Full text
59,821 characters
· extracted from
preprint-html
· click to expand
Tissue-specific cis-regulatory divergence implicates a fatty acid elongase necessary for inhibiting interspecies mating in Drosophila | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Tissue-specific cis-regulatory divergence implicates a fatty acid elongase necessary for inhibiting interspecies mating in Drosophila View ORCID Profile Peter A. Combs , View ORCID Profile Joshua J. Krupp , Neil M. Khosla , View ORCID Profile Dennis Bua , View ORCID Profile Dmitri A. Petrov , View ORCID Profile Joel D. Levine , View ORCID Profile Hunter B. Fraser doi: https://doi.org/10.1101/344754 Peter A. Combs 1 Department of Biology, Stanford University Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Peter A. Combs Joshua J. Krupp 2 Department of Biology, University of Toronto , Mississauga Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Joshua J. Krupp Neil M. Khosla 1 Department of Biology, Stanford University Find this author on Google Scholar Find this author on PubMed Search for this author on this site Dennis Bua 1 Department of Biology, Stanford University Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Dennis Bua Dmitri A. Petrov 1 Department of Biology, Stanford University Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Dmitri A. Petrov Joel D. Levine 2 Department of Biology, University of Toronto , Mississauga Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Joel D. Levine Hunter B. Fraser 1 Department of Biology, Stanford University Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Hunter B. Fraser Abstract Full Text Info/History Metrics Preview PDF Abstract Pheromones known as cuticular hydrocarbons are a major component of reproductive isolation in Drosophila . Individuals from morphologically similar sister species produce different sets of hydrocarbons that allow potential mates to identify them as a suitable partner. In order to explore the molecular mechanisms underlying speciation, we performed RNA-seq in F1 hybrids to measure tissue-specific cis-regulatory divergence between the sister species D. simulans and D. sechellia . By focusing on cis-regulatory changes specific to female oenocytes, we rapidly identified a small number of candidate genes. We found that one of these, the fatty acid elongase eloF , broadly affects both the complement of hydrocarbons present on D. sechellia females and the propensity of D. simulans males to mate with those females. In addition, knockdown of eloF in the more distantly related D. melanogaster led to a similar shift in hydrocarbons as well as lower interspecific mate discrimination by D. simulans males. Thus, cis-regulatory changes in eloF appear to be a major driver in the sexual isolation of D. simulans from multiple other species. More generally, our RNA-seq approach proved to be far more efficient than QTL mapping in identifying candidate genes; the same framework can be used to pinpoint cis-regulatory drivers of divergence in a wide range of traits differing between any interfertile species. Introduction Reproductive isolation is a major component of speciation. Postzygotic incompatibilities leading to hybrid sterility or inviability (also known as Dobzhansky-Muller incompatibilities) have been especially well-studied, with several examples narrowed down to specific genes ( Watanabe 1979 ; Sawamura et al. 1993 ; Phadnis et al. 2015 ). However when the distributions of related species overlap, rejection of interspecific partners may account for a much larger fraction of reproductive isolation ( Coyne and Orr 1997 ; Quinn et al. 2000 ; Byrne and Rice 2006 ; Shahandeh et al. 2018 ). This preference for conspecific mates may be subject to strong selection ( Noor 1995 ; Servedio and Noor 2003 ; Coyne and Orr 2004 ), since interspecific hybridization carries significant fitness costs, including potential inviability or sterility of offspring. Drosophila has been a key model organism for the study of reproductive isolation, including the role of mate choice ( Coyne and Orr 2004 ). Courtship in Drosophila is a highly stereotyped procedure, with multiple opportunities for both females and males to reject interspecific partners ( Sokolowski 2001 ; Lasbleiz et al. 2006 ). This affords the opportunity for flies to reduce energy expenditure on reproductively fruitless partners. While female mate choice has been more heavily studied ( Spieth 1952 ; Partridge 1980 ; Fowler and Partridge 1989 ; Greenspan and Ferveur 2000 ), there is a growing recognition that choice by males can also be an important factor ( Byrne and Rice 2006 ; Edward and Chapman 2011 ; Pischedda et al. 2014 ; Shahandeh et al. 2018 ). In fact, male choice can be responsible for most reproductive isolation in some cases ( Shahandeh et al. 2018 ). Beyond simply the opportunity cost of devoting time towards courting a heterospecific female, mating itself can be costly for males, with mated male Drosophila having reduced lifespans ( Partridge and Farquhar 1981 ). Simulations have shown that male mate choice can reinforce speciation under when hybrids are less fit ( Servedio 2007 ). D. simulans and D. sechellia are two closely related sister species, separated by approximately 250 thousand years ( Garrigan et al. 2012 ). The species are believed to have diverged in allopatry ( Kliman et al. 2000 ), though currently their ranges overlap and hybrids can be found in the wild ( Matute and Ayroles 2014 ). In laboratory conditions, D. sechellia males will readily mate with D. simulans females, producing sterile male and fertile female hybrid offspring, while the reciprocal cross is much more difficult ( Lachaise et al. 1986 ). Male mate choice in these species—which accounts for over 70% of their reproductive isolation ( Shahandeh et al. 2018 )—is mediated by female cuticular hydrocarbons (CHCs), which are key molecules involved in species recognition that are produced primarily in specialized cells called oenocytes ( Billeter et al. 2009 ). In this study, we sought to identify the specific gene(s) responsible for CHC-mediated behavioral reproductive isolation in D. simulans and D. sechellia . Thus far, QTL mapping has been the primary method used to investigate this question. QTLs affecting CHCs have been mapped, but these contain many CHC-related genes ( Coyne et al. 1994 ; Gleason et al. 2005 ; 2009 ), and fine-mapping has not been reported. As a complementary approach, we reasoned that genes responsible for major changes in CHCs may share three key characteristics: 1) Cis-regulatory divergence in female oenocytes; 2) Female-specific expression; and 3) Oenocyte-specific expression. Although these are certainly not required—for example, CHC divergence might occur via changes in protein-coding regions—any genes meeting all three criteria would be excellent candidates. Cis-regulatory divergence can be measured genome-wide via high-throughput