Investigation of the prevalence of Brucella antibodies and field strains in immunized dairy herds in Lingwu, Ningxia | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Investigation of the prevalence of Brucella antibodies and field strains in immunized dairy herds in Lingwu, Ningxia Yong Shi, Yimeng Cui, Gaowa Wudong, Shengnan Li, Ye Yuan, Danyu Zhao, and 11 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3888156/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Brucella 19 strain vaccines are widely used to prevent brucellosis in cattle. The vaccine antibodies are generally acknowledged to persist for less than 12 months after immunization. The real rate of persistent antibodies may be a difference because of different feeding management and immunization schedules. The effect of vaccine immunization and the correlation between the persistence of antibodies induced by immunization and field strain infection remains unclear in the northwest of China. Results We revealed that Brucella A19 vaccine antibodies persist in dairy herds for more than 12 months. We established a PCR method for identifying both Brucella A19 and non-A19 strains, resulting in the detection of 10 field strains of Brucella abortus from vaginal swab samples collected from 1,537 dairy cows. We analyzed the rates of seropositivity and herd seropositive rates in dairy cattle in Lingwu City from 2021 to 2023. By employing a mathematical expectation strategy, we completed testing of 1537 samples after conducting only 306 tests of pools of six samples, thereby reducing the workload by 80.1%. Conclusion We propose that the detection of antibodies in cattle vaccinated with the A19 vaccine more than 12 months previously should not be solely relied upon as a diagnostic basis for brucellosis, and it is essential to combine this approach with PCR analysis to specifically identify field strains. Timely detection of Brucella in aborting livestock was identified as an efficient strategy for diagnosis. This research provides valuable data for the prevention and control of brucellosis in immunized cattle herds, as well as serving as a reference method for investigating and diagnosing brucellosis in livestock vaccinated in other regions. Brucella Brucellosis persistent antibodies Brucella A19 strain Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Brucellosis is caused by bacteria of the genus Brucella[ 1 , 2 ], which can lead to a potentially debilitating chronic infection associated with febrile illness in humans, and abortion, premature birth and decreased productivity in livestock[ 3 , 4 ]. Thus, brucellosis is serious public health threat and is associated with significant economic losses in the livestock industry animals[ 5 , 6 ]. Over 500,000 new human cases of brucellosis are diagnosed each year [ 7 , 8 ], although the true number of cases is likely to be much higher due to inaccurate diagnosis, inadequate surveillance, and incomplete reporting. Brucellosis is widespread throughout the world, only a few countries in the world have successfully achieved brucellosis purification[ 9 ]. Brucellae are non-motile, non-spore-forming, and slow-growing Gram-negative coccobacilli belonging to the Brucellaceae family in the alpha-2 subclass of the proteobacteria[ 10 , 11 ]. In recent years, 12 new species of Brucella have been identified[ 12 ]. Brucellosis is transmitted horizontally or vertically among both domestic and feral animals, and person-to-person transmission of the infection is rare[ 13 ]. B. melitensis , B. abortus , B. suis , and B. canis are the main causes of the disease in humans, with infections resulting from direct contact with birth fluids or infected tissues, or Brucella aerosol[ 14 ]. Consumption of unpasteurized dairy products infected with Brucella spp. is also a major route for human infection[ 15 , 16 ]. Control of zoonotic diseases in human populations has relied heavily on the control of animal disease[ 17 ]. Vaccination is the main strategy for the prevention and control of brucellosis[ 18 , 19 ]. B. abortus S19, RB51, and B. melitensis Rev. 1 vaccines have been widely used in many countries[ 20 – 22 ], while B. abortus A19, B. melitensis M5 and B. suis S2 vaccines are used in China[ 23 – 25 ]. The A19 and S19 strains are predominantly utilized for Brucella vaccination in cattle[ 25 ], both originating from Brucella abortus strain19 isolated in the United States in 1923, exhibited a 99.9% homology, with A19 lacking the 702-bp deletion in the erythritol gene that was present in S19[ 26 ]. Although Brucella live attenuated vaccines can cause abortions in pregnant animals and are virulent in humans, this approach has played an important part in controlling the spread of epidemics and reducing the incidence of human disease[ 27 ]. However, most vaccines are smooth strains, as most serologic tests are primarily based on detection of antibodies against the O-side chain of Brucella , discriminating between vaccine-induced antibodies and those generated by field virus infection poses a challenge[ 27 , 28 ]. Therefore, bacterial culture and nucleic acid amplification are necessary for the diagnosis of brucellosis in animals. The vaccination-test-slaughter eradication strategy is commonly employed for brucellosis control in many countries[ 9 ]. Typically, the presence of antibodies is detected for a period of time after vaccination and antibody-positive livestock are subsequently culled. In China, according to the Technical Points for Brucellosis Prevention and Control (1st edition) issued by the Ministry of Agriculture of the People’s Republic of China, cattle should be monitored for A19 strain vaccine antibodies for a period of 12 months post-immunization. This prescribed approach implicitly recognizes the loss of immune antibodies 12 months post immunization with A19 vaccine. However, it has been reported that vaccine-induced antibodies persist in cattle immunized with Brucella S19 strain vaccine 12 months after vaccination, making it a challenge to differentiate between vaccine-induced antibodies and those resulting from field strain infection [ 29 , 30 ]. Consequently, if cattle continue to test positive for antibodies beyond 12 months, indiscriminate culling may lead to erroneous elimination of cattle that are not infected field Brucella, causing significant economic losses. Similar to other provinces in northwest China where brucellosis is highly endemic, a program of livestock immunization with the brucellosis vaccine has been implemented in NingXia Province. However, there is a paucity of reports regarding the seropositivity rate of anti-Brucella antibodies and the prevalence of field strains in livestock within the areas in which this strategy has been implemented. The absence of this data severely hampers the development of effective prevention and control strategies for brucellosis in these regions, particular human brucellosis [ 31 ]. The Chinese government has placed great emphasis on the prevention and control of brucellosis, as evidenced by the implementation of the Five-Year Action Plan for Brucellosis Prevention and Control in Livestock (2022–2026), which aims to achieve control of the individual positive rate at < 0.4% and the herd positive rate at < 7%. In 2022, the dairy cow population in Lingwu City reached 196,400 and produced an annual output of 567,900 tons of milk, ranking second in NingXia Province. The expansion of dairy farming scale in recent years has significantly heightened the risk of brucellosis transmission[ 32 – 34 ]. Epidemiological investigation is the first step to achieving the goal of brucellosis eradication. The objective of this study was to elucidate the serological and etiological status of brucellosis in immunized dairy herds and their interrelationships, thereby providing a scientific foundation for epidemiological investigation, control, and eradication of brucellosis in this region as well as other areas where immunization is implemented. Materials and methods Identification of the DNA sequence that distinguishes Brucella A19 from other strains The Brucella A19 vaccine is utilized for cattle immunization in dairy farms located in Lingwu City. Therefore, it is imperative to establish a method that can differentiate the Brucella A19 strain from other strains. We utilized the genome comparison software Mauve to conduct a comparative analysis of the reference sequences of Brucella A19 strain (NZ_CP030751.1, NZ_CP030752.1) and the classical strain 2308 (NC_007618.1, NC_007624.1) in the NCBI database. The resulting sequence fragments were subsequently verified by BLAST program on the NCBI website, ultimately revealing distinct variations in sequence between the Brucella A19 strain and other strains. PCR-based differential diagnostic approach PCR primers were designed to distinguish A19 from other strains according to the specific sequence differences using Primer5 software. The specificity of the primers was verified by PCR using genomic DNA from B. abortus A19 strains, B. suis S2 strain, Escherichia coli , Salmonella , Staphylococcus and Streptococcus preserved in our laboratory. The 25-µl PCR system comprised 12.5 µl 2× Taq PCR Mix (Vazyme Biotech Co., Ltd, China), 1 µl each primer, 5 µl double-distilled water, and 2.5 µl template DNA. The PCR amplification was performed using the following parameters: pre-denaturation at 95°C for 5 min followed by 35 cycles of denaturation at 95°C for 60 s, annealing at 58°C for 30 s and extension at 72°C for another 30 s. The amplified products were analyzed on 1% agarose electrophoresis gel and visualized under ultraviolet light. Serological tests Whole blood (2–5 ml) was collected from the tail vein of the selected livestock. To isolate the serum, the samples were incubated at 37℃ for 1 h and then centrifuged at 3,000 rpm for 5 min. The sera were decanted and stored at − 20°C prior to testing with a commercial Rose Bengal Plate Test (RBPT) for Brucella (Institute of Veterinary Drug Control, China). Processing of swab samples Total DNA was extracted from vaginal swab samples for PCR amplification using a highly effective commercial DNA extraction kit (Tiangen Biochemical Technology Co., China) according to the manufacturer’s instructions. The seroprevalence investigation of Brucella antibody in vaccinated cattle in Lingwu City. The cross-sectional serological survey was conducted in seven townships in Lingwu City from 2021 to 2023. The subjects included cattle that were immunized with a brucellosis A19 strain vaccine more than one year prior to the study. To ensure a comprehensive analysis, at least 20 samples were collected from large-scale pastures, while a minimum of three samples were obtained from smallholder farms. The serologic and etiological testing for Brucella was subsequently conducted. Investigation of the positive rate of Brucella antibodies in dairy herds of three brucellosis-free dairy farms The cows in the three dairy farms were sourced from brucellosis-free regions of Australia and New Zealand with strict adherence to self-breeding practices. With a robust biosafety system in place, the annual abortion rate across all pastures remained below 5%, while no instances of Brucella field strains infection were detected during continuous brucellosis surveillance of cattle for nearly a year. The blood and vaginal swab samples were randomly collected from cows that had been immunized with the brucellosis A19 vaccine a minimum of 12 months previously, ensuring a ratio of no less than 10% in each ranch. Serologic and etiological testing for Brucella was conducted subsequently. Investigation of Brucella field strains among cattle in 10 dairy farms Blood and vaginal swab samples were collected from cattle that had immunized with Brucella A19 vaccine for more than 12 months in 10 dairy farms, with a minimum sampling proportion of 10%. Serologic and etiological testing for Brucella was conducted subsequently. DNA positive samples were further characterized using a multiple PCR method for Brucella species identification [ 35 ], which successfully addressed the limitations of the AMOS-PCR method in distinguishing B. abortus type 3[ 36 ]. Molecular detection of brucellosis utilizing the mathematical expectation method The previously reported method for mutation screening utilizing the mathematical expectation (ME) strategy exhibits both speed and accuracy, making it suitable for large sample sizes with low frequency mutations[ 37 , 38 ]. We utilized ME values to expedite large-scale detection of brucellosis in domestic animals, thereby saving time and effort. We applied the expected prevalence rate of 3% for brucellosis in livestock within Lingwu City adopted in a previous official sampling strategy to our formula and concluded that the number of required detections could be minimized by mixing 6 samples. Therefore, we consolidated the DNA extracted from 6 samples into a composite sample for PCR detection. In the event of a positive result from the pooled sample, each of the six samples was tested individually. Results Distinctive differential sequences of Brucella A19 strain The genome comparison software Mauve was used to determine differences in the genome