MicroRNA363-5p Targets Thrombospondin3 to Regulate Pathological Cardiac Remodeling

MicroRNA363-5p Targets Thrombospondin3 to Regulate Pathological Cardiac Remodeling | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article MicroRNA363-5p Targets Thrombospondin3 to Regulate Pathological Cardiac Remodeling Yu-Kun Ma, Xin-yi Han, Shu-huai Zan, Hui-ting Liu, Xue-yan Zhou, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4371143/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 07 Oct, 2024 Read the published version in Molecular and Cellular Biochemistry → Version 1 posted 10 You are reading this latest preprint version Abstract Cardiac remodeling is an end-stage manifestation of multiple cardiovascular diseases, and microRNAs are involved in a variety of posttranscriptional regulatory processes. miR-363-5p targeting of Thrombospondin3 (THBS3) has been shown to play an important regulatory role in vascular endothelial cells, but the roles of these two in cardiac remodeling are unknown. We first established an in vivo model of cardiac remodeling induced by transverse aortic narrow (TAC). human cardiomyocyte cell line (AC16) and human cardiac fibroblast cell line (HCF) were treated with 1 µmol/L angiotensin II (AngⅡ) to construct an in vitro model of myocardial hypertrophy and myocardial fibrosis. In all three of the above models, we found a significant decreasing trend of miR-363-5p, suggesting that it plays a key regulatory role in the occurrence and development of cardiac remodeling. Subsequently, overexpression of miR-363-5p significantly attenuated myocardial hypertrophy and myocardial fibrosis in vitro as evidenced by reduced the area of AC16, the cell viability of HCFs, the relative expression of the protein of fetal genes (ANP, BNP, β-MHC) and fibrosis marker (collagen Ⅰ, collagen Ⅲ, α-MSA), whereas inhibition of miR-363 -5p expression showed the opposite trend. In addition, we also confirmed the targeted binding relationship between miR-363-5p and THBS3 by dual luciferase reporter gene assay, and the relative expression of THBS3 mRNA and protein were significantly decreased upon overexpression of miR-363-5p. Moreover, overexpression of miR-363-5p with THBS3 Simultaneously partially eliminated the delaying effect of miR-363-5p on myocardial hypertrophy and myocardial fibrosis in vitro. In conclusion, Overexpression of miR-363-5p attenuated the prohypertrophic and profibrotic effects of Ang II on AC16 and HCF by a mechanism related to the inhibition of THBS3 expression. MicrRNA-363-5p Thrombospondin 3 Cardiac remodeling Cardiac hypertrophy Myocardial fibrosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 1. Introduction Heart failure (HF) is a clinical syndrome characterized by high morbidity and mortality due to structural or functional abnormalities of the heart caused by a variety of different harmful stimuli that result in impaired ventricular diastolic function[ 1 , 2 ]. Both primary and secondary CVD eventually lead to HF, and according to global epidemiologic surveys, the prevalence of HF ranges from 3 to 5 per 100 people in the total population[ 3 ]. Therefore, the prevention and treatment of HF has become the focus of the cardiovascular disease (CVD) research field. In response to the development of HF, there are multiple compensatory responses in the body, among which cardiac remodeling is a chronic adaptive response in response to the long-term increase in cardiac load, which is an important molecular pathological basis for the development of HF. The heart is composed of cardiomyocytes, noncardiomyocytes (e.g., cardiac fibroblasts), and extracellular matrix (ECM), and all three of these components are altered accordingly during the onset and development of cardiac remodeling[ 4 ]. Cardiomyocyte remodeling consists mainly of cardiac hypertrophy and changes in the cardiomyocyte phenotype. Cardiac hypertrophy refers to an increase in the size of cardiomyocytes, which is manifested at the cellular level by a widening of cell diameter and an increase in length, and at the organ level by an increase in the weight of the ventricle and a thickening of the ventricular wall, and the above alterations help to maintain the volume of cardiac output[ 5 ]; alterations in the phenotype of cardiomyocytes refer to the activation of genes that are in the quiescent fetal phase in adult cardiomyocytes, such as ANP, BNP, and β-MHC, and the transformed cardiomyocytes can change the diastolic capacity of the myocardium[ 6 ]. Cardiac fibroblasts are the main component of noncardiomyocytes in the human heart, and when subjected to external pathological stimuli, fibroblasts are activated and undergo a cellular phenotypic transition to further differentiate into myofibroblasts, which also secrete α-smooth muscle actin (α-SMA)[ 7 ]. α-SMA is secreted by myofibroblasts with genes encoding for collagen fibers of types Ⅰ and Ⅲ in their nuclei, which leads to increased secretion of ECM, which is predominantly composed of type Ⅰ and Ⅲ collagen fibers. This increases the tensile strength of the myocardium and prevents ventricular thinning[ 8 ]. The above compensatory methods are initially beneficial to the organism, but their compensatory capacity is limited. Under long-term and continuous pathological stimuli, excessive myocardial hypertrophy occurs in the form of ischemia and hypoxia, resulting in weakened myocardial diastolic force[ 9 ], excessive ECM deposition, an imbalance in degradation and an imbalance in proportion, leading to myocardial fibrosis, which will subsequently reduces the compliance of the ventricular wall and increases stiffness, affecting the heart's diastolic function, and compensates for cardiac remodeling toward decompensation, resulting in HF, and even sudden death from cardiovascular disease[ 10 ]. Therefore, delaying and reversing cardiac remodeling is essential for the treatment of HF and the prevention of sudden cardiovascular death. Related studies have pointed out that the progression of cardiac remodeling cannot be assessed routinely by endomyocardial biopsy at present, but can be reflected in circulating in vivo levels of several biomarkers (e.g., noncoding RNAs.), which may characterize the development of HF and its long-term prognosis[11]. Noncoding RNAs (ncRNA) are considered as waste RNAs because they have not been directly involved in the transcription of genes for a long time, but as they have been studied more intensively, they have been found to play key regulatory roles in participating in a variety of biological processes. Noncoding RNAs include lncRNAs, microRNAs, and cicrcRNAs, among which microRNAs are small endogenous ncRNAs that regulate a variety of biological processes by binding to the 3'UTR region of target mRNAs, then inhibiting translation, or contributing to mRNA degradation. Numerous studies have shown that microRNAs are involved in the regulation of cardiac remodeling, and that miR-574 regulates the expression of FAM210A and affects pathological cardiac remodeling[12]. Downregulation of miR128 ameliorates Ang II-induced cardiac remodeling through the SIRT1/PIK3R1 pathway[13]. THBS2 mediates the regulation of pulmonary arterial hypertension-induced cardiac fibrosis via miR-29a-3p[14]. miR-27b-3p downregulates FGF1 and exacerbates pathological cardiac remodeling[4], et. al. The Thrombospondin (THBS) family consists of five homologous genes, of which THBS1 and THBS2 form dimers and THBS3, 4, and 5 form trimers. THBS proteins are selectively expressed during embryonic development, but in adulthood their expression is essentially absent until an injurious event occurs and, they play an important role in tissue repair. Although the C-terminal end 1/2 amino acid sequences of all THBS families are highly homologous, each family has all have different functions. Numerous studies have confirmed that THBS proteins play important roles in cardiovascular pathology, for example, THBS1 gene deletion exacerbates pressure overload-induced myocardial hypertrophy, myocardial dilatation, and cardiomyocyte death[ 15 ]. In response to pressure overload, mice with THBS2 deletion exhibit cardiac rupture and HF, suggesting that THBS2 is required for the maintenance of cardiac integrity[ 16 ]. THBS3 expression is downregulated in an animal model of cardiac hypertrophy established by transverse aortic narrowing and THBS3 activates endoplasmic reticulum stress[ 17 ]. THBS4-deficient mice also exhibit important deficits in adapting to chronic pressure overload, resulting in ventricular dilatation, decreased cardiac function, and increased heart weight[ 18 ]. In addition, THBS plays a key regulatory role in a variety of CVDs including myocardial infarction[ 19 ], HF[ 20 ], atherosclerosis[ 21 , 22 ], and valvular disease[ 23 ], opening up possibilities for CVD treatment and intervention. The first discovered THBS1 and THBS2 were the focus of many early studies and are known for their potent antiangiogenic effects, and recently THBS1 has also been found to exhibit unique activity in thyroid tumors[ 24 ]. In addition, THBS3 and THBS4 are highly similar in terms of protein structure and overall sequence, both proteins are expressed in the heart and are upregulated in cardiac diseases, and the function of THBS4 in HF has been investigated. Moreover, miR-363-5p targeting of THBS3 has been shown to play an important regulatory role in vascular endothelial cells[ 25 ], but the roles of these two in myocardial hypertrophy are unknown. On this basis, our group screened microRNAs (miR-363-5p) that regulate the transcriptional level of THBS3 through microRNA database, trying to explore the regulatory role of both in cardiac remodeling. Thus, we demonstrated that miR-363-5p expression was decreased in cardiac remodeling and that miR-363-5p exacerbated myocardial hypertrophy and myocardial fibrosis by downregulating THBS3 expression. Our findings provide a novel therapeutic target for the prevention and treatment of HF. 2. Materials and Methods 2.1 Mice and Transverse Aortic Constriction (TAC) A total of 12 male C57BL/6 mice were purchased from BEIENTE Biotechnology Co., Ltd, Hubei, China (SPF grade, 17–24 g, 6–8 weeks old) and randomly divided into model group ("TAC" group) and sham operation group ("Sham" group). The mice were anesthetized with a single intraperitoneal injection of 2,2,2-tribromoethanol saline solution (Sigma-Aldrich, St. Louis, USA, 10 µl/g). A topical depilatory agent was applied to the neck and chest for hair removal. 75% alcohol was used to disinfect the skin of the chest, and a 1.5-2 cm incision was made in the midline of the neck and chest, then gently detach the thymus gland and fat to expose the aortic arch. A 28G cushion needle was placed between the right cephalic brachial artery and the left common carotid artery, and the aortic arch was ligated with a 7 − 0 suture around the cushion needle, and the cushion needle was subsequently withdrawn to achieve the purpose of narrowing the vessel. The wound was wiped with povidone-iodine, the thoracic cavity was closed layer by layer, the skin was sutured, and the animals were placed on a warming plate and kept warm until they awoke, and then they were returned to the cage for routine rearing. In the Sham group, no ligatures were placed after the aortic arch had been freed, and all other operations were identical to those in the TAC group. 2.2 Echocardiography Echocardiography was performed on the mice at 4 and 8 weeks after TAC, respectively. First, the small animal ultrasound detector (Esaote, Firenze, Italy) was turned on and the corresponding detection module was selected. The mice were placed into the anesthesia induction box, and the anesthesia gas was adjusted to 3 L/min. After 1 min, the mice were anesthetized, and the mice were gently picked up and placed on the mouse board, and the anesthesia gas flow was subsequently adjusted to 1.5 L/min. The ultrasound coupling agent was then applied to the detection site, and the position of the probe was adjusted until the left ventricle of the heart was clearly defined and the long axis of the heart was perpendicular to the direction of the body, and M-ultrasound was selected on the touch panel, and the sampling line was adjusted, and the appropriate detection module was chosen. Adjust the sampling line and choose the appropriate position until the image was clear. Finally, the end-systolic thickness of the posterior wall of the left ventricle (LvPws, mm), the end-diastolic thickness of the posterior wall of the left ventricle (LvPwd, mm), the end-systolic internal diameters of the posterior wall of the left ventricle (LVIDs, mm), and the end-diastolic internal diameters of the posterior wall of the left ventricle (LVIDd, mm) were measured and recorded, and the left ventricular ejection fraction and the left ventricular shortening rate of the left ventricle short-axis were calculated separately in the mice. All measurements covered at least three consecutive cardiac cycles. 2.3 HE staining Four weeks after TAC, mice were euthanized. Mouse hearts were removed and put into 4% formaldehyde solution, ethanol solution and xylene (YANTAI YUANDONG FINE CHEMICALS CO., LTD, YanTai, China) to complete the fixation, dehydration and transparency operations, and the hearts were immersed in paraffin wax for embedding. After trimming the shape of the wax blocks, they were fixed on a slicer (Leica, Wetzlar, Germany) to make a series of slices. The sections were sequentially placed in hematoxylin staining solution, 1% ethanol hydrochloride and eosin staining (YANTAI YUANDONG FINE CHEMICALS CO., LTD, YanTai, China) for staining and differentiation. After drying at room temperature and adding coverslips, the sections were sealed and fixed using neutral resin. Finally, the cells were observed and photographed under microscope (Olympus, Tokyo, Japan), which required that most of the field of view be in cross-section, and the cells selected for calculation of cross-sectional area were required to have a unique nucleus and a relatively clear border. 2.4 Masson staining Tissue sections were deparaffinized in xylene solution, fixed in Bouin's solution (56°C, 15min), and gently rinsed in running water. Tissue sections were immersed in Weigert's iron hematoxylin staining solution (5-10min), 1% hydrochloric acid alcohol differentiation (15s), and then immersed in Lichtenstein's red acidic magenta staining solution (5-10min), immersed in phosphomolybdic acid solution (5min), restained using aniline blue staining solution (5min), and immersed in 1% glacial acetic acid (2min). Tissue sections were rapidly immersed in 95% ethanol I and 95% ethanol II for each 5 times, and then xylene for 2 times for transparency. Neutral gum was used to seal the sections, and then cover the tissues gently with coverslips to avoid air bubbles, and air-dried in a ventilated place (all the above reagents were purchased from YANTAI YUANDONG FINE CHEMICALS CO., LTD, YanTai, China). 