sequencing of cDNA (RNA-seq) in interspecific hybrids. Hybrids are required because comparisons between species involve a combination of both cis- and trans-acting changes; in contrast, measuring allele-specific expression (ASE) in F1 hybrids neatly controls for potential trans-acting changes, since each allele experiences the same trans-regulatory environment within the hybrid nuclei. Thus, differential expression of the two alleles in a hybrid can only be explained by cis-regulatory divergence. To generate genome-wide data covering all three criteria listed above, we performed RNA-seq in D. sechellia / simulans hybrids. To measure female-specificity, we included samples from both male and female oenocytes, and to measure oenocyte-specificity, we included samples from male and female fat bodies (an adjacent non-CHC producing tissue; Lawrence and Johnston 1986). Using this approach, we identified three candidate genes for drivers of CHC differences between the species. Ablation of these genes pointed towards a major role of eloF , a fatty acid elongase, in the reproductive isolation of D. simulans from both D. sechellia as well as the more distantly related D. melanogaster . Results Allele-specific expression identifies fatty acid elongases as a major differentiator between D. simulans and D. sechellia female oenocytes We first set out to identify genes with cis-regulatory divergence specific to female oenocytes. We mated D. sechellia males to D. simulans females and dissected both oenocytes and fat bodies from the progeny, pooling approximately 20 individuals from each sex ( Figure 1A ). Then, we extracted RNA and constructed RNA-seq libraries, which we sequenced to approximately 30 million reads per sample ( Supplemental Table 1 ). We called allele-specific reads for each sample by aligning to a D. simulans reference sequence, and controlled for potential mapping bias by discarding any read that did not map to the same location if alleles were swapped in silico ( van de Geijn et al. 2015 ). Despite the use of a D. simulans reference genome, we found a majority of reads were assigned to D. sechellia ( Supplemental Table 1 ), possibly indicating low levels of non-hybrid D. sechellia samples. We estimated the significance of each gene’s allele specific expression (ASE) using a negative-binomial test ( Love et al. 2014 ) for deviation from the average fraction of D. sechellia reads in a given sample. Download figure Open in new tab Figure 1: RNA-seq of oenocytes and fat bodies from hybrid D. simulans × D. sechellia flies reveals a strong cis-regulatory component of CHC production. A) We dissected oenocytes (blue dots) and fat bodies (green regions) from hybrid D. simulans × D. sechellia males and females and performed RNA-sequencing. B) Genes are plotted by specificity of expression to female oenocytes (x-axis; mean of female oenocyte expression divided by maximum expression in female fat bodies, male oenocytes, and female oenocytes) and allele-specific expression p-value (y-axis). Green dots indicate genes with significant ASE compared to the distribution of reads in the female oenocytes, blue dots indicate those that have significantly higher expression in female oenocytes compared to female fat bodies and male oenocytes, and red dots indicate genes with both tissue-specific and species-specific expression. C) Overlap of genes with ASE in female oenocytes (green circle), and differential expression in female oenocytes compared to other tissues (blue and cyan circles). Even at a stringent cutoff, we identified 239 genes with significant (negative binomial q-value < 0.001) ASE in female oenocytes. This is not surprising, since various Drosophila interspecific hybrids have also yielded large numbers of genes with strong ASE. Of the 239 significant genes, 27 have been annotated with the Gene Ontology term “Fatty acid biosynthetic process” (GO:0006633) (Supplemental Table 3). Therefore we concluded that, even when combined with GO annotations, ASE in female oenocytes was insufficient to identify a manageable number of candidate genes involved in CHC differences and speciation. We reasoned that in addition to ASE, genes important to female CHC differences between D. simulans and D. sechellia would likely be expressed specifically in female oenocytes ( Figure 1B and C). To identify candidate genes, we looked for genes that had significantly higher expression in the female oenocytes compared to both male oenocytes and female fat bodies (Sleuth q-value<0.001 for both comparisons; ( Pimentel et al. 2017 )). Only six genes passed these cutoffs. Reassuringly, one of these was desatF (also known as Fad2 ), a fatty-acid desaturase which is known to be expressed in D. sechellia female oenocytes, but not in males or in D. simulans ( Shirangi et al. 2009 ). Among the six candidate genes, the only enriched molecular function Gene Ontology terms were related to “fatty acid elongase activity” (GO:0009922 and its parent GO terms), which describe the three genes eloF, CG8534, and bond (in all cases, we use the names of the D. melanogaster orthologs) ( Boyle et al. 2004 ). All three of these have ELO family domains ( Szafer-Glusman et al. 2008 ). Both eloF and CG8534 were D. sechellia- biased, while bond was D. simulans- biased. We further detected a weak signal for FASN3, a putative acyl transferase ( Table 1 ). No other gene that is both oenocyte- and species-specific in its expression has an annotated Gene Ontology term or protein domain that is clearly related to CHC production ( Table 1 ). View this table: View inline View popup Download powerpoint Table 1: Genes with female oenocyte- and species-specific expression Genes with significant tissue-specific (sleuth q-value <0.001 in comparisons both between the two female tissues, and between the two oenocyte samples) and species-specific expression (negative binomial p-value < .001). Specificity is the ratio of the mean expression in female oenocytes to the highest expression among male oenocytes, female fat bodies, and male fat bodies. Gene ontology (GO) terms are annotated molecular function terms (see Supplemental Table 2 for citations). GO terms without experimental evidence are in italics. Protein domains are InterPro annotated protein domains/motifs as listed on FlyBase v2017_06 ( Finn et al. 2017 ; Gramates et al. 2017 ). Compared to the female oenocytes, male oenocytes had a much weaker signal of ASE among genes with sex- and oenocyte-specific expression ( Supplemental Figure 2 ). Given the overall weaker signal in male oenocytes, we chose to focus on changes in female CHC production that might drive speciation. Male fat bodies had over 80 genes with tissue- and species-specific expression ( Supplemental Figure 2A ). Gene ontology analysis of these male fat body genes highlighted several significant GO terms, including “oxidation-reduction process” (p=2.9 × 10 −7 ) and “catalytic