sequences of the A19 and classical 2308 strains based on the reference sequences of Brucella A19 strain and the classical strain 2308. This comparison revealed a 68-bp sequence deficiency in the genome of the A19 strain between positions 371,765 and 371,766 on Chromosome 2, which corresponds to the sequence between positions 371,759 and 371,826 of the 2308 strain genome. Although the comparison of the reference genomes indicated a deletion of 72-bp genetic sequence, our results indicate otherwise. The 68-bp deletion sequence is GGTGTGGTCGCGGGCTTCCTGATGCAGGGCGTGACCTTGCAGGAATTCGGC ATCATCCTTTATTTCCC . Comparison of the genome sequences of Brucella strains from positions 371,465 to 372,065 using the BLAST program in NCBI showed that only A19, LBAB038, S19 and 19BA strains had 100% similarity compared to other Brucella strains. Thus, our data revealed that only these four Brucella strains lacked the deletion of 68-bp bases identified by the Mauve software. PCR-based identification of Brucella strain A19 Using the classical 2308 strain of Brucella as a template, we used Primer 5 software to design a pair of primers across the 68-bp deleted sequence of A19 to establish a PCR method for distinguishing A19 strains from other strains. The upstream and downstream primer sequences were 5'-TCGTTCCTTTCGCCCTATTAC-3' and 5'-TGTTGAAGCCGAGCCAGTC-3', respectively. The expected amplicon size for strain A19 was 374 bp, while other strains were predicted to yield a fragment of 442 bp. As shown in Fig. 1 , the established PCR method generated products of the expected sizes for strains A19, 2308, S2 and 16M. PCR assay specificity To assess the discriminatory power of the established PCR method among a A19 vaccine strain, non-A19 Brucella strains and other non- Brucella strains, DNA amplification was performed using these strains as templates. As shown in Fig. 2 , a 374-bp fragment was amplified from A19 DNA template, while a 442-bp product was generated from non-A19 Brucella strains, while no amplification signal was detected from the other non-A19 Brucella strains. These results indicated the high specificity of this PCR method and its ability to differentiate between A19 and other non-A19 Brucella strains. The seroprevalence investigation of Brucella antibody in vaccinated cattle in Lingwu City The Brucella antibody seropositivity rates in dairy cows immunized for more than 12 months in Lingwu City from 2021 to 2023 are shown in Table 1 . A total of 5,435 samples were collected over the course of three years with 1,726 collected in 2021, 2,146 in 2022, and 1,563 in 2023. According to the RBPT method, 1,447 of these samples were seropositive, accounting for 23.4%, 26.7%, and 30.0%, respectively, of the samples collected in each of the three years. The average prevalence of Brucella antibody seropositivity in dairy cattle was 26.6%. Table 1 Brucella antibody seropositivity rate in dairy cows in Lingwu City from 2021 to 2023 Year Number Number of positives Positive rate 2021 1726 404 23.4% 2022 2146 574 26.7% 2023 1563 469 30.0% The herd Brucella antibody seropositivity rates in Lingwu City from 2021 to 2023 are shown in Table 2 . The numbers of farms sampled from 2021–2023 were 234, 265, and 123 respectively, with corresponding herd seropositivity rates of 32.91%, 36.23%, and 55.28%, respectively. Additionally, the average herd seropositivity rate for cattle in Lingwu was 38.75%. Table 2 Herd Brucella antibody seropositivity rates in Lingwu City from 2021 to 2023 Year Number Number of positives Positive rate 2021 234 77 32.9% 2022 265 96 36.2% 2023 123 68 55.3% The seroprevalence of Brucella antibodies in three brucellosis-free dairy farms A total of 533 cows from three dairy farms immunized with Brucella 19 vaccine more than 12 months previously were tested for antibodies. The positive rates of Brucella-specific antibodies were 26.5%, 18.0%, and 5.4%, respectively. Brucella molecules were not detected in vaginal swab samples collected from both antibody-negative and antibody-positive cattle. The specific results are presented in Table 3 . Table 3 The seroprevalence of Brucella antibodies in three brucellosis-free dairy farms Farm number Serological testing PCR testing Positive Number Positive rate Positive Number Positive rate A 253 67 26.5% 0 0.0% B 150 27 18.0% 0 0.0% C 130 7 5.4% 0 0.0% Investigation of Brucella field strains among cattle in 10 dairy farms We next evaluated the established PCR method to identify Brucella field strains in dairy cattle 1004 samples collected from 10 dairy farms (Table 4 ). Brucella field strains were found to be present in 5 of the 10 farms. Furthermore, all 10 Brucella field strains were identified (Fig. 3 ), further identification as Brucella abortus (Fig. 4 ). The dairy herd antibody-positive rate ranged from 10.5–41.2%. In particular, the cows that tested positive for the Brucella field strains were all found to be antibody-positive within 15 days of abortion. Table 4 Detection of the Brucella field strain in 10 dairy farms Farm number Serological testing PCR testing Positive Number Positive rate Positive Number Positive rate 1 185 0 0.0% 32 17.3% 2 103 0 0.0% 23 22.3% 3 143 0 0.0% 15 10.5% 4 106 0 0.0% 16 15.1% 5 69 2 2.9% 23 33.3% 6 97 2 2.1% 40 41.2% 7 75 1 1.3% 27 36.0% 8 40 0 0.0% 21 23.3% 9 56 2 3.6% 23 41.1% 10 80 3 3.8% 31 38.8% Molecular detection of brucellosis utilizing mathematical expectations Using the established PCR method, we analyzed a total of 1537 samples. The ME method offers the advantage that six samples can be pooled into one for detection purposes. Analysis of all 1,537 samples in only 306 tests using this method yielded the required number of detections was achieved. This represented a significant decrease in the workload of 80.1% and a greatly enhanced detection efficiency (Table 5 ). Table 5 Statistics of reaction times based on ME method Breeds Data Sizes 1537 Assumed prevalence 3.0% Number of individuals in one reaction time(NR1) 1 Reaction times (RT1) 1537 Number of individuals in one mixed group (NG6) 6 Reaction times (RT6) 306 Reduction rate (RR) 80.1% Discussion It is of significant value to conduct investigations on the prevalence rate of Brucella antibodies and the field strains of Brucella in livestock, as this can aid in controlling the spread of brucellosis among livestock, thereby reducing the incidence of human brucellosis, and promoting eradication of this disease[ 39 ]. The rate of persistence of antibody immunity more than 12 months after Brucella vaccine immunization in NingXia remains unknown. In this study, we aimed to elucidate the serological and etiological status of brucellosis in immunized dairy herds and their interrelationships, thereby providing a scientific foundation for epidemiological investigation, control, and eradication of brucellosis in this region as well as other areas where immunization is implemented. To overcome the challenge of identifying cattle infected with Brucella field strains, we aimed to identify deletion or addition sequences of the Brucella A19 vaccine strain by comparing its genome sequence with those of other strains. For this purpose, we used the gene collinearity analysis software Mauve, a JAVA-based program for gene sequence comparison that incorporates elements from the BLAST program. Using this approach, we identified a 68-bp deletion fragment on chromosome 2 specific to the A19 strain, which was consistent with previous reports[ 40 ].Then we subsequently designed upstream and downstream primers to discriminate between A19 and non-A19 strains of Brucella based on the size difference of the target amplified fragment using PCR methodology. Validation of this technique revealed that this method exhibits excellent specificity and can be utilized with precision in both laboratory tests and clinical trials. In this study, we successfully applied this method to identify cows infected with field Brucella strains in dairy herds. Furthermore, this method can also be employed for identifying A19 and non-A19 strains of Brucella in cattle in other vaccination areas. In Lingwu, cattle are typically first immunized with the Brucella vaccine between 3 to 8 months of age, followed by a low-dose booster at 3 months later. Based on this vaccine immunization program implemented from 2021 to 2023, individual Brucella antibody-positive rates among cattle vaccinated in Lingwu City were recorded as 23.4%, 26.7%, and 30.0% respectively, while herd positivity rates stood at 32.9%, 36.2%, and 55.3%, respectively. The seroprevalence of Brucella antibodies in dairy cows exceeded that reported previously[ 31 ], potentially due to the increased utilization of vaccines or the escalated dissemination of brucellosis. Due to local implementation of the Brucella A19 vaccine, traditional serological methods are not suitable for differentiating antibody responses caused by infections with field strains of Brucella [ 27 ].These findings indicate that a certain proportion of cattle immunized with the brucellosis vaccine remain seropositive for more than one year in Lingwu immunized dairy herds. The achievement of an individual seropositive rate below 0.4% and a population seropositive rate below 7% by 2026 poses significant challenges. The results of a large-scale serological survey revealed that an average 26.7% percentage of cows vaccinated with the immune Brucella A19 strain vaccine test positive for antibodies after 12 months. We hypothesize that many of these antibodies are persistent and produced by the vaccine itself. It is suspected that the persisting antibody may be attributed to previous immunization (prime and boost) with Brucella vaccines in the Lingwu area, and that A19 strains exhibit stronger virulence compared to the S19 strain[ 26 ]. Therefore, we conducted an additional seroprevalence survey on dairy farms free from brucellosis to ascertain the proportion of antibodies that persist 12 months post-vaccination. Previous research has shown that this immunization program effectively renders cows negative for brucellosis after 7 months under experimental conditions [ 35 ]. However, our investigation of three Brucella-free dairy farms revealed that between 5.4% and 26.5% of cows still tested positive for A19 vaccine-induced antibodies at 12 months post-immunization. Additionally, no evidence of field Brucella was found in swab tests conducted on these cattle, and the most did not exhibit typical symptoms such as abortion associated with brucellosis. Therefore, we infer that these persistent antibodies are durable titers induced by the vaccine, which aligns with previous findings [ 29 , 30 ]. The presence of these persistent antibodies is likely influenced by factors such as vaccine virulence and immunization schedule. Consequently, serological methods alone cannot accurately diagnose bovine brucellosis in immune areas nor can arbitrary culling serologically positive individuals guarantee the elimination of actual cases since a significant number of uninfected Brucella field strains cattle may be unnecessarily destroyed. A total of 1004 bovine vaginal swabs from vaccinated cattle were collected to detect 10 field strain samples, all of which were further identified as Brucella abortus . Since it has been reported that human brucellosis in NingXia is predominantly caused by Brucella melitensis [ 35 ], our results further suggested that sheep suffering from brucellosis in NingXia are an important source of human brucellosis. Thus, there is a need to strengthen prevention and control measures for brucellosis in sheep to reduce the incidence of human cases. We speculated that the risk of transmission of brucellosis in dairy cattle in Lingwu City was the brucellosis in cattle itself, not other domestic animals. It is particularly noteworthy that Brucella field strains were not detected in the antibody-negative cattle, while those infected with Brucella field strains cattle all tested positive for antibodies and abortion occurred within 15 days. Previous reports[ 30 ] have indicated that cows infected with brucella typically do not transmit the infection to other animals unless calving or aborting, after which they become efficient transmitters via products of parturition. However, their ability to infect other animals diminishes rapidly after delivery, usually within 30 days[ 30 ]. Our findings support this perspective and suggest that timely identification of abortion cases can serve as an effective means for eradication of Brucella-infected cattle by continuous culling. Our results confirmed the positive role of the Brucella A19 vaccine in reducing the incidence of brucellosis induced abortion in cattle by visiting farm ranch workers, but also demonstrated that vaccine cannot be used as the only means of decontamination, as cattle cannot rely on the protective effect of vaccine to clear Brucella field strains. The findings provide valuable data for informing the prevention and control strategy of brucellosis in dairy cattle in areas of dairy herds immunized with the A19 vaccine. Epidemiological investigations usually involve large sample sizes and require time-consuming and labor-intensive testing. In the current study, we were able to reduce the number of tests