2.5 Cell culture and establishment of in vitro models of cardiac hypertrophy and myocardial fibrosis The human cardiomyocyte cell line (AC16) was purchased from iCell (Shanghai, China), and the human cardiac fibroblast cell line (HCF) was purchased from BeNa Culture Collection (HeNan, China). AC16 cells were cultured in DMEM/F-12 medium (iCell, Shanghai, China), and HCF cells were cultured in DMEM medium (Hyclone, Logan, UT, USA), which was supplemented with 10% fetal bovine serum, 1% penicillin/streptomycin, and cultured in a constant temperature incubator at 37°C with 5% CO2. AC16 cells and HCF cells were treated with 1 µmol/L Ang II (Abmole, Chicago, IL, USA) for 24 h to induce the development of hypertrophic phenotype and fibrotic phenotype. At the end of induction, the validity of the model establishment was evaluated by the protein expression levels of fibrotic marker (collagen I, collagen III, and α-SMA) and fetal genes (ANP, BNP, and β-MHC), the area of AC16 cells, and the viability of HCF cells. 2.6 Cell transfection Take jetPRIME buffer (50µl), add mimics (100nM) or inhibitor (200nM) and vortex to mix. Add jetPRIME reagent (1µl) and incubate at room temperature for 10min. Take 50µl of the above mixtures and add them into the cell culture medium respectively, and replace the fresh medium after 4–6 hours, add 1µmol/L Ang II, 5% CO2, and incubate at 37℃. Subsequent assays were performed 48h after transfection. jetPRIME reagent, mimics, inhibitor and the corresponding negative control (NC) were purchased from PolyPlus (Strasbourg, France). 2.7 Phalloidin-Alexa Fluor 488 staining AC16 cells were washed twice with PBS (Life, Carlsbad, California CA, USA), fixed with methanol-free formaldehyde solution (Servicebio, Wuhan, China) at room temperature for 10–20 min, and then washed with PBS containing 0.1% Triton X-100 (Sigma, Darmstadt, Germany) for 5 min each time. Actin-Tracker Green (Beyotime, Shanghai, China) was diluted with PBS containing 1–5% BSA and 0.1% Triton X-100 at a ratio of 1:40–200. The dilution ratio was adjusted appropriately according to the staining effect. Add 200µl of staining solution to each slice and incubate for 30-60min at room temperature, avoiding light. 20µl of DAPI (Servicebio, Shanghai, China) was added to the sealing film and incubated for 10min at room temperature, avoiding light, and then put the slides back into the 24-well plate. Clip out the membrane, absorb the excess water with filter paper, add sealing agent to seal the membrane, and then perform fluorescence detection. 2.8 CCK8 Take 20 µl of cell suspension and add 20 µl of Trypan blue for counting, spread the plate at 10,000/well (96-well plate), 100 µl per well, and set up a blank group at the same time, add 100 µl of sterile PBS in the wells around the cell wells, 5% CO2, and incubate at 37℃ overnight. Subsequently, transfection reagents were added for transfection. 10µl of CCK8 solution (DOJINDO, Kumamoto prefecture, Japan) was added to each well and incubated in 5% CO2, 37℃ incubator for 3h, and the optical density (OD) of 450 nm was measured in each well by micro-plate reader (Thermo, Waltham, MA, USA). 2.9 Transwell 200µl of cell suspension was added to the Transwell, 600µl of medium containing 10% FBS was added to the lower chamber of 24-well plate, and incubated at 37℃ for 24 h. The Transwell was removed, the culture solution in the wells was discarded, and the cells were washed twice with PBS. The cells were fixed with 4% PFA for 10min, and washed twice with PBS. Crystalline violet (Beyotime, Shanghai, China) was stained for 10 min, washed twice with PBS, and the cells in the upper chamber were wiped out with a cotton swab. The migrated cells were observed under the microscope, and 3 fields of view were randomly selected for photographing and counting. 2.10 Quantitative real-time fluorescence PCR (qRT-PCR) Total RNA was extracted from cell lines and tissues using TsingZol Total RNA Extraction Reagent. Then, mRNA and microRNA were reverse transcribed into cDNA using SynScriptTM III cDNA Synthesis Mix according to the instructions (all the above reagents were purchased from TSINGKE, Beijing, China). The real-time fluorescence quantitative PCR reaction and results were conducted in a real-time PCR instrument (ABI QuantStudio 12K, Foster City, CA, USA). The reaction conditions were as follows: pre-denaturation at 95°C for 1 min, denaturation at 95°C for 10 s, annealing at 60°C for 10 s, and extension at 72°C for 15 s. A total of 40 cycles were performed. The relative expression levels of THBS3 mRNA and miR-363-5p were calculated by 2-ΔΔCt method. GAPDH and U6 were used as internal references to detect the expression levels of coding genes and miR-363-5p, respectively. The primer sequences are listed below: Table 1 The sequences of PCR primer Name Sequences(5’-3’) size(bp) GADPH ATGGGTGTGAACCACGAGA 115 CAGGGATGATGTTCTGGGCA THBS3 GATGGCAATGGAGAAGGAGATG 184 TGTCTGGGTAGGATTGCTCATT miR-363-5p loop GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC AAATTGCA 80 U6 CGCTTCGGCAGCACATATAC 85 AAATATGGAACGCTTCACGA 2.11 Western blot Total cell and tissue proteins were extracted using RIPA lysate containing protease inhibitors. BCA protein quantification kit was used to determine the protein content and calculate the volume of samples (lysate and BCA kit were purchased from Beyotime, Shanghai, China). After denaturing polyacrylamide gel electrophoresis, the proteins were transferred to PVDF membrane (Millipore, MA, USA) and incubated at 4°C with primary antibodies ANP (BOSTER, CAL, USA, 1:1000), BNP (Affinity, Melbourne, Victoria, Australia, 1:1000), β- MHC (BOSTER, Cal, USA, 1:1000), THBS3 (proteintech, Chicago, IL, USA, 1:1000), GAPDH (proteintech, Chicago, IL, USA, 1:1000) overnight. TBST (Sinopharm Chemical ReagentCo., Ltd, Shanghai, China) was washed and incubated with the corresponding secondary antibody (1:5000) for 1h at room temperature, washed three times with PBST, and developed, exposed and photographed by a gel imaging system. 2.12 Double-Luciferase Reporter Assay The binding sequence of miR-363-5p to THBS3 was predicted based on the microRNA database ( https://mpd.bioinf.uni-sb.de/ ; https://mirdb.org/ ), and the sequence and its mutated sequence were constructed into the pGL3-promoter vector, respectively, to obtain the wild-type THBS3 and the mutant THBS3 recombinant plasmids. THBS3-WT and THBS3-MUT were co-transfected into HEK293 cells in mimics-NC and miR-363-5p mimics, respectively, and the fluorescence intensities of firefly luciferase and sea kidney luciferase (TransGen, Beijing, China) were measured after 24 h, respectively. The binding effect of miR-363-5p on THBS3 was determined by calculating the magnitude of the ratio between the two. 2.13 Statistical analysis Image J software (NIH, Bethesda, USA), SPSS 27.0 (IBM Corp, IL, USA) and GraphPad Prism 9.0 (GraphPad Software, La Jolla, CA, USA) were used for processing the data and statistical analysis. All the data are expressed as the mean ± standard deviations. The t test was used for comparisons between two groups, and one-way analysis of variance (ANOVA) was used for comparisons among multiple groups. The Bonferroni-corrected post hoc test was implemented for pairwise comparisons within the groups. At P < 0.05, the data were considered significant. 3. Results 3.1 miR-363-5p expression is downregulated in an in vivo model of TAC-induced cardiac remodeling To investigate the role of miR-363-5p in cardiac remodeling, we first generated an in vivo model of cardiac remodeling by transverse aortic constriction (TAC) and evaluated the success of the model by detecting multiple indicators.C57BL/6 mice were subjected to TAC, and echocardiography was performed at 4 weeks and 8 weeks postoperatively. Subsequently, the end-systolic inner diameter of the left ventricular posterior wall (LVIDs), the end-diastolic inner diameter of the left ventricular posterior wall (LVIDd), the end-systolic thickness of the left ventricular posterior wall (LVPWs), and the end-diastolic thickness of the left ventricular posterior wall (LVPWd) were significantly greater in the TAC group than in the sham group ( P < 0.05) (Fig. 1 a ~ b), and the ejection fraction (EF%) and short-axis shortening rate (FS%) were significantly lower in the TAC group than in the sham group ( P < 0.05) (Fig. 1 c).The heart weight-to-body weight ratio (HW/BW) and tibia length-to-heart weight ratio (TL/BW) were calculated, and comparisons revealed that the HW/BW and TL/BW of mice were significantly greater after TAC ( P < 0.05) (Fig. 1 d). H&E staining and Masson staining revealed that the size of cardiomyocytes and the area of fibrotic deposits in the myocardial tissues of mice that underwent TAC were significantly greater ( P < 0.05) (Fig. 1 e ~ h). Western blotting was used to examine the protein expression levels of ANP, BNP, β-MHC, α-SMA, collagen Ⅰ, and collagen Ⅲ in the myocardial tissues of the mice, and the relative expression levels of the above mentioned proteins were significantly elevated in the mice after TAC ( P < 0.05) (Fig. 1 i ~ k).The above results indicated that an in vivo model of cardiac remodeling was successfully established from imaging, morphology and molecular biology perspectives. qRT‒PCR revealed that the relative expression level of miR-363-5p in the myocardial tissues of mice with cardiac remodeling was significantly decreased ( P < 0.05) (Fig. 1 l), indicating that miR-363-5p plays a key regulatory role in cardiac remodeling. 3.2 miR-363-5p expression is downregulated in Ang II-induced cardiac hypertrophy and cardiac fibrosis in vitro models Human cardiomyocytes (AC16) and human fibroblasts (HCFs) were induced with 1 µmol/L Ang II to establish an in vitro model of cardiac hypertrophy and myocardial fibrosis. The results showed that the cell area of AC16 cells was significantly greater ( P < 0.05) (Fig. 2 a ~ b), and the viability of HCF cells was significantly enhanced by Ang II induction ( P < 0.05) (Fig. 2 c). Western blot analysis of fetal gene and fibrosis marker expression revealed that the relative expression of the above mentioned proteins was significantly greater in AC16 and HCF cells treated with Ang II ( P < 0.05) (Fig. 2 d ~ g). The above results indicate that in vitro models of cardiac hypertrophy and myocardial fibrosis have been successfully established. miR-363-5p expression in both cell lines was measured by qRT‒PCR, and the results showed that the relative expression level of miR-363-5p was significantly lower in AC16 and HCF cells treated with Ang II ( P < 0.05) (Fig. 2 h), suggesting that miR-363-5p plays a key role in cardiac hypertrophy and myocardial fibrosis in vitro. 3.3 miR-363-5p attenuates Ang II-induced cardiac hypertrophy and myocardial fibrosis To investigate the effects of miR-363-5p on cardiac hypertrophy and myocardial fibrosis in vitro, miR-363-5p mimics and miR-363-5p inhibitor were transfected into Ang II-induced AC16 cells and HCF cells to determine the effects of miR-363-5p on the hypertrophic phenotype and fibrosis phenotype. qRT‒PCR revealed that the relative expression level of miR-363-5p was significantly greater or lower than that of mimics-NC or inhibitor-NC ( P < 0.05) (Fig. 3 a), indicating successful transfection.In addition, the miR-363-5p mimic significantly reduced the area of AC16 cells, decreased the viability of HCFs, and decreased the relative expression of ANP, BNP, β-MHC, collagen Ⅰ, collagen Ⅲ and α-SMA, whereas the miR-363-5p inhibitor had the opposite effect ( P < 0.05) (Fig. 3 b ~ h). These results indicated that miR-363-5p could delay Ang II-induced cardiac hypertrophy and myocardial fibrosis in vitro. 3.4 THBS3 is a target gene of miR-363-5p Bioinformatics online analysis revealed ( https://mpd.bioinf.uni-sb.de/ ; https://mirdb.org/ ) that the 3'UTR of THBS3 contains a potential binding site for miR-363-5p (Fig. 4 a). Subsequently, a dual luciferase reporter gene assay was performed, and the results showed that luciferase activity was significantly lower in HEK293 cells cotransfected with the 3'UTR of wild-type THBS3 and miR-363-5p mimics than in those cotransfected with mimics-NC ( P 0.05) (Fig. 4 b). In addition, qRT‒PCR and Western blot results showed that both THBS3 mRNA and protein expression levels were significantly downregulated ( P < 0.05) (Fig. 4 c ~ f). The above results suggested that miR-363-5p negatively regulates THBS3 expression. 3.5 THBS3 mediates the delayed effect of miR-363-5p To investigate whether THBS3 mediates miR-363-5p to exert a regulatory effect on myocardial hypertrophy and myocardial fibrosis, a THBS3 overexpression vector was constructed, and the THBS3 overexpression vector was cotransfected with miR-363-5p mimics into AC16 and HCF cells to observe whether the overexpression of THBS3 partially eliminated the delayed effects of miR-363-5p on myocardial hypertrophy and myocardial fibrosis. First, Western blot and qRT‒PCR results showed that the THBS3 overexpression vector was constructed successfully ( P < 0.05) (Fig. 5 a ~ b). Moreover, compared with those in cells overexpressing miR-363-5p alone, the area of AC16, the viability of HCFs, the migration rate of HCFs and the relative expression of ANP, BNP, β-MHC, collagen Ⅰ, collagen Ⅲ, and α-SMA were significantly greater in cells co-overexpressing THBS3 and miR-363-5p ( P < 0.05) (Fig. 5 c ~ k), and the effect of miR-363-5p was partially reversed. 