activity” (p=6.7 × 10 −10 ) ( Boyle et al. 2004 ), but no candidate genes with obvious roles in pheromone production or mating activity were present. However, these genes may be useful for future studies of regulatory evolution in fat bodies, which could affect traits including metabolism and mating behavior ( Lazareva et al. 2007 ). eloF has widespread effects on the hydrocarbon profile of D. sechellia and D. melanogaster To explore the role of our candidate genes on CHC profiles of these species, we performed gas chromatography coupled to mass spectrometry (GCMS). Consistent with previous measurements of hydrocarbon profiles of Drosophila , we found that wildtype D. simulans has more short-chain hydrocarbons than D. sechellia ( Figure 2A ; ( Jallon and David 1987 )). In particular, D. sechellia has almost no 23-carbon CHCs, while the predominant D. simulans hydrocarbon is 7-tricosene, a 23-carbon monoene. Indeed, there was only one hydrocarbon shorter than 26 carbons with a greater representation in D. sechellia than D. simulans, the 25-carbon pentacosadiene (~2 fold higher in D. sechellia) . There were no CHCs longer than 26 carbons that were more abundant in D. simulans than D. sechellia. Download figure Open in new tab Figure 2: eloF- flies have an overall shorter CHC complement A) Total ion chromatographs of the hydrocarbon profile of wild-type D. sechellia (top) and D. simulans (bottom). Retention time and abundance is relative to the n-hexacosane (26C) normalization peak. Grey regions indicate number of carbons in CHC backbone. CHCs with more than a 3-fold change marked with asterisks at the location of the peak in the genotype with lower production. B-C) Total ion chromatographs of the hydrocarbon profile of wild-type (top) and eloF- (bottom) D. melanogaster (A) and D. sechellia (B). D) Average log2 fold changes of the measured compounds between D. simulans and D. sechellia vs log2 fold changes between wild-type and knockout of eloF in D. sechellia . Points are colored by the number of carbons in the backbone. E) Principal components analysis of wild-type and eloF- D. melanogaster, simulans, and sechellia . Principal components were calculated for the wild-type data, then eloF- data projected onto the same coordinates. To explore the effects of our candidate genes on CHC profiles, we studied the phenotypic effects of their RNAi knockdowns in D. melanogaster. We did not pursue desatF , which already has a well-established role in Drosophila speciation ( Legendre et al. 2008 ; Fang et al. 2009 ; Shirangi et al. 2009 ), or FASN3 , which is essential for viability ( Chung and Carroll 2015 ). For the remaining three CHC-related candidates, we created RNAi knockdowns in D. melanogaster females for each of these genes specifically in oenocytes by crossing PromE(800)-gal4 males with UAS-shRNA females from the TRiP project ( Billeter et al. 2009 ; Perkins et al. 2015 ), then screened the CHC profiles of the progeny by GCMS. As negative controls, we crossed PromE(800)-gal4 males with females of Bloomington stock #32186, which carries 10 copies of UAS-driven mCD8-tagged GFP. Of our three candidate genes, we found that one ( CG8534 ) was essential for viability. Its highest expression is in the 3 rd -4 th day of pupation ( Graveley et al. 2011 ), so it may be involved in development. Attempts to delay induction of gal4- driven RNAi by incubating larvae at 18°C were not successful in rescuing females. Knockdown of our second candidate ( bond ) in females led to ~60% increases in levels of pentacosadiene (a 25 carbon hydrocarbon) and ~60% decrease in levels of heptacosadiene (27 carbon) ( Supplemental Figure 3 ). However other hydrocarbons were not significantly affected. We observed the most pronounced effects for RNAi knockdown of our third candidate, eloF . We found that female flies with eloF knocked down have significantly fewer long-chain CHCs and more short-chain CHCs than wildtype flies (>3-fold change between CHCs with longer vs. shorter than 26 carbons; Figure 2B ), consistent with previous work ( Chertemps et al. 2007 ). Interestingly, eloF also had the strongest ASE among the six candidate genes (79-fold higher expression from D. sechellia alleles). To examine the effect of eloF on CHCs in D. sechellia , we used CRISPR/Cas9 genome editing to create two independent lines of D. sechellia with eloF knocked out and replaced with P3- RFP. As expected, nearly all of the CHCs whose levels changed after eloF knockdown in D. melanogaster show a similar difference in D. sechellia ( Figure 2C ). Thus, we conclude that the molecular substrates and products of eloF are substantially similar between D. melanogaster and sechellia. We noticed that there was a strong correlation between the changes observed between the sister species D. simulans and D. sechellia and the changes between wild-type and eloF depleted females from both D. melanogaster and D. sechellia ( Figure 2D and Supplemental Figure 4 ). Consistent with eloF ’s role as a fatty acid elongase, much of this variation consisted in broad differences in overall length of the hydrocarbons. To visualize entire CHC profiles, we performed principal components analysis, which showed that 94% of the total variation was captured by the first two components. The first principal component of variation separated D. simulans from both D. melanogaster and D. sechellia ( Figure 2E ). While knockdown or knockout of eloF did not completely transform the profiles of either species to D. simulans , it did make the profiles significantly closer. Thus, we concluded that one or more of the products of eloF may be acting as an anti-aphrodisiac to D. simulans males (or, alternatively, one of the substrates may be an aphrodisiac). Notably, several previous studies have mapped quantitative trait loci (QTLs) that include eloF . For example, eloF is located within QTLs affecting CHC differences and mate discrimination between D. simulans and D. sechellia ( Gleason et al. 2005 ; 2009 ), as well as a QTL for copulation frequency between D. simulans males and D. mauritiana females ( Moehring et al. 2004 ). However in all of these studies, the QTLs also contained hundreds of other genes (including many other elongases). Therefore, although eloF is an excellent candidate gene, its role in reproductive isolation has not been explored. Expression of eloF is sufficient for species discrimination by D. simulans males To determine whether the change in eloF expression (and concomitant CHC changes) could be responsible for sexual isolation between the species, we performed mate choice assays. We placed single D. simulans males in a chamber with a single female and recorded video in well-lit conditions for 30 minutes. We noted the time of the first instance of various copulatory behaviors, including tapping, male wing song, and licking ( Figure 3A-C ). With the exception of licking, these behaviors are not