from 1537 required to analyze all the samples individually using traditional techniques, to only 306 by employing the ME strategy where six samples are mixed into one test, thereby reducing the test workload by 80.1%. Thus, the ME strategy is a time-saving and cost-effective method for molecular detection of brucellosis. This study also has certain limitations. The RBPT method utilized for analysis of a large number of serum samples serves as a preliminary screening approach for brucellosis antibodies, rather than a diagnostic method. In comparison with the cELISA method, the RBPT method exhibits lower sensitivity [ 41 ]. However, RBPT is more rapid, cost-effective, and suitable for widespread use at the grassroots level compared to cELISA. Nucleic acids were extracted for PCR analysis from vaginal swab samples collected from cows that were immunized more than 12 months previously. Due to the fact that field strains of Brucella were not in their excretion period during sampling of infected cattle, these cases may be missed. Therefore, it is strongly recommended that individual molecular detection should be conducted on abortive cattle and those affected by brucellosis should be eliminated promptly. In this study, we also discovered a significant number of antibody-positive cattle one year after immunization of herds with Brucella attenuated vaccine; however, not all of these cattle were infected with field strains of brucellosis. Consequently, investigating the duration of antibodies and influencing factors following immunization with Brucella A19 vaccine should be considered as a future research direction. These vaccine-induced antibodies may interfere with efforts aimed at eradication of brucellosis and mistaken culling of these cattle would result in substantial economic losses and burdens both for ranches and local governments. The eradication of brucellosis is a complex and costly endeavor. Many countries, including the United States and Australia, have dedicated decades to achieving success, while many countries have failed due to inadequate policy implementation, insufficient funding, and lack of awareness among farmers (Zhang, 2018). Vaccination has been implemented in Northwest of China for several years now. This survey revealed that immunization has significantly reduced the incidence of brucellosis in many farms, confirming the effectiveness of the local vaccine immunization program, although it is crucial to consider factors such as local vaccine immunization programs, vaccine-induced antibody persistence, and epidemic strains of brucella. After a certain period of time, simply relying on serological tests to determine whether cattle are infected with wild strains is not sufficient and inappropriate criteria for brucellosis diagnosis may result in the unnecessary culling of a significant number of domestic animals, leading to substantial economic losses and impeding the progress of animal husbandry. In summary, we propose that the diagnosis of brucellosis in cattle vaccinated with Brucella A19 strain vaccine should not solely rely on serological methods due to the persistence of vaccine-induced antibodies, but rather incorporate PCR methods to detect field Brucella infection. Declarations Ethics approval and consent to participate The animal study was reviewed and approved by the Experiment Center of Northwest A&F University (Approval No.2021028) and was in accordance with the Ethics on Animal Care guidelines for the use of animals in the experimental research. Performed under the control of the “Guidelines on Ethical Treatment of Experimental Animals" (2006) No.398 set by the Ministry of Science and Technology, China. Consent for publication Not applicable. Competing interests The authors declare that they have no competing interests. Availability of data and materials The raw data used and/or analyzed during the current study are available from the corresponding author upon reasonable request. Authors’ contributions experimental design and planning: A.W, Y.P, Y.S, Y.C; serological analysis G.W, S.L, Y.Y; molecular detection: D.Z, S.Y data processing and statistical analysis Z.D, B.L; the sample collection: X.L, Z.L, F.Z, M.X, Z.Z; drafting of the manuscript: Y.S; critical revision of the manuscript: A.W, Y.P, D.Z, W.L All authors read and approved the manuscript Funding This study was financially supported by the General Project of the Key Research and Development Program of Ningxia Hui Autonomous Region. The project, titled "Research and Development and Application of Prevention and Control Technology for Reproductive Disorders in Dairy Cows," was assigned the project number 2018BBF33001. Acknowledgments We thank Ma Xingyun, Ma Lei, Ma Jiajun and others from Ningxia Xingyuanda Farming and Animal Husbandry Co., LTD for their help and support in this study. Author details 1 College of Veterinary Medicine, Northwest A&F University, Yangling District, Xianyang 712100, China; 2 Key Laboratory of Animal Biotechnology of the Ministry of Agriculture, Northwest A&F University, Yangling District, Xianyang 712100, China 3 Animal Health supervision Institute of Lingwu City, Ningxia 750000, China 4 Animal Disease Control and Prevention center of Lingwu City, Ningxia 750000, China * Correspondence: [email protected] ; [email protected] ; References Moreno E: Retrospective and prospective perspectives on zoonotic brucellosis . Front Microbiol 2014, 5 :213. Kneipp C, Malik R, Mor SM, Wiethoelter AK: Commentary: Retrospective and prospective perspectives on zoonotic brucellosis . Front Microbiol 2019, 10 :1859. Godfroid J: Brucellosis in livestock and wildlife: zoonotic diseases without pandemic potential in need of innovative one health approaches . Arch Public Health 2017, 75 :34. Yuan HT, Wang CL, Liu LN, Wang D, Li D, Li ZJ, Liu ZG: Epidemiologically characteristics of human brucellosis and antimicrobial susceptibility pattern of Brucella melitensis in Hinggan League of the Inner Mongolia Autonomous Region, China . Infect Dis Poverty 2020, 9 (1):79. Dean AS, Crump L, Greter H, Schelling E, Zinsstag J: Global burden of human brucellosis: a systematic review of disease frequency . PLoS Negl Trop Dis 2012, 6 (10):e1865. Singh BB, Khatkar MS, Aulakh RS, Gill JPS, Dhand NK: Estimation of the health and economic burden of human brucellosis in India . Prev Vet Med 2018, 154 :148-155. Pappas G, Papadimitriou P, Akritidis N, Christou L, Tsianos EV: The new global map of human brucellosis . Lancet Infect Dis 2006, 6 (2):91-99. Seleem MN, Boyle SM, Sriranganathan N: Brucellosis: a re-emerging zoonosis . Vet Microbiol 2010, 140 (3-4):392-398. Zhang N, Huang D, Wu W, Liu J, Liang F, Zhou B, Guan P: Animal brucellosis control or eradication programs worldwide: A systematic review of experiences and lessons learned . Prev Vet Med 2018, 160 :105-115. Barbier T, Collard F, Zuniga-Ripa A, Moriyon I, Godard T, Becker J, Wittmann C, Van Schaftingen E, Letesson JJ: Erythritol feeds the pentose phosphate pathway via three new isomerases leading to D-erythrose-4-phosphate in Brucella . Proc Natl Acad Sci U S A 2014, 111 (50):17815-17820. Bowman DD: Introduction to the alpha-proteobacteria: Wolbachia and Bartonella, Rickettsia, Brucella, Ehrlichia, and Anaplasma . Top Companion Anim Med 2011, 26 (4):173-177. Vergnaud G, Hauck Y, Christiany D, Daoud B, Pourcel C, Jacques I, Cloeckaert A, Zygmunt MS: Genotypic Expansion Within the Population Structure of Classical Brucella Species Revealed by MLVA16 Typing of 1404 Brucella Isolates From Different Animal and Geographic Origins, 1974-2006 . Front Microbiol 2018, 9 :1545. Tuon FF, Gondolfo RB, Cerchiari N: Human-to-human transmission of Brucella - a systematic review . Trop Med Int Health 2017, 22 (5):539-546. Kamal IH, Al Gashgari B, Moselhy SS, Kumosani TA, Abulnaja KO: Two-stage PCR assay for detection of human brucellosis in endemic areas . BMC Infect Dis 2013, 13 :145. Casalinuovo F, Ciambrone L, Cacia A, Rippa P: Contamination of Bovine, Sheep and Goat Meat with Brucella Spp . Ital J Food Saf 2016, 5 (3):5913. Ye HY, Xing FF, Yang J, Lo SK, Lau RW, Chen JH, Chiu KH, Yuen KY: High index of suspicion for brucellosis in a highly cosmopolitan city in southern China . BMC Infect Dis 2020, 20 (1):22. Rubach MP, Halliday JE, Cleaveland S, Crump JA: Brucellosis in low-income and middle-income countries . Curr Opin Infect Dis 2013, 26 (5):404-412. Schuchat A, Bell BP: Monitoring the impact of vaccines postlicensure: new challenges, new opportunities . Expert Rev Vaccines 2008, 7 (4):437-456. Moriyon I, Grillo MJ, Monreal D, Gonzalez D, Marin C, Lopez-Goni I, Mainar-Jaime RC, Moreno E, Blasco JM: Rough vaccines in animal brucellosis: structural and genetic basis and present status . Vet Res 2004, 35 (1):1-38. Avila-Calderon ED, Lopez-Merino A, Sriranganathan N, Boyle SM, Contreras-Rodriguez A: A history of the development of Brucella vaccines . Biomed Res Int 2013, 2013 :743509. Zamri-Saad M, Kamarudin MI: Control of animal brucellosis: The Malaysian experience . Asian Pac J Trop Med 2016, 9 (12):1136-1140. Hou H, Liu X, Peng Q: The advances in brucellosis vaccines . Vaccine 2019, 37 (30):3981-3988. Jiang H, Dong H, Peng X, Feng Y, Zhu L, Niu K, Peng Y, Fan H, Ding J: Transcriptome analysis of gene expression profiling of infected macrophages between Brucella suis 1330 and live attenuated vaccine strain S2 displays mechanistic implication for regulation of virulence . Microb Pathog 2018, 119 :241-247. Wang F, Qiao Z, Hu S, Liu W, Zheng H, Liu S, Zhao X, Bu Z: Comparison of genomes of Brucella melitensis M28 and the B. melitensis M5-90 derivative vaccine strain highlights the translation elongation factor Tu gene tuf2 as an attenuation-related gene . Infect Immun 2013, 81 (8):2812-2818. He CY, Zhang YZ, Liu MZ, Zhao HL, Ren LS, Liu BS, He S, Chen ZL: Combined immunization with inactivated vaccine reduces the dose of live B. abortus A19 vaccine . BMC Vet Res 2022, 18 (1):128. Wang S, Wang W, Sun K, Bateer H, Zhao X: Comparative genomic analysis between newly sequenced Brucella abortus vaccine strain A19 and another Brucella abortus vaccine S19 . Genomics 2020, 112 (2):1444-1453. Olsen SC, Stoffregen WS: Essential role of vaccines in brucellosis control and eradication programs for livestock . Expert Rev Vaccines 2005, 4 (6):915-928. Perkins SD, Smither SJ, Atkins HS: Towards a Brucella vaccine for humans . FEMS Microbiol Rev 2010, 34 (3):379-394. Manthei CA: Brucellosis. Application of research to bovine brucellosis control and eradication programs . J Dairy Sci 1968, 51 (7):1115-1120. Ragan VE, Animal, Plant Health Inspection S: The Animal and Plant Health Inspection Service (APHIS) brucellosis eradication program in the United States . Vet Microbiol 2002, 90 (1-4):11-18. Ran X, Cheng J, Wang M, Chen X, Wang H, Ge Y, Ni H, Zhang XX, Wen X: Brucellosis seroprevalence in dairy cattle in China during 2008-2018: A systematic review and meta-analysis . Acta Trop 2019, 189 :117-123. Mamani M, Majzoobi MM, Keramat F, Varmaghani N, Moghimbeigi A: Seroprevalence of Brucellosis in Butchers, Veterinarians and Slaughterhouse Workers in Hamadan, Western Iran . J Res Health Sci 2018, 18 (1):e00406. Liu ZG, Wang M, Ta N, Fang MG, Mi JC, Yu RP, Luo Y, Cao X, Li ZJ: Seroprevalence of human brucellosis and molecular characteristics of Brucella strains in Inner Mongolia Autonomous region of China, from 2012 to 2016 . Emerg Microbes Infect 2020, 9 (1):263-274. Omer MK, Skjerve E, Woldehiwet Z, Holstad G: Risk factors for Brucella spp. infection In dairy cattle farms in Asmara, State of Eritrea . Prev Vet Med 2000, 46 (4):257-265. Diao Z: Serological investigation of Brucella in a largescale dairy farm and establishment of quadruple PCR detection method . In . : Northwest A&F University.; 2023. in press Mamisashvili E, Kracalik IT, Onashvili T, Kerdzevadze L, Goginashvili K, Tigilauri T, Donduashvili M, Nikolaishvili M, Beradze I, Zakareishvili M et al : Seroprevalence of brucellosis in livestock within three endemic regions of the country of Georgia . Prev Vet Med 2013, 110 (3-4):554-557. Yang Q, Zhang S, Liu L, Cao X, Lei C, Qi X, Lin F, Qu W, Qi X, Liu J et al : Application of mathematical expectation (ME) strategy for detecting low frequency mutations: An example for evaluating 14-bp insertion/deletion (indel) within the bovine PRNP gene . Prion 2016, 10 (5):409-419. Li J, Zhu X, Ma L, Xu H, Cao X, Luo R, Chen H, Sun X, Cai Y, Lan X: Detection of a new 20-bp insertion/deletion (indel) within sheep PRND gene using mathematical expectation (ME) method . Prion 2017, 11 (2):143-150. Dadar M, Tiwari R, Sharun K, Dhama K: Importance of brucellosis control programs of livestock on the improvement of one health . Vet Q 2021, 41 (1):137-151. Baoshan L, Yinbo Y, Jingbo Z, Yi Z, Jianghua Y, Dawei C, Chi M, Donghai Y, Bohan Y, Rongnian Z et al : Combined nucleic acid assays for diagnosis of A19 vaccine-caused human brucellosis . Transbound Emerg Dis 2021, 68 (2):368-374. Arif S, Heller J, Hernandez-Jover M, McGill DM, Thomson PC: Evaluation of three serological tests for diagnosis of bovine brucellosis in smallholder farms in Pakistan by estimating sensitivity and specificity using Bayesian latent class analysis . Prev Vet Med 2018, 149 :21-28. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3888156","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":268991570,"identity":"91362401-2377-447e-ab5c-f236e0f99c43","order_by":0,"name":"Yong Shi","email":"","orcid":"","institution":"Northwest A\u0026F University","correspondingAuthor":false,"prefix":"","firstName":"Yong","middleName":"","lastName":"Shi","suffix":""},{"id":268991571,"identity":"1d4f647e-f5a3-4d0a-baa5-291e1be212d3","order_by":1,"name":"Yimeng Cui","email":"","orcid":"","institution":"Northwest A\u0026F University","correspondingAuthor":false,"prefix":"","firstName":"Yimeng","middleName":"","lastName":"Cui","suffix":""},{"id":268991572,"identity":"00d441ff-9751-4b63-8c6b-d8d8cae1a785","order_by":2,"name":"Gaowa Wudong","email":"","orcid":"","institution":"Northwest A\u0026F University","correspondingAuthor":false,"prefix":"","firstName":"Gaowa","middleName":"","lastName":"Wudong","suffix":""},{"id":268991573,"identity":"196bc4b1-f28e-4da5-950d-467239a6a44d","order_by":3,"name":"Shengnan Li","email":"","orcid":"","institution":"Northwest A\u0026F University","correspondingAuthor":false,"prefix":"","firstName":"Shengnan","middleName":"","lastName":"Li","suffix":""},{"id":268991574,"identity":"2e11e0fe-0164-40a7-b6b3-8e82a87b86f9","order_by":4,"name":"Ye Yuan","email":"","orcid":"","institution":"Northwest A\u0026F University","correspondingAuthor":false,"prefix":"","firstName":"Ye","middleName":"","lastName":"Yuan","suffix":""},{"id":268991575,"identity":"62ebe27a-65d3-462b-9d32-90052753b085","order_by":5,"name":"Danyu Zhao","email":"","orcid":"","institution":"Northwest A\u0026F University","correspondingAuthor":false,"prefix":"","firstName":"Danyu","middleName":"","lastName":"Zhao","suffix":""},{"id":268991576,"identity":"df505073-05e2-4250-8ec8-54bfb34fbea2","order_by":6,"name":"Shurong Yin","email":"","orcid":"","institution":"Northwest A\u0026F University","correspondingAuthor":false,"prefix":"","firstName":"Shurong","middleName":"","lastName":"Yin","suffix":""},{"id":268991577,"identity":"95b16db4-3beb-493e-a105-f9744005c4c6","order_by":7,"name":"Ziyang Diao","email":"","orcid":"","institution":"Northwest A\u0026F University","correspondingAuthor":false,"prefix":"","firstName":"Ziyang","middleName":"","lastName":"Diao","suffix":""},{"id":268991578,"identity":"9a86a34f-745e-44e0-a58b-d771b398e632","order_by":8,"name":"Bin Li","email":"","orcid":"","institution":"Northwest A\u0026F University","correspondingAuthor":false,"prefix":"","firstName":"Bin","middleName":"","lastName":"Li","suffix":""},{"id":268991579,"identity":"4e1ebfb5-d9a8-48e2-a526-8f7a93f0a35d","order_by":9,"name":"Dong Zhou","email":"","orcid":"","institution":"Northwest A\u0026F University","correspondingAuthor":false,"prefix":"","firstName":"Dong","middleName":"","lastName":"Zhou","suffix":""},{"id":268991580,"identity":"d810cfac-7016-433f-949a-15555f238353","order_by":10,"name":"Xuejun Li","email":"","orcid":"","institution":"Animal Health supervision Institute of Lingwu City","correspondingAuthor":false,"prefix":"","firstName":"Xuejun","middleName":"","lastName":"Li","suffix":""},{"id":268991581,"identity":"25bb6a54-f938-463a-83c3-42444ffb68ef","order_by":11,"name":"Zhanlin Wang","email":"","orcid":"","institution":"Animal Disease Control and Prevention center of Lingwu City","correspondingAuthor":false,"prefix":"","firstName":"Zhanlin","middleName":"","lastName":"Wang","suffix":""},{"id":268991582,"identity":"f7225902-fc0a-4b89-8e19-cfa7f98e1a48","order_by":12,"name":"Fengxia Zhang","email":"","orcid":"","institution":"Animal Disease Control and Prevention center of Lingwu City","correspondingAuthor":false,"prefix":"","firstName":"Fengxia","middleName":"","lastName":"Zhang","suffix":""},{"id":268991583,"identity":"b5f6dc29-060e-436b-9cfe-11f9a08817bd","order_by":13,"name":"Min Xie","email":"","orcid":"","institution":"Animal Disease Control and Prevention center of Lingwu City","correspondingAuthor":false,"prefix":"","firstName":"Min","middleName":"","lastName":"Xie","suffix":""},{"id":268991584,"identity":"b598610b-958d-4e52-9641-a3314b37efc1","order_by":14,"name":"Zehui Zhao","email":"","orcid":"","institution":"Animal Disease Control and Prevention center of Lingwu City","correspondingAuthor":false,"prefix":"","firstName":"Zehui","middleName":"","lastName":"Zhao","suffix":""},{"id":268991585,"identity":"f339f91e-4e59-4edb-aa9a-989ec4585590","order_by":15,"name":"Aihua Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9klEQVRIiWNgGAWjYNACgwMMDOwNQIYNiJdArBYeIGZII1oLA1C5RAKRWgyOnz384kfBncT+mW+PSfxIOMzAz55jwPBzBx4tZ/LSLHsMniXOuJ2XJtkD1CLZ88aAsfcMbi1mB3LMDHgMDic23M4xu8H74zCDwY0cA2bGNjxazr8xM/wD1DL/5hmzm3+AttgT1HIjx/gxyJYNN3jMbvMAtRhIENBif+ONGbOMwWHjjWdyzH/LJKTzSJx5VnCwF48Wyf4c449v/hyWnXf8jLHhmwRrOf725I0PfuLRAgRsEsg8HhBxAK8GBgbmDwQUjIJRMApGwUgHAEGoWYFvkWLSAAAAAElFTkSuQmCC","orcid":"","institution":"Northwest A\u0026F University","correspondingAuthor":true,"prefix":"","firstName":"Aihua","middleName":"","lastName":"Wang","suffix":""},{"id":268991586,"identity":"6cba5b67-fe06-480c-9ef7-f64723ad7ca5","order_by":16,"name":"yaping Jin","email":"","orcid":"","institution":"Northwest A\u0026F University","correspondingAuthor":false,"prefix":"","firstName":"yaping","middleName":"","lastName":"Jin","suffix":""}],"badges":[],"createdAt":"2024-01-22 14:09:56","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3888156/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3888156/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":50297590,"identity":"a47a4f49-5ad5-4684-9218-45e58f09ae9b","added_by":"auto","created_at":"2024-01-29 10:49:29","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":100366,"visible":true,"origin":"","legend":"\u003cp\u003eDevelopment of a PCR method to identify \u003cem\u003eBrucella\u003c/em\u003e A19 and non-A19 strains. M, DL 1000 DNA Marker; 1, \u003cem\u003eB. abortus\u003c/em\u003e A19 strain; 2, \u003cem\u003eB. abortus\u003c/em\u003e 2308 strain; 3, \u003cem\u003eB. suis\u003c/em\u003e S2 strain; 4, \u003cem\u003eB. melitensis \u003c/em\u003e16M strain; 5, Negative control.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-3888156/v1/6a6bbd90e5984d183a55775e.png"},{"id":50297596,"identity":"c38a26ec-44fb-459e-8cdb-13e272097cf3","added_by":"auto","created_at":"2024-01-29 10:49:30","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":86424,"visible":true,"origin":"","legend":"\u003cp\u003eSpecificity of the PCR method for identification of \u003cem\u003eBrucella\u003c/em\u003e A19 and non-A19 strains. M, DL 1000 DNA Marker; 1, \u003cem\u003eB. abortus\u003c/em\u003eA19 strain; 2, \u003cem\u003eB. suis\u003c/em\u003e S2 strain; 3, \u003cem\u003eEscherichia coli\u003c/em\u003e; 4, \u003cem\u003eSalmonella\u003c/em\u003e; 5, \u003cem\u003eStaphylococcus\u003c/em\u003e; 6, \u003cem\u003eStreptococcus\u003c/em\u003e; 7, Negative control.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-3888156/v1/a5934243deb0f01c020ee25c.png"},{"id":50297588,"identity":"b03cab2f-ebec-4969-934b-35a7a943fb76","added_by":"auto","created_at":"2024-01-29 10:49:29","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":121197,"visible":true,"origin":"","legend":"\u003cp\u003eInvestigation of \u003cem\u003eBrucella\u003c/em\u003e field strains in 10 large-scale dairy farms using the established PCR method. M, DL 1000 DNA Marker; 1, \u003cem\u003eB. abortus\u003c/em\u003e A19 strain; 2, \u003cem\u003eB. suis\u003c/em\u003e S2 strain; 3–12, field strains; 13, Negative control.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-3888156/v1/27f30d6a9b6617784b3c59d3.png"},{"id":50297598,"identity":"686200d4-d61a-4c55-b555-e34bae836b3c","added_by":"auto","created_at":"2024-01-29 10:49:30","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":121325,"visible":true,"origin":"","legend":"\u003cp\u003eThe identification of \u003cem\u003eBrucella\u003c/em\u003efield strain species. M, DL 1000 DNA Marker; 1, \u003cem\u003eB. abortus\u003c/em\u003e A19 strain; 2, \u003cem\u003eB. suis\u003c/em\u003e S2 strain; 3, \u003cem\u003eB. melitensis\u003c/em\u003e 16M strain; 4–13, field strains; 14, Negative control.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-3888156/v1/659714ac41c6e88532807797.png"},{"id":53844018,"identity":"d4183663-57b0-41c1-8d19-35d9836ebb2a","added_by":"auto","created_at":"2024-04-01 08:08:16","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1838684,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3888156/v1/c6859225-d305-4386-ba8d-ced6184d9b10.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Investigation of the prevalence of Brucella antibodies and field strains in immunized dairy herds in Lingwu, Ningxia","fulltext":[{"header":"Introduction","content":"\u003cp\u003eBrucellosis is caused by bacteria of the genus Brucella[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e], which can lead to a potentially debilitating chronic infection associated with febrile illness in humans, and abortion, premature birth and decreased productivity in livestock[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Thus, brucellosis is serious public health threat and is associated with significant economic losses in the livestock industry animals[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Over 500,000 new human cases of brucellosis are diagnosed each year [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], although the true number of cases is likely to be much higher due to inaccurate diagnosis, inadequate surveillance, and incomplete reporting. Brucellosis is widespread throughout the world, only a few countries in the world have successfully achieved brucellosis purification[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cem\u003eBrucellae\u003c/em\u003e are non-motile, non-spore-forming, and slow-growing Gram-negative coccobacilli belonging to the \u003cem\u003eBrucellaceae\u003c/em\u003e family in the alpha-2 subclass of the proteobacteria[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. In recent years, 12 new species of \u003cem\u003eBrucella\u003c/em\u003e have been identified[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Brucellosis is transmitted horizontally or vertically among both domestic and feral animals, and person-to-person transmission of the infection is rare[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. \u003cem\u003eB. melitensis\u003c/em\u003e, \u003cem\u003eB. abortus\u003c/em\u003e, \u003cem\u003eB. suis\u003c/em\u003e, and \u003cem\u003eB. canis\u003c/em\u003e are the main causes of the disease in humans, with infections resulting from direct contact with birth fluids or infected tissues, or \u003cem\u003eBrucella\u003c/em\u003e aerosol[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Consumption of unpasteurized dairy products infected with \u003cem\u003eBrucella\u003c/em\u003e spp. is also a major route for human infection[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eControl of zoonotic diseases in human populations has relied heavily on the control of animal disease[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Vaccination is the main strategy for the prevention and control of brucellosis[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. \u003cem\u003eB. abortus\u003c/em\u003e S19, RB51, and \u003cem\u003eB. melitensis\u003c/em\u003e Rev. 1 vaccines have been widely used in many countries[\u003cspan additionalcitationids=\"CR21\" citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], while \u003cem\u003eB. abortus\u003c/em\u003e A19, \u003cem\u003eB. melitensis\u003c/em\u003e M5 and \u003cem\u003eB. suis\u003c/em\u003e S2 vaccines are used in China[\u003cspan additionalcitationids=\"CR24\" citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. The A19 and S19 strains are predominantly utilized for Brucella vaccination in cattle[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], both originating from \u003cem\u003eBrucella abortus\u003c/em\u003e strain19 isolated in the United States in 1923, exhibited a 99.9% homology, with A19 lacking the 702-bp deletion in the erythritol gene that was present in S19[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Although \u003cem\u003eBrucella\u003c/em\u003e live attenuated vaccines can cause abortions in pregnant animals and are virulent in humans, this approach has played an important part in controlling the spread of epidemics and reducing the incidence of human disease[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. However, most vaccines are smooth strains, as most serologic tests are primarily based on detection of antibodies against the O-side chain of \u003cem\u003eBrucella\u003c/em\u003e, discriminating between vaccine-induced antibodies and those generated by field virus infection poses a challenge[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Therefore, bacterial culture and nucleic acid amplification are necessary for the diagnosis of brucellosis in animals.