4 Discussion This study focused on the effect of miR-363-5p, which targets THBS3, on Ang II-induced cardiac hypertrophy and myocardial fibrosis. The results showed that miR-363-5p was significant decreased in both in vivo and in vitro models of cardiac hypertrophy and myocardial fibrosis established by TAC surgery and Ang II induction; the overexpression of miR-363-5p in the in vitro model effectively attenuated the phenotypes of cardiac hypertrophy and fibrosis; and THBS3, a downstream target of miR-363-5p, mediated the delayed effect of miR-363- 5p on cardiac hypertrophy and fibrosis. Whether primary or secondary cardiovascular disease (CVD), if not treated and allowed to develop, eventually led to cardiac remodeling, which in turn led to HF. Myocardial hypertrophy and myocardial fibrosis are important compensatory modes of cardiac remodeling, and their progression precedes that of HF; therefore, reversing and slowing down myocardial hypertrophy and myocardial fibrosis are of great significance in the prevention and treatment of HF. As the knowledge of microRNAs becomes clearer, they have been found to play important roles in many CVDs, but their specific mechanisms have not been fully elucidated. Thrombospondin (THBS) is an extracellular matrix protein that plays an important role in regulating cell-cell and cell-matrix interactions, and THBS plays an important regulatory role in many CVDs, which offers the possibility of intervention and treatment of CVDs. Our group subsequently searched the microRNA database to search for upstream microRNAs that regulate THBS3, and ultimately target miR-363-5p. It has been shown that miR-363-5p can regulate the expression of THBS3 at the posttranscriptional level to affect the properties of vascular endothelial cells[ 25 ], but it is not yet clear whether these two factors play a role in cardiac diseases. With the above theoretical basis, our group designed experiments to explore the effects of both on cardiac remodeling. There are many methods to construct an in vivo model of cardiac remodeling, and the common methods are aortic constriction, Ang II infusion, and norepinephrine infusion, etc. TAC was first proposed by Rockman[ 26 ], and it is one of the most commonly used surgical procedures to simulate the increase in preload and afterload resulting in HF in animals, with fewer postoperative infections and less mortality. In most studies, the success of model construction was comprehensively judged from multiple perspectives after TAC by echocardiography, calculating cardiac coefficients, observing gross and microscopic changes in the heart, quantifying the size of cardiomyocytes, detecting the expression of hypertrophic markers and fibrosis marker proteins, and determining the viability of fibroblasts and the rate of cell migration. In addition, under a variety of pathological stimuli, fetal genes, such as ANP, BNP and β-MHC, can be activated in quiescent cardiomyocytes, so the above three proteins have been regarded as marker proteins of cardiac hypertrophy in a large number of related studies; fibroblasts are transformed to myofibroblasts and secrete α-SMA, and myofibroblasts are an important source of collagen Ⅰ and collagen Ⅲ. Thus, the above three proteins are also considered as marker proteins of myocardial fibrosis. In this study, we also examined the end-systolic and end-diastolic thickness and internal diameter of the posterior wall of the left ventricle, EF%, and FS% at 4 and 8 weeks after TAC, and found that the above indices of the TAC mice were obviously abnormal. The cardiac coefficients of the mice were calculated, and the hearts of the mice were subjected to HE staining and Masson staining. After TAC, cardiomyocytes were significantly enlarged, and the area of collagen deposition increased. Western blot analysis of the expression of hypertrophy marker proteins and fibrosis marker proteins revealed that the above proteins were significantly elevated in the myocardial tissues of mice subjected to TAC, which was consistent with previous studies, and at the same time, the above results also comprehensively and powerfully confirmed the successful establishment of the in vivo model of cardiac remodeling from multi perspectives of echocardiography, macroscopic, morphology, and molecular biology and confirmed that the prerequisites for the next step of the experiments were met. To clarify the expression of miR-363-5p in the in vivo model of cardiac remodeling, the expression of miR-363-5p was detected in the myocardial tissues of the two groups of mice, and it was found that the relative expression level of miR-363-5p in the myocardial tissues of the mice after TAC was significantly reduced, suggesting that it has an important role in regulating the onset and development of cardiac remodeling. To explore the specific mechanism, in vitro experiments were designed for further demonstration. Ang Ⅱ is ideally used as a commonly used drug to replicate in vitro cardiac hypertrophy and myocardial fibrosis models[ 27 , 28 ]. After AC16 and HCF cells were treated with 1 µmol/L Ang Ⅱ for 48 h in, the comparison revealed that the cell area of the AC16 cells and the expression of hypertrophic marker proteins were significantly greater, which could effectively induce cardiac hypertrophy. Moreover, the viability of HCFs cells and the expression of fibrotic markers were also significantly greater, which could effectively induce myocardial fibrosis, consistent with previous studies. The above results also demonstrated that the in vitro models of cardiac hypertrophy and myocardial fibrosis were successfully established. Subsequently, the relative expression levels of miR-363-5p were detected, and the comparison revealed that miR-363-5p was significantly lower after Ang Ⅱ treatment, suggesting that miR-363-5p plays an important role in the regulation of myocardial hypertrophy and myocardial fibrosis in vitro. Subsequently, changes in hypertrophy- and fibrosis-related phenotypes were observed after specific transfection of miR-363-5p mimics and miR-363-5p inhibitor in Ang II-induced cardiomyocytes and fibroblasts, and the results showed that overexpression of miR-363-5p significantly reduced the cardiomyocyte cell area, the expression level of hypertrophic marker proteins, cell viability of fibroblasts, and expression level of fibrosis marker proteins, while inhibition of miR-363-5p expression showed the opposite trend. The above results suggest that miR-363-5p inhibits and delays myocardial hypertrophy and myocardial fibrosis from the perspectives of morphology and molecular biology, respectively. The effects of microRNAs on cardiac hypertrophy and myocardial fibrosis may be either promotional or inhibitory, with different microRNAs responding to different mechanisms. This is mainly because different microRNAs have different coping mechanisms and different circulating levels under different pathological stimuli. Therefore, it is necessary to select the circulating levels of several key microRNAs, discuss the significance of each, and comprehensively assess the progression of myocardial hypertrophy to guide clinical diagnosis and treatment. THBS proteins are selectively expressed during embryonic development, and in adulthood, expression is largely absent until an injurious event occurs, which may be induced in all five family members[ 23 ]. Little is known about the role of THBS3 in tissue homeostasis and disease, except for its role in bone development. Lynch J et al reported that transgenic mice in which THBS3 was overexpressed in cardiomyocytes exhibited exacerbated cardiac pathology in response to stressful stimuli, whereas mice lacking THBS3 were protected[ 29 ], Tobias G et al. demonstrated that in a TAC-induced cardiac hypertrophy animal model, in an in vitro model of activated calmodulin phosphatase A-induced cardiomyopathy and in an animal model of dilated cardiomyopathy mimicked by Csrp 3−/− , the expression of THBS3 was elevated and activated endoplasmic reticulum stress-related molecules, such as ATF6, BiP, and others[ 17 ]. THBS3 was predicted to be a potential target gene of miR-363-5p in the microRNA database. In this paper, we verified that miR-363-5p successfully binds to wild-type THBS3 sequences and represses the transcription of downstream genes by dual luciferase reporter gene experiments, which results in restricted luciferase gene expression and low fluorescence intensity from catabolism of the substrate. In contrast, miR-363-5p could not bind to the THBS3 mutant sequence, so it did not affect the gene transcription of luciferase, and the fluorescence intensity produced by the decomposed luciferase substrate was similar to that of the control group, and there was no statistically significant difference between the two. The above results suggested that miR-363-5p has a potential binding site for THBS3. Subsequently, miR-363-5p was overexpressed in the tool cells to detect the changes in THBS3 mRNA and protein expression, and the results showed that the expression was significantly decreased compared with that in the control group. The above results indicated that miR-363-5p could bind to THBS3 and negatively regulate its expression. To verify whether THBS3 mediates the regulation of miR-363-5p in cardiac hypertrophy and myocardial fibrosis, rescue experiments were designed to overexpress both THBS3 and miR-363-5p in myocardial hypertrophy and myocardial fibrosis in vitro, and the results showed that compared with the overexpression of miR-363-5p alone, when miR-363-5p and THBS3 were simultaneously overexpressed, the cell area of AC16, the expression levels of hypertrophic marker proteins, the cell viability and migration rate of HCFs, and the expression level of fibrotic markers were significantly increased, suggesting that THBS3 partially eliminated and reversed the delayed effect of miR-363-5p on myocardial hypertrophy and myocardial fibrosis, and acted as a downstream factor to promote myocardial hypertrophy and myocardial fibrosis. Considering the intricate signaling network of the organism, this study lacks the basis of in vivo experiments, and an animal model will be established for further in-depth study at a later stage to continue to explore microRNAs and related proteins related to cardiac hypertrophy to provide powerful biomarkers for clinical diagnosis and treatment. 5 Conclusion The expression of miR-363-5p was reduced in an in vivo model of cardiac remodeling established by TAC surgery, and the targeted binding of miR-363-5p to THBS3 delayed the progression of myocardial hypertrophy and myocardial fibrosis. This finding provides strong theoretical guidance for the clinical prevention and treatment of heart failure and the reduction of sudden death in cardiovascular disease patients. Declarations Author contributions All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Yu-Kun Ma, Xin-Yi Han and Shu-Huai Zan. The first draft of the manuscript was written by Yu-Kun MA and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript. Data availability: The data underlying this article will be shared on reasonable request on the corresponding author. Funding: The program was supported by the Natural Science Foundation of Shandong Province, China (No: ZR2021MH127). Conflicts of interest: The authors have no competing interests to declare that are relevant to the content of this article. Ethics approval: All procedures involving animals were conformed to the National Institutes of Health Guide for the Care and Use of Laboratory Animals and approved (IACUC-BNT-2023-010) by the Experimental Animal Ethics Committee of BEIENTE Biotechnology Co., Ltd, HuBei, China (SYSK-2021-0119). References Anna Jeong YL, Taewon Kook D-H, Kwon YK, Cho J, Ryu Y-G, Lee S, Shin N, Choe YS, Kim HJ, Cho JC, Kim Y, Choi S-J, Lee H-S, Kim (2023) Hae Jin Kee, Kwang-Il Nam,Youngkeun Ahn, Myung Ho Jeong, Woo Jin Park, Young-Kook Kim, and Hyun Kook. Circular RNA circSMAD4 regulates cardiac fibrosis by targeting miR-671-5p and FGFR2 in cardiac fibroblasts. Mol Therapy: Nucleic Acids 34:1–19. 10.1016/j.omtn.2023.102071 Li J, Salvador AM, Li G, Valkov N, Ziegler O, Yeri A et al (2021) Mir-30d Regulates Cardiac Remodeling by Intracellular and Paracrine Signaling. Circul Res 128(1). 10.1161/circresaha.120.317244 Ambrosy AP, Fonarow GC, Butler J, Chioncel O, Greene SJ, Vaduganathan M et al (2014) The Global Health and Economic Burden of Hospitalizations for Heart Failure. J Am Coll Cardiol 63(12):1123–1133. 10.1016/j.jacc.2013.11.053 Li G, Shao Y, Guo HC, Zhi Y, Qiao B, Ma K et al (2022) MicroRNA-27b-3p down-regulates FGF1 and aggravates pathological cardiac remodelling. Cardiovasc Res 118(9):2139–2151. 10.1093/cvr/cvab248 Linlin Zhao F, Dongdong Du N, Wu (2022) Histone demethylase KDM3C regulates the lncRNA GAS5–miR-495-3p–PHF8 axis in cardiac hypertrophy. Ann NYAcad Sci 1516286–299. 10.1111/nyas.14813 Gaddam RR, Kim YR, Jacobs JS, Yoon JY, Li Q, Cai A et al (2022) The microRNA-204-5p inhibits APJ signalling and confers resistance to cardiac hypertrophy and dysfunction. Clin translational Med 12(1):e693. 10.1002/ctm2.693 Ma CX, Wei ZR, Sun T, Yang MH, Sun YQ, Kai KL et al (2023) Circ–sh3rf3/GATA–4/miR–29a regulatory axis in fibroblast–myofibroblast differentiation and myocardial fibrosis. Cell Mol Life Sci 80(2):50. 10.1007/s00018-023-04699-7 Li HYDZYHZCDYLZXHHH (2022) MicroRNA–451a attenuates angiotensin II–induced cardiac fibrosis and inflammation by directly targeting T–box1. J Physiol Biochemistr 78:257–269. 10.1007/s13105-021-00861-6 Kadiam C, Venkata Subbaiah J, Wu WHWT, Yao P (2022) FAM114A1 influences cardiac pathological remodeling by regulating angiotensin II signaling. JCI Insight 7(13):e152783. 10.1172/jci10.1172/jci.insight.152783DS1 Weipeng Ge CH, Zhang W, Guo X, Gao P, Song X, Gao R, Liu Y, Guo W, Li B, Zhao H (2021) Jing Wang Mep1a contributes to Ang II-induced cardiac remodeling by promoting cardiac hypertrophy, fibrosis and inflammation. J Mol Cell Cardiol 152:52–68. 10.1016/j.yjmcc.2020.11.015 Arantxa G, Mark RA, Boer RAd, Thum T, Arfsten H, Hülsmann M et al (2022) Cardiac remodelling – Part 1: From cells and tissues to circulating biomarkers. A review from the Study Group on Biomarkers of the Heart Failure Association of the European Society of Cardiology. Eur J Heart Fail 24(6):927–943. 10.1002/ejhf.2493 Jiangbin Wu KCVS, Feng Jiang O, Hedaya A, Mohan T, Yang K, Welle S, Ghaemmaghami (2021) Wai Hong Wilson Tang, Eric Small, Chen Yan & Peng Yao. MicroRNA-574 regulates FAM210A expression and influences pathological cardiac remodeling. 13:1–20. 10.15252/emmm.202012710 Zhan Hp, Huang F, Niu Q, Jiao Ml H, Xm, Zhang K et al (2021) Downregulation of miR-128 Ameliorates Ang II-Induced Cardiac Remodeling via SIRT1/PIK3R1 Multiple Targets. Oxidative Med Cell Longev 2021:1–17. 10.1155/2021/8889195 Hsu CH, Liu IF, Kuo HF, Li CY, Lian WS, Chang CY et al (2021) miR-29a-3p/THBS2 Axis Regulates PAH-Induced Cardiac Fibrosis. Int J Mol Sci 22(19). 10.3390/ijms221910574 Urao N, Mirza RE, Corbiere TF, Hollander Z, Borchers CH, Koh TJ (2017) Thrombospondin-1 and disease progression in dysferlinopathy. Hum Mol Genet 26(24):4951–4960. 10.1093/hmg/ddx378 Schroen B, Heymans S, Sharma U, Blankesteijn WM, Pokharel S, Cleutjens JPM et al (2004) Thrombospondin-2 Is Essential for Myocardial Matrix Integrity. Circul Res. 10.1161/01.RES.0000141019.20332.3e Schips TG, Vanhoutte D, Vo A, Correll RN, Brody MJ, Khalil H et al (2019) Thrombospondin-3 augments injury-induced cardiomyopathy by intracellular integrin inhibition and sarcolemmal instability. Nat Commun 10(1):76. 