16T15:57:48+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":75888490,"identity":"c085aff7-c50c-4be4-ab9f-ce99b039f694","added_by":"auto","created_at":"2025-02-10 09:32:55","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":73402,"visible":true,"origin":"","legend":"\u003cp\u003eOne-step growth curves of FHV-1 field and vaccine strains in CRFK cells infected in triplicate an M.O.I. of 5 TCID\u003csub\u003e50\u003c/sub\u003e per cell. Viral titres at each timepoint were determined using TCID\u003csub\u003e50\u003c/sub\u003e assays and the mean TCID\u003csub\u003e50\u003c/sub\u003e titre across triplicates is shown. Error bars represent the standard deviation.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-5965961/v1/8ec3f7ac4320ee31aeb0af61.png"},{"id":75888493,"identity":"dc4f07d6-4c46-44df-97ce-d0c2f02f40dd","added_by":"auto","created_at":"2025-02-10 09:32:56","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":176580,"visible":true,"origin":"","legend":"\u003cp\u003ePercentage of the total reads that mapped to the domestic cat genome Fca126 (RefSeq acc. GCA_018350175.1) and FHV-1 field strain 384/75 in each replicate (rep) of the FHV-1 infected and uninfected cells. The total number of reads of each sample is shown at the right end of each sample. The unmapped reads are also shown.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-5965961/v1/3d0d2fc8d3e028fb751b9455.png"},{"id":75890142,"identity":"a28d6a71-edbc-4a82-8cba-dc742cdf81da","added_by":"auto","created_at":"2025-02-10 09:40:56","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":122178,"visible":true,"origin":"","legend":"\u003cp\u003e(A) The log\u003csub\u003e10\u003c/sub\u003e transcript per million (logTPM) count of FHV-1 384/75 genes in CRFK cells. (B) The logTPM count of FHV-1 vaccine genes in CRFK cells. The median TPM across the genome is shown in red and the order of genes presented represents the order of the genes in the genome. The transcription of UL32 in field and vaccine strains is highlighted in red.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-5965961/v1/5ed6e28a2f194eff7813d0ec.png"},{"id":75890143,"identity":"5da2366c-5f93-4f53-82c5-ce02e22e716d","added_by":"auto","created_at":"2025-02-10 09:40:56","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":145110,"visible":true,"origin":"","legend":"\u003cp\u003eThe average genome copies of UL32 and UL33 transcripts in field and vaccine infection groups using RT-qPCR. Error bars representing the standard deviations of each replicate at each timepoint are shown.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-5965961/v1/ba282f5ca9dbf71788fce319.png"},{"id":75888503,"identity":"38cfe893-f635-42be-b8ab-5f262d5c7476","added_by":"auto","created_at":"2025-02-10 09:32:56","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":203801,"visible":true,"origin":"","legend":"\u003cp\u003eVolcano plots of the significantly expressed up- and downregulated host genes in CRFK cells infected with the field strain 384/75 or the vaccine strain (Feligen). Host gene expression in the FHV-1 infected samples was compared to the uninfected cells. The top 10 up- and downregulated genes are labelled.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-5965961/v1/ab8ded438aafbb826074d492.png"},{"id":75890380,"identity":"4bc03446-df81-4556-8606-c0d9961d8612","added_by":"auto","created_at":"2025-02-10 09:48:56","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":97603,"visible":true,"origin":"","legend":"\u003cp\u003eThe number of host genes differentially expressed in both infection groups and unique to each infection group are shown (blue and yellow circles). The total number of up- and downregulated genes unique to samples with field and vaccine infections are shown alongside each infection group (purple and green circles).\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-5965961/v1/d01bf61e5ad5fbbecb249105.png"},{"id":75890381,"identity":"c4a3faa5-00a7-48bd-affc-df67771b47ea","added_by":"auto","created_at":"2025-02-10 09:48:56","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":383347,"visible":true,"origin":"","legend":"\u003cp\u003eStatistical enrichment analysis of the total up- and downregulated protein-encoding genes in the field and vaccine infection groups by biological process, molecular function, and cellular components. Overrepresented GO terms are shown \u0026gt; 0 and the underrepresented GO terms are shown \u0026lt; 0. The number of enriched genes that contributed to each pathway is shown.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-5965961/v1/84bbe2c37862d28a2bb44fac.png"},{"id":75888499,"identity":"a1d0ffbe-cedb-4138-ae8d-811a2878cf96","added_by":"auto","created_at":"2025-02-10 09:32:56","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":318668,"visible":true,"origin":"","legend":"\u003cp\u003ePANTHER GO analysis of host pathways in vaccine infection group that were not differentially regulated in the field infection group. The number of upregulated protein-encoding genes contributing to host pathways are shown \u0026gt; 0 and the downregulated genes are shown \u0026lt; 0.\u003c/p\u003e","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-5965961/v1/7ba2c26a3f67c68c9ff25f4f.png"},{"id":81050882,"identity":"3f81561b-c97c-421d-a49e-0084f1a37090","added_by":"auto","created_at":"2025-04-21 16:06:24","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2262483,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5965961/v1/3eca457a-3e2f-49d9-8602-7128bf35a04d.pdf"},{"id":75888491,"identity":"b4d41f16-79f3-4c9f-8359-779e232b5765","added_by":"auto","created_at":"2025-02-10 09:32:56","extension":"png","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":36267,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary figure 1.\u003c/strong\u003e Principal component analysis (PCA) plot of host transcription profiles in CRFK cells infected with field strain 384/75 (green), Feligen vaccine strain (yellow) or uninfected (purple). Each data point shows the biological replicates of each group with 95% confidence ellipses.\u003c/p\u003e","description":"","filename":"Supplementaryfigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-5965961/v1/b332899b3784365195ed9459.png"},{"id":75890146,"identity":"a80fc330-ec4a-4762-b8d4-0dfdb55ae10e","added_by":"auto","created_at":"2025-02-10 09:40:56","extension":"png","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":162242,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary figure 2\u003c/strong\u003e. Volcano plot of FHV-1 genes in CRFK cells infected with Feligen vaccine strain compared to the 384/75 field strain. The log\u003csub\u003e2\u003c/sub\u003e fold-change (log\u003csub\u003e2\u003c/sub\u003eFC) of FHV-1 gene expression is shown with the statistical significance (–log\u003csub\u003e10 \u003c/sub\u003e(adjusted P-value)) indicated by the dotted line at P= –0.05 (or –log\u003csub\u003e10\u003c/sub\u003eP = 1.30). The differentially expressed gene UL32 is labelled.\u003c/p\u003e","description":"","filename":"Supplementaryfigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-5965961/v1/fef71e4d80dd7450d4f1e8be.png"}],"financialInterests":"No competing interests reported.","formattedTitle":"Transcriptomic profiles of Crandell-Rees feline kidney cells infected with Varicellovirus felidalpha-1 (FHV-1) field and vaccine strains","fulltext":[{"header":"Background","content":"\u003cp\u003eFeline viral rhinotracheitis (FVR) is a highly infectious upper respiratory tract disease (URTD) in cats caused by \u003cem\u003eVaricellovirus felidalpha-1\u003c/em\u003e (FHV-1, previously \u003cem\u003eFelid alphaherpesvirus-1\u003c/em\u003e). Primary FHV-1 replication occurs in the mucosae of the eyes and upper respiratory tract, which results in clinical signs such as rhinitis, conjunctivitis, and ocular ulcerations. In severe infections, FHV-1 can cause blindness (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e), pneumonia (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e) and nonsuppurative meningoencephalitis (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). The presence of other viruses such a \u003cem\u003eFeline calicivirus\u003c/em\u003e (FCV) can change FHV-1 infection outcomes, resulting in severe infections that can lead to euthanasia (\u003cspan additionalcitationids=\"CR5 CR6\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e). Host factors such as age, immune status and vaccination history can influence the host response to FHV-1 and disease outcome. Characterising the transcriptomic response during FHV-1 infection allows investigation of host and viral factors contributing to viral pathogenesis.\u003c/p\u003e \u003cp\u003eHerpesviruses are enveloped DNA viruses that are classified into three subfamilies, \u003cem\u003eAlphaherpesvirinae, Betaherpesvirinae\u003c/em\u003e and \u003cem\u003eGammaherpesvirinae\u003c/em\u003e. \u003cem\u003eVaricellovirus felidalpha-1\u003c/em\u003e (FHV-1) is a member of the \u003cem\u003eAlphaherpesvirinae\u003c/em\u003e subfamily and the \u003cem\u003eVaricellovirus\u003c/em\u003e genus (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). The FHV-1 genome is 134 kbp, which encodes 78 open reading frames (ORFs) and 74 proteins (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). Alphaherpesviruses can establish latent infections in the trigeminal ganglion, which can occur after primary FHV-1 infection (\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e). Cats do not present clinical signs or shed the virus during latency. Viral reactivation can occur spontaneously, and lead to viral shedding, with or without clinical signs (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eCurrent FHV-1 vaccines are modified live-attenuated or inactivated forms of the F2 strain. These vaccines can minimise the severity of clinical signs but do not prevent infection or the establishment of latent infections (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e). Vaccinated domestic cat populations show effective protection against FHV-1 clinical signs. However, the impairment of the immune response by FHV-1 can increase the susceptibility to secondary infections and severe diseases (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). Investigating the host and viral gene expressions during FHV-1 infections using strains that differ in virulence could shed light on variations in disease outcomes and inform future vaccine studies. This study investigates the transcriptomes of Crandell-Rees feline kidney (CRFK) cells infected with FHV-1 field or vaccine strains using an \u003cem\u003ein vitro\u003c/em\u003e model to better understand host responses to FHV-1.