\u003c/p\u003e \u003cp\u003eThe vaccination-test-slaughter eradication strategy is commonly employed for brucellosis control in many countries[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Typically, the presence of antibodies is detected for a period of time after vaccination and antibody-positive livestock are subsequently culled. In China, according to the Technical Points for Brucellosis Prevention and Control (1st edition) issued by the Ministry of Agriculture of the People\u0026rsquo;s Republic of China, cattle should be monitored for A19 strain vaccine antibodies for a period of 12 months post-immunization. This prescribed approach implicitly recognizes the loss of immune antibodies 12 months post immunization with A19 vaccine. However, it has been reported that vaccine-induced antibodies persist in cattle immunized with Brucella S19 strain vaccine 12 months after vaccination, making it a challenge to differentiate between vaccine-induced antibodies and those resulting from field strain infection [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Consequently, if cattle continue to test positive for antibodies beyond 12 months, indiscriminate culling may lead to erroneous elimination of cattle that are not infected field Brucella, causing significant economic losses.\u003c/p\u003e \u003cp\u003eSimilar to other provinces in northwest China where brucellosis is highly endemic, a program of livestock immunization with the brucellosis vaccine has been implemented in NingXia Province. However, there is a paucity of reports regarding the seropositivity rate of anti-Brucella antibodies and the prevalence of field strains in livestock within the areas in which this strategy has been implemented. The absence of this data severely hampers the development of effective prevention and control strategies for brucellosis in these regions, particular human brucellosis [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. The Chinese government has placed great emphasis on the prevention and control of brucellosis, as evidenced by the implementation of the Five-Year Action Plan for Brucellosis Prevention and Control in Livestock (2022\u0026ndash;2026), which aims to achieve control of the individual positive rate at \u0026lt;\u0026thinsp;0.4% and the herd positive rate at \u0026lt;\u0026thinsp;7%. In 2022, the dairy cow population in Lingwu City reached 196,400 and produced an annual output of 567,900 tons of milk, ranking second in NingXia Province. The expansion of dairy farming scale in recent years has significantly heightened the risk of brucellosis transmission[\u003cspan additionalcitationids=\"CR33\" citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Epidemiological investigation is the first step to achieving the goal of brucellosis eradication. The objective of this study was to elucidate the serological and etiological status of brucellosis in immunized dairy herds and their interrelationships, thereby providing a scientific foundation for epidemiological investigation, control, and eradication of brucellosis in this region as well as other areas where immunization is implemented.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e \u003cb\u003eIdentification of the DNA sequence that distinguishes\u003c/b\u003e \u003cb\u003eBrucella\u003c/b\u003e \u003cb\u003eA19 from other strains\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eBrucella\u003c/em\u003e A19 vaccine is utilized for cattle immunization in dairy farms located in Lingwu City. Therefore, it is imperative to establish a method that can differentiate the \u003cem\u003eBrucella\u003c/em\u003e A19 strain from other strains. We utilized the genome comparison software Mauve to conduct a comparative analysis of the reference sequences of \u003cem\u003eBrucella\u003c/em\u003e A19 strain (NZ_CP030751.1, NZ_CP030752.1) and the classical strain 2308 (NC_007618.1, NC_007624.1) in the NCBI database. The resulting sequence fragments were subsequently verified by BLAST program on the NCBI website, ultimately revealing distinct variations in sequence between the \u003cem\u003eBrucella\u003c/em\u003e A19 strain and other strains.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePCR-based differential diagnostic approach\u003c/h2\u003e \u003cp\u003ePCR primers were designed to distinguish A19 from other strains according to the specific sequence differences using Primer5 software. The specificity of the primers was verified by PCR using genomic DNA from \u003cem\u003eB. abortus\u003c/em\u003e A19 strains, \u003cem\u003eB. suis\u003c/em\u003e S2 strain, \u003cem\u003eEscherichia coli\u003c/em\u003e, \u003cem\u003eSalmonella\u003c/em\u003e, \u003cem\u003eStaphylococcus\u003c/em\u003e and \u003cem\u003eStreptococcus\u003c/em\u003e preserved in our laboratory. The 25-\u0026micro;l PCR system comprised 12.5 \u0026micro;l 2\u0026times; Taq PCR Mix (Vazyme Biotech Co., Ltd, China), 1 \u0026micro;l each primer, 5 \u0026micro;l double-distilled water, and 2.5 \u0026micro;l template DNA. The PCR amplification was performed using the following parameters: pre-denaturation at 95\u0026deg;C for 5 min followed by 35 cycles of denaturation at 95\u0026deg;C for 60 s, annealing at 58\u0026deg;C for 30 s and extension at 72\u0026deg;C for another 30 s. The amplified products were analyzed on 1% agarose electrophoresis gel and visualized under ultraviolet light.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eSerological tests\u003c/h2\u003e \u003cp\u003eWhole blood (2\u0026ndash;5 ml) was collected from the tail vein of the selected livestock. To isolate the serum, the samples were incubated at 37℃ for 1 h and then centrifuged at 3,000 rpm for 5 min. The sera were decanted and stored at \u0026minus;\u0026thinsp;20\u0026deg;C prior to testing with a commercial Rose Bengal Plate Test (RBPT) for \u003cem\u003eBrucella\u003c/em\u003e (Institute of Veterinary Drug Control, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eProcessing of swab samples\u003c/h2\u003e \u003cp\u003eTotal DNA was extracted from vaginal swab samples for PCR amplification using a highly effective commercial DNA extraction kit (Tiangen Biochemical Technology Co., China) according to the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003cp\u003e \u003cb\u003eThe seroprevalence investigation of Brucella antibody in vaccinated cattle in Lingwu City.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe cross-sectional serological survey was conducted in seven townships in Lingwu City from 2021 to 2023. The subjects included cattle that were immunized with a brucellosis A19 strain vaccine more than one year prior to the study. To ensure a comprehensive analysis, at least 20 samples were collected from large-scale pastures, while a minimum of three samples were obtained from smallholder farms. The serologic and etiological testing for Brucella was subsequently conducted.\u003c/p\u003e \u003cp\u003e \u003cb\u003eInvestigation of the positive rate of Brucella antibodies in dairy herds of three brucellosis-free dairy farms\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe cows in the three dairy farms were sourced from brucellosis-free regions of Australia and New Zealand with strict adherence to self-breeding practices. With a robust biosafety system in place, the annual abortion rate across all pastures remained below 5%, while no instances of Brucella field strains infection were detected during continuous brucellosis surveillance of cattle for nearly a year. The blood and vaginal swab samples were randomly collected from cows that had been immunized with the brucellosis A19 vaccine a minimum of 12 months previously, ensuring a ratio of no less than 10% in each ranch. Serologic and etiological testing for Brucella was conducted subsequently.\u003c/p\u003e \u003cp\u003e \u003cb\u003eInvestigation of\u003c/b\u003e \u003cb\u003eBrucella\u003c/b\u003e \u003cb\u003efield strains among cattle in 10 dairy farms\u003c/b\u003e\u003c/p\u003e \u003cp\u003eBlood and vaginal swab samples were collected from cattle that had immunized with Brucella A19 vaccine for more than 12 months in 10 dairy farms, with a minimum sampling proportion of 10%. Serologic and etiological testing for Brucella was conducted subsequently. DNA positive samples were further characterized using a multiple PCR method for \u003cem\u003eBrucella\u003c/em\u003e species identification [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e], which successfully addressed the limitations of the AMOS-PCR method in distinguishing \u003cem\u003eB. abortus\u003c/em\u003e type 3[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eMolecular detection of brucellosis utilizing the mathematical expectation method\u003c/h2\u003e \u003cp\u003eThe previously reported method for mutation screening utilizing the mathematical expectation (ME) strategy exhibits both speed and accuracy, making it suitable for large sample sizes with low frequency mutations[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. We utilized ME values to expedite large-scale detection of brucellosis in domestic animals, thereby saving time and effort. We applied the expected prevalence rate of 3% for brucellosis in livestock within Lingwu City adopted in a previous official sampling strategy to our formula and concluded that the number of required detections could be minimized by mixing 6 samples. Therefore, we consolidated the DNA extracted from 6 samples into a composite sample for PCR detection. In the event of a positive result from the pooled sample, each of the six samples was tested individually.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eDistinctive differential sequences of\u003c/b\u003e \u003cb\u003eBrucella\u003c/b\u003e \u003cb\u003eA19 strain\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe genome comparison software Mauve was used to determine differences in the genome sequences of the A19 and classical 2308 strains based on the reference sequences of Brucella A19 strain and the classical strain 2308. This comparison revealed a 68-bp sequence deficiency in the genome of the A19 strain between positions 371,765 and 371,766 on Chromosome 2, which corresponds to the sequence between positions 371,759 and 371,826 of the 2308 strain genome. Although the comparison of the reference genomes indicated a deletion of 72-bp genetic sequence, our results indicate otherwise. The 68-bp deletion sequence is \u003cem\u003eGGTGTGGTCGCGGGCTTCCTGATGCAGGGCGTGACCTTGCAGGAATTCGGC ATCATCCTTTATTTCCC\u003c/em\u003e. Comparison of the genome sequences of Brucella strains from positions 371,465 to 372,065 using the BLAST program in NCBI showed that only A19, LBAB038, S19 and 19BA strains had 100% similarity compared to other Brucella strains. Thus, our data revealed that only these four Brucella strains lacked the deletion of 68-bp bases identified by the Mauve software.\u003c/p\u003e \u003cp\u003e \u003cb\u003ePCR-based identification of\u003c/b\u003e \u003cb\u003eBrucella\u003c/b\u003e \u003cb\u003estrain A19\u003c/b\u003e\u003c/p\u003e \u003cp\u003eUsing the classical 2308 strain of \u003cem\u003eBrucella\u003c/em\u003e as a template, we used Primer 5 software to design a pair of primers across the 68-bp deleted sequence of A19 to establish a PCR method for distinguishing A19 strains from other strains. The upstream and downstream primer sequences were 5'-TCGTTCCTTTCGCCCTATTAC-3' and 5'-TGTTGAAGCCGAGCCAGTC-3', respectively. The expected amplicon size for strain A19 was 374 bp, while other strains were predicted to yield a fragment of 442 bp. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, the established PCR method generated products of the expected sizes for strains A19, 2308, S2 and 16M.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003ePCR assay specificity\u003c/h2\u003e \u003cp\u003eTo assess the discriminatory power of the established PCR method among a A19 vaccine strain, non-A19 \u003cem\u003eBrucella\u003c/em\u003e strains and other non-\u003cem\u003eBrucella\u003c/em\u003e strains, DNA amplification was performed using these strains as templates. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, a 374-bp fragment was amplified from A19 DNA template, while a 442-bp product was generated from non-A19 Brucella strains, while no amplification signal was detected from the other non-A19 \u003cem\u003eBrucella\u003c/em\u003e strains. These results indicated the high specificity of this PCR method and its ability to differentiate between A19 and other non-A19 \u003cem\u003eBrucella\u003c/em\u003e strains.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eThe seroprevalence investigation of Brucella antibody in vaccinated cattle in Lingwu City\u003c/h2\u003e \u003cp\u003eThe \u003cem\u003eBrucella\u003c/em\u003e antibody seropositivity rates in dairy cows immunized for more than 12 months in Lingwu City from 2021 to 2023 are shown in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. A total of 5,435 samples were collected over the course of three years with 1,726 collected in 2021, 2,146 in 2022, and 1,563 in 2023. According to the RBPT method, 1,447 of these samples were seropositive, accounting for 23.4%, 26.7%, and 30.0%, respectively, of the samples collected in each of the three years. The average prevalence of \u003cem\u003eBrucella\u003c/em\u003e antibody seropositivity in dairy cattle was 26.6%.