10.1038/s41467-018-08026-8 Palao T, Rippe C, van Veen H, VanBavel E, Sward K, Bakker EN (2016) Thrombospondin-4 knockout in hypertension protects small-artery endothelial function but induces aortic aneurysms. Am J Physiol Heart Circ Physiol 310(11):H1486–H1493. 10.1152/ajpheart.00046.2016 Stenina-Adognravi O, Thrombospondins (2013) Old Players, New Games. Curr Opin Lipidol 24(5):401–409. 10.1097/MOL.0b013e3283642912 Mustonen E, Ruskoaho H, Rysa J (2013) Thrombospondins, potential drug targets for cardiovascular diseases. Basic Clin Pharmacol Toxicol 112(1):4–12. 10.1111/bcpt.12026 Stenina OI, Topol EJ, Plow EF, Thrombospondins (2007) Their Polymorphisms, and Cardiovascular Disease. Arterioscler Thromb Vasc Biol. 10.1161/ATVBAHA.107.141713 Singla B, Aithbathula RV, Pervaiz N, Kathuria I, Swanson M, Ekuban FA et al (2023) CD47 Activation by Thrombospondin-1 in Lymphatic Endothelial Cells Suppresses Lymphangiogenesis and Promotes Atherosclerosis. Arterioscler Thromb Vasc Biol 43(7):1234–1250. 10.1161/ATVBAHA.122.318904/10.514 1Q Adams JC, Lawler J (2011) The thrombospondins. Cold Spring Harb Perspect Biol 3(10):1–29. 10.1101/cshperspect.a009712 Hong Y, Kim I, Moon H, Lee J, Lertpatipanpong P, Ryu CH et al (2023) Novel thrombospondin-1 transcript exhibits distinctive expression and activity in thyroid tumorigenesis. Oncogene 42(22):1832–1842. 10.1038/s41388-023-02692-9/6.6340 1Q Costa A, Afonso J, Osório C, Gomes AL, Caiado F, Valente J et al (2013) miR-363-5p regulates endothelial cell properties and their communication with hematopoietic precursor cells. J Hematol Oncol 6(87):1–12 ROCKMAN HA, Ross RS, HARRIS AN, KNOWLTON KU, STEINHELPERt ME, FIELDt LJ et al (1991) Segregation of atrial-specific and inducible expression of an atrial natriuretic factor transgene in an in vivo murine model of cardiac hypertrophy. Proc Natl Acad Sci 88:8277–8281 Jia G, Liang C, Li W, Dai H (2022) MiR-410-3p facilitates Angiotensin II-induced cardiac hypertrophy by targeting Smad7. Bioengineered 13(1):119–127. 10.1080/21655979.2021.2009968 Rui Zhang YQ, Zhenjun Ji C, Hao Y, Su Y, Yao W, Zuo X, Chen M, Yang, Ma G (2022) METTL3 mediates Ang–II–induced cardiac hypertrophy through accelerating pri–miR–221/222 maturation in an m6A–dependent manner. Cell Mol Biol Lett 27(55):1–19. 10.1186/s11658-022-00349-1 Lynch JM, Maillet M, Vanhoutte D, Schloemer A, Sargent MA, Blair NS et al (2012) A thrombospondin-dependent pathway for a protective ER stress response. Cell 149(6):1257–1268. 10.1016/j.cell.2012.03.050 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 07 Oct, 2024 Read the published version in Molecular and Cellular Biochemistry → Version 1 posted Editorial decision: Revision requested 06 Aug, 2024 Reviews received at journal 30 Jul, 2024 Reviewers agreed at journal 27 Jul, 2024 Reviews received at journal 25 Jun, 2024 Reviewers agreed at journal 06 Jun, 2024 Reviewers agreed at journal 03 Jun, 2024 Reviewers invited by journal 27 May, 2024 Editor assigned by journal 22 May, 2024 Submission checks completed at journal 08 May, 2024 First submitted to journal 05 May, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4371143","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":300111939,"identity":"91dfda71-1796-4a3b-baae-aeb939e7b59a","order_by":0,"name":"Yu-Kun Ma","email":"","orcid":"","institution":"Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Yu-Kun","middleName":"","lastName":"Ma","suffix":""},{"id":300111940,"identity":"4724691d-45d5-4ad8-a801-a701c6206ae5","order_by":1,"name":"Xin-yi Han","email":"","orcid":"","institution":"Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Xin-yi","middleName":"","lastName":"Han","suffix":""},{"id":300111941,"identity":"687186a1-5906-4590-b302-7cc5ce78147a","order_by":2,"name":"Shu-huai Zan","email":"","orcid":"","institution":"Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Shu-huai","middleName":"","lastName":"Zan","suffix":""},{"id":300111942,"identity":"3b9e55e1-40e8-4419-b3e0-a0baeb57c502","order_by":3,"name":"Hui-ting Liu","email":"","orcid":"","institution":"Affiliated Hospital of Qingdao University, Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Hui-ting","middleName":"","lastName":"Liu","suffix":""},{"id":300111943,"identity":"a14e48e9-0648-4cf1-81dd-d051553ad226","order_by":4,"name":"Xue-yan Zhou","email":"","orcid":"","institution":"Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Xue-yan","middleName":"","lastName":"Zhou","suffix":""},{"id":300111944,"identity":"47ad049e-17b8-46d4-aa95-d4bf04b4e83a","order_by":5,"name":"Dan-xue Zhao","email":"","orcid":"","institution":"Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Dan-xue","middleName":"","lastName":"Zhao","suffix":""},{"id":300111945,"identity":"885b90f5-564d-4d38-8fab-06444b72962f","order_by":6,"name":"Rui Xing","email":"","orcid":"","institution":"Qingdao University","correspondingAuthor":false,"prefix":"","firstName":"Rui","middleName":"","lastName":"Xing","suffix":""},{"id":300111946,"identity":"56b752b5-94b1-414c-9017-5e89c1ddb401","order_by":7,"name":"Peng Zhao","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3UlEQVRIiWNgGAWjYHACNijNfIAhgUQtbAkka+ExIE493430Zw9+VNyRM+df8/nDwx12DPzt3fgtk7yRkG7Yc+aZseWMt9skEs8kM0icObsBrxaDGwnHJHjbDiduuHF2G0NiGzODgUQuIS2JbZJ/2w7Xb7hx5vGHxLZ6YrQks0kDbUkwON/DIJHYdpiwFskzz9ikZc48M9xwg80MqOU4D0G/8B1Pfyb5puKOvMH5w48//myrluNv78WvheFCAog8wMAgAWYw8OBXDgLnD0C18B8grHgUjIJRMApGJgAAQMNRUjyrNrsAAAAASUVORK5CYII=","orcid":"","institution":"Affiliated Hospital of Qingdao University, Qingdao University","correspondingAuthor":true,"prefix":"","firstName":"Peng","middleName":"","lastName":"Zhao","suffix":""}],"badges":[],"createdAt":"2024-05-05 09:53:32","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4371143/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4371143/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11010-024-05125-7","type":"published","date":"2024-10-07T15:57:20+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":56529352,"identity":"3fe88810-0c34-470e-8254-3b4d9cdeb666","added_by":"auto","created_at":"2024-05-15 11:25:22","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":328666,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003emiR-363-5p expression is downregulated in vivo model of Cardiac Remodeling induced by TAC \u003c/strong\u003e\u0026nbsp;(a~c) Echocardiographic detection at 4 and 8 Weeks After TAC, respectively, (a) Representative images of M-mode echocardiography, (b) Comparison of echocardiography parameters, LV posterior wall end-systolic thickness (LVPWs, mm), LV posterior wall end-diastolic thickness (LVPWd, mm), LV posterior wall end-systolic internal diameter (LVIDs, mm), LV posterior wall end-diastolic internal diameter (LVIDd, mm), (c) ejection fraction (EF%), short-axis shortening (FS%). (d) Comparison of organ coefficients in mice, Heart weight to body weight ratio (HW/BW, mg/g), Heart weight to tibia length ratio (HW/TL, mg/mm). (e~h) Mouse hearts were taken out for observation and staining at 8 weeks after TAC, (e) Gross view of the mouse heart, scale bar = 2.5 cm, (f) HE staining for observation of cardiac sections and cardiomyocyte sizes, upper scale bar = 1,000 μm, lower scale bar = 50 μm, (g) Masson staining to observe myocardial fibrosis deposition, scale bar = 1,000 μm in the upper panel, scale bar = 50 μm in the lower panel, (h) Quantitative comparison of cardiomyocyte size and myocardial fibrosis deposition area. (i~k) the relative protein expression level of ANP, BNP, β-MHC (j) and collagen Ⅰ, collagen Ⅲ, α-SMA (k) were detected by western blot. l. the relative expression level of miR-363-5p was detected by qRT-PCR.\u0026nbsp; \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e＜0.05 v.s Sham, \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e＜0.01 v.s Sham,\u003csup\u003e ***\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e＜0.001 v.s Sham.\u003c/p\u003e","description":"","filename":"F1.png","url":"https://assets-eu.researchsquare.com/files/rs-4371143/v1/9168512e5527d38808ce001a.png"},{"id":56528593,"identity":"c06901e3-e70d-48ec-aaf5-6c3a02ba91db","added_by":"auto","created_at":"2024-05-15 11:17:22","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":140836,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003emiR-363-5p expression is decreased in both Ang II-induced cardiac hypertrophy and myocardial fibrosis in vitro models\u003c/strong\u003e\u0026nbsp; (a~b) the size of AC16 was observed and compared by phalloidin-Alexa Fluor 488 staining, scale bar = 50μm. (c) the cell viability of HCF was detected by CCK8. (d~e) the relative protein expression level of ANP, BNP, and β-MHC were detected by western blot. (f~g) the relative protein expression level of collagen Ⅰ, collagen Ⅲ, and α-SMA were detected by western blot. (h) the relative expression level of miR-363-5p in AC16 and HCF were detected by qRT-PCR.\u0026nbsp; \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e＜0.05 v.s Control, \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e＜0.01 v.s Control, \u003csup\u003e***\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e＜0.001 v.s Control.\u003c/p\u003e","description":"","filename":"Picture2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4371143/v1/7b552d6146826a566ac10f95.jpg"},{"id":56529353,"identity":"f01f3dcb-3935-4b5c-852b-c411bdbdc0cf","added_by":"auto","created_at":"2024-05-15 11:25:23","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":264080,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003emiR-363-5p attenuates Ang II-Induced cardiac hypertrophy and myocardial fibrosis \u003c/strong\u003e\u0026nbsp;(a) the relative expression level of miR-363-5p in AC16 and HCF were detected by qRT-PCR. (b~c) the size of AC16 was observed and compared by phalloidin-Alexa Fluor 488 staining, scale bar = 50μm. (d) the cell viability of HCF was detected by CCK8. (e~f) the relative protein expression level of ANP, BNP, and β-MHC were detected by western blot. (g~h) the relative protein expression level of collagen Ⅰ, collagen Ⅲ, and α-SMA were detected by western blot. \u003csup\u003e**\u003c/sup\u003e \u003cem\u003eP\u003c/em\u003e＜0.01 v.s mimics-NC, \u003csup\u003e***\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e＜0.001 v.s mimics-NC, \u003csup\u003e#\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e＜0.05 v.s inhibitor-NC, \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e＜0.01 v.s inhibitor-NC, \u003csup\u003e###\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e＜0.001 v.s inhibitor-NC.\u003c/p\u003e","description":"","filename":"Picture3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4371143/v1/3c98281147b898bf415b8a49.jpg"},{"id":56528591,"identity":"19f98bdb-186e-4579-988e-edc7d348b213","added_by":"auto","created_at":"2024-05-15 11:17:22","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":120674,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTHBS3 is a target gene of miR-363-5p\u003c/strong\u003e\u0026nbsp; (a) A binding site of THBS3 and miR-363-5p was predicted by miRPathDB and miRDB. (b) luciferase activity was detected by dual luciferase reporter gene assay. (c~d) the realtive expression of THBS3 mRNA in AC16 and HCF were detected by qRT-PCR. (e~f) the relative expression of THBS3 protein in AC16 and HCF were by western blot. \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e＜0.01 v.s mimics-NC, \u003csup\u003e\u0026nbsp;***\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e＜0.001 v.s mimics-NC.\u003c/p\u003e","description":"","filename":"Picture4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4371143/v1/f40302ac1a7ce7cb78a286f4.jpg"},{"id":56528596,"identity":"bfd0d07c-9491-4c47-8f7b-4b870ce5156c","added_by":"auto","created_at":"2024-05-15 11:17:23","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":396760,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTHBS3 mediates the delayed effects of miR-363-5p on cardiac hypertrophy and myocardial fibrosis in vitro\u003c/strong\u003e \u0026nbsp;(a) the realtive expression of THBS3 mRNA in AC16 and HCF were detected by qRT-PCR. (b) the relative expression of THBS3 protein in AC16 and HCF were by western blot. \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e＜0.01 vs OE-NC, \u003csup\u003e\u0026nbsp;***\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e＜0.001 vs OE-NC.\u003c/p\u003e\n\u003cp\u003e(c~d) the size of AC16 was observed and compared by phalloidin-Alexa Fluor 488 staining, scale bar = 50μm. (e) the cell viability of HCF was detected by CCK8. (f~g) the relative protein expression level of ANP, BNP, and β-MHC were detected by western blot. (h~i) the relative protein expression level of collagen Ⅰ, collagen Ⅲ, and α-SMA were detected by western blot. (j~k) the migration rate of HCF was detected by Transwell, scale bar =100μm. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e＜0.05vs OE-NC + miR mimics,\u0026nbsp; \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e＜0.01 vs OE-NC + miR mimics, \u003csup\u003e\u0026nbsp;***\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e＜0.001 vs OE-NC + miR mimics\u003c/p\u003e","description":"","filename":"Picture5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4371143/v1/1db9d7ddc4aed942cab1b629.jpg"},{"id":66597575,"identity":"e32bf98d-cfca-4ace-a7bf-d5636a60ce02","added_by":"auto","created_at":"2024-10-14 16:11:03","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1962797,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4371143/v1/3bb0f81e-65fc-46dd-b8b8-ba9dfb0c55e4.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"MicroRNA363-5p Targets Thrombospondin3 to Regulate Pathological Cardiac Remodeling","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eHeart failure (HF) is a clinical syndrome characterized by high morbidity and mortality due to structural or functional abnormalities of the heart caused by a variety of different harmful stimuli that result in impaired ventricular diastolic function[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Both primary and secondary CVD eventually lead to HF, and according to global epidemiologic surveys, the prevalence of HF ranges from 3 to 5 per 100 people in the total population[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Therefore, the prevention and treatment of HF has become the focus of the cardiovascular disease (CVD) research field. In response to the development of HF, there are multiple compensatory responses in the body, among which cardiac remodeling is a chronic adaptive response in response to the long-term increase in cardiac load, which is an important molecular pathological basis for the development of HF.