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003eVirus selection and cell culture\u003c/h2\u003e\n \u003cp\u003eArchived FHV-1 isolates of the F2 vaccine strain Feligen (Virbac New Zealand Ltd) and field strains that had been collected from cats with URTD were selected based on clinical signs and disease severity (Table \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e) (Vaz et al., 2016). These isolates had 99.3% genetic identity using MAFFT whole genome alignment (\u003cspan class=\"CitationRef\"\u003e13\u003c/span\u003e). Monolayers of CRFK cells (\u003cspan class=\"CitationRef\"\u003e14\u003c/span\u003e) were grown at 37\u0026deg;C in a humidified atmosphere of 5% v/v CO\u003csub\u003e2\u003c/sub\u003e in growth media containing Dulbecco\u0026rsquo;s Modified Eagle basal media (DMEM, Sigma), 5% v/v foetal bovine serum (FBS, Sigma), 10 mM N-2-hydroxyethylpiperazine-N\u0026rsquo;-2- ethanesulfonic acid (HEPES) (pH 7.7) and antimicrobials (50 mg/mL ampicillin, 5 mg/mL amphotericin B).\u003c/p\u003e\n\u003c/div\u003e\n\u003ch3\u003eViral growth kinetics\u003c/h3\u003e\n\u003cp\u003eOne-step growth kinetics of each strain were determined in triplicate 6-well plates of CRFK cells. Uninfected cell monolayers at approximately 75% confluency were separately inoculated with each strain at a multiplicity of infection (M.O.I.) of 5 TCID\u003csub\u003e50\u003c/sub\u003e per cell. Uninfected control monolayers were mock inoculated with growth media only. After 1 hour of incubation at 37\u0026deg;C, the cell monolayers were washed twice with phosphate-buffered saline solution (PBS, pH 7.4, 137 mM NaCl, 8.2 mM Na\u003csub\u003e2\u003c/sub\u003eHPO\u003csub\u003e4\u003c/sub\u003e, 2.7 mM KCl) to remove the residual inoculum. Maintenance media containing DMEM with 1% v/v FBS, 10 mM HEPES pH 7.7 buffer solution and antimicrobials (50 mg/mL ampicillin, 5 mg/mL amphotericin B) were then added to each well. Samples were collected at six timepoints; 1-, 3-, 9-, 12-, 18- and 24-hours post-infection (h.p.i.) by freezing the plates at \u0026minus;\u0026thinsp;80\u0026deg;C. The material in each well was stored in 1 mL aliquots and used to determine the viral titres in CRFK cells by TCID\u003csub\u003e50\u003c/sub\u003e titration assays (\u003cspan class=\"CitationRef\"\u003e17\u003c/span\u003e). Statistical analysis of viral titres between FHV-1 strains at each time point was performed using Student\u0026rsquo;s t-test, with P-values\u0026thinsp;\u0026lt;\u0026thinsp;0.05 considered significant.\u003c/p\u003e\n\u003ch3\u003eSample preparation for RNA sequencing\u003c/h3\u003e\n\u003cp\u003eInoculations of the Feligen vaccine strain and field strain 384/75 at an M.O.I. of 5 TCID\u003csub\u003e50\u003c/sub\u003e per cell were performed in 6-well plates of CRFK cells in triplicate and harvested at 6 h.p.i. for RNA isolation and sequencing. The supernatant was collected from the cell monolayers and stored in 1 mL aliquots at -80\u0026deg;C. These samples were used to quantify viral titres by TCID\u003csub\u003e50\u003c/sub\u003e titration assays (\u003cspan class=\"CitationRef\"\u003e17\u003c/span\u003e). The cell monolayers were scraped from the wells and centrifuged at 300 \u0026times; \u003cem\u003eg\u003c/em\u003e for 5 minutes to remove the remaining supernatant. The pelleted material was resuspended in RLT Plus buffer (RNeasy Mini Kit, Qiagen) with 1% v/v b-mercaptoethanol and stored at \u0026minus;\u0026thinsp;80\u0026deg;C. The total RNA was extracted using the RNeasy Plus mini kit (Qiagen), according to the manufacturer\u0026rsquo;s instructions. The quality of RNA in each sample was quantified using the Agilent 4200 Tapestation system (Agilent Technologies, Santa Clara, CA). All samples showed RNA integrity numbers (RIN)\u0026thinsp;\u0026gt;\u0026thinsp;8 and were used for Illumina RNA-sequencing.\u003c/p\u003e\n\u003ch3\u003eIllumina RNA sequencing\u003c/h3\u003e\n\u003cp\u003eLibraries of cDNA were constructed and sequenced at the Australian Genome Research Facility (AGRF, Melbourne). Briefly, the TruSeq stranded mRNA library preparation kit (Illumina Inc., San Diego) was used to construct cDNA libraries. Samples with the correct fragment size (~\u0026thinsp;260 bp) were normalised to a sequencing depth of 20\u0026nbsp;million reads on the NextSeq 500 sequencing platform (Illumina Inc, San Diego) to produce libraries of 150 bp paired-end reads.\u003c/p\u003e\n\u003ch3\u003eQuality control and processing of RNA-seq reads\u003c/h3\u003e\n\u003cp\u003eRaw sequence reads were uploaded to the Galaxy web platform and analysed on the public server \u003cem\u003eusegalaxy.org\u003c/em\u003e to assess the read quality using FastQC version 0.11.8 (\u003cspan class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e19\u003c/span\u003e). Adapter sequences and low-quality reads were trimmed using CutAdapt (\u003cspan class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e21\u003c/span\u003e). The high-quality reads were mapped to the annotated domestic cat genome 126 version 1 (\u003cspan class=\"CitationRef\"\u003e22\u003c/span\u003e) (general feature format and FASTA format), obtained from the NCBI database (Genbank accession no. GCF_018350175.1), to determine host transcription. The total reads from each library were also mapped to the FHV-1 field strain 384/75 genome (\u003cspan class=\"CitationRef\"\u003e15\u003c/span\u003e) (Genbank Accession No. KR381782) to compare viral transcripts between field and vaccine strains. Both host and viral read mapping was performed using RNAstar (\u003cspan class=\"CitationRef\"\u003e23\u003c/span\u003e).\u003c/p\u003e\n\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\n \u003ch2\u003eDifferential gene expression analysis\u003c/h2\u003e\n \u003cp\u003eThe host and viral counts per gene were normalised and converted to log\u003csub\u003e2\u003c/sub\u003e counts per million (CPM) on the interactive RNA-seq analysis platform Degust using Voom/Limma version 4.2 (\u003cspan class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan class=\"CitationRef\"\u003e26\u003c/span\u003e). Significant changes to gene expression were filtered in the RStudio environment version 2023.06.1\u0026thinsp;+\u0026thinsp;524 using the log\u003csub\u003e2\u003c/sub\u003e fold changes (LFC) that met the following conditions: (i) genes must have greater than 10 CPM reads in at least one treatment group, (ii) the LFC must be greater than 2 (or less than \u0026minus;\u0026thinsp;2), and (iii) the false discovery rate (FDR) of genes must be \u0026lt;\u0026thinsp;0.05. Analyses of viral gene expression were performed on Geneious Prime 2023.0.1\u003c/p\u003e\n\u003c/div\u003e\n\u003ch3\u003eCategorisation of host genes with gene ontology\u003c/h3\u003e\n\u003cp\u003eDifferential host gene expression was further analysed on the online PANTHER database version 17.0 to identify enriched gene ontology (GO) terms that were retrieved from the Uniprot database (\u003cspan class=\"CitationRef\"\u003e27\u003c/span\u003e). The protein-encoding genes of the cat were extracted, indexed and linked to the differentially expressed host genes to analyse pathway regulation by biological function (\u003cspan class=\"CitationRef\"\u003e28\u003c/span\u003e). Statistical enrichment analysis on the differentially expressed genes was categorised by molecular function, cellular component, and biological processes with P-values\u0026thinsp;\u0026lt;\u0026thinsp;0.05 considered significant (\u003cspan class=\"CitationRef\"\u003e29\u003c/span\u003e).\u003c/p\u003e\n\u003ch3\u003eSample preparation for UL32 RT-qPCR\u003c/h3\u003e\n\u003cp\u003eTo further investigate FHV-1 UL32 expression, CRFK cells were infected and harvested as described for viral growth kinetics. At each timepoint, the cell monolayers were scraped from the wells and centrifuged at 300 \u0026times; \u003cem\u003eg\u003c/em\u003e for 5 minutes to separate and remove the supernatant. The pelleted material was resuspended in RLT buffer with 1% v/v \u0026beta;-mercaptoethanol and stored in 1 mL aliquots at \u0026minus;\u0026thinsp;80\u0026deg;C. The total RNA was extracted using the RNeasy Plus mini kit and converted into cDNA using the SuperScript III reverse transcriptase kit (Invitrogen), following the manufacturer\u0026rsquo;s instructions. The cDNA of each triplicate across the six timepoints was stored at \u0026minus;\u0026thinsp;80\u0026deg;C and quantified using RT-qPCR.\u003c/p\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003ePreparation of standards for UL32 RT-qPCR\u003c/h2\u003e\n \u003cp\u003eField strain 384/75 was used to generate standard curves for UL32 RT-qPCR transcription analysis. The total RNA was extracted using the RNeasy Plus mini kit and converted into cDNA using the Superscript III reverse transcriptase, according to the manufacturer\u0026rsquo;s instructions. The concentration of cDNA was determined using the Qubit RNA Broad Range Assay kit (Invitrogen) and serially diluted 10-fold from 10\u003csup\u003e8\u003c/sup\u003e to 10\u003csup\u003e2\u003c/sup\u003e copies per \u0026micro;L in triplicate with nuclease-free water.