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003e\u003cem\u003eBrucella\u003c/em\u003e antibody seropositivity rate in dairy cows in Lingwu City from 2021 to 2023\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYear\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNumber\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNumber of positives\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePositive rate\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2021\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1726\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e404\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e23.4%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2022\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2146\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e574\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e26.7%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2023\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1563\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e469\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e30.0%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe herd \u003cem\u003eBrucella\u003c/em\u003e antibody seropositivity rates in Lingwu City from 2021 to 2023 are shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. The numbers of farms sampled from 2021\u0026ndash;2023 were 234, 265, and 123 respectively, with corresponding herd seropositivity rates of 32.91%, 36.23%, and 55.28%, respectively. Additionally, the average herd seropositivity rate for cattle in Lingwu was 38.75%.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eHerd \u003cem\u003eBrucella\u003c/em\u003e antibody seropositivity rates in Lingwu City from 2021 to 2023\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYear\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNumber\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNumber of positives\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePositive rate\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2021\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e234\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e77\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e32.9%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2022\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e265\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e96\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e36.2%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2023\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e123\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e68\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e55.3%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eThe seroprevalence of Brucella antibodies in three brucellosis-free dairy farms\u003c/h2\u003e \u003cp\u003eA total of 533 cows from three dairy farms immunized with Brucella 19 vaccine more than 12 months previously were tested for antibodies. The positive rates of Brucella-specific antibodies were 26.5%, 18.0%, and 5.4%, respectively. Brucella molecules were not detected in vaginal swab samples collected from both antibody-negative and antibody-positive cattle. The specific results are presented in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe seroprevalence of Brucella antibodies in three brucellosis-free dairy farms\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eFarm\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003enumber\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eSerological testing\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003ePCR testing\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePositive Number\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePositive rate\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePositive Number\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePositive rate\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e253\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e67\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e26.5%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e150\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e18.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e130\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e5.4%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eInvestigation of\u003c/b\u003e \u003cb\u003eBrucella\u003c/b\u003e \u003cb\u003efield strains among cattle in 10 dairy farms\u003c/b\u003e\u003c/p\u003e \u003cp\u003eWe next evaluated the established PCR method to identify \u003cem\u003eBrucella\u003c/em\u003e field strains in dairy cattle 1004 samples collected from 10 dairy farms (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). \u003cem\u003eBrucella\u003c/em\u003e field strains were found to be present in 5 of the 10 farms. Furthermore, all 10 \u003cem\u003eBrucella\u003c/em\u003e field strains were identified (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e), further identification as \u003cem\u003eBrucella abortus\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). The dairy herd antibody-positive rate ranged from 10.5\u0026ndash;41.2%. In particular, the cows that tested positive for the Brucella field strains were all found to be antibody-positive within 15 days of abortion.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eDetection of the \u003cem\u003eBrucella\u003c/em\u003e field strain in 10 dairy farms\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eFarm\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003enumber\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eSerological testing\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e \u003cp\u003ePCR testing\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePositive Number\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePositive rate\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePositive Number\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePositive rate\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e185\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e17.3%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e103\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e22.3%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e143\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e10.5%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e106\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e15.1%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e69\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2.9%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e33.3%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e97\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2.1%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e41.2%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e75\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1.3%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e36.0%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e23.3%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.6%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e41.1%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e80\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3.8%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c6\"\u003e \u003cp\u003e38.8%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eMolecular detection of brucellosis utilizing mathematical expectations\u003c/h2\u003e \u003cp\u003eUsing the established PCR method, we analyzed a total of 1537 samples. The ME method offers the advantage that six samples can be pooled into one for detection purposes. Analysis of all 1,537 samples in only 306 tests using this method yielded the required number of detections was achieved. This represented a significant decrease in the workload of 80.1% and a greatly enhanced detection efficiency (Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eStatistics of reaction times based on ME method\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBreeds\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eData\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSizes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1537\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAssumed prevalence\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e3.0%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNumber of individuals in one reaction time(NR1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eReaction times (RT1)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1537\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNumber of individuals in one mixed group (NG6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eReaction times (RT6)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e306\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eReduction rate (RR)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e80.1%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIt is of significant value to conduct investigations on the prevalence rate of Brucella antibodies and the field strains of \u003cem\u003eBrucella\u003c/em\u003e in livestock, as this can aid in controlling the spread of brucellosis among livestock, thereby reducing the incidence of human brucellosis, and promoting eradication of this disease[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. The rate of persistence of antibody immunity more than 12 months after Brucella vaccine immunization in NingXia remains unknown. In this study, we aimed to elucidate the serological and etiological status of brucellosis in immunized dairy herds and their interrelationships, thereby providing a scientific foundation for epidemiological investigation, control, and eradication of brucellosis in this region as well as other areas where immunization is implemented.\u003c/p\u003e \u003cp\u003eTo overcome the challenge of identifying cattle infected with Brucella field strains, we aimed to identify deletion or addition sequences of the Brucella A19 vaccine strain by comparing its genome sequence with those of other strains. For this purpose, we used the gene collinearity analysis software Mauve, a JAVA-based program for gene sequence comparison that incorporates elements from the BLAST program. Using this approach, we identified a 68-bp deletion fragment on chromosome 2 specific to the A19 strain, which was consistent with previous reports[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e].Then we subsequently designed upstream and downstream primers to discriminate between A19 and non-A19 strains of Brucella based on the size difference of the target amplified fragment using PCR methodology. Validation of this technique revealed that this method exhibits excellent specificity and can be utilized with precision in both laboratory tests and clinical trials. In this study, we successfully applied this method to identify cows infected with field Brucella strains in dairy herds. Furthermore, this method can also be employed for identifying A19 and non-A19 strains of Brucella in cattle in other vaccination areas.\u003c/p\u003e \u003cp\u003eIn Lingwu, cattle are typically first immunized with the Brucella vaccine between 3 to 8 months of age, followed by a low-dose booster at 3 months later. Based on this vaccine immunization program implemented from 2021 to 2023, individual \u003cem\u003eBrucella\u003c/em\u003e antibody-positive rates among cattle vaccinated in Lingwu City were recorded as 23.4%, 26.7%, and 30.0% respectively, while herd positivity rates stood at 32.9%, 36.2%, and 55.3%, respectively. The seroprevalence of \u003cem\u003eBrucella\u003c/em\u003e antibodies in dairy cows exceeded that reported previously[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], potentially due to the increased utilization of vaccines or the escalated dissemination of brucellosis. Due to local implementation of the \u003cem\u003eBrucella\u003c/em\u003e A19 vaccine, traditional serological methods are not suitable for differentiating antibody responses caused by infections with field strains of \u003cem\u003eBrucella\u003c/em\u003e [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e].These findings indicate that a certain proportion of cattle immunized with the brucellosis vaccine remain seropositive for more than one year in Lingwu immunized dairy herds. The achievement of an individual seropositive rate below 0.4% and a population seropositive rate below 7% by 2026 poses significant challenges. The results of a large-scale serological survey revealed that an average 26.7% percentage of cows vaccinated with the immune Brucella A19 strain vaccine test positive for antibodies after 12 months. We hypothesize that many of these antibodies are persistent and produced by the vaccine itself. It is suspected that the persisting antibody may be attributed to previous immunization (prime and boost) with Brucella vaccines in the Lingwu area, and that A19 strains exhibit stronger virulence compared to the S19 strain[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Therefore, we conducted an additional seroprevalence survey on dairy farms free from brucellosis to ascertain the proportion of antibodies that persist 12 months post-vaccination.