\u003c/p\u003e \u003cp\u003eThe heart is composed of cardiomyocytes, noncardiomyocytes (e.g., cardiac fibroblasts), and extracellular matrix (ECM), and all three of these components are altered accordingly during the onset and development of cardiac remodeling[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Cardiomyocyte remodeling consists mainly of cardiac hypertrophy and changes in the cardiomyocyte phenotype. Cardiac hypertrophy refers to an increase in the size of cardiomyocytes, which is manifested at the cellular level by a widening of cell diameter and an increase in length, and at the organ level by an increase in the weight of the ventricle and a thickening of the ventricular wall, and the above alterations help to maintain the volume of cardiac output[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]; alterations in the phenotype of cardiomyocytes refer to the activation of genes that are in the quiescent fetal phase in adult cardiomyocytes, such as ANP, BNP, and β-MHC, and the transformed cardiomyocytes can change the diastolic capacity of the myocardium[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Cardiac fibroblasts are the main component of noncardiomyocytes in the human heart, and when subjected to external pathological stimuli, fibroblasts are activated and undergo a cellular phenotypic transition to further differentiate into myofibroblasts, which also secrete α-smooth muscle actin (α-SMA)[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. α-SMA is secreted by myofibroblasts with genes encoding for collagen fibers of types Ⅰ and Ⅲ in their nuclei, which leads to increased secretion of ECM, which is predominantly composed of type Ⅰ and Ⅲ collagen fibers. This increases the tensile strength of the myocardium and prevents ventricular thinning[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. The above compensatory methods are initially beneficial to the organism, but their compensatory capacity is limited. Under long-term and continuous pathological stimuli, excessive myocardial hypertrophy occurs in the form of ischemia and hypoxia, resulting in weakened myocardial diastolic force[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], excessive ECM deposition, an imbalance in degradation and an imbalance in proportion, leading to myocardial fibrosis, which will subsequently reduces the compliance of the ventricular wall and increases stiffness, affecting the heart's diastolic function, and compensates for cardiac remodeling toward decompensation, resulting in HF, and even sudden death from cardiovascular disease[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Therefore, delaying and reversing cardiac remodeling is essential for the treatment of HF and the prevention of sudden cardiovascular death. Related studies have pointed out that the progression of cardiac remodeling cannot be assessed routinely by endomyocardial biopsy at present, but can be reflected in circulating in vivo levels of several biomarkers (e.g., noncoding RNAs.), which may characterize the development of HF and its long-term prognosis[11]. Noncoding RNAs (ncRNA) are considered as waste RNAs because they have not been directly involved in the transcription of genes for a long time, but as they have been studied more intensively, they have been found to play key regulatory roles in participating in a variety of biological processes. Noncoding RNAs include lncRNAs, microRNAs, and cicrcRNAs, among which microRNAs are small endogenous ncRNAs that regulate a variety of biological processes by binding to the 3'UTR region of target mRNAs, then inhibiting translation, or contributing to mRNA degradation. Numerous studies have shown that microRNAs are involved in the regulation of cardiac remodeling, and that miR-574 regulates the expression of FAM210A and affects pathological cardiac remodeling[12]. Downregulation of miR128 ameliorates Ang II-induced cardiac remodeling through the SIRT1/PIK3R1 pathway[13]. THBS2 mediates the regulation of pulmonary arterial hypertension-induced cardiac fibrosis via miR-29a-3p[14]. miR-27b-3p downregulates FGF1 and exacerbates pathological cardiac remodeling[4], et. al.\u003c/p\u003e \u003cp\u003eThe Thrombospondin (THBS) family consists of five homologous genes, of which THBS1 and THBS2 form dimers and THBS3, 4, and 5 form trimers. THBS proteins are selectively expressed during embryonic development, but in adulthood their expression is essentially absent until an injurious event occurs and, they play an important role in tissue repair. Although the C-terminal end 1/2 amino acid sequences of all THBS families are highly homologous, each family has all have different functions. Numerous studies have confirmed that THBS proteins play important roles in cardiovascular pathology, for example, THBS1 gene deletion exacerbates pressure overload-induced myocardial hypertrophy, myocardial dilatation, and cardiomyocyte death[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. In response to pressure overload, mice with THBS2 deletion exhibit cardiac rupture and HF, suggesting that THBS2 is required for the maintenance of cardiac integrity[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. THBS3 expression is downregulated in an animal model of cardiac hypertrophy established by transverse aortic narrowing and THBS3 activates endoplasmic reticulum stress[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. THBS4-deficient mice also exhibit important deficits in adapting to chronic pressure overload, resulting in ventricular dilatation, decreased cardiac function, and increased heart weight[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. In addition, THBS plays a key regulatory role in a variety of CVDs including myocardial infarction[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], HF[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], atherosclerosis[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], and valvular disease[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], opening up possibilities for CVD treatment and intervention.\u003c/p\u003e \u003cp\u003eThe first discovered THBS1 and THBS2 were the focus of many early studies and are known for their potent antiangiogenic effects, and recently THBS1 has also been found to exhibit unique activity in thyroid tumors[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. In addition, THBS3 and THBS4 are highly similar in terms of protein structure and overall sequence, both proteins are expressed in the heart and are upregulated in cardiac diseases, and the function of THBS4 in HF has been investigated. Moreover, miR-363-5p targeting of THBS3 has been shown to play an important regulatory role in vascular endothelial cells[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], but the roles of these two in myocardial hypertrophy are unknown. On this basis, our group screened microRNAs (miR-363-5p) that regulate the transcriptional level of THBS3 through microRNA database, trying to explore the regulatory role of both in cardiac remodeling.\u003c/p\u003e \u003cp\u003eThus, we demonstrated that miR-363-5p expression was decreased in cardiac remodeling and that miR-363-5p exacerbated myocardial hypertrophy and myocardial fibrosis by downregulating THBS3 expression. Our findings provide a novel therapeutic target for the prevention and treatment of HF.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Mice and Transverse Aortic Constriction (TAC)\u003c/h2\u003e \u003cp\u003eA total of 12 male C57BL/6 mice were purchased from BEIENTE Biotechnology Co., Ltd, Hubei, China (SPF grade, 17\u0026ndash;24 g, 6\u0026ndash;8 weeks old) and randomly divided into model group (\"TAC\" group) and sham operation group (\"Sham\" group). The mice were anesthetized with a single intraperitoneal injection of 2,2,2-tribromoethanol saline solution (Sigma-Aldrich, St. Louis, USA, 10 \u0026micro;l/g). A topical depilatory agent was applied to the neck and chest for hair removal. 75% alcohol was used to disinfect the skin of the chest, and a 1.5-2 cm incision was made in the midline of the neck and chest, then gently detach the thymus gland and fat to expose the aortic arch. A 28G cushion needle was placed between the right cephalic brachial artery and the left common carotid artery, and the aortic arch was ligated with a 7\u0026thinsp;\u0026minus;\u0026thinsp;0 suture around the cushion needle, and the cushion needle was subsequently withdrawn to achieve the purpose of narrowing the vessel. The wound was wiped with povidone-iodine, the thoracic cavity was closed layer by layer, the skin was sutured, and the animals were placed on a warming plate and kept warm until they awoke, and then they were returned to the cage for routine rearing. In the Sham group, no ligatures were placed after the aortic arch had been freed, and all other operations were identical to those in the TAC group.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Echocardiography\u003c/h2\u003e \u003cp\u003eEchocardiography was performed on the mice at 4 and 8 weeks after TAC, respectively. First, the small animal ultrasound detector (Esaote, Firenze, Italy) was turned on and the corresponding detection module was selected. The mice were placed into the anesthesia induction box, and the anesthesia gas was adjusted to 3 L/min. After 1 min, the mice were anesthetized, and the mice were gently picked up and placed on the mouse board, and the anesthesia gas flow was subsequently adjusted to 1.5 L/min. The ultrasound coupling agent was then applied to the detection site, and the position of the probe was adjusted until the left ventricle of the heart was clearly defined and the long axis of the heart was perpendicular to the direction of the body, and M-ultrasound was selected on the touch panel, and the sampling line was adjusted, and the appropriate detection module was chosen. Adjust the sampling line and choose the appropriate position until the image was clear. Finally, the end-systolic thickness of the posterior wall of the left ventricle (LvPws, mm), the end-diastolic thickness of the posterior wall of the left ventricle (LvPwd, mm), the end-systolic internal diameters of the posterior wall of the left ventricle (LVIDs, mm), and the end-diastolic internal diameters of the posterior wall of the left ventricle (LVIDd, mm) were measured and recorded, and the left ventricular ejection fraction and the left ventricular shortening rate of the left ventricle short-axis were calculated separately in the mice. All measurements covered at least three consecutive cardiac cycles.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 HE staining\u003c/h2\u003e \u003cp\u003eFour weeks after TAC, mice were euthanized. Mouse hearts were removed and put into 4% formaldehyde solution, ethanol solution and xylene (YANTAI YUANDONG FINE CHEMICALS CO., LTD, YanTai, China) to complete the fixation, dehydration and transparency operations, and the hearts were immersed in paraffin wax for embedding. After trimming the shape of the wax blocks, they were fixed on a slicer (Leica, Wetzlar, Germany) to make a series of slices. The sections were sequentially placed in hematoxylin staining solution, 1% ethanol hydrochloride and eosin staining (YANTAI YUANDONG FINE CHEMICALS CO., LTD, YanTai, China) for staining and differentiation. After drying at room temperature and adding coverslips, the sections were sealed and fixed using neutral resin. Finally, the cells were observed and photographed under microscope (Olympus, Tokyo, Japan), which required that most of the field of view be in cross-section, and the cells selected for calculation of cross-sectional area were required to have a unique nucleus and a relatively clear border.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Masson staining\u003c/h2\u003e \u003cp\u003eTissue sections were deparaffinized in xylene solution, fixed in Bouin's solution (56\u0026deg;C, 15min), and gently rinsed in running water. Tissue sections were immersed in Weigert's iron hematoxylin staining solution (5-10min), 1% hydrochloric acid alcohol differentiation (15s), and then immersed in Lichtenstein's red acidic magenta staining solution (5-10min), immersed in phosphomolybdic acid solution (5min), restained using aniline blue staining solution (5min), and immersed in 1% glacial acetic acid (2min). Tissue sections were rapidly immersed in 95% ethanol I and 95% ethanol II for each 5 times, and then xylene for 2 times for transparency. Neutral gum was used to seal the sections, and then cover the tissues gently with coverslips to avoid air bubbles, and air-dried in a ventilated place (all the above reagents were purchased from YANTAI YUANDONG FINE CHEMICALS CO., LTD, YanTai, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Cell culture and establishment of in vitro models of cardiac hypertrophy and myocardial fibrosis\u003c/h2\u003e \u003cp\u003eThe human cardiomyocyte cell line (AC16) was purchased from iCell (Shanghai, China), and the human cardiac fibroblast cell line (HCF) was purchased from BeNa Culture Collection (HeNan, China). AC16 cells were cultured in DMEM/F-12 medium (iCell, Shanghai, China), and HCF cells were cultured in DMEM medium (Hyclone, Logan, UT, USA), which was supplemented with 10% fetal bovine serum, 1% penicillin/streptomycin, and cultured in a constant temperature incubator at 37\u0026deg;C with 5% CO2. AC16 cells and HCF cells were treated with 1 \u0026micro;mol/L Ang II (Abmole, Chicago, IL, USA) for 24 h to induce the development of hypertrophic phenotype and fibrotic phenotype. At the end of induction, the validity of the model establishment was evaluated by the protein expression levels of fibrotic marker (collagen I, collagen III, and α-SMA) and fetal genes (ANP, BNP, and β-MHC), the area of AC16 cells, and the viability of HCF cells.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Cell transfection\u003c/h2\u003e \u003cp\u003eTake jetPRIME buffer (50\u0026micro;l), add mimics (100nM) or inhibitor (200nM) and vortex to mix. Add jetPRIME reagent (1\u0026micro;l) and incubate at room temperature for 10min. Take 50\u0026micro;l of the above mixtures and add them into the cell culture medium respectively, and replace the fresh medium after 4\u0026ndash;6 hours, add 1\u0026micro;mol/L Ang II, 5% CO2, and incubate at 37℃. Subsequent assays were performed 48h after transfection. jetPRIME reagent, mimics, inhibitor and the corresponding negative control (NC) were purchased from PolyPlus (Strasbourg, France).