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003eFHV-1 RT-qPCR\u003c/h2\u003e\n \u003cp\u003ePrimer sets for UL32 and UL33 genes were designed to produce 150 bp products. Each 20 \u0026micro;L reaction was performed in the AriaMx Real-Time PCR system (Agilent Technologies) and contained 0.17 mM of either UL32 or UL33 primers (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e), 0.2 mM of each dNTP, 2 mM MgCl\u003csub\u003e2\u003c/sub\u003e, GoTaq colourless buffer (Promega), 8 mM Syto 9 (Life technologies), 1 U GoTaq Flexi DNA polymerase (Promega) and 3 \u0026micro;L of cDNA template. Negative control reactions containing DNA-free water instead of cDNA template were included in triplicate. Initial denaturation was performed at 95\u0026deg;C for 3 minutes, followed by 35 cycles of denaturation at 95\u0026deg;C for 30 seconds, annealing at 58\u0026deg;C for 30 seconds and extension at 72\u0026deg;C for 20 seconds. A melt curve was produced by heating the amplified product from 72 to 95\u0026deg;C, increasing by 0.2\u0026deg;C every second, to confirm the correct product was amplified. The genome copies in each sample were determined using the AriaMx Real-Time PCR software and the UL32 transcription was normalised to the neighbouring upstream gene UL33 at each timepoint for field and vaccine strains. The UL33 gene is conserved amongst alphaherpesviruses and transcribes independently to UL32. The relative UL32 expression in the vaccine infection group at each timepoint was compared to the field infection, using Student\u0026rsquo;s t-test with P-values\u0026thinsp;\u0026lt;\u0026thinsp;0.05 considered significant.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\n \u003ch2\u003eGrowth kinetics of FHV-1 field and vaccine strains\u003c/h2\u003e\n \u003cp\u003eThe growth curves of the different FHV-1 strains were similar over 24 hours (Fig. 1). Cytopathic effects (CPE) were observed in cells infected with FHV-1 from 6 h.p.i. Statistical analysis of viral titres between FHV-1 isolates showed significantly higher titres of field strain 356/75b compared to the vaccine strain at 1 and 18 h.p.i. (P\u0026thinsp;=\u0026thinsp;0.04 and P\u0026thinsp;=\u0026thinsp;0.02, respectively) and significantly higher titres than field isolates 571/79 (P\u0026thinsp;=\u0026thinsp;0.02) and 384/75 (P\u0026thinsp;=\u0026thinsp;0.02) at 3 and 24 h.p.i, respectively. Field isolate 384/75 showed significantly lower viral titres than isolate 356/75b at 12 h.p.i. (P\u0026thinsp;=\u0026thinsp;0.03). No CPE was observed in the uninfected cells at any time point.\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eHost and viral RNA are distinguishable in FHV-1 infections\u003c/em\u003e in vitro\u003c/p\u003e\n \u003cp\u003eHigh-quality reads across the infection groups mapped to the domestic cat genome. In samples infected with FHV-1 field or vaccine strains, the total reads also mapped to the genome of the field strain 384/75 (Fig.\u0026nbsp;2). The principal component analysis (PCA) plot generated using the log\u003csub\u003e2\u003c/sub\u003e CPM values of the total reads mapped to the cat genome showed minimal variation between the triplicates of FHV-1 infection groups and a distinct difference between the infection groups and uninfected samples (Supplementary Fig.\u0026nbsp;1). The data from this study has been deposited to the NCBI BioProject database under BioProject accession number PRJNA1082348.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n \u003ch2\u003eField and vaccine strains show minimal differences in viral gene transcription\u003c/h2\u003e\n \u003cp\u003eViral reads in the FHV-1 infection groups mapped to the complete FHV-1 genome consisting of 73 viral genes. The transcript per million (TPM) of each FHV-1 gene is shown in Fig.\u0026nbsp;3. Differential viral gene expression analysis of the vaccine strain compared to the field strain showed a significant difference in UL32 gene transcription with an LFC of 2.16 (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Supplementary Fig.\u0026nbsp;2).\u003c/p\u003e\n \u003cp\u003eFurther examination of UL32 transcription using RT-qPCR did not show significant differences in relative UL32 expression, compared to UL33, across timepoints between field and vaccine strains. The average copy numbers of UL32 and UL33 transcripts in samples infected with field or vaccine strains are shown in Fig.\u0026nbsp;4.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n \u003ch2\u003eField and vaccine FHV-1 strains induce changes to host cellular gene expression\u003c/h2\u003e\n \u003cp\u003eThe total host reads in the field and vaccine infection group compared to the uninfected samples showed differentially expressed host genes (Fig.\u0026nbsp;5). Cells infected with the field strain 384/75 showed a total of 1,024 differentially expressed genes compared to uninfected cells, of which 837 were upregulated and 187 were downregulated. In cells infected with the vaccine strain, 2,823 genes were differentially expressed. Of these 2,500 genes were upregulated and 323 genes were downregulated.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\n \u003ch2\u003eDifferentially expressed host genes between field and vaccine strains\u003c/h2\u003e\n \u003cp\u003eA comparison of the differentially expressed host genes in the field and vaccine infection groups showed 795 genes that were identified in both infection groups (Fig.\u0026nbsp;6). Of these, 682 were upregulated and 113 were downregulated. The remaining genes differentially expressed in each infection group showed the vaccine infection group with ten times more differentially expressed genes than the field infection group. The top 10 commonly up- and downregulated genes showed greater changes in host gene expression in the vaccine infection group than in the field infection group, compared to uninfected cells (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e). Genes encoding histone proteins dominated the top 10 upregulated gene, accounting for eight upregulated genes in both infection groups. The top 10 downregulated genes common to both infection strains dysregulated cell surface and pattern recognition receptors, as well as genes regulating cell adhesion, migration and division processes associated with immune responses.\u003c/p\u003e\n \u003cp\u003eHost gene expressions can differ between field and vaccine FHV-1 strains\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\n \u003cp\u003eThe top 10 up- and downregulated genes unique to each infection group showed similar changes in LFC expression levels (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). The LFC values of these genes were generally lower than the genes common between the infection groups described in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e. The highest upregulated genes uniquely differentially expressed in the field infection group were associated with tRNA species and regulatory proteins involved in the cell cycle. The characterised downregulated genes were involved in the expression of transmembrane proteins, binding proteins, and regulators of the immune response. The greatest upregulated genes uniquely differentially expressed in samples infected with the vaccine strain were small non-coding RNA. The most downregulated genes were associated with kinase expression, transmembrane cell signalling protein, cellular metabolism, and inflammatory responses.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\n \u003ch2\u003eField and vaccine FHV-1 strains enriched genes with different host functions\u003c/h2\u003e\n \u003cp\u003eThe significant differentially expressed host genes in the FHV-1 infection groups were linked to GO terms that categorise the differentially expressed genes based on their roles in cellular components, molecular functions, and biological processes. The enriched GO terms in field and vaccine infection groups showed differences within each functional group category and more enriched GO terms in cells infected with the field strain compared to the vaccine strain (Fig.\u0026nbsp;7). Infections using the vaccine strain may induce more host gene and pathway changes than the field strain but fewer enriched host pathways. Independent enrichment analysis of the upregulated and downregulated genes in samples with FHV-1 infections did not show significantly enriched GO terms across most functional categories. The upregulated genes in samples infected with the field strain were an exception, with 27 genes overrepresented in the DNA binding molecular function.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\n \u003ch2\u003eField and vaccine FHV-1 strains regulated different host pathways\u003c/h2\u003e\n \u003cp\u003eThe differentially expressed host genes in samples infected with the vaccine strain regulated more host proteins and pathways than cells infected with the field strain. Infections with the vaccine strain contributed to 224 protein-encoding genes which regulated 76 pathways, compared to 93 genes in the field strain regulating 48 pathways. In samples infected with the vaccine strain, the expression of 34 unique protein-encoding genes contributed to 24 dysregulated pathways (Fig.\u0026nbsp;8).