\u003c/p\u003e \u003cp\u003ePrevious research has shown that this immunization program effectively renders cows negative for brucellosis after 7 months under experimental conditions [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. However, our investigation of three Brucella-free dairy farms revealed that between 5.4% and 26.5% of cows still tested positive for A19 vaccine-induced antibodies at 12 months post-immunization. Additionally, no evidence of field Brucella was found in swab tests conducted on these cattle, and the most did not exhibit typical symptoms such as abortion associated with brucellosis. Therefore, we infer that these persistent antibodies are durable titers induced by the vaccine, which aligns with previous findings [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. The presence of these persistent antibodies is likely influenced by factors such as vaccine virulence and immunization schedule. Consequently, serological methods alone cannot accurately diagnose bovine brucellosis in immune areas nor can arbitrary culling serologically positive individuals guarantee the elimination of actual cases since a significant number of uninfected Brucella field strains cattle may be unnecessarily destroyed.\u003c/p\u003e \u003cp\u003eA total of 1004 bovine vaginal swabs from vaccinated cattle were collected to detect 10 field strain samples, all of which were further identified as \u003cem\u003eBrucella abortus\u003c/em\u003e. Since it has been reported that human brucellosis in NingXia is predominantly caused by \u003cem\u003eBrucella melitensis\u003c/em\u003e[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e], our results further suggested that sheep suffering from brucellosis in NingXia are an important source of human brucellosis. Thus, there is a need to strengthen prevention and control measures for brucellosis in sheep to reduce the incidence of human cases. We speculated that the risk of transmission of brucellosis in dairy cattle in Lingwu City was the brucellosis in cattle itself, not other domestic animals. It is particularly noteworthy that Brucella field strains were not detected in the antibody-negative cattle, while those infected with Brucella field strains cattle all tested positive for antibodies and abortion occurred within 15 days. Previous reports[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e] have indicated that cows infected with brucella typically do not transmit the infection to other animals unless calving or aborting, after which they become efficient transmitters via products of parturition. However, their ability to infect other animals diminishes rapidly after delivery, usually within 30 days[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Our findings support this perspective and suggest that timely identification of abortion cases can serve as an effective means for eradication of Brucella-infected cattle by continuous culling. Our results confirmed the positive role of the Brucella A19 vaccine in reducing the incidence of brucellosis induced abortion in cattle by visiting farm ranch workers, but also demonstrated that vaccine cannot be used as the only means of decontamination, as cattle cannot rely on the protective effect of vaccine to clear Brucella field strains. The findings provide valuable data for informing the prevention and control strategy of brucellosis in dairy cattle in areas of dairy herds immunized with the A19 vaccine.\u003c/p\u003e \u003cp\u003eEpidemiological investigations usually involve large sample sizes and require time-consuming and labor-intensive testing. In the current study, we were able to reduce the number of tests from 1537 required to analyze all the samples individually using traditional techniques, to only 306 by employing the ME strategy where six samples are mixed into one test, thereby reducing the test workload by 80.1%. Thus, the ME strategy is a time-saving and cost-effective method for molecular detection of brucellosis.\u003c/p\u003e \u003cp\u003eThis study also has certain limitations. The RBPT method utilized for analysis of a large number of serum samples serves as a preliminary screening approach for brucellosis antibodies, rather than a diagnostic method. In comparison with the cELISA method, the RBPT method exhibits lower sensitivity [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. However, RBPT is more rapid, cost-effective, and suitable for widespread use at the grassroots level compared to cELISA. Nucleic acids were extracted for PCR analysis from vaginal swab samples collected from cows that were immunized more than 12 months previously. Due to the fact that field strains of \u003cem\u003eBrucella\u003c/em\u003e were not in their excretion period during sampling of infected cattle, these cases may be missed. Therefore, it is strongly recommended that individual molecular detection should be conducted on abortive cattle and those affected by brucellosis should be eliminated promptly. In this study, we also discovered a significant number of antibody-positive cattle one year after immunization of herds with Brucella attenuated vaccine; however, not all of these cattle were infected with field strains of brucellosis. Consequently, investigating the duration of antibodies and influencing factors following immunization with Brucella A19 vaccine should be considered as a future research direction. These vaccine-induced antibodies may interfere with efforts aimed at eradication of brucellosis and mistaken culling of these cattle would result in substantial economic losses and burdens both for ranches and local governments.\u003c/p\u003e \u003cp\u003eThe eradication of brucellosis is a complex and costly endeavor. Many countries, including the United States and Australia, have dedicated decades to achieving success, while many countries have failed due to inadequate policy implementation, insufficient funding, and lack of awareness among farmers (Zhang, 2018). Vaccination has been implemented in Northwest of China for several years now. This survey revealed that immunization has significantly reduced the incidence of brucellosis in many farms, confirming the effectiveness of the local vaccine immunization program, although it is crucial to consider factors such as local vaccine immunization programs, vaccine-induced antibody persistence, and epidemic strains of brucella. After a certain period of time, simply relying on serological tests to determine whether cattle are infected with wild strains is not sufficient and inappropriate criteria for brucellosis diagnosis may result in the unnecessary culling of a significant number of domestic animals, leading to substantial economic losses and impeding the progress of animal husbandry. In summary, we propose that the diagnosis of brucellosis in cattle vaccinated with Brucella A19 strain vaccine should not solely rely on serological methods due to the persistence of vaccine-induced antibodies, but rather incorporate PCR methods to detect field Brucella infection.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe animal study was reviewed and approved by the Experiment Center of Northwest A\u0026amp;F University (Approval No.2021028) and was in accordance with the Ethics on Animal Care guidelines for the use of animals in the experimental research. \u0026nbsp;Performed under the control of the \u0026ldquo;Guidelines on Ethical Treatment of Experimental Animals\u0026quot; (2006) No.398 set by the Ministry of Science and Technology, China.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe raw data used and/or analyzed during the current study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eexperimental design and planning: A.W, Y.P, Y.S, Y.C;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eserological analysis G.W, S.L, Y.Y;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003emolecular detection: D.Z, S.Y\u0026nbsp;\u003c/p\u003e\n\u003cp\u003edata processing and statistical analysis Z.D, B.L;\u003c/p\u003e\n\u003cp\u003ethe sample collection: X.L, Z.L, F.Z, M.X, Z.Z;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003edrafting of the manuscript: Y.S;\u0026nbsp;\u003c/p\u003e\n\u003cp\u003ecritical revision of the manuscript: A.W, Y.P, D.Z, W.L\u003c/p\u003e\n\u003cp\u003eAll authors read and approved the manuscript\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was financially supported by the\u0026nbsp;General Project of the Key Research and Development Program of Ningxia Hui Autonomous Region.\u0026nbsp;The project, titled \u0026quot;Research and Development and Application of Prevention and Control Technology for Reproductive Disorders in Dairy Cows,\u0026quot; was assigned the project number 2018BBF33001.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Ma Xingyun, Ma Lei, Ma Jiajun and others from Ningxia Xingyuanda Farming and Animal Husbandry Co., LTD for their help and support in this study. \u003cstrong\u003eAuthor details\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e1 College of Veterinary Medicine, Northwest A\u0026amp;F University, Yangling District, Xianyang 712100, China;\u003c/p\u003e\n\u003cp\u003e2 Key Laboratory of Animal Biotechnology of the Ministry of Agriculture, Northwest A\u0026amp;F University, Yangling District, Xianyang 712100, China\u003c/p\u003e\n\u003cp\u003e3 Animal Health supervision Institute of Lingwu City, Ningxia 750000, China\u003c/p\u003e\n\u003cp\u003e4 Animal Disease Control and Prevention center of Lingwu City, Ningxia 750000, China\u003c/p\u003e\n\u003cp\u003e* Correspondence:
[email protected];
[email protected];\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eMoreno E: \u003cstrong\u003eRetrospective and prospective perspectives on zoonotic brucellosis\u003c/strong\u003e. \u003cem\u003eFront Microbiol\u0026nbsp;\u003c/em\u003e2014, \u003cstrong\u003e5\u003c/strong\u003e:213.\u003c/li\u003e\n \u003cli\u003eKneipp C, Malik R, Mor SM, Wiethoelter AK: \u003cstrong\u003eCommentary: Retrospective and prospective perspectives on zoonotic brucellosis\u003c/strong\u003e. \u003cem\u003eFront Microbiol\u0026nbsp;\u003c/em\u003e2019, \u003cstrong\u003e10\u003c/strong\u003e:1859.\u003c/li\u003e\n \u003cli\u003eGodfroid J: \u003cstrong\u003eBrucellosis in livestock and wildlife: zoonotic diseases without pandemic potential in need of innovative one health approaches\u003c/strong\u003e. \u003cem\u003eArch Public Health\u0026nbsp;\u003c/em\u003e2017, \u003cstrong\u003e75\u003c/strong\u003e:34.\u003c/li\u003e\n \u003cli\u003eYuan HT, Wang CL, Liu LN, Wang D, Li D, Li ZJ, Liu ZG: \u003cstrong\u003eEpidemiologically characteristics of human brucellosis and antimicrobial susceptibility pattern of Brucella melitensis in Hinggan League of the Inner Mongolia Autonomous Region, China\u003c/strong\u003e. \u003cem\u003eInfect Dis Poverty\u0026nbsp;\u003c/em\u003e2020, \u003cstrong\u003e9\u003c/strong\u003e(1):79.\u003c/li\u003e\n \u003cli\u003eDean AS, Crump L, Greter H, Schelling E, Zinsstag J: \u003cstrong\u003eGlobal burden of human brucellosis: a systematic review of disease frequency\u003c/strong\u003e. \u003cem\u003ePLoS Negl Trop Dis\u0026nbsp;\u003c/em\u003e2012, \u003cstrong\u003e6\u003c/strong\u003e(10):e1865.\u003c/li\u003e\n \u003cli\u003eSingh BB, Khatkar MS, Aulakh RS, Gill JPS, Dhand NK: \u003cstrong\u003eEstimation of the health and economic burden of human brucellosis in India\u003c/strong\u003e. \u003cem\u003ePrev Vet Med\u0026nbsp;\u003c/em\u003e2018, \u003cstrong\u003e154\u003c/strong\u003e:148-155.\u003c/li\u003e\n \u003cli\u003ePappas G, Papadimitriou P, Akritidis N, Christou L, Tsianos EV: \u003cstrong\u003eThe new global map of human brucellosis\u003c/strong\u003e. \u003cem\u003eLancet Infect Dis\u0026nbsp;\u003c/em\u003e2006, \u003cstrong\u003e6\u003c/strong\u003e(2):91-99.\u003c/li\u003e\n \u003cli\u003eSeleem MN, Boyle SM, Sriranganathan N: \u003cstrong\u003eBrucellosis: a re-emerging zoonosis\u003c/strong\u003e. \u003cem\u003eVet Microbiol\u0026nbsp;\u003c/em\u003e2010, \u003cstrong\u003e140\u003c/strong\u003e(3-4):392-398.\u003c/li\u003e\n \u003cli\u003eZhang N, Huang D, Wu W, Liu J, Liang F, Zhou B, Guan P: \u003cstrong\u003eAnimal brucellosis control or eradication programs worldwide: A systematic review of experiences and lessons learned\u003c/strong\u003e. \u003cem\u003ePrev Vet Med\u0026nbsp;\u003c/em\u003e2018, \u003cstrong\u003e160\u003c/strong\u003e:105-115.\u003c/li\u003e\n \u003cli\u003eBarbier T, Collard F, Zuniga-Ripa A, Moriyon I, Godard T, Becker J, Wittmann C, Van Schaftingen E, Letesson JJ: \u003cstrong\u003eErythritol feeds the pentose phosphate pathway via three new isomerases leading to D-erythrose-4-phosphate in Brucella\u003c/strong\u003e. \u003cem\u003eProc Natl Acad Sci U S A\u0026nbsp;\u003c/em\u003e2014, \u003cstrong\u003e111\u003c/strong\u003e(50):17815-17820.\u003c/li\u003e\n \u003cli\u003eBowman DD: \u003cstrong\u003eIntroduction to the alpha-proteobacteria: Wolbachia and Bartonella, Rickettsia, Brucella, Ehrlichia, and Anaplasma\u003c/strong\u003e. \u003cem\u003eTop Companion Anim Med\u0026nbsp;\u003c/em\u003e2011, \u003cstrong\u003e26\u003c/strong\u003e(4):173-177.