subject to rejection by females (the mating chambers are small enough that females are effectively unable to escape, while tapping is very rapid and wing song does not involve contact), and thus primarily represent choice by the males. Download figure Open in new tab Figure 3: D. simulans males court interspecific eloF - females at significantly higher rates A-C) We recorded between 42 and 80 pairs of single D. simulans males courting single females of the indicated genotype. We recorded the time between male’s first tapping the female (and ostensibly sampling the female CHCs) and either singing behavior or licking of the female’s posterior prior to copulation. D) Female flies bearing a functional copy of eloF ( D. melanogaster WT and D. simulans WT) were courted by D. simulans males at significantly lower rates than D. simulans conspecific females and interspecific females without eloF . We performed the indicated Fisher’s exact tests for differences in courtship rate (as measured by rate of proceeding to precopulatory licking), with Bonferroni-corrected p -values above each bar when significant. E) Violin plots of the delay between first contact between males and females and initiation of courtship. Black lines indicate mean time to courtship. Gray ticks indicate the underlying data. Although the D. simulans males were slower to court D. melanogaster WT females, this represents only 5 cases of courtship (out of 60 trials), and no comparisons were significant by t-test at even a nominal p=0.05 cutoff. We first tested whether eloF might drive the behavioral isolation of D. simulans and D. sechellia, and so tested D. sechellia females with D. simulans males. As expected, D. simulans males courted wild-type D. sechellia females at a significantly lower rate than D. simulans females. Remarkably, D. simulans males courted eloF- D. sechellia females at the same rate as conspecific females ( Figure 3D ). We observed no significant difference in the courtship rate between the two independently generated D. sechellia knockout lines. We then asked whether eloF might also mediate mate discrimination between D. melanogaster and D. simulans. As expected, when D. simulans males were presented with wildtype D. melanogaster females they rarely proceeded to courtship ( Figure 3D and Supplemental Figure 5A ). However, when we knocked down eloF expression in D. melanogaster females using oenocyte-specific RNAi, males courted them at rates only slightly lower than conspecifics. The choice by males seems to be nearly binary. In the rare cases when D. simulans males did court wild-type D. melanogaster females, they did so approximately as quickly as they did for D. simulans females ( Figure 3E and Supplemental Figure 5B ). In none of the comparisons was there a significant difference in time between first contact between the flies and any of the steps in courtship at a nominal (i.e. without correcting for multiple testing) α=0.01 level. Discussion Sexual selection in Drosophila has been studied for over one hundred years, with chemical odorants quickly being noticed as a primary signal ( Sturtevant 1915 ), although the study of the evolution of these odorants came only after gas chromatography allowed the separation of different components ( Hedin et al. 1972 ). Early work in the field sought to identify differences in CHC profiles between species and their effects on mating ( Pechine et al. 1985 ; Jallon and David 1987 ; Cobb and Jallon 1990 ), and more recent genetic approaches have allowed for mapping of QTLs affecting these CHC differences ( Moehring et al. 2004 ; Gleason et al. 2005 ; 2009 ). However, pinpointing the genes responsible for these changes is still quite difficult ( Shirangi et al. 2009 ). In this study, we have found that RNA-seq in F1 hybrids is a rapid, efficient means of identifying genes potentially involved in phenotypic divergence. Neither comparisons of expression across tissues nor of ASE within a single tissue was able to sufficiently narrow the list of candidate genes ( Figure 1C ); however, the combination of these orthogonal filters, together with gene annotations, allowed us to focus on only three excellent candidate genes. This can be compared with the most widely used alternative for studying the genetic basis of phenotypic divergence, QTL mapping. In QTL mapping, hundreds of progeny from genetic crosses must be genotyped and phenotyped, requiring years of effort even for rapidly reproducing species such as Drosophilids. Moreover, this effort leads to QTLs that typically span over a hundred genes, since resolution is limited by infrequent recombinations. Therefore, follow-up studies to test specific genes are often prohibitive. We envision that our approach of intersecting filters based only on RNA-seq in F1s may be widely applicable to other tissue-specific, sex-specific, stage-specific, or condition-specific traits that differ between interfertile populations or species. Consistent with other recent observations ( Shahandeh et al. 2018 ), we found that CHC differences between the species seem to be the major source of sexual isolation between D. simulans males and females from both D. sechellia and D. melanogaster , and we also showed that ablating eloF alleviates nearly all of the isolation from both D. sechellia and D. melanogaster . The magnitude of this effect is comparable to the reduction in barriers between D. simulans males and D. melanogaster females by ablating oenocytes entirely, a much more radical intervention ( eloF appears to represent ~85% of the barrier in this study, compared to ~100% in Billeter et al. 2009 ). One important caveat is that this isolation is observed under forced-choice laboratory conditions. Providing the choice between conspecifics and heterospecifics has been shown to increase isolation, while rates of hybridization in the wild have been strikingly higher than laboratory predictions ( Coyne et al. 2005 ; Llopart et al. 2005 ). Our identification of eloF as the necessary for D. simulans isolation is buttressed by understanding its role in the biochemical pathways of CHC synthesis but does not entirely depend on that foreknowledge. It is important that we were able to design our experiments knowing that the CHC biochemical pathway takes place almost completely in the oenocytes ( Wicker-Thomas et al. 2015 ). However, having identified the candidate genes using RNA-seq, previous work investigating CHC synthesis allowed us to hypothesize why the candidates lead to different CHC profiles ( Coyne 1996 ; Ferveur et al. 1997 ; Coyne et al. 1999 ; Labeur et al. 2002 ; Chertemps et al. 2007 ; Legendre et al. 2008 ). An interesting direction for future work would be to measure the effects of knocking out other genes in this pathway on CHC profiles and reproductive isolation. Because eloF affects so many CHCs, it is not clear which CHC(s) act as the discriminative signal. The 27-carbon