\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn this study, infections of CRFK cells with field and vaccine FHV-1 strains induced significant changes to host gene expression when compared to uninfected cells. Histone genes were strongly represented in the top 10 upregulated genes while genes associated with cell adhesion and immune activation were downregulated in CRFK cells infected with field or vaccine strains. Between the two infection strains, host genes associated with immunoregulation differed in expression. Infections using the field strain induced fewer differentially expressed host genes compared to the vaccine strain, which resulted in less host proteins and pathways differentially regulated. However, pathway enrichment analysis showed more enriched host pathways during infections using the field strain than the vaccine strain. These findings compare the gene expression patterns during infections using field or vaccine strains, demonstrating the different host responses to FHV-1 associated with viral strain virulence.\u003c/p\u003e \u003cp\u003eObservable CPE induced by FHV-1 strains in CRFK cells demonstrated viral replication, which indicated the presence of viral and cellular mRNA in the infected cell cultures. These epithelial cells are highly susceptible to FHV-1 infections and do not contain immune cells. This allowed this study to characterise the host and viral transcription profiles during FHV-1 infections in a homogenous population of cells from the natural host. Genes encoding histones and proteins associated with adaptive immune activation showed similar expression patterns between field and vaccine strains, consistent with previous \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e FHV-1 studies using RT-qPCR (\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e). The consistencies between this \u003cem\u003ein vitro\u003c/em\u003e study and past \u003cem\u003ein vivo\u003c/em\u003e studies suggests the findings from this study are relevant to the host response in cats with FHV-1.\u003c/p\u003e \u003cp\u003eHistone genes were upregulated during FHV-1 infections, compared to uninfected cells, which is consistent with previous studies using herpes simplex virus type 1 (HSV-1) (\u003cspan additionalcitationids=\"CR33\" citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e). Histones are structural proteins that package DNA within the cell nucleus and form the nucleoprotein complex, chromatin. The upregulation of histone genes in this study highlights the interactions between histones and the viral genome, which are well-characterised in alphaherpesviruses (\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e). Upon viral entry into the nucleus, herpesvirus DNA binds to histones to induce modifications to the structure of host chromatin and trigger the expression of precursor histones. Host repair factors and DNA damage responses are associated with chromatin modifications, suggesting host DNA repair pathways may be activated during herpesvirus infection (\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eCell surface receptors and growth factors associated with innate immune activity were downregulated during FHV-1 infections compared to uninfected cells. This finding is consistent with previous HSV-1 transcription studies in epithelial cells which observed changes in host pathways regulating cell adhesion and migration, and immune activation (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e). Cell surface and pattern recognition receptors have roles regulating cell adhesion and migration, including the recruitment of leukocytes, such as macrophages and T-cells (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e). Additionally, cellular growth factors involved in cell injury responses can influence cell differentiation and division processes that contribute to inflammation and repair. Previous \u003cem\u003ein vitro\u003c/em\u003e studies have demonstrated FHV-1 can downregulate the surface expression of major histocompatibility complex (MHC) class II proteins, which suggests FHV-1 influences immunoregulation (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e). While MHC class I proteins can activate cytotoxic T-cells to directly kill infected cells, MHC class II proteins can induce T-helper cells to activate antiviral immune responses (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e). The downregulation of MHC class II proteins alongside genes which regulate cell surface receptors and growth factors is consistent with FHV-1 altering the differentiation and recruitment of immune cells during infection, potentially contributing to suppressed host responses.\u003c/p\u003e \u003cp\u003eComparative analysis between field and vaccine strains showed distinct host pathways regulations associated with cell migration, T-cell activation and innate immunity during infections using the vaccine strain. While the vaccine strain induced more host gene changes, the field strain affected a broader range of host pathways. The similarities and differences in host gene and pathway expression associated with immune cell regulation, between field and vaccine strains, suggests the magnitude of gene expression changes may influence the host response. The vaccine strain may induce more targeted changes in specific host pathways to activate a more targeted immune response. However, the field strain could influence more host functions, resulting in a broader impact on immune responses. These findings demonstrate how different host responses between viral strain virulence and genetics may contribute to altered disease outcomes.\u003c/p\u003e \u003cp\u003eViral transcripts of the late gene UL32 in the field and vaccine FHV-1 strains showed conflicting results between RNA-sequencing and RT-qPCR analysis. While RNA-sequencing identified potential differences in UL32 transcription, this was not confirmed by RT-qPCR. Transcriptomic analysis using RT-qPCR allows high specificity and sensitivity when analysing gene transcripts of low target numbers (\u003cspan additionalcitationids=\"CR43\" citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e). This suggests the absence of differences in FHV-1 gene transcription between field and vaccine strains in this study indicates that factors beyond viral gene transcription may contribute to differences in viral virulence between field and vaccine strains. Viral growth kinetics between FHV-1 field and vaccine strains were similar and previous studies analysing the genome sequences of clinical and vaccine FHV-1 isolates observed 99% homogeneity and no changes in virulence factors (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e). The viral gene UL32 is conserved amongst herpesviruses and is required for the cleavage and packaging of viral DNA. Previous transcriptomic studies of HSV-1 have shown differences in viral gene expression and protein levels between strains in epithelial and neuronal cells (\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e). These findings suggest future studies that explores viral gene expression at various timepoint across the viral replication cycle or in other cell types could shed light on differences between FHV-1 strains that could contribute to phenotypes of FHV-1 infections.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eThe findings in this study demonstrated the host and viral transcriptomic profiles of FHV-1 infections \u003cem\u003ein vitro\u003c/em\u003e. Host gene expression of CRFK cells infected with field and vaccine strains showed many consistencies to previous transcriptomic analyses of herpesviruses and FHV-1 infections \u003cem\u003ein vivo\u003c/em\u003e. The differential expression of histones and inflammatory genes identified in this study may contribute to immune responses and pathogenesis involved in FHV-1 infections. Future transcriptomic studies in other systems, such as respiratory tissue explant systems or \u003cem\u003ein vivo\u003c/em\u003e infections, will be needed to provide a comprehensive understanding of host responses to FHV-1 and enhance our understanding of herpesvirus pathogenesis.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"576\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.4645%;\"\u003e\n \u003cp\u003eAGRF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 83.5355%;\"\u003e\n \u003cp\u003eAustralian Genome Research Facility\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.4645%;\"\u003e\n \u003cp\u003eCPE\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 83.5355%;\"\u003e\n \u003cp\u003eCytopathic effects\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.4645%;\"\u003e\n \u003cp\u003eCPM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 83.5355%;\"\u003e\n \u003cp\u003eCounts per million\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.4645%;\"\u003e\n \u003cp\u003eCRFK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 83.5355%;\"\u003e\n \u003cp\u003eCrandell- Rees feline kidney\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.4645%;\"\u003e\n \u003cp\u003eDMEM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 83.5355%;\"\u003e\n \u003cp\u003eDulbecco\u0026rsquo;s Modified Eagle basal media\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.4645%;\"\u003e\n \u003cp\u003eFBS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 83.5355%;\"\u003e\n \u003cp\u003eFoetal bovine serum\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.4645%;\"\u003e\n \u003cp\u003eFCV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 83.5355%;\"\u003e\n \u003cp\u003eFeline calicivirus\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.4645%;\"\u003e\n \u003cp\u003eFDR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 83.5355%;\"\u003e\n \u003cp\u003eFalse discovery rate\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.4645%;\"\u003e\n \u003cp\u003eFHV-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 83.5355%;\"\u003e\n \u003cp\u003e\u003cem\u003eVarivellovirus felidalpha-1\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.4645%;\"\u003e\n \u003cp\u003eFVR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 83.5355%;\"\u003e\n \u003cp\u003eFeline viral rhinotracheitis\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.4645%;\"\u003e\n \u003cp\u003eGO\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 83.5355%;\"\u003e\n \u003cp\u003eGene ontology\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.4645%;\"\u003e\n \u003cp\u003eHEPES\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 83.5355%;\"\u003e\n \u003cp\u003eN-2-hydroxyethylpiperazine-N\u0026rsquo;-2- ethanesulfonic acid\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.4645%;\"\u003e\n \u003cp\u003eHSV-1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 83.5355%;\"\u003e\n \u003cp\u003eHerpes simplex virus type 1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.4645%;\"\u003e\n \u003cp\u003eh.p.i.