\u003c/li\u003e\n \u003cli\u003eVergnaud G, Hauck Y, Christiany D, Daoud B, Pourcel C, Jacques I, Cloeckaert A, Zygmunt MS: \u003cstrong\u003eGenotypic Expansion Within the Population Structure of Classical Brucella Species Revealed by MLVA16 Typing of 1404 Brucella Isolates From Different Animal and Geographic Origins, 1974-2006\u003c/strong\u003e. \u003cem\u003eFront Microbiol\u0026nbsp;\u003c/em\u003e2018, \u003cstrong\u003e9\u003c/strong\u003e:1545.\u003c/li\u003e\n \u003cli\u003eTuon FF, Gondolfo RB, Cerchiari N: \u003cstrong\u003eHuman-to-human transmission of Brucella - a systematic review\u003c/strong\u003e. \u003cem\u003eTrop Med Int Health\u0026nbsp;\u003c/em\u003e2017, \u003cstrong\u003e22\u003c/strong\u003e(5):539-546.\u003c/li\u003e\n \u003cli\u003eKamal IH, Al Gashgari B, Moselhy SS, Kumosani TA, Abulnaja KO: \u003cstrong\u003eTwo-stage PCR assay for detection of human brucellosis in endemic areas\u003c/strong\u003e. \u003cem\u003eBMC Infect Dis\u0026nbsp;\u003c/em\u003e2013, \u003cstrong\u003e13\u003c/strong\u003e:145.\u003c/li\u003e\n \u003cli\u003eCasalinuovo F, Ciambrone L, Cacia A, Rippa P: \u003cstrong\u003eContamination of Bovine, Sheep and Goat Meat with Brucella Spp\u003c/strong\u003e. \u003cem\u003eItal J Food Saf\u0026nbsp;\u003c/em\u003e2016, \u003cstrong\u003e5\u003c/strong\u003e(3):5913.\u003c/li\u003e\n \u003cli\u003eYe HY, Xing FF, Yang J, Lo SK, Lau RW, Chen JH, Chiu KH, Yuen KY: \u003cstrong\u003eHigh index of suspicion for brucellosis in a highly cosmopolitan city in southern China\u003c/strong\u003e. \u003cem\u003eBMC Infect Dis\u0026nbsp;\u003c/em\u003e2020, \u003cstrong\u003e20\u003c/strong\u003e(1):22.\u003c/li\u003e\n \u003cli\u003eRubach MP, Halliday JE, Cleaveland S, Crump JA: \u003cstrong\u003eBrucellosis in low-income and middle-income countries\u003c/strong\u003e. \u003cem\u003eCurr Opin Infect Dis\u0026nbsp;\u003c/em\u003e2013, \u003cstrong\u003e26\u003c/strong\u003e(5):404-412.\u003c/li\u003e\n \u003cli\u003eSchuchat A, Bell BP: \u003cstrong\u003eMonitoring the impact of vaccines postlicensure: new challenges, new opportunities\u003c/strong\u003e. \u003cem\u003eExpert Rev Vaccines\u0026nbsp;\u003c/em\u003e2008, \u003cstrong\u003e7\u003c/strong\u003e(4):437-456.\u003c/li\u003e\n \u003cli\u003eMoriyon I, Grillo MJ, Monreal D, Gonzalez D, Marin C, Lopez-Goni I, Mainar-Jaime RC, Moreno E, Blasco JM: \u003cstrong\u003eRough vaccines in animal brucellosis: structural and genetic basis and present status\u003c/strong\u003e. \u003cem\u003eVet Res\u0026nbsp;\u003c/em\u003e2004, \u003cstrong\u003e35\u003c/strong\u003e(1):1-38.\u003c/li\u003e\n \u003cli\u003eAvila-Calderon ED, Lopez-Merino A, Sriranganathan N, Boyle SM, Contreras-Rodriguez A: \u003cstrong\u003eA history of the development of Brucella vaccines\u003c/strong\u003e. \u003cem\u003eBiomed Res Int\u0026nbsp;\u003c/em\u003e2013, \u003cstrong\u003e2013\u003c/strong\u003e:743509.\u003c/li\u003e\n \u003cli\u003eZamri-Saad M, Kamarudin MI: \u003cstrong\u003eControl of animal brucellosis: The Malaysian experience\u003c/strong\u003e. \u003cem\u003eAsian Pac J Trop Med\u0026nbsp;\u003c/em\u003e2016, \u003cstrong\u003e9\u003c/strong\u003e(12):1136-1140.\u003c/li\u003e\n \u003cli\u003eHou H, Liu X, Peng Q: \u003cstrong\u003eThe advances in brucellosis vaccines\u003c/strong\u003e. \u003cem\u003eVaccine\u0026nbsp;\u003c/em\u003e2019, \u003cstrong\u003e37\u003c/strong\u003e(30):3981-3988.\u003c/li\u003e\n \u003cli\u003eJiang H, Dong H, Peng X, Feng Y, Zhu L, Niu K, Peng Y, Fan H, Ding J: \u003cstrong\u003eTranscriptome analysis of gene expression profiling of infected macrophages between Brucella suis 1330 and live attenuated vaccine strain S2 displays mechanistic implication for regulation of virulence\u003c/strong\u003e. \u003cem\u003eMicrob Pathog\u0026nbsp;\u003c/em\u003e2018, \u003cstrong\u003e119\u003c/strong\u003e:241-247.\u003c/li\u003e\n \u003cli\u003eWang F, Qiao Z, Hu S, Liu W, Zheng H, Liu S, Zhao X, Bu Z: \u003cstrong\u003eComparison of genomes of Brucella melitensis M28 and the B. melitensis M5-90 derivative vaccine strain highlights the translation elongation factor Tu gene tuf2 as an attenuation-related gene\u003c/strong\u003e. \u003cem\u003eInfect Immun\u0026nbsp;\u003c/em\u003e2013, \u003cstrong\u003e81\u003c/strong\u003e(8):2812-2818.\u003c/li\u003e\n \u003cli\u003eHe CY, Zhang YZ, Liu MZ, Zhao HL, Ren LS, Liu BS, He S, Chen ZL: \u003cstrong\u003eCombined immunization with inactivated vaccine reduces the dose of live B. abortus A19 vaccine\u003c/strong\u003e. \u003cem\u003eBMC Vet Res\u0026nbsp;\u003c/em\u003e2022, \u003cstrong\u003e18\u003c/strong\u003e(1):128.\u003c/li\u003e\n \u003cli\u003eWang S, Wang W, Sun K, Bateer H, Zhao X: \u003cstrong\u003eComparative genomic analysis between newly sequenced Brucella abortus vaccine strain A19 and another Brucella abortus vaccine S19\u003c/strong\u003e. \u003cem\u003eGenomics\u0026nbsp;\u003c/em\u003e2020, \u003cstrong\u003e112\u003c/strong\u003e(2):1444-1453.\u003c/li\u003e\n \u003cli\u003eOlsen SC, Stoffregen WS: \u003cstrong\u003eEssential role of vaccines in brucellosis control and eradication programs for livestock\u003c/strong\u003e. \u003cem\u003eExpert Rev Vaccines\u0026nbsp;\u003c/em\u003e2005, \u003cstrong\u003e4\u003c/strong\u003e(6):915-928.\u003c/li\u003e\n \u003cli\u003ePerkins SD, Smither SJ, Atkins HS: \u003cstrong\u003eTowards a Brucella vaccine for humans\u003c/strong\u003e. \u003cem\u003eFEMS Microbiol Rev\u0026nbsp;\u003c/em\u003e2010, \u003cstrong\u003e34\u003c/strong\u003e(3):379-394.\u003c/li\u003e\n \u003cli\u003eManthei CA: \u003cstrong\u003eBrucellosis. Application of research to bovine brucellosis control and eradication programs\u003c/strong\u003e. \u003cem\u003eJ Dairy Sci\u0026nbsp;\u003c/em\u003e1968, \u003cstrong\u003e51\u003c/strong\u003e(7):1115-1120.\u003c/li\u003e\n \u003cli\u003eRagan VE, Animal, Plant Health Inspection S: \u003cstrong\u003eThe Animal and Plant Health Inspection Service (APHIS) brucellosis eradication program in the United States\u003c/strong\u003e. \u003cem\u003eVet Microbiol\u0026nbsp;\u003c/em\u003e2002, \u003cstrong\u003e90\u003c/strong\u003e(1-4):11-18.\u003c/li\u003e\n \u003cli\u003eRan X, Cheng J, Wang M, Chen X, Wang H, Ge Y, Ni H, Zhang XX, Wen X: \u003cstrong\u003eBrucellosis seroprevalence in dairy cattle in China during 2008-2018: A systematic review and meta-analysis\u003c/strong\u003e. \u003cem\u003eActa Trop\u0026nbsp;\u003c/em\u003e2019, \u003cstrong\u003e189\u003c/strong\u003e:117-123.\u003c/li\u003e\n \u003cli\u003eMamani M, Majzoobi MM, Keramat F, Varmaghani N, Moghimbeigi A: \u003cstrong\u003eSeroprevalence of Brucellosis in Butchers, Veterinarians and Slaughterhouse Workers in Hamadan, Western Iran\u003c/strong\u003e. \u003cem\u003eJ Res Health Sci\u0026nbsp;\u003c/em\u003e2018, \u003cstrong\u003e18\u003c/strong\u003e(1):e00406.\u003c/li\u003e\n \u003cli\u003eLiu ZG, Wang M, Ta N, Fang MG, Mi JC, Yu RP, Luo Y, Cao X, Li ZJ: \u003cstrong\u003eSeroprevalence of human brucellosis and molecular characteristics of Brucella strains in Inner Mongolia Autonomous region of China, from 2012 to 2016\u003c/strong\u003e. \u003cem\u003eEmerg Microbes Infect\u0026nbsp;\u003c/em\u003e2020, \u003cstrong\u003e9\u003c/strong\u003e(1):263-274.\u003c/li\u003e\n \u003cli\u003eOmer MK, Skjerve E, Woldehiwet Z, Holstad G: \u003cstrong\u003eRisk factors for Brucella spp. infection In dairy cattle farms in Asmara, State of Eritrea\u003c/strong\u003e. \u003cem\u003ePrev Vet Med\u0026nbsp;\u003c/em\u003e2000, \u003cstrong\u003e46\u003c/strong\u003e(4):257-265.\u003c/li\u003e\n \u003cli\u003eDiao Z: \u003cstrong\u003eSerological investigation of Brucella in a largescale dairy farm and establishment of quadruple PCR detection method\u003c/strong\u003e. In\u003cem\u003e.\u003c/em\u003e: Northwest A\u0026amp;F University.; 2023. in press\u003c/li\u003e\n \u003cli\u003eMamisashvili E, Kracalik IT, Onashvili T, Kerdzevadze L, Goginashvili K, Tigilauri T, Donduashvili M, Nikolaishvili M, Beradze I, Zakareishvili M\u003cem\u003e\u0026nbsp;et al\u003c/em\u003e: \u003cstrong\u003eSeroprevalence of brucellosis in livestock within three endemic regions of the country of Georgia\u003c/strong\u003e. \u003cem\u003ePrev Vet Med\u0026nbsp;\u003c/em\u003e2013, \u003cstrong\u003e110\u003c/strong\u003e(3-4):554-557.\u003c/li\u003e\n \u003cli\u003eYang Q, Zhang S, Liu L, Cao X, Lei C, Qi X, Lin F, Qu W, Qi X, Liu J\u003cem\u003e\u0026nbsp;et al\u003c/em\u003e: \u003cstrong\u003eApplication of mathematical expectation (ME) strategy for detecting low frequency mutations: An example for evaluating 14-bp insertion/deletion (indel) within the bovine PRNP gene\u003c/strong\u003e. \u003cem\u003ePrion\u0026nbsp;\u003c/em\u003e2016, \u003cstrong\u003e10\u003c/strong\u003e(5):409-419.\u003c/li\u003e\n \u003cli\u003eLi J, Zhu X, Ma L, Xu H, Cao X, Luo R, Chen H, Sun X, Cai Y, Lan X: \u003cstrong\u003eDetection of a new 20-bp insertion/deletion (indel) within sheep PRND gene using mathematical expectation (ME) method\u003c/strong\u003e. \u003cem\u003ePrion\u0026nbsp;\u003c/em\u003e2017, \u003cstrong\u003e11\u003c/strong\u003e(2):143-150.\u003c/li\u003e\n \u003cli\u003eDadar M, Tiwari R, Sharun K, Dhama K: \u003cstrong\u003eImportance of brucellosis control programs of livestock on the improvement of one health\u003c/strong\u003e. \u003cem\u003eVet Q\u0026nbsp;\u003c/em\u003e2021, \u003cstrong\u003e41\u003c/strong\u003e(1):137-151.\u003c/li\u003e\n \u003cli\u003eBaoshan L, Yinbo Y, Jingbo Z, Yi Z, Jianghua Y, Dawei C, Chi M, Donghai Y, Bohan Y, Rongnian Z\u003cem\u003e\u0026nbsp;et al\u003c/em\u003e: \u003cstrong\u003eCombined nucleic acid assays for diagnosis of A19 vaccine-caused human brucellosis\u003c/strong\u003e. \u003cem\u003eTransbound Emerg Dis\u0026nbsp;\u003c/em\u003e2021, \u003cstrong\u003e68\u003c/strong\u003e(2):368-374.\u003c/li\u003e\n \u003cli\u003eArif S, Heller J, Hernandez-Jover M, McGill DM, Thomson PC: \u003cstrong\u003eEvaluation of three serological tests for diagnosis of bovine brucellosis in smallholder farms in Pakistan by estimating sensitivity and specificity using Bayesian latent class analysis\u003c/strong\u003e. \u003cem\u003ePrev Vet Med\u0026nbsp;\u003c/em\u003e2018, \u003cstrong\u003e149\u003c/strong\u003e:21-28.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Brucella, Brucellosis, persistent antibodies, Brucella A19 strain","lastPublishedDoi":"10.21203/rs.3.rs-3888156/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3888156/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground\u003c/strong\u003e Brucella 19 strain vaccines are widely used to prevent brucellosis in cattle. The vaccine antibodies are generally acknowledged to persist for less than 12 months after immunization. The real rate of persistent antibodies may be a difference because of different feeding management and immunization schedules. The effect of vaccine immunization and the correlation between the persistence of antibodies induced by immunization and field strain infection remains unclear in the northwest of China. \u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults \u003c/strong\u003eWe revealed that \u003cem\u003eBrucella\u003c/em\u003e A19 vaccine antibodies persist in dairy herds for more than 12 months. We established a PCR method for identifying both \u003cem\u003eBrucella\u003c/em\u003e A19 and non-A19 strains, resulting in the detection of 10 field strains of \u003cem\u003eBrucella abortus\u003c/em\u003e from vaginal swab samples collected from 1,537 dairy cows. We analyzed the rates of seropositivity and herd seropositive rates in dairy cattle in Lingwu City from 2021 to 2023. By employing a mathematical expectation strategy, we completed testing of 1537 samples after conducting only 306 tests of pools of six samples, thereby reducing the workload by 80.1%.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion\u003c/strong\u003e We propose that the detection of antibodies in cattle vaccinated with the A19 vaccine more than 12 months previously should not be solely relied upon as a diagnostic basis for brucellosis, and it is essential to combine this approach with PCR analysis to specifically identify field strains. Timely detection of \u003cem\u003eBrucella\u003c/em\u003ein aborting livestock was identified as an efficient strategy for diagnosis. This research provides valuable data for the prevention and control of brucellosis in immunized cattle herds, as well as serving as a reference method for investigating and diagnosing brucellosis in livestock vaccinated in other regions.\u003c/p\u003e","manuscriptTitle":"Investigation of the prevalence of Brucella antibodies and field strains in immunized dairy herds in Lingwu, Ningxia","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-29 10:49:25","doi":"10.21203/rs.3.rs-3888156/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"cad2c7e7-23d3-4068-83f4-4cd1be90eeb7","owner":[],"postedDate":"January 29th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-04-01T08:00:03+00:00","versionOfRecord":[],"versionCreatedAt":"2024-01-29 10:49:25","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3888156","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3888156","identity":"rs-3888156","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.