CHC 7,11-heptacosadiene has been shown to be involved in male D. melanogaster and D. simulans preference ( Antony et al. 1985 ; Billeter et al. 2009 ), although other CHCs could also contribute. Further, the identity of the male receptor is unknown, although Gr32a seems to be the major chemoreceptor in D. melanogaster responsible for species recognition ( Fan et al. 2013 ). While reagents in non- melanogaster Drosophilids are now available (Stern et al, 2017 ) , screening multiple gustatory receptors in D. simulans is not yet as straightforward as an RNAi experiment in D. melanogaster . However, even without knowing the specific causal CHCs we can hypothesize a parsimonious evolutionary scenario to explain our observations. D. sechellia and D. melanogaster both express eloF in female oenocytes; therefore this is likely to be the ancestral state for these species, with the 79-fold lower eloF expression in D. simulans being a derived change specific to this species. Our experiments show that D. simulans males prefer mates lacking eloF , suggesting that male preferences have co-evolved with CHC profiles in D. simulans . An intriguing question for future work will be whether the gene(s) responsible for this co-evolved male preference could be identified with a similar tissue-specific ASE approach as demonstrated here. Another open question regards the sequence changes that have led to the expression differences of eloF . It seems significant that both a nearby coding gene ( CG8534 , also a fatty acid elongase) and a non-coding RNA ( CR44035 , of unknown function) share a similar pattern of female oenocyte-specific ASE. Neither of the genes bordering these 3 genes share this pattern, suggesting the existence of a species-variable topologically associated domain that is transcriptionally active in D. sechellia but not D. simulans . The transcription factor Doublesex has been implicated in the evolution of other Drosophila species’ CHC profiles ( Shirangi et al. 2009 ), but searches for clear changes in canonical or non-canonical Doublesex binding sites have been fruitless in the species pair in this work. Further, the set of fixed changes is too large to easily test just a small set of candidates—in the noncoding region around eloF and CG8534 , there are 136 SNPs and 10 indels (comprising 67 bases) where D. simulans has a derived allele differing from both D. sechellia and D. melanogaster (thus matching the parsimonious evolutionary scenario described above), in addition to several nonsynonymous changes in eloF ( Supplemental Figure 6 ). An association study of eloF expression or CHC profiles in a panel of sequenced D. simulans may provide more targeted hypotheses, but only if the causal variant(s) are segregating within D. simulans , which seems unlikely given the major effect they would have on CHCs that are essential for mate choice. Unlike previous observations that CHC changes can affect desiccation resistance ( Chung et al. 2014 ; Ferveur et al. 2018 ), our preliminary tests of eloF’s effects on desiccation did not yield a strong effect (data not shown). These studies examined flies from widely varying ecological niches (Australian desert/jungle and France/Zimbabwe), whereas D. simulans and D. sechellia have overlapping ranges ( Matute and Ayroles 2014 ). Thus, we would not expect strong pressure for differences in tolerance to desiccation. Evolution of elongase expression may be involved in other insect speciation events as well. For instance, QTL studies between the jewel wasps Nasonia vitripennis and N. giraulti have implicated an elongase in CHC changes between those species ( Niehuis et al. 2011 ). Furthermore, our analysis of CHC profiles in stingless bees shows at least two speciation events that show broad changes in the length of CHC backbones, which may be explained by divergence in elongase activity ( Supplemental Figure 7 ; Nunes et al, 2017). Therefore, we hypothesize elongases may represent a general mechanism contributing to many cases of reproductive isolation in diverse insects. Materials and Methods RNA extraction and sequencing Oenocyte and fat body dissections were performed as described in Krupp and Levine (2010). The oenocytes and fat body of 10-day-old D. simulans/D. sechellia hybrid flies were isolated separately from the dorsal abdominal segments of both adult male and female abdomens. Each tissue sample represented the pooled material collected from 20 flies. Hybrid flies were reared in a 12hr light:12 hr dark cycle and tissues dissected at equal time intervals across a 24hr period. Immediately following dissection tissues were placed into cell lysis buffer to aid in preserving the integrity of the RNA. Total RNA was isolated using the RNeasy Micro kit (Qiagen). We prepared libraries from the RNA using the NextFLEX RNA-seq library preparation kit (BioO Scientific, Austin, TX), and sequenced the libraries using 101bp paired end reads on an Illumina HiSeq 2000. We created a corrected D. simulans genome by using bowtie2 version 2.2.5 with arguments --very-sensitive to map genomic DNA reads from D. simulans and D. sechellia to the FlyBase 2.01 D. simulans reference genome ( Hu et al. 2013 ; Coolon et al. 2014 ). Polymorphisms were called using GATK ( HaplotypeCaller --genotyping_mode DISCOVERY -fixMisencodedQuals -stand_emit_conf 10 -stand_call_conf 30 ) ( DePristo et al. 2011 ), then the ~34,000 SNPs that were fixed in both D. simulans and D. sechellia were replaced with the consensus sequence (this step was more important for creating a simulans/sechellia version of the D. melanogaster genome for Supplemental Figure N). RNA-seq reads were mapped to the reference genome using STAR with arguments --outFilterMultimapNmax 1 --outSAMattributes MD NH --clip5pNbases 6 --sjdbGTFfile ( Dobin et al. 2013 ). Following the WASP pipeline, duplicate reads were discarded randomly, then filtered based on whether reads with the alleles swapped in silico to create artificial transcripts from the other species mapped to the same position ( van de Geijn et al. 2015 ). Reads were assigned to a species only if both paired ends mapped unambiguously to one species, and allele-specific expression negative binomial p-values were calculated from aligned read counts using DESeq2 with model ~Replicate + AlignsToSpecies ( Love et al. 2014 ). Default DESeq settings were used to correct for multiple hypothesis testing. Transcript abundances were estimated using kallisto with default arguments ( Bray et al. 2016 ). We used sleuth to identify differentially expressed genes between samples with matched sex and tissue type ( Pimentel et al. 2017 ). Fly rearing For RNAi flies, virgin females of the shRNA driver were isolated within 18 hours of eclosion, then kept isolated from males for 3 days on standard cornmeal media to ensure virgin status. We used Bloomington Stock IDs 34676 ( bond) , 53947 ( eloF), 53299 ( CG8534), and 32186 (GFP