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 83.5355%;\"\u003e\n \u003cp\u003eHours post-infection\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.4645%;\"\u003e\n \u003cp\u003eLFC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 83.5355%;\"\u003e\n \u003cp\u003eLog\u003csub\u003e2\u003c/sub\u003e fold change\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.4645%;\"\u003e\n \u003cp\u003eMHC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 83.5355%;\"\u003e\n \u003cp\u003eMajor histocompatibility complex\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.4645%;\"\u003e\n \u003cp\u003eM.O.I.\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 83.5355%;\"\u003e\n \u003cp\u003eMultiplicity of infection\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.4645%;\"\u003e\n \u003cp\u003eN/A\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 83.5355%;\"\u003e\n \u003cp\u003eNot applicable\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.4645%;\"\u003e\n \u003cp\u003eORFs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 83.5355%;\"\u003e\n \u003cp\u003eOpen reading frames\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.4645%;\"\u003e\n \u003cp\u003ePBS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 83.5355%;\"\u003e\n \u003cp\u003ePhosphate-buffered saline solution\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.4645%;\"\u003e\n \u003cp\u003ePCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 83.5355%;\"\u003e\n \u003cp\u003ePrincipal component analysis\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.4645%;\"\u003e\n \u003cp\u003eRIN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 83.5355%;\"\u003e\n \u003cp\u003eRNA integrity numbers\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.4645%;\"\u003e\n \u003cp\u003eTCID\u003csub\u003e50\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 83.5355%;\"\u003e\n \u003cp\u003eMedian tissue culture infective dose\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.4645%;\"\u003e\n \u003cp\u003eTPM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 83.5355%;\"\u003e\n \u003cp\u003eTranscripts per million\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 16.4645%;\"\u003e\n \u003cp\u003eURTD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 83.5355%;\"\u003e\n \u003cp\u003eUpper respiratory tract disease\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cem\u003e\u003cu\u003eEthics approval \u003c/u\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cu\u003eAvailability of data and materials \u003c/u\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets generated during the current study are available in the GenBank repository BioProject\u0026nbsp;accession number\u0026nbsp;PRJNA1082348\u003c/p\u003e\n\u003cp\u003ehttps://www.ncbi.nlm.nih.gov/bioproject/PRJNA1082348/\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cu\u003eCompeting interests\u003c/u\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare the research was conducted in the absence of any commercial or financial relationships that could be considered as potential conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cu\u003eFunding\u003c/u\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eNo funding.\u003c/p\u003e\n\u003cp\u003e\u003cu\u003eAuthors contributions\u003c/u\u003e\u003c/p\u003e\n\u003cp\u003eEK performed the experiments, bioinformatics and analysed the transcriptomic data in this study. ARL, CAH and JMD designed the project and offered laboratory advice. ARL provided the cells used in this study. All authors contributed to the editing and approved the final manuscripts.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e\u003cu\u003eAcknowledgments \u003c/u\u003e\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe authors would like to acknowledge Paola Vaz for providing the FHV-1 isolates for this study and the Asia-Pacific Centre for Animal Health research group for supporting this project.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eGould D. Feline herpesvirus-1: ocular manifestations, diagnosis and treatment options. J Feline Med Surg. 2011;13(5):333\u0026ndash;46.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMonne Rodriguez JM, Leeming G, Kohler K, Kipar A. Feline Herpesvirus Pneumonia: Investigations Into the Pathogenesis. Vet Pathol. 2017;54(6):922\u0026ndash;32.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHora AS, Tonietti PO, Guerra JM, Leme MC, Pena HF, Maiorka PC, et al. Felid herpesvirus 1 as a causative agent of severe nonsuppurative meningoencephalitis in a domestic cat. J Clin Microbiol. 2013;51(2):676\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFernandez M, Manzanilla EG, Lloret A, Le\u0026oacute;n M, Thibault JC. Prevalence of feline herpesvirus-1, feline calicivirus, Chlamydophila felis and Mycoplasma felis DNA and associated risk factors in cats in Spain with upper respiratory tract disease, conjunctivitis and/or gingivostomatitis. J Feline Med Surg. 2017;19(4):461\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThiry E, Addie D, Belak S, Boucraut-Baralon C, Egberink H, Frymus T, et al. Feline herpesvirus infection. ABCD guidelines on prevention and management. J Feline Med Surg. 2009;11(7):547\u0026ndash;55.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMonne Rodriguez J, Kohler K, Kipar A. Calicivirus co-infections in herpesvirus pneumonia in kittens. Vet J. 2018;236:1\u0026ndash;3.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNajafi H, Madadgar O, Jamshidi S, Ghalyanchi Langeroudi A, Darzi Lemraski M. Molecular and clinical study on prevalence of feline herpesvirus type 1 and calicivirus in correlation with feline leukemia and immunodeficiency viruses. Veterinary Res Forum. 2014;5(4):255\u0026ndash;61.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGatherer D, Depledge DP, Hartley CA, Szpara ML, Vaz PK, Benkő M et al. ICTV Virus Taxonomy Profile: Herpesviridae 2021. J Gen Virol. 2021;102(10).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRota PA, Maes RK, Ruyechan WT. Physical characterization of the genome of feline herpesvirus-1. Virology. 1986;154(1):168\u0026ndash;79.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaes R. Felid herpesvirus type 1 infection in cats: a natural host model for alphaherpesvirus pathogenesis. ISRN Veterinary Sci. 2012;2012:495830.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGaskell RM, Dennis PE, Goddard LE, Cocker FM, Wills JM. Isolation of felid herpesvirus I from the trigeminal ganglia of latently infected cats. J Gen Virol. 1985;66(Pt 2):391\u0026ndash;4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRichter M, Schudel L, Tobler K, Matheis F, Vogtlin A, Vanderplasschen A, et al. Clinical, virological, and immunological parameters associated with superinfection of latently with FeHV-1 infected cats. Vet Microbiol. 2009;138(3\u0026ndash;4):205\u0026ndash;16.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKatoh K, Standley DM. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol Biol Evol. 2013;30(4):772\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCrandell RA, Fabricant CG, Nelson-Rees WA. Development, characterization, and viral susceptibility of a feline (Felis catus) renal cell line (CRFK). Vitro. 1973;9(3):176\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVaz PK, Job N, Horsington J, Ficorilli N, Studdert MJ, Hartley CA, et al. Low genetic diversity among historical and contemporary clinical isolates of felid herpesvirus 1. BMC Genomics. 2016;17:704.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBittle JL, Rubic WJ. Immunogenic and protective effects of the F-2 strain of feline viral rhinotracheitis virus. Am J Vet Res. 1975;36(1):89\u0026ndash;91.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSmither SJ, Lear-Rooney C, Biggins J, Pettitt J, Lever MS, Olinger GG. Jr. Comparison of the plaque assay and 50% tissue culture infectious dose assay as methods for measuring filovirus infectivity. J Virol Methods. 2013;193(2):565\u0026ndash;71.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAfgan E, Baker D, van den Beek M, Blankenberg D, Bouvier D, Čech M, et al. The Galaxy platform for accessible, reproducible and collaborative biomedical analyses: 2016 update. Nucleic Acids Res. 2016;44(W1):W3\u0026ndash;10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBlankenberg D, Von Kuster G, Bouvier E, Baker D, Afgan E, Stoler N, et al. Dissemination of scientific software with Galaxy ToolShed. Genome Biol. 2014;15(2):403.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJalili V, Afgan E, Gu Q, Clements D, Blankenberg D, Goecks J, et al. The Galaxy platform for accessible, reproducible and collaborative biomedical analyses: 2020 update. Nucleic Acids Res. 2020;48(W1):W395\u0026ndash;402.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartin M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnetjournal. 2011;17(1):10.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLopez JV, Cevario S, O'Brien SJ. Complete nucleotide sequences of the domestic cat (Felis catus) mitochondrial genome and a transposed mtDNA tandem repeat (Numt) in the nuclear genome. Genomics. 