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Phalloidin-Alexa Fluor 488 staining\u003c/h2\u003e \u003cp\u003eAC16 cells were washed twice with PBS (Life, Carlsbad, California CA, USA), fixed with methanol-free formaldehyde solution (Servicebio, Wuhan, China) at room temperature for 10\u0026ndash;20 min, and then washed with PBS containing 0.1% Triton X-100 (Sigma, Darmstadt, Germany) for 5 min each time. Actin-Tracker Green (Beyotime, Shanghai, China) was diluted with PBS containing 1\u0026ndash;5% BSA and 0.1% Triton X-100 at a ratio of 1:40\u0026ndash;200. The dilution ratio was adjusted appropriately according to the staining effect. Add 200\u0026micro;l of staining solution to each slice and incubate for 30-60min at room temperature, avoiding light. 20\u0026micro;l of DAPI (Servicebio, Shanghai, China) was added to the sealing film and incubated for 10min at room temperature, avoiding light, and then put the slides back into the 24-well plate. Clip out the membrane, absorb the excess water with filter paper, add sealing agent to seal the membrane, and then perform fluorescence detection.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 CCK8\u003c/h2\u003e \u003cp\u003eTake 20 \u0026micro;l of cell suspension and add 20 \u0026micro;l of Trypan blue for counting, spread the plate at 10,000/well (96-well plate), 100 \u0026micro;l per well, and set up a blank group at the same time, add 100 \u0026micro;l of sterile PBS in the wells around the cell wells, 5% CO2, and incubate at 37℃ overnight. Subsequently, transfection reagents were added for transfection. 10\u0026micro;l of CCK8 solution (DOJINDO, Kumamoto prefecture, Japan) was added to each well and incubated in 5% CO2, 37℃ incubator for 3h, and the optical density (OD) of 450 nm was measured in each well by micro-plate reader (Thermo, Waltham, MA, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Transwell\u003c/h2\u003e \u003cp\u003e200\u0026micro;l of cell suspension was added to the Transwell, 600\u0026micro;l of medium containing 10% FBS was added to the lower chamber of 24-well plate, and incubated at 37℃ for 24 h. The Transwell was removed, the culture solution in the wells was discarded, and the cells were washed twice with PBS. The cells were fixed with 4% PFA for 10min, and washed twice with PBS. Crystalline violet (Beyotime, Shanghai, China) was stained for 10 min, washed twice with PBS, and the cells in the upper chamber were wiped out with a cotton swab. The migrated cells were observed under the microscope, and 3 fields of view were randomly selected for photographing and counting.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10 Quantitative real-time fluorescence PCR (qRT-PCR)\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from cell lines and tissues using TsingZol Total RNA Extraction Reagent. Then, mRNA and microRNA were reverse transcribed into cDNA using SynScriptTM III cDNA Synthesis Mix according to the instructions (all the above reagents were purchased from TSINGKE, Beijing, China). The real-time fluorescence quantitative PCR reaction and results were conducted in a real-time PCR instrument (ABI QuantStudio 12K, Foster City, CA, USA). The reaction conditions were as follows: pre-denaturation at 95\u0026deg;C for 1 min, denaturation at 95\u0026deg;C for 10 s, annealing at 60\u0026deg;C for 10 s, and extension at 72\u0026deg;C for 15 s. A total of 40 cycles were performed. The relative expression levels of THBS3 mRNA and miR-363-5p were calculated by 2-ΔΔCt method. GAPDH and U6 were used as internal references to detect the expression levels of coding genes and miR-363-5p, respectively. The primer sequences are listed below:\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe sequences of PCR primer\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eName\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequences(5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003esize(bp)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eGADPH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGGGTGTGAACCACGAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e115\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAGGGATGATGTTCTGGGCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eTHBS3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGATGGCAATGGAGAAGGAGATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e184\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGTCTGGGTAGGATTGCTCATT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003emiR-363-5p loop\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC AAATTGCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e80\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eU6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGCTTCGGCAGCACATATAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e85\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAATATGGAACGCTTCACGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11 Western blot\u003c/h2\u003e \u003cp\u003eTotal cell and tissue proteins were extracted using RIPA lysate containing protease inhibitors. BCA protein quantification kit was used to determine the protein content and calculate the volume of samples (lysate and BCA kit were purchased from Beyotime, Shanghai, China). After denaturing polyacrylamide gel electrophoresis, the proteins were transferred to PVDF membrane (Millipore, MA, USA) and incubated at 4\u0026deg;C with primary antibodies ANP (BOSTER, CAL, USA, 1:1000), BNP (Affinity, Melbourne, Victoria, Australia, 1:1000), β- MHC (BOSTER, Cal, USA, 1:1000), THBS3 (proteintech, Chicago, IL, USA, 1:1000), GAPDH (proteintech, Chicago, IL, USA, 1:1000) overnight. TBST (Sinopharm Chemical ReagentCo., Ltd, Shanghai, China) was washed and incubated with the corresponding secondary antibody (1:5000) for 1h at room temperature, washed three times with PBST, and developed, exposed and photographed by a gel imaging system.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.12 Double-Luciferase Reporter Assay\u003c/h2\u003e \u003cp\u003eThe binding sequence of miR-363-5p to THBS3 was predicted based on the microRNA database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://mpd.bioinf.uni-sb.de/\u003c/span\u003e\u003cspan address=\"https://mpd.bioinf.uni-sb.de/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e; \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://mirdb.org/\u003c/span\u003e\u003cspan address=\"https://mirdb.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), and the sequence and its mutated sequence were constructed into the pGL3-promoter vector, respectively, to obtain the wild-type THBS3 and the mutant THBS3 recombinant plasmids. THBS3-WT and THBS3-MUT were co-transfected into HEK293 cells in mimics-NC and miR-363-5p mimics, respectively, and the fluorescence intensities of firefly luciferase and sea kidney luciferase (TransGen, Beijing, China) were measured after 24 h, respectively. The binding effect of miR-363-5p on THBS3 was determined by calculating the magnitude of the ratio between the two.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.13 Statistical analysis\u003c/h2\u003e \u003cp\u003eImage J software (NIH, Bethesda, USA), SPSS 27.0 (IBM Corp, IL, USA) and GraphPad Prism 9.0 (GraphPad Software, La Jolla, CA, USA) were used for processing the data and statistical analysis. All the data are expressed as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviations. The t test was used for comparisons between two groups, and one-way analysis of variance (ANOVA) was used for comparisons among multiple groups. The Bonferroni-corrected post hoc test was implemented for pairwise comparisons within the groups. At \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, the data were considered significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.1 miR-363-5p expression is downregulated in an in vivo model of TAC-induced cardiac remodeling\u003c/h2\u003e \u003cp\u003eTo investigate the role of miR-363-5p in cardiac remodeling, we first generated an in vivo model of cardiac remodeling by transverse aortic constriction (TAC) and evaluated the success of the model by detecting multiple indicators.C57BL/6 mice were subjected to TAC, and echocardiography was performed at 4 weeks and 8 weeks postoperatively. Subsequently, the end-systolic inner diameter of the left ventricular posterior wall (LVIDs), the end-diastolic inner diameter of the left ventricular posterior wall (LVIDd), the end-systolic thickness of the left ventricular posterior wall (LVPWs), and the end-diastolic thickness of the left ventricular posterior wall (LVPWd) were significantly greater in the TAC group than in the sham group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea\u0026thinsp;~\u0026thinsp;b), and the ejection fraction (EF%) and short-axis shortening rate (FS%) were significantly lower in the TAC group than in the sham group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec).The heart weight-to-body weight ratio (HW/BW) and tibia length-to-heart weight ratio (TL/BW) were calculated, and comparisons revealed that the HW/BW and TL/BW of mice were significantly greater after TAC (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed). H\u0026amp;E staining and Masson staining revealed that the size of cardiomyocytes and the area of fibrotic deposits in the myocardial tissues of mice that underwent TAC were significantly greater (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ee\u0026thinsp;~\u0026thinsp;h). Western blotting was used to examine the protein expression levels of ANP, BNP, β-MHC, α-SMA, collagen Ⅰ, and collagen Ⅲ in the myocardial tissues of the mice, and the relative expression levels of the above mentioned proteins were significantly elevated in the mice after TAC (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ei\u0026thinsp;~\u0026thinsp;k).The above results indicated that an in vivo model of cardiac remodeling was successfully established from imaging, morphology and molecular biology perspectives. qRT‒PCR revealed that the relative expression level of miR-363-5p in the myocardial tissues of mice with cardiac remodeling was significantly decreased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003el), indicating that miR-363-5p plays a key regulatory role in cardiac remodeling.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.2 miR-363-5p expression is downregulated in Ang II-induced cardiac hypertrophy and cardiac fibrosis in vitro models\u003c/h2\u003e \u003cp\u003eHuman cardiomyocytes (AC16) and human fibroblasts (HCFs) were induced with 1 \u0026micro;mol/L Ang II to establish an in vitro model of cardiac hypertrophy and myocardial fibrosis. The results showed that the cell area of AC16 cells was significantly greater (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea\u0026thinsp;~\u0026thinsp;b), and the viability of HCF cells was significantly enhanced by Ang II induction (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec). Western blot analysis of fetal gene and fibrosis marker expression revealed that the relative expression of the above mentioned proteins was significantly greater in AC16 and HCF cells treated with Ang II (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed\u0026thinsp;~\u0026thinsp;g). The above results indicate that in vitro models of cardiac hypertrophy and myocardial fibrosis have been successfully established. miR-363-5p expression in both cell lines was measured by qRT‒PCR, and the results showed that the relative expression level of miR-363-5p was significantly lower in AC16 and HCF cells treated with Ang II (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eh), suggesting that miR-363-5p plays a key role in cardiac hypertrophy and myocardial fibrosis in vitro.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.3 miR-363-5p attenuates Ang II-induced cardiac hypertrophy and myocardial fibrosis\u003c/h2\u003e \u003cp\u003eTo investigate the effects of miR-363-5p on cardiac hypertrophy and myocardial fibrosis in vitro, miR-363-5p mimics and miR-363-5p inhibitor were transfected into Ang II-induced AC16 cells and HCF cells to determine the effects of miR-363-5p on the hypertrophic phenotype and fibrosis phenotype. qRT‒PCR revealed that the relative expression level of miR-363-5p was significantly greater or lower than that of mimics-NC or inhibitor-NC (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea), indicating successful transfection.In addition, the miR-363-5p mimic significantly reduced the area of AC16 cells, decreased the viability of HCFs, and decreased the relative expression of ANP, BNP, β-MHC, collagen Ⅰ, collagen Ⅲ and α-SMA, whereas the miR-363-5p inhibitor had the opposite effect (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb\u0026thinsp;~\u0026thinsp;h). These results indicated that miR-363-5p could delay Ang II-induced cardiac hypertrophy and myocardial fibrosis in vitro.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.4 THBS3 is a target gene of miR-363-5p\u003c/h2\u003e \u003cp\u003eBioinformatics online analysis revealed (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://mpd.bioinf.uni-sb.de/\u003c/span\u003e\u003cspan address=\"https://mpd.bioinf.uni-sb.de/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e; \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://mirdb.org/\u003c/span\u003e\u003cspan address=\"https://mirdb.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) that the 3'UTR of THBS3 contains a potential binding site for miR-363-5p (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). Subsequently, a dual luciferase reporter gene assay was performed, and the results showed that luciferase activity was significantly lower in HEK293 cells cotransfected with the 3'UTR of wild-type THBS3 and miR-363-5p mimics than in those cotransfected with mimics-NC (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), while when the mutant 3'UTR was cotransfected with miR-363-5p mimics, there was no significant change in luciferase activity (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb). In addition, qRT‒PCR and Western blot results showed that both THBS3 mRNA and protein expression levels were significantly downregulated (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec\u0026thinsp;~\u0026thinsp;f). The above results suggested that miR-363-5p negatively regulates THBS3 expression.