control). We combined approximately 25 UAS-shRNA females with approximately 10 Gal4 driver males. Adults were moved to fresh vials every 3 days to ensure separation of the parents and the Gal4+UAS offspring. Knockout D. sechellia flies were created using CRISPR/Cas9 mediated editing. We designed guides to cut at the 55 th nucleotide downstream of the ATG and the 114 th nucleotide upstream of the stop codon of GM23846 (the D. sechellia ortholog of eloF) . We used sense oligos CTTCGCAGCGATCCATGGGTCCCCA (gene 5’-ward cut site) and CTTCGATCCGCATCCGTAGGTCAA (gene 3’-ward cut site). Embryos were injected (WellGenetics, Taipei, Taiwan) with both guides and a dsDNA donor containing ~1000bp homology arms and RFP driven by 3 P3 promoters and flanked by LoxP sites. Embryos were from the D. sechellia genome strain #14021-0248.25. All flies, either RNAi or CRISPR edited were separated by sex within 18 hours of eclosion, then kept isolated for 5-7 days to ensure virgin status. Any vials with larvae after 5 days were discarded. Since the PromE(800)-gal4 construct is balanced with Tm3.5b, we selected straight-winged flies as RNAi positive. Gas chromatography–mass spectrometry We performed GCMS by anesthetizing 5 females at 4°C for 3-5 minutes, then washing them for 5 minutes with 50µL of hexane spiked with 10mg/mL of n-hexane as a standard. Spectra were obtained using an Agilent (HP) 7890/5975 single quadrupole GC-MS instrument with a split ratio of 1:20, injector temperature of 280°C, and an oven temperature program of 35°C hold for 3.75min, 20°C/min ramp from 35°C to 320°C, and a 320°C hold for 7 min. We collected spectra for at least 3 sets of 5 flies for each genotype. Identities of different hydrocarbon peaks were inferred by inspecting the singly-ionized mass spectrum bin. Mating assays We performed mating assays by anesthetizing separate vials of males and females at 4°C for 3-5 minutes, then used a paintbrush to transfer one male and one female to each well of the mating chamber. The mating chamber was 3D printed from acrylic plastic and has 18 separate 2cm diameter × 5mm circular wells, with a removable clear plastic lid. We allowed flies to acclimate at room temperature and ambient light for 10-15 minutes, then recorded 30m of video with bright lights, which we found were required for D. simulans males to initiate courtship. The mating light was a 75W, 14” circular fluorescent bulb placed approximately 30cm above the mating chamber. Video of mating assays was recorded using a Dino-Lite digital microscope, then analyzed by two separate graders (PAC and NMK), who recorded the time of first contact by the male, the time of the male first following the female, the time of the first wing song by the male, and the time of first licking by the male of the female’s abdomen ( Sokolowski 2001 ). Graders were blinded to the fly identities in each video. Data Availability Sequencing data has been deposited at the Gene Expression Omnibus under access number GSE114478. An interactive tool to explore the RNA-seq dataset is available at http://combsfraser-oenocytes.appspot.com/ . Acknowledgements We thank Nirao Shah and Osama Ahmed for helpful discussions on mating assays. We thank David Stern for helpful discussions and the D. simulans tsimbazaza strain. The Bloomington Drosophila Stock Center (NIH P40OD018537) provided the RNAi strains and the Drosophila Species Stock Center at UCSD (now at Cornell University) provided the D. sechellia strains through support of NSF CSBR grant 1351502. GCMS was performed at the Vincent Coates Foundation Mass Spectrometry Laboratory, Stanford University Mass Spectrometry ( http://mass-spec.stanford.edu ), which is supported in part by NIH P30 CA124435. This work was supported by NIH grant 2R01GM097171-05A1. References 1. ↵ Antony , C. , T. L. Davis , D. A. Carlson , J. M. Pechine , and J.-M. Jallon , 1985 Compared behavioral responses of male Drosophila melanogaster (Canton S) to natural and synthetic aphrodisiacs . J. Chem. Ecol. 11 : 1617 – 1629 . OpenUrl CrossRef PubMed Web of Science 2. ↵ Billeter , J.-C. , J. Atallah , J. J. Krupp , J. G. Millar , and J. D. Levine , 2009 Specialized cells tag sexual and species identity in Drosophila melanogaster . Nature 461 : 987 – 991 . OpenUrl CrossRef PubMed Web of Science 3. ↵ Boyle , E. I. , S. Weng , J. Gollub , H. Jin , D. Botstein et al. , 2004 GO::TermFinder--open source software for accessing Gene Ontology information and finding significantly enriched Gene Ontology terms associated with a list of genes . Bioinformatics 20 : 3710 – 3715 . OpenUrl CrossRef PubMed Web of Science 4. ↵ Bray , N. L. , H. Pimentel , P. Melsted , and L. Pachter , 2016 Near-optimal probabilistic RNA-seq quantification . Nat Biotech 34 : 525 – 527 . OpenUrl CrossRef PubMed 5. ↵ Byrne , P. G. , and W. R. Rice , 2006 Evidence for adaptive male mate choice in the fruit fly Drosophila melanogaster . Proc. Biol. Sci. 273 : 917 – 922 . OpenUrl CrossRef PubMed Web of Science 6. ↵ Chertemps , T. , L. Duportets , C. Labeur , R. Ueda , K. Takahashi et al. , 2007 A female-biased expressed elongase involved in long-chain hydrocarbon biosynthesis and courtship behavior in Drosophila melanogaster . Proc. Natl. Acad. Sci. 104 : 4273 – 4278 . OpenUrl Abstract / FREE Full Text 7. ↵ Chung , H. , and S. B. Carroll , 2015 Wax, sex and the origin of species: Dual roles of insect cuticular hydrocarbons in adaptation and mating . Bioessays 37 : 822 – 830 . OpenUrl CrossRef PubMed 8. ↵ Chung , H. , D. W. Loehlin , H. D. Dufour , K. Vaccarro , J. G. Millar et al. , 2014 A single gene affects both ecological divergence and mate choice in Drosophila . Science 343 : 1148 – 1151 . OpenUrl Abstract / FREE Full Text 9. ↵ Cobb , M. , and J.-M. Jallon , 1990 Pheromones, mate recognition and courtship stimulation in the Drosophila melanogaster species sub-group . Anim Behav 39 : 1058 – 1067 . OpenUrl CrossRef Web of Science 10. ↵ Coolon , J. D. , C. J. McManus , K. R. Stevenson , B. R. Graveley , and P. J. Wittkopp , 2014 Tempo and mode of regulatory evolution in Drosophila . Genome Res 24 : 797 – 808 . OpenUrl Abstract / FREE Full Text 11. ↵ Coyne , J. A. , 1996 Genetics of differences in pheromonal hydrocarbons between Drosophila melanogaster and D. simulans . Genetics 143 : 353 – 364 . OpenUrl Abstract / FREE Full Text 12. ↵ Coyne , J. A. , and H. A. Orr , 1997 “ Patterns of Speciation in Drosophila ” Revisited. Evolution 51 : 295 – 303 . OpenUrl 13. ↵ Coyne , J. A. , and H. A. Orr , 2004 Speciation . Sinauer Associates Incorporated . 14. ↵ Coyne , J. A. , A. P. Crittenden , and K. Mah , 1994 Genetics of a pheromonal difference contributing to reproductive isolation in Drosophila . Science 265 : 1461 – 1464 . OpenUrl Abstract / FREE Full Text 15. ↵ Coyne , J. A. , S. Elwyn , and E. Rolán-Alvarez , 2005 Impact of experimental design on Drosophila sexual isolation studies: direct effects and comparison to field hybridization data . Evolution 59 : 2588 – 2601 . OpenUrl CrossRef PubMed Web of Science 16. ↵ Coyne , J. A. , C. Wicker-Thomas , and J.