1996;33(2):229\u0026ndash;46.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWidmann J, Stombaugh J, McDonald D, Chocholousova J, Gardner P, Iyer MK, et al. RNASTAR: an RNA STructural Alignment Repository that provides insight into the evolution of natural and artificial RNAs. RNA J. 2012;18(7):1319\u0026ndash;27.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePowell D. drpowell/degust 4.1.1 (4.1.1). Zenodo. 2019 [Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.5281/zenodo.3501067\u003c/span\u003e\u003cspan address=\"10.5281/zenodo.3501067\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRitchie ME, Phipson B, Wu D, Hu Y, Law CW, Shi W, et al. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015;43(7):47.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLaw CW, Chen Y, Shi W, Smyth GK. voom: precision weights unlock linear model analysis tools for RNA-seq read counts. Genome Biol. 2014;15(2):R29.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThomas PD, Ebert D, Muruganujan A, Mushayahama T, Albou L-P, Mi H. PANTHER: Making genome-scale phylogenetics accessible to all. Protein Sci. 2022;31(1):8\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMi H, Thomas P. PANTHER pathway: an ontology-based pathway database coupled with data analysis tools. Methods Mol Biology. 2009;563:123\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMi H, Muruganujan A, Huang X, Ebert D, Mills C, Guo X, et al. Protocol Update for large-scale genome and gene function analysis with the PANTHER classification system (v.14.0). Nat Protoc. 2019;14(3):703\u0026ndash;21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJohnson LR, Maggs DJ. Feline herpesvirus type-1 transcription is associated with increased nasal cytokine gene transcription in cats. Vet Microbiol. 2005;108(3\u0026ndash;4):225\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnsari MA, Dutta S, Veettil MV, Dutta D, Iqbal J, Kumar B, et al. Herpesvirus Genome Recognition Induced Acetylation of Nuclear IFI16 Is Essential for Its Cytoplasmic Translocation, Inflammasome and IFN-β Responses. PLoS Pathog. 2015;11(7):1005019.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao C, Chen L, Tang SB, Long QY, He JL, Zhang NA, et al. The epigenetic landscapes of histone modifications on HSV-1 genome in human THP-1 cells. Antiviral Res. 2020;176:104730.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eConn KL, Hendzel MJ, Schang LM. The differential mobilization of histones H3.1 and H3.3 by herpes simplex virus 1 relates histone dynamics to the assembly of viral chromatin. PLoS Pathog. 2013;9(10):1003695.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCliffe AR, Knipe DM. Herpes Simplex Virus ICP0 Promotes both Histone Removal and Acetylation on Viral DNA during Lytic Infection. J Virol. 2008;82(24):12030\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVan Opdenbosch N, Favoreel H, Van de Walle GR. Histone modifications in herpesvirus infections. Biol Cell. 2012;104(3):139\u0026ndash;64.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWilkinson DE, Weller SK. Recruitment of cellular recombination and repair proteins to sites of herpes simplex virus type 1 DNA replication is dependent on the composition of viral proteins within prereplicative sites and correlates with the induction of the DNA damage response. J Virol. 2004;78(9):4783\u0026ndash;96.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMangold CA, Rathbun MM, Renner DW, Kuny CV, Szpara ML. Viral infection of human neurons triggers strain-specific differences in host neuronal and viral transcriptomes. PLoS Pathog. 2021;17(3):1009441.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVyas D, Patel M, Wairkar S. Strategies for active tumor targeting-an update. Eur J Pharmacol. 2022;915:174512.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang J, Wang S, Chen L, Tan J. SCARA5 suppresses the proliferation and migration, and promotes the apoptosis of human retinoblastoma cells by inhibiting the PI3K/AKT pathway. Mol Med Rep. 2021;23(3):202.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMontagnaro S, Longo M, Pacilio M, Indovina P, Roberti A, De Martino L, et al. Feline herpesvirus-1 down-regulates MHC class I expression in an homologous cell system. J Cell Biochem. 2009;106(1):179\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRosendahl Huber S, van Beek J, de Jonge J, Luytjes W, van Baarle D. T cell responses to viral infections - opportunities for Peptide vaccination. Front Immunol. 2014;5:171.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLitster A, Wu CC, Leutenegger CM. Detection of feline upper respiratory tract disease pathogens using a commercially available real-time PCR test. Vet J. 2015;206(2):149\u0026ndash;53.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang D-K, Kim H-H, Park Y-R, Yoo JY, Choi S-S, Park Y, et al. Isolation and Molecular Characterization of Feline Herpesvirus 1 from Naturally Infected Korean Cats. J Bacteriol Virol. 2020;50(4):263\u0026ndash;72.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMazzei M, Vascellari M, Zanardello C, Melchiotti E, Vannini S, Forzan M, et al. Quantitative real time polymerase chain reaction (qRT-PCR) and RNAscope in situ hybridization (RNA-ISH) as effective tools to diagnose feline herpesvirus-1-associated dermatitis. Vet Dermatol. 2019;30(6):491\u0026ndash;147.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLewin AC, Coghill LM, McLellan GJ, Bentley E, Kousoulas KG. Genomic analysis for virulence determinants in feline herpesvirus type-1 isolates. Virus Genes. 2020;56(1):49\u0026ndash;57.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\n \u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n \u003ctable id=\"Tab3\" border=\"1\"\u003e\n \u003ccaption\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eThe top 10 commonly up- and downregulated genes in both field (384/75) and vaccine (Feligen) infections in CRFK cells. The functions of characterised genes are shown alongside the gene expression levels, which are represented by log\u003csub\u003e2\u003c/sub\u003e fold change (LFC) and are shown in order of expression in field infection samples.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"12\" align=\"left\"\u003e\n \u003cp\u003eUp regulated\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" align=\"left\"\u003e\n \u003cp\u003eGene ID\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" align=\"left\"\u003e\n \u003cp\u003eGene function\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" align=\"left\"\u003e\n \u003cp\u003e384/75\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" align=\"left\"\u003e\n \u003cp\u003eVaccine\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFDR\u003csup\u003e1\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLFC\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFDR\u003csup\u003e1\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLFC\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eH4C16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHistone\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7.48\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7.16\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eH4C13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHistone\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7.48\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.92\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eH2BC3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHistone\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7.32\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7.32\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eH3C11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHistone\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7.21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7.80\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLOC123386069\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7.20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7.80\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLOC111559230\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.98\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8.68\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eH3C6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHistone\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.86\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.94\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHistone H4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHistone\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.81\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7.48\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHistone H4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHistone\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.78\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.62\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHistone H3.1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHistone\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.77\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e6.71\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"10\" align=\"left\"\u003e\n \u003cp\u003eDown regulated\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCOL8A1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCell homeostasis\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-5.87\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-5.63\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eATP6V0D2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCell adhesion\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-5.63\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-4.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eADAMDEC1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCell migration\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.03\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-5.22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-4.37\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFGF7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGrowth factor\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-5.13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-5.72\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eVCAM1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCell surface receptor\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.00\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-5.13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-6.10\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSCARA5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePattern recognition receptor\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.04\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-5.11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-5.54\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eREG4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCell homeostasis\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-5.06\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-4.73\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCB1H4orf36\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026ndash;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-4.63\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-2.20\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eMHC class II\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCell surface receptor\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-4.58\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-2.17\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTMEM100\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCell homeostasis\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-4.56\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-5.14\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"7\"\u003e\n \u003cp\u003e\u003csup\u003e\u003cem\u003e1\u003c/em\u003e\u003c/sup\u003e \u003cem\u003eThe false discovery rate (FDR) is shown\u003c/em\u003e\u003c/p\u003e\n \u003cp\u003e\u003cem\u003e\u003csup\u003e2\u0026nbsp;\u003c/sup\u003e \u003cem\u003eP-values\u0026thinsp;\u0026lt;\u0026thinsp;0.05 with LFC\u0026thinsp;\u0026gt;\u0026thinsp;2 for upregulated or \u0026lt; -2 for downregulated genes were considered significant.\u003c/em\u003e\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n \u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n \u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n \u003ctable id=\"Tab4\" border=\"1\"\u003e\n \u003ccaption\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eTop 10 up- and downregulated genes unique to FHV-1 field (384/75) and vaccine (Feligen) infections in CRFK cells. Gene expression levels are represented by log\u003csub\u003e2\u003c/sub\u003e fold change (LFC) and were compared to uninfected samples across triplicates.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"12\" align=\"left\"\u003e\n \u003cp\u003eUp regulated\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" align=\"left\"\u003e\n \u003cp\u003eGene ID\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" align=\"left\"\u003e\n \u003cp\u003e384/75\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" align=\"left\"\u003e\n \u003cp\u003eGene ID\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" align=\"left\"\u003e\n \u003cp\u003eVaccine\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFDR\u003csup\u003e1\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLFC\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFDR\u003csup\u003e1\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLFC\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLOC111560238\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.04\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4.29\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSNORD58\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5.71\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLOC109499602\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.47\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSNORA3/45\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5.52\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTRNAW-CCA_8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.04\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.44\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLOC123384631\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5.47\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTRNAF-GAA_10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.43\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSNORD14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5.45\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLOC109491671\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.42\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLOC109502106\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5.45\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLOC109500935\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.38\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLOC111561262\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5.35\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLOC101088630\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.29\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLOC111561932\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5.32\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSFN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.05\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSNORD22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5.18\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLOC111560944\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLOC123385372\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5.13\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLOC109493372\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3.19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLOC109501215\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e5.10\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"10\" align=\"left\"\u003e\n \u003cp\u003eDown regulated\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTMEM26\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-3.77\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTRIB3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-4.35\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eINHBE\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-3.49\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLOC109503125\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-4.13\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFABP7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.03\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-3.30\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLOC101096785\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-4.00\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLOC109491403\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-3.20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eXPNPEP2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.05\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-3.65\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLOC123380486\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-3.11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLOC111556196\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-3.56\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLOC111558401\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-3.10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEDNRA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-3.42\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLOC123383220\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-3.08\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eDUOX2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-3.42\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLOC109503254\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.02\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-2.99\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLOC102899057\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-3.40\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLOC123383127\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-2.98\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHLF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-3.34\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLOC109500446\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e0.03\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-2.95\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLOC101085945\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u0026lt;\u0026thinsp;0.01\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e-3.31\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"7\"\u003e\u003csup\u003e\u003cem\u003e1\u003c/em\u003e\u003c/sup\u003e \u003cem\u003eThe false discovery rate (FDR) is shown\u003c/em\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"7\"\u003e\u003csup\u003e\u003cem\u003e2\u003c/em\u003e\u003c/sup\u003e \u003cem\u003eP-values\u0026thinsp;\u0026lt;\u0026thinsp;0.05 with LFC\u0026thinsp;\u0026gt;\u0026thinsp;2 for upregulated and LFC \u0026lt; -2 for downregulated were considered significant\u003c/em\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n \u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003eFHV-1 isolates used in this study\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eVirus ID\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eYear of isolation\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eGenbank Acc. No.