-M. Jallon , 1999 A gene responsible for a cuticular hydrocarbon polymorphism in Drosophila melanogaster. Genet . Res . 73 : 189 – 203 . OpenUrl 17. ↵ DePristo , M. A. , E. Banks , R. Poplin , K. V. Garimella , J. R. Maguire et al. , 2011 A framework for variation discovery and genotyping using next-generation DNA sequencing data . Nat Genet 43 : 491 – 498 . OpenUrl CrossRef PubMed Web of Science 18. ↵ Dobin , A. , C. A. Davis , F. Schlesinger , J. Drenkow , C. Zaleski et al. , 2013 STAR: ultrafast universal RNA-seq aligner . Bioinformatics 29 : 15 – 21 . OpenUrl CrossRef PubMed Web of Science 19. ↵ Edward , D. A. , and T. Chapman , 2011 The evolution and significance of male mate choice . Trends Ecol. Evol. (Amst.) 26 : 647 – 654 . OpenUrl 20. ↵ Fan , P. , D. S. Manoli , O. M. Ahmed , Y. Chen , N. Agarwal et al. , 2013 Genetic and neural mechanisms that inhibit Drosophila from mating with other species . Cell 154 : 89 – 102 . OpenUrl CrossRef PubMed Web of Science 21. ↵ Fang , S. , C.-T. Ting , C.-R. Lee , K.-H. Chu , C.-C. Wang et al. , 2009 Molecular evolution and functional diversification of fatty acid desaturases after recurrent gene duplication in Drosophila . Molecular Biology and Evolution 26 : 1447 – 1456 . OpenUrl CrossRef PubMed Web of Science 22. ↵ Ferveur , J.-F. , J. Cortot , K. Rihani , M. Cobb , and C. Everaerts , 2018 Desiccation resistance: effect of cuticular hydrocarbons and water content in Drosophila melanogaster adults . PeerJ 6 : e4318 . OpenUrl 23. ↵ Ferveur , J. F. , F. Savarit , C. J. O’Kane , G. Sureau , R. J. Greenspan et al. , 1997 Genetic feminization of pheromones and its behavioral consequences in Drosophila males . Science 276 : 1555 – 1558 . OpenUrl Abstract / FREE Full Text 24. ↵ Finn , R. D. , T. K. Attwood , P. C. Babbitt , A. Bateman , P. Bork et al. , 2017 InterPro in 2017-beyond protein family and domain annotations . Nucleic Acids Research 45 : D190 – D199 . OpenUrl CrossRef PubMed 25. ↵ Fowler , K. , and L. Partridge , 1989 A cost of mating in female fruitflies . Nature 338 : 760 – 761 . OpenUrl CrossRef Web of Science 26. ↵ Garrigan , D. , S. B. Kingan , A. J. Geneva , P. Andolfatto , A. G. Clark et al. , 2012 Genome sequencing reveals complex speciation in the Drosophila simulans clade . Genome Res 22 : 1499 – 1511 . OpenUrl Abstract / FREE Full Text 27. ↵ Gleason , J. M. , J.-M. Jallon , J.-D. Rouault , and M. G. Ritchie , 2005 Quantitative trait loci for cuticular hydrocarbons associated with sexual isolation between Drosophila simulans and D. sechellia . Genetics 171 : 1789 – 1798 . OpenUrl Abstract / FREE Full Text 28. ↵ Gleason , J. M. , R. A. James , C. Wicker-Thomas , and M. G. Ritchie , 2009 Identification of quantitative trait loci function through analysis of multiple cuticular hydrocarbons differing between Drosophila simulans and Drosophila sechellia females . Heredity (Edinb) 103 : 416 – 424 . OpenUrl 29. ↵ Gramates , L. S. , S. J. Marygold , G. D. Santos , J.-M. Urbano , G. Antonazzo et al. , 2017 FlyBase at 25: looking to the future . Nucleic Acids Research 45 : D663 – D671 . OpenUrl CrossRef PubMed 30. ↵ Graveley , B. R. , A. N. Brooks , J. W. Carlson , M. O. Duff , J. M. Landolin et al. , 2011 The developmental transcriptome of Drosophila melanogaster . Nature 471 : 473 – 479 . OpenUrl CrossRef PubMed Web of Science 31. ↵ Greenspan , R. J. , and J. F. Ferveur , 2000 Courtship in Drosophila . Annu. Rev. Genet. 34 : 205 – 232 . OpenUrl CrossRef PubMed Web of Science 32. ↵ Hedin , P. A. , C. S. Niemeyer , R. C. Gueldner , and A. C. Thompson , 1972 A gas chromatographic survey of the volatile fractions of twenty species of insects from eight orders . J. Insect Physiol . 18 : 555 – 564 . OpenUrl 33. ↵ Hu , T. T. , M. B. Eisen , K. R. Thornton , and P. Andolfatto , 2013 A second-generation assembly of the Drosophila simulans genome provides new insights into patterns of lineage-specific divergence . Genome Res 23 : 89 – 98 . OpenUrl Abstract / FREE Full Text 34. ↵ Jallon , J.-M. , and J. R. David , 1987 Variation in Cuticular Hydrocarbons Among the Eight Species of the Drosophila melanogaster Subgroup . Evolution 41 : 294 – 302 . OpenUrl CrossRef Web of Science 35. ↵ Kliman , R. M. , P. Andolfatto , J. A. Coyne , F. Depaulis , M. Kreitman et al. , 2000 The Population Genetics of the Origin and Divergence of the Drosophila simulans Complex Species . Genetics 156 : 1913 – 1931 . OpenUrl Abstract / FREE Full Text 36. ↵ Labeur , C. , R. Dallerac , and C. Wicker-Thomas , 2002 Involvement of desat1 gene in the control of Drosophila melanogaster pheromone biosynthesis . Genetica 114 : 269 – 274 . OpenUrl CrossRef PubMed Web of Science 37. ↵ Lachaise , D. , J. R. David , F. Lemeunier , and L. Tsacas , 1986 The reproductive relationships of Drosophila sechellia with D. mauritiana, D. simulans, and D. melanogaster from the Afrotropical region . Evolution . 38. ↵ Lasbleiz , C. , J.-F. Ferveur , and C. Everaerts , 2006 Courtship behaviour of Drosophila melanogaster revisited . Anim Behav 72 : 1001 – 1012 . OpenUrl CrossRef Web of Science 39. ↵ Lazareva , A. A. , G. Roman , W. Mattox , P. E. Hardin , and B. Dauwalder , 2007 A role for the adult fat body in Drosophila male courtship behavior . PLoS Genet 3 : e16 . OpenUrl CrossRef PubMed 40. ↵ Legendre , A. , X.-X. Miao , J.-L. Da Lage , and C. Wicker-Thomas , 2008 Evolution of a desaturase involved in female pheromonal cuticular hydrocarbon biosynthesis and courtship behavior in Drosophila. Insect Biochem . Mol. Biol. 38 : 244 – 255 . OpenUrl 41. ↵ Llopart , A. , D. Lachaise , and J. A. Coyne , 2005 An anomalous hybrid zone in Drosophila . Evolution 59 : 2602 – 2607 . OpenUrl CrossRef PubMed Web of Science 42. ↵ Love , M. I. , W. Huber , and S. Anders , 2014 Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2 . Genome Biol 15 : 31 – 21 . OpenUrl CrossRef 43. ↵ Matute , D. R. , and J. F. Ayroles , 2014 Hybridization occurs between Drosophila simulans and D. sechellia in the Seychelles archipelago . J. Evol. Biol. 27 : 1057 – 1068 . OpenUrl CrossRef PubMed 44. ↵ Moehring , A. J. , J. Li , M. D. Schug , S. G. Smith , M. deAngelis et al. , 2004 Quantitative trait loci for sexual isolation between Drosophila simulans and D. mauritiana . Genetics 167 : 1265 – 1274 . OpenUrl Abstract / FREE Full Text 45. ↵ Niehuis , O. , J. Büllesbach , A. K. Judson , T. Schmitt , and J. Gadau , 2011 Genetics of cuticular hydrocarbon differences between males of the parasitoid wasps Nasonia giraulti and Nasonia vitripennis . Heredity (Edinb) 107 : 61 – 70 . OpenUrl CrossRef PubMed 46. ↵ Noor , M. A. , 1995 Speciation driven by natural selection in Drosophila . Nature 375 : 674 – 675 . OpenUrl CrossRef PubMed Web of Science 47. ↵ Partridge , L. , 1980 Mate choice increases a component of offspring fitness in fruit flies. ature, Lond . Nature 283 : 290 – 291 . OpenUrl CrossRef Web of Science 48. ↵ Partridge , L. , and M. Farquhar , 1981 Sexual activity reduces lifespan of male fruitflies . Nature 294 : 580 – 582 . OpenUrl CrossRef Web of Science 49. ↵ Pechine , J. M. , F. Perez , C. Antony , and J.-M. Jallon , 1985 A further characterization of Drosophila cuticular monoenes using a mass spectrometry method to localize double bonds in complex mixtures . Anal. Biochem. 145 : 177 – 182 . OpenUrl CrossRef PubMed Web of Science 50. ↵ Perkins , L. A. , L. Holderbaum , R. Tao , Y. Hu , R. Sopko et al. , 2015 The Transgenic RNAi Project at Harvard Medical School: Resources and Validation . Genetics 201 : 843 – 852 . OpenUrl Abstract / FREE Full Text 51. ↵ Phadnis , N. , E. P. Baker , J. C. Cooper , K. A. Frizzell , E. Hsieh et al. , 2015 The Drosophila melanogaster hybrid male rescue gene causes inviability in male and female species hybrids . Science 350 : 1552 – 1555 . OpenUrl Abstract / FREE Full Text 52. ↵ Pimentel , H. , N. L. Bray , S. Puente , P. Melsted , and L. Pachter , 2017 Differential analysis of RNA-seq incorporating quantification uncertainty . Nat Meth 14 : 687 – 690 . OpenUrl CrossRef 53. ↵ Pischedda , A. , M. P. Shahandeh , W. G. Cochrane , V. A. Cochrane , and T. L. Turner , 2014 Natural variation in the strength and direction of male mating preferences for female pheromones in Drosophila melanogaster . PLoS ONE 9 : e87509 . OpenUrl 54. ↵ Quinn , T. P. , M. J. Unwin , and M. T. Kinnison , 2000 Evolution of temporal isolation in the wild: genetic divergence in timing of migration and breeding by introduced chinook salmon populations . Evolution 54 : 1372 – 1385 . OpenUrl CrossRef PubMed Web of Science 55. ↵ Sawamura , K. , M.-T. Yamamoto , and T. K. Watanabe , 1993 Hybrid lethal systems in the Drosophila melanogaster species complex. II. The Zygotic hybrid rescue (Zhr) gene of D. melanogaster . Genetics 133 : 307 – 313 . OpenUrl Abstract / FREE Full Text 56. ↵ Servedio , M. R. , 2007 Male versus female mate choice: sexual selection and the evolution of species recognition via reinforcement . Evolution 61 : 2772 – 2789 . OpenUrl CrossRef PubMed Web of Science 57. ↵ Servedio , M. R. , and M. A. F. Noor , 2003 The Role of Reinforcement in Speciation: Theory and Data. Annu . Rev. Ecol. Evol. Syst. 34 : 339 – 364 . OpenUrl 58. ↵ Shahandeh , M. P. , A. Pischedda , and T. L. Turner , 2018 Male mate choice via cuticular hydrocarbon pheromones drives reproductive isolation between Drosophila species . Evolution 72 : 123 – 135 . OpenUrl 59. ↵ Shirangi , T. R. , H. D. Dufour , T. M. Williams , and S. B. Carroll , 2009 Rapid evolution of sex pheromone-producing enzyme expression in Drosophila . PLoS Biol 7 : e1000168 . OpenUrl CrossRef PubMed 60. ↵ Sigrist , C. J. A. , E. de Castro , L. Cerutti , B. A. Cuche , N. Hulo et al. , 2012 New and continuing developments at PROSITE . Nucleic Acids Research 41 : D344 – D347 . OpenUrl PubMed 61. ↵ Sokolowski , M. B. , 2001 Drosophila: genetics meets behaviour . Nat. Rev. Genet. 2 : 879 – 890 . OpenUrl CrossRef PubMed Web of Science 62. ↵ Spieth , H. T. , 1952 Mating behavior within the genus Drosophila (Diptera). Bulletin of the AMNH; v. 99, article 7 . Bulletin of the American Museum of Natural History 99 : 399 – 474 . OpenUrl 63. ↵ Sturtevant , A. H. , 1915 Experiments on sex recognition and the problem of sexual selection in Drosophila . Journal of Animal Behavior 5 : 351 – 365 . OpenUrl 64. ↵ Szafer-Glusman , E. , M. G. Giansanti , R. Nishihama , B. Bolival Jr . , J. Pringle et al. , 2008 A role for very-long-chain fatty acids in furrow ingression during cytokinesis in Drosophila spermatocytes . Curr Biol 18 : 1426 – 1431 . OpenUrl CrossRef PubMed Web of Science 65. Tanji , T. , A. Ohashi-Kobayashi , and S. Natori , 2006 Participation of a galactose-specific C-type lectin in Drosophila immunity . Biochem. J. 396 : 127 – 138 . OpenUrl Abstract / FREE Full Text 66. Theopold , U. , M. Rissler , M. Fabbri , O. Schmidt , and S. Natori , 1999 Insect glycobiology: a lectin multigene family in Drosophila melanogaster . Biochem. Biophys. Res. Commun. 261 : 923 – 927 . OpenUrl CrossRef PubMed Web of Science 67. ↵ van de Geijn , B. , G. McVicker , Y. Gilad , and J. K. Pritchard , 2015 WASP: allele-specific software for robust molecular quantitative trait locus discovery . Nat Meth 12 : 1061 – 1063 . OpenUrl 68. ↵ Watanabe , T. K. , 1979 A gene that rescues the lethal hybrids between Drosophila melanogaster and D. simulans . Jpn. J. Genet. 54 : 325 – 331 . OpenUrl CrossRef 69. ↵ Wicker-Thomas , C. , D. Garrido , G. Bontonou , L. Napal , N. Mazuras et al. , 2015 Flexible origin of hydrocarbon/pheromone precursors in Drosophila melanogaster . J. Lipid Res . 56 : 2094 – 2101 . OpenUrl Abstract / FREE Full Text Back to top Previous Next Posted June 12, 2018. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Tissue-specific cis-regulatory divergence implicates a fatty acid elongase necessary for inhibiting interspecies mating in Drosophila Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Tissue-specific cis-regulatory divergence implicates a fatty acid elongase necessary for inhibiting interspecies mating in Drosophila Peter A. Combs , Joshua J. Krupp , Neil M. Khosla , Dennis Bua , Dmitri A. Petrov , Joel D. Levine , Hunter B. Fraser bioRxiv 344754; doi: https://doi.org/10.1101/344754 Share This Article: Copy Citation Tools Tissue-specific cis-regulatory divergence implicates a fatty acid elongase necessary for inhibiting interspecies mating in Drosophila Peter A. Combs , Joshua J. Krupp , Neil M. Khosla , Dennis Bua , Dmitri A. Petrov , Joel D. Levine , Hunter B. Fraser bioRxiv 344754; doi: https://doi.org/10.1101/344754 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Areas All Articles Animal Behavior and Cognition (7969) Biochemistry (18633) Bioengineering (14770) Bioinformatics (44156) Biophysics (22458) Cancer Biology (19591) Cell Biology (26746) Clinical Trials (138) Developmental Biology (13902) Ecology (20890) Epidemiology (2067) Evolutionary Biology (25316) Genetics (16100) Genomics (23400) Immunology (18609) Microbiology (42209) Molecular Biology (17947) Neuroscience (92896) Paleontology (693) Pathology (2969) Pharmacology and Toxicology (5063) Physiology (8066) Plant Biology (15908) Scientific Communication and Education (2091) Synthetic Biology (4538) Systems Biology (10188) Zoology (2376) window.__CF$cv$params={r:'a3797fa7cd9dfc7e',t:'MTc4ODgyMzc5OQ==',u:'01a07e350b7c74f39186cff2feaae38d',ut:'VeIpN8GpZRGeHfyqZ2kjiYvfPixqB0yTgaGPnI20hH8-1788823800-1.2.1.1-J4mEdRScUAmeXUqowu7X34YxwL06dVPldEYcy76fgLn3pTVme_o3Qdq.o3iVnnBT.cDe1qzhOhCSazYkqlnuOqtY23yAdouQzYo8onGQR_k',i:60};(function(){if(!document.body)return;var s=document.createElement('script');s.src='/cdn-cgi/challenge-platform/scripts/precursor/main.js';document.head.appendChild(s);})();
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.