\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eDisease\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSite\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e384/75\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1975\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eKR381782 (\u003cspan class=\"CitationRef\"\u003e15\u003c/span\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ePneumonia\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLung\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e356/75b\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1975\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eKR381784 (\u003cspan class=\"CitationRef\"\u003e15\u003c/span\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eURTD\u003csup\u003e1\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eN/A\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFeligen\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1975\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eKR296657 (\u003cspan class=\"CitationRef\"\u003e16\u003c/span\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eN/A\u003csup\u003e2\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eVaccine\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e571/79\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\"\u003e\n \u003cp\u003e1979\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eKR381785 (\u003cspan class=\"CitationRef\"\u003e15\u003c/span\u003e)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eConjunctivitis\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEye swab\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"5\"\u003e\u003csup\u003e\u003cem\u003e1\u003c/em\u003e\u003c/sup\u003e \u003cem\u003eURTD\u0026thinsp;=\u0026thinsp;Upper respiratory tract disease\u003c/em\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"5\"\u003e\u003csup\u003e\u003cem\u003e2\u003c/em\u003e\u003c/sup\u003e \u003cem\u003eN/A\u0026thinsp;=\u0026thinsp;Not applicable\u003c/em\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003ctable id=\"Tab2\" border=\"1\"\u003e\n \u003ccaption\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003ePrimers used for UL32 FHV-1 RT-qPCR.\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePrimer\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eDirection\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSequence (5\u0026rsquo; \u0026rarr; 3\u0026rsquo;)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eBinding site (nt)\u003csup\u003e1\u003c/sup\u003e\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" align=\"left\"\u003e\n \u003cp\u003eUL32\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCATACCACTCTGTGCCACC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e46,212\u0026ndash;46,231\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGAACGCCCCCACCAAAGTAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e46,318\u0026ndash;46,299\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" align=\"left\"\u003e\n \u003cp\u003eUL33\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eForward\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAACGTGATTTTTGCGTGGCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e45,525\u0026ndash;45,544\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eReverse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTTATCATATACCCAGCGACTCG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e45,624\u0026ndash;45,603\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003ctfoot\u003e\n \u003ctr\u003e\n \u003ctd colspan=\"4\"\u003e\u003csup\u003e\u003cem\u003e1\u003c/em\u003e\u003c/sup\u003e \u003cem\u003eNucleotide numbers of the binding site relate to the alignment of the FHV-1 F2 vaccine strain (Feligen) (Genbank Accession No. KR296657)\u003c/em\u003e\u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tfoot\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003cbr\u003e\u003c/div\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"virology-journal","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"virj","sideBox":"Learn more about [Virology Journal](http://virologyj.biomedcentral.com/)","snPcode":"12985","submissionUrl":"https://submission.nature.com/new-submission/12985/3","title":"Virology Journal","twitterHandle":"@VirologyJ","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"feline herpesvirus-1, upper respiratory tract disease, feline viral rhinotracheitis, transcriptomics, virus-host interaction, molecular pathogenesis","lastPublishedDoi":"10.21203/rs.3.rs-5965961/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5965961/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003e \u003cem\u003eVaricellovirus felidalpha-1\u003c/em\u003e (FHV-1, previously \u003cem\u003eFelid alphaherpesvirus-1\u003c/em\u003e) is a significant cause of upper respiratory tract disease in feline populations. Cats infected with FHV-1 show clinical signs that vary in severity. This can be due to differences in host responses and virus strain virulence. Investigating the gene transcription profiles during infections using FHV-1 strains could inform our understanding of host and viral factors contributing to disease outcomes. This study characterised the transcriptomes of Crandell\u0026ndash;Rees feline kidney (CRFK) cells infected with field or vaccine FHV-1 strains to better understand the host response during infection.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eCrandell\u0026ndash;Rees feline kidney cells were infected with either the FHV-1 Feligen vaccine strain or the 384/75 field strain associated with severe disease. The transcriptomes were characterised using RNA-sequencing. To determine the host cellular transcription profile, the total transcripts were mapped to the cat genome and compared to uninfected cells. To characterise the viral transcription profile, the total reads were mapped to each FHV-1 strain. The differentially expressed host genes between infection strains were compared and further analysed using the PANTHER database to examine host pathway regulation.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eThe findings in this study show the differential host gene expressions induced by FHV-1 compared to uninfected CRFK cells. Genes encoding histone proteins were upregulated, while genes involved in cell adhesion and migration processes were downregulated during infections with FHV-1. Comparative analysis between field and vaccine strains showed similarities and differences in host gene expressions. Notably, upregulated genes unique to the field strain were associated with regulatory proteins involved in the cell cycle, while downregulated host genes in field and vaccine strains showed distinct host gene and pathway expressions involved in immune activation.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eThis study demonstrates the host and viral gene expressions during FHV-1 infection shows the distinct host responses to field and vaccine strains using an \u003cem\u003ein vitro\u003c/em\u003e model. These findings provide a foundation for future transcriptomic investigations in other cell types, including \u003cem\u003eex-vivo\u003c/em\u003e explants systems, to enhance our understanding of host-pathogen interactions and viral pathogenesis that may inform future vaccine attenuation studies.\u003c/p\u003e","manuscriptTitle":"Transcriptomic profiles of Crandell-Rees feline kidney cells infected with Varicellovirus felidalpha-1 (FHV-1) field and vaccine strains","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-02-10 09:32:51","doi":"10.21203/rs.3.rs-5965961/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-03-07T02:02:29+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-03-05T02:58:21+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-03-03T18:29:48+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"246102277123890481378961540354960639327","date":"2025-02-24T03:35:20+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"171482690903190513462296525037447851537","date":"2025-02-21T01:50:52+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-02-18T02:02:10+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-02-06T10:24:44+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-02-06T09:23:01+00:00","index":"","fulltext":""},{"type":"submitted","content":"Virology Journal","date":"2025-02-05T13:04:04+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"virology-journal","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"virj","sideBox":"Learn more about [Virology Journal](http://virologyj.biomedcentral.com/)","snPcode":"12985","submissionUrl":"https://submission.nature.com/new-submission/12985/3","title":"Virology Journal","twitterHandle":"@VirologyJ","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"db87a855-4313-4340-aa59-501bd13e5978","owner":[],"postedDate":"February 10th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-04-21T16:01:42+00:00","versionOfRecord":{"articleIdentity":"rs-5965961","link":"https://doi.org/10.1186/s12985-025-02722-w","journal":{"identity":"virology-journal","isVorOnly":false,"title":"Virology Journal"},"publishedOn":"2025-04-16 15:57:48","publishedOnDateReadable":"April 16th, 2025"},"versionCreatedAt":"2025-02-10 09:32:51","video":"","vorDoi":"10.1186/s12985-025-02722-w","vorDoiUrl":"https://doi.org/10.1186/s12985-025-02722-w","workflowStages":[]},"version":"v1","identity":"rs-5965961","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5965961","identity":"rs-5965961","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.