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.5 THBS3 mediates the delayed effect of miR-363-5p\u003c/h2\u003e \u003cp\u003eTo investigate whether THBS3 mediates miR-363-5p to exert a regulatory effect on myocardial hypertrophy and myocardial fibrosis, a THBS3 overexpression vector was constructed, and the THBS3 overexpression vector was cotransfected with miR-363-5p mimics into AC16 and HCF cells to observe whether the overexpression of THBS3 partially eliminated the delayed effects of miR-363-5p on myocardial hypertrophy and myocardial fibrosis. First, Western blot and qRT‒PCR results showed that the THBS3 overexpression vector was constructed successfully (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea\u0026thinsp;~\u0026thinsp;b). Moreover, compared with those in cells overexpressing miR-363-5p alone, the area of AC16, the viability of HCFs, the migration rate of HCFs and the relative expression of ANP, BNP, β-MHC, collagen Ⅰ, collagen Ⅲ, and α-SMA were significantly greater in cells co-overexpressing THBS3 and miR-363-5p (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec\u0026thinsp;~\u0026thinsp;k), and the effect of miR-363-5p was partially reversed.\u003c/p\u003e"},{"header":"4 Discussion","content":"\u003cp\u003eThis study focused on the effect of miR-363-5p, which targets THBS3, on Ang II-induced cardiac hypertrophy and myocardial fibrosis. The results showed that miR-363-5p was significant decreased in both in vivo and in vitro models of cardiac hypertrophy and myocardial fibrosis established by TAC surgery and Ang II induction; the overexpression of miR-363-5p in the in vitro model effectively attenuated the phenotypes of cardiac hypertrophy and fibrosis; and THBS3, a downstream target of miR-363-5p, mediated the delayed effect of miR-363- 5p on cardiac hypertrophy and fibrosis.\u003c/p\u003e \u003cp\u003eWhether primary or secondary cardiovascular disease (CVD), if not treated and allowed to develop, eventually led to cardiac remodeling, which in turn led to HF. Myocardial hypertrophy and myocardial fibrosis are important compensatory modes of cardiac remodeling, and their progression precedes that of HF; therefore, reversing and slowing down myocardial hypertrophy and myocardial fibrosis are of great significance in the prevention and treatment of HF. As the knowledge of microRNAs becomes clearer, they have been found to play important roles in many CVDs, but their specific mechanisms have not been fully elucidated. Thrombospondin (THBS) is an extracellular matrix protein that plays an important role in regulating cell-cell and cell-matrix interactions, and THBS plays an important regulatory role in many CVDs, which offers the possibility of intervention and treatment of CVDs. Our group subsequently searched the microRNA database to search for upstream microRNAs that regulate THBS3, and ultimately target miR-363-5p. It has been shown that miR-363-5p can regulate the expression of THBS3 at the posttranscriptional level to affect the properties of vascular endothelial cells[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], but it is not yet clear whether these two factors play a role in cardiac diseases. With the above theoretical basis, our group designed experiments to explore the effects of both on cardiac remodeling.\u003c/p\u003e \u003cp\u003eThere are many methods to construct an in vivo model of cardiac remodeling, and the common methods are aortic constriction, Ang II infusion, and norepinephrine infusion, etc. TAC was first proposed by Rockman[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], and it is one of the most commonly used surgical procedures to simulate the increase in preload and afterload resulting in HF in animals, with fewer postoperative infections and less mortality. In most studies, the success of model construction was comprehensively judged from multiple perspectives after TAC by echocardiography, calculating cardiac coefficients, observing gross and microscopic changes in the heart, quantifying the size of cardiomyocytes, detecting the expression of hypertrophic markers and fibrosis marker proteins, and determining the viability of fibroblasts and the rate of cell migration. In addition, under a variety of pathological stimuli, fetal genes, such as ANP, BNP and β-MHC, can be activated in quiescent cardiomyocytes, so the above three proteins have been regarded as marker proteins of cardiac hypertrophy in a large number of related studies; fibroblasts are transformed to myofibroblasts and secrete α-SMA, and myofibroblasts are an important source of collagen Ⅰ and collagen Ⅲ. Thus, the above three proteins are also considered as marker proteins of myocardial fibrosis. In this study, we also examined the end-systolic and end-diastolic thickness and internal diameter of the posterior wall of the left ventricle, EF%, and FS% at 4 and 8 weeks after TAC, and found that the above indices of the TAC mice were obviously abnormal. The cardiac coefficients of the mice were calculated, and the hearts of the mice were subjected to HE staining and Masson staining. After TAC, cardiomyocytes were significantly enlarged, and the area of collagen deposition increased. Western blot analysis of the expression of hypertrophy marker proteins and fibrosis marker proteins revealed that the above proteins were significantly elevated in the myocardial tissues of mice subjected to TAC, which was consistent with previous studies, and at the same time, the above results also comprehensively and powerfully confirmed the successful establishment of the in vivo model of cardiac remodeling from multi perspectives of echocardiography, macroscopic, morphology, and molecular biology and confirmed that the prerequisites for the next step of the experiments were met. To clarify the expression of miR-363-5p in the in vivo model of cardiac remodeling, the expression of miR-363-5p was detected in the myocardial tissues of the two groups of mice, and it was found that the relative expression level of miR-363-5p in the myocardial tissues of the mice after TAC was significantly reduced, suggesting that it has an important role in regulating the onset and development of cardiac remodeling. To explore the specific mechanism, in vitro experiments were designed for further demonstration.\u003c/p\u003e \u003cp\u003eAng Ⅱ is ideally used as a commonly used drug to replicate in vitro cardiac hypertrophy and myocardial fibrosis models[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. After AC16 and HCF cells were treated with 1 \u0026micro;mol/L Ang Ⅱ for 48 h in, the comparison revealed that the cell area of the AC16 cells and the expression of hypertrophic marker proteins were significantly greater, which could effectively induce cardiac hypertrophy. Moreover, the viability of HCFs cells and the expression of fibrotic markers were also significantly greater, which could effectively induce myocardial fibrosis, consistent with previous studies. The above results also demonstrated that the in vitro models of cardiac hypertrophy and myocardial fibrosis were successfully established. Subsequently, the relative expression levels of miR-363-5p were detected, and the comparison revealed that miR-363-5p was significantly lower after Ang Ⅱ treatment, suggesting that miR-363-5p plays an important role in the regulation of myocardial hypertrophy and myocardial fibrosis in vitro.\u003c/p\u003e \u003cp\u003eSubsequently, changes in hypertrophy- and fibrosis-related phenotypes were observed after specific transfection of miR-363-5p mimics and miR-363-5p inhibitor in Ang II-induced cardiomyocytes and fibroblasts, and the results showed that overexpression of miR-363-5p significantly reduced the cardiomyocyte cell area, the expression level of hypertrophic marker proteins, cell viability of fibroblasts, and expression level of fibrosis marker proteins, while inhibition of miR-363-5p expression showed the opposite trend. The above results suggest that miR-363-5p inhibits and delays myocardial hypertrophy and myocardial fibrosis from the perspectives of morphology and molecular biology, respectively. The effects of microRNAs on cardiac hypertrophy and myocardial fibrosis may be either promotional or inhibitory, with different microRNAs responding to different mechanisms. This is mainly because different microRNAs have different coping mechanisms and different circulating levels under different pathological stimuli. Therefore, it is necessary to select the circulating levels of several key microRNAs, discuss the significance of each, and comprehensively assess the progression of myocardial hypertrophy to guide clinical diagnosis and treatment.\u003c/p\u003e \u003cp\u003eTHBS proteins are selectively expressed during embryonic development, and in adulthood, expression is largely absent until an injurious event occurs, which may be induced in all five family members[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Little is known about the role of THBS3 in tissue homeostasis and disease, except for its role in bone development. Lynch J et al reported that transgenic mice in which THBS3 was overexpressed in cardiomyocytes exhibited exacerbated cardiac pathology in response to stressful stimuli, whereas mice lacking THBS3 were protected[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], Tobias G et al. demonstrated that in a TAC-induced cardiac hypertrophy animal model, in an in vitro model of activated calmodulin phosphatase A-induced cardiomyopathy and in an animal model of dilated cardiomyopathy mimicked by Csrp\u003csup\u003e3\u0026minus;/\u0026minus;\u003c/sup\u003e, the expression of THBS3 was elevated and activated endoplasmic reticulum stress-related molecules, such as ATF6, BiP, and others[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTHBS3 was predicted to be a potential target gene of miR-363-5p in the microRNA database. In this paper, we verified that miR-363-5p successfully binds to wild-type THBS3 sequences and represses the transcription of downstream genes by dual luciferase reporter gene experiments, which results in restricted luciferase gene expression and low fluorescence intensity from catabolism of the substrate. In contrast, miR-363-5p could not bind to the THBS3 mutant sequence, so it did not affect the gene transcription of luciferase, and the fluorescence intensity produced by the decomposed luciferase substrate was similar to that of the control group, and there was no statistically significant difference between the two. The above results suggested that miR-363-5p has a potential binding site for THBS3. Subsequently, miR-363-5p was overexpressed in the tool cells to detect the changes in THBS3 mRNA and protein expression, and the results showed that the expression was significantly decreased compared with that in the control group. The above results indicated that miR-363-5p could bind to THBS3 and negatively regulate its expression.\u003c/p\u003e \u003cp\u003eTo verify whether THBS3 mediates the regulation of miR-363-5p in cardiac hypertrophy and myocardial fibrosis, rescue experiments were designed to overexpress both THBS3 and miR-363-5p in myocardial hypertrophy and myocardial fibrosis in vitro, and the results showed that compared with the overexpression of miR-363-5p alone, when miR-363-5p and THBS3 were simultaneously overexpressed, the cell area of AC16, the expression levels of hypertrophic marker proteins, the cell viability and migration rate of HCFs, and the expression level of fibrotic markers were significantly increased, suggesting that THBS3 partially eliminated and reversed the delayed effect of miR-363-5p on myocardial hypertrophy and myocardial fibrosis, and acted as a downstream factor to promote myocardial hypertrophy and myocardial fibrosis.\u003c/p\u003e \u003cp\u003eConsidering the intricate signaling network of the organism, this study lacks the basis of in vivo experiments, and an animal model will be established for further in-depth study at a later stage to continue to explore microRNAs and related proteins related to cardiac hypertrophy to provide powerful biomarkers for clinical diagnosis and treatment.\u003c/p\u003e"},{"header":"5 Conclusion","content":"\u003cp\u003eThe expression of miR-363-5p was reduced in an in vivo model of cardiac remodeling established by TAC surgery, and the targeted binding of miR-363-5p to THBS3 delayed the progression of myocardial hypertrophy and myocardial fibrosis. This finding provides strong theoretical guidance for the clinical prevention and treatment of heart failure and the reduction of sudden death in cardiovascular disease patients.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Yu-Kun Ma, Xin-Yi Han and Shu-Huai Zan. The first draft of the manuscript was written by Yu-Kun MA and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability:\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe data underlying this article will be shared on reasonable request on the corresponding author.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u0026nbsp;\u003c/strong\u003eThe program was supported by the Natural Science Foundation of Shandong Province, China (No: ZR2021MH127).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of interest:\u003c/strong\u003e The authors have no competing interests to declare that are relevant to the content of this article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval:\u003c/strong\u003e All procedures involving animals were conformed to the National Institutes of Health Guide for the Care and Use of Laboratory Animals and approved (IACUC-BNT-2023-010) by the Experimental Animal Ethics Committee of BEIENTE Biotechnology Co., Ltd, HuBei, China (SYSK-2021-0119).\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAnna Jeong YL, Taewon Kook D-H, Kwon YK, Cho J, Ryu Y-G, Lee S, Shin N, Choe YS, Kim HJ, Cho JC, Kim Y, Choi S-J, Lee H-S, Kim (2023) Hae Jin Kee, Kwang-Il Nam,Youngkeun Ahn, Myung Ho Jeong, Woo Jin Park, Young-Kook Kim, and Hyun Kook. Circular RNA circSMAD4 regulates cardiac fibrosis by targeting miR-671-5p and FGFR2 in cardiac fibroblasts. Mol Therapy: Nucleic Acids 34:1\u0026ndash;19. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.omtn.2023.102071\u003c/span\u003e\u003cspan address=\"10.1016/j.omtn.2023.102071\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi J, Salvador AM, Li G, Valkov N, Ziegler O, Yeri A et al (2021) Mir-30d Regulates Cardiac Remodeling by Intracellular and Paracrine Signaling. Circul Res 128(1). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1161/circresaha.120.317244\u003c/span\u003e\u003cspan address=\"10.1161/circresaha.120.317244\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmbrosy AP, Fonarow GC, Butler J, Chioncel O, Greene SJ, Vaduganathan M et al (2014) The Global Health and Economic Burden of Hospitalizations for Heart Failure. J Am Coll Cardiol 63(12):1123\u0026ndash;1133. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jacc.2013.11.053\u003c/span\u003e\u003cspan address=\"10.1016/j.jacc.2013.11.053\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi G, Shao Y, Guo HC, Zhi Y, Qiao B, Ma K et al (2022) MicroRNA-27b-3p down-regulates FGF1 and aggravates pathological cardiac remodelling. Cardiovasc Res 118(9):2139\u0026ndash;2151. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/cvr/cvab248\u003c/span\u003e\u003cspan address=\"10.1093/cvr/cvab248\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLinlin Zhao F, Dongdong Du N, Wu (2022) Histone demethylase KDM3C regulates the lncRNA GAS5\u0026ndash;miR-495-3p\u0026ndash;PHF8 axis in cardiac hypertrophy. Ann NYAcad Sci 1516286\u0026ndash;299. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/nyas.14813\u003c/span\u003e\u003cspan address=\"10.1111/nyas.14813\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGaddam RR, Kim YR, Jacobs JS, Yoon JY, Li Q, Cai A et al (2022) The microRNA-204-5p inhibits APJ signalling and confers resistance to cardiac hypertrophy and dysfunction. Clin translational Med 12(1):e693. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/ctm2.693\u003c/span\u003e\u003cspan address=\"10.1002/ctm2.693\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa CX, Wei ZR, Sun T, Yang MH, Sun YQ, Kai KL et al (2023) Circ\u0026ndash;sh3rf3/GATA\u0026ndash;4/miR\u0026ndash;29a regulatory axis in fibroblast\u0026ndash;myofibroblast differentiation and myocardial fibrosis. Cell Mol Life Sci 80(2):50. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s00018-023-04699-7\u003c/span\u003e\u003cspan address=\"10.1007/s00018-023-04699-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi HYDZYHZCDYLZXHHH (2022) MicroRNA\u0026ndash;451a attenuates angiotensin II\u0026ndash;induced cardiac fibrosis and inflammation by directly targeting T\u0026ndash;box1. J Physiol Biochemistr 78:257\u0026ndash;269. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s13105-021-00861-6\u003c/span\u003e\u003cspan address=\"10.1007/s13105-021-00861-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKadiam C, Venkata Subbaiah J, Wu WHWT, Yao P (2022) FAM114A1 influences cardiac pathological remodeling by regulating angiotensin II signaling. JCI Insight 7(13):e152783. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1172/jci10.1172/jci.insight.152783DS1\u003c/span\u003e\u003cspan address=\"10.1172/jci10.1172/jci.insight.152783DS1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWeipeng Ge CH, Zhang W, Guo X, Gao P, Song X, Gao R, Liu Y, Guo W, Li B, Zhao H (2021) Jing Wang Mep1a contributes to Ang II-induced cardiac remodeling by promoting cardiac hypertrophy, fibrosis and inflammation. J Mol Cell Cardiol 152:52\u0026ndash;68. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.yjmcc.2020.11.015\u003c/span\u003e\u003cspan address=\"10.1016/j.yjmcc.2020.11.015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eArantxa G, Mark RA, Boer RAd, Thum T, Arfsten H, H\u0026uuml;lsmann M et al (2022) Cardiac remodelling \u0026ndash; Part 1: From cells and tissues to circulating biomarkers. A review from the Study Group on Biomarkers of the Heart Failure Association of the European Society of Cardiology. Eur J Heart Fail 24(6):927\u0026ndash;943. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/ejhf.2493\u003c/span\u003e\u003cspan address=\"10.1002/ejhf.2493\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiangbin Wu KCVS, Feng Jiang O, Hedaya A, Mohan T, Yang K, Welle S, Ghaemmaghami (2021) Wai Hong Wilson Tang, Eric Small, Chen Yan \u0026amp; Peng Yao. MicroRNA-574 regulates FAM210A expression and influences pathological cardiac remodeling. 13:1\u0026ndash;20. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.15252/emmm.202012710\u003c/span\u003e\u003cspan address=\"10.15252/emmm.202012710\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhan Hp, Huang F, Niu Q, Jiao Ml H, Xm, Zhang K et al (2021) Downregulation of miR-128 Ameliorates Ang II-Induced Cardiac Remodeling via SIRT1/PIK3R1 Multiple Targets. Oxidative Med Cell Longev 2021:1\u0026ndash;17. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1155/2021/8889195\u003c/span\u003e\u003cspan address=\"10.1155/2021/8889195\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHsu CH, Liu IF, Kuo HF, Li CY, Lian WS, Chang CY et al (2021) miR-29a-3p/THBS2 Axis Regulates PAH-Induced Cardiac Fibrosis. Int J Mol Sci 22(19). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms221910574\u003c/span\u003e\u003cspan address=\"10.3390/ijms221910574\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUrao N, Mirza RE, Corbiere TF, Hollander Z, Borchers CH, Koh TJ (2017) Thrombospondin-1 and disease progression in dysferlinopathy. Hum Mol Genet 26(24):4951\u0026ndash;4960. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/hmg/ddx378\u003c/span\u003e\u003cspan address=\"10.1093/hmg/ddx378\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchroen B, Heymans S, Sharma U, Blankesteijn WM, Pokharel S, Cleutjens JPM et al (2004) Thrombospondin-2 Is Essential for Myocardial Matrix Integrity. Circul Res. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1161/01.RES.0000141019.20332.3e\u003c/span\u003e\u003cspan address=\"10.1161/01.RES.0000141019.20332.3e\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchips TG, Vanhoutte D, Vo A, Correll RN, Brody MJ, Khalil H et al (2019) Thrombospondin-3 augments injury-induced cardiomyopathy by intracellular integrin inhibition and sarcolemmal instability. Nat Commun 10(1):76. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41467-018-08026-8\u003c/span\u003e\u003cspan address=\"10.1038/s41467-018-08026-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePalao T, Rippe C, van Veen H, VanBavel E, Sward K, Bakker EN (2016) Thrombospondin-4 knockout in hypertension protects small-artery endothelial function but induces aortic aneurysms. Am J Physiol Heart Circ Physiol 310(11):H1486\u0026ndash;H1493. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1152/ajpheart.00046.2016\u003c/span\u003e\u003cspan address=\"10.1152/ajpheart.00046.2016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStenina-Adognravi O, Thrombospondins (2013) Old Players, New Games. Curr Opin Lipidol 24(5):401\u0026ndash;409. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1097/MOL.0b013e3283642912\u003c/span\u003e\u003cspan address=\"10.1097/MOL.0b013e3283642912\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMustonen E, Ruskoaho H, Rysa J (2013) Thrombospondins, potential drug targets for cardiovascular diseases. Basic Clin Pharmacol Toxicol 112(1):4\u0026ndash;12. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/bcpt.12026\u003c/span\u003e\u003cspan address=\"10.1111/bcpt.12026\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStenina OI, Topol EJ, Plow EF, Thrombospondins (2007) Their Polymorphisms, and Cardiovascular Disease. Arterioscler Thromb Vasc Biol. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1161/ATVBAHA.107.141713\u003c/span\u003e\u003cspan address=\"10.1161/ATVBAHA.107.141713\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSingla B, Aithbathula RV, Pervaiz N, Kathuria I, Swanson M, Ekuban FA et al (2023) CD47 Activation by Thrombospondin-1 in Lymphatic Endothelial Cells Suppresses Lymphangiogenesis and Promotes Atherosclerosis. Arterioscler Thromb Vasc Biol 43(7):1234\u0026ndash;1250. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1161/ATVBAHA.122.318904/10.514 1Q\u003c/span\u003e\u003cspan address=\"10.1161/ATVBAHA.122.318904/10.514 1Q\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAdams JC, Lawler J (2011) The thrombospondins. Cold Spring Harb Perspect Biol 3(10):1\u0026ndash;29. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1101/cshperspect.a009712\u003c/span\u003e\u003cspan address=\"10.1101/cshperspect.a009712\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHong Y, Kim I, Moon H, Lee J, Lertpatipanpong P, Ryu CH et al (2023) Novel thrombospondin-1 transcript exhibits distinctive expression and activity in thyroid tumorigenesis. Oncogene 42(22):1832\u0026ndash;1842. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41388-023-02692-9/6.6340 1Q\u003c/span\u003e\u003cspan address=\"10.1038/s41388-023-02692-9/6.6340 1Q\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCosta A, Afonso J, Os\u0026oacute;rio C, Gomes AL, Caiado F, Valente J et al (2013) miR-363-5p regulates endothelial cell properties and their communication with hematopoietic precursor cells. J Hematol Oncol 6(87):1\u0026ndash;12\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eROCKMAN HA, Ross RS, HARRIS AN, KNOWLTON KU, STEINHELPERt ME, FIELDt LJ et al (1991) Segregation of atrial-specific and inducible expression of an atrial natriuretic factor transgene in an in vivo murine model of cardiac hypertrophy. Proc Natl Acad Sci 88:8277\u0026ndash;8281\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJia G, Liang C, Li W, Dai H (2022) MiR-410-3p facilitates Angiotensin II-induced cardiac hypertrophy by targeting Smad7. Bioengineered 13(1):119\u0026ndash;127. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1080/21655979.2021.2009968\u003c/span\u003e\u003cspan address=\"10.1080/21655979.2021.2009968\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRui Zhang YQ, Zhenjun Ji C, Hao Y, Su Y, Yao W, Zuo X, Chen M, Yang, Ma G (2022) METTL3 mediates Ang\u0026ndash;II\u0026ndash;induced cardiac hypertrophy through accelerating pri\u0026ndash;miR\u0026ndash;221/222 maturation in an m6A\u0026ndash;dependent manner. Cell Mol Biol Lett 27(55):1\u0026ndash;19. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s11658-022-00349-1\u003c/span\u003e\u003cspan address=\"10.1186/s11658-022-00349-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLynch JM, Maillet M, Vanhoutte D, Schloemer A, Sargent MA, Blair NS et al (2012) A thrombospondin-dependent pathway for a protective ER stress response. Cell 149(6):1257\u0026ndash;1268. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2012.03.050\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2012.03.050\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"molecular-and-cellular-biochemistry","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcbi","sideBox":"Learn more about [Molecular and Cellular Biochemistry](https://www.springer.com/journal/11010)","snPcode":"11010","submissionUrl":"https://submission.nature.com/new-submission/11010/3","title":"Molecular and Cellular Biochemistry","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"MicrRNA-363-5p, Thrombospondin 3, Cardiac remodeling, Cardiac hypertrophy, Myocardial fibrosis","lastPublishedDoi":"10.21203/rs.3.rs-4371143/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4371143/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eCardiac remodeling is an end-stage manifestation of multiple cardiovascular diseases, and microRNAs are involved in a variety of posttranscriptional regulatory processes. miR-363-5p targeting of Thrombospondin3 (THBS3) has been shown to play an important regulatory role in vascular endothelial cells, but the roles of these two in cardiac remodeling are unknown. We first established an in vivo model of cardiac remodeling induced by transverse aortic narrow (TAC). human cardiomyocyte cell line (AC16) and human cardiac fibroblast cell line (HCF) were treated with 1 \u0026micro;mol/L angiotensin II (AngⅡ) to construct an in vitro model of myocardial hypertrophy and myocardial fibrosis. In all three of the above models, we found a significant decreasing trend of miR-363-5p, suggesting that it plays a key regulatory role in the occurrence and development of cardiac remodeling. Subsequently, overexpression of miR-363-5p significantly attenuated myocardial hypertrophy and myocardial fibrosis in vitro as evidenced by reduced the area of AC16, the cell viability of HCFs, the relative expression of the protein of fetal genes (ANP, BNP, β-MHC) and fibrosis marker (collagen Ⅰ, collagen Ⅲ, α-MSA), whereas inhibition of miR-363 -5p expression showed the opposite trend. In addition, we also confirmed the targeted binding relationship between miR-363-5p and THBS3 by dual luciferase reporter gene assay, and the relative expression of THBS3 mRNA and protein were significantly decreased upon overexpression of miR-363-5p. Moreover, overexpression of miR-363-5p with THBS3 Simultaneously partially eliminated the delaying effect of miR-363-5p on myocardial hypertrophy and myocardial fibrosis in vitro. In conclusion, Overexpression of miR-363-5p attenuated the prohypertrophic and profibrotic effects of Ang II on AC16 and HCF by a mechanism related to the inhibition of THBS3 expression.\u003c/p\u003e","manuscriptTitle":"MicroRNA363-5p Targets Thrombospondin3 to Regulate Pathological Cardiac Remodeling","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-05-15 11:17:18","doi":"10.21203/rs.3.rs-4371143/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-08-06T17:52:43+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-07-30T21:15:14+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"70201442922177932583117132616609993841","date":"2024-07-27T13:30:22+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-06-26T03:47:38+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"58490336892442528574911793717237092036","date":"2024-06-06T11:38:01+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"61559284830205527958606099363954283946","date":"2024-06-03T20:55:27+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-05-27T08:24:27+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-05-22T17:57:12+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-05-08T09:42:18+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular and Cellular Biochemistry","date":"2024-05-05T09:43:10+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"molecular-and-cellular-biochemistry","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcbi","sideBox":"Learn more about [Molecular and Cellular Biochemistry](https://www.springer.com/journal/11010)","snPcode":"11010","submissionUrl":"https://submission.nature.com/new-submission/11010/3","title":"Molecular and Cellular Biochemistry","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"0dc87a21-0683-4f87-af7b-6ec6947ad323","owner":[],"postedDate":"May 15th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-10-14T16:07:16+00:00","versionOfRecord":{"articleIdentity":"rs-4371143","link":"https://doi.org/10.1007/s11010-024-05125-7","journal":{"identity":"molecular-and-cellular-biochemistry","isVorOnly":false,"title":"Molecular and Cellular Biochemistry"},"publishedOn":"2024-10-07 15:57:20","publishedOnDateReadable":"October 7th, 2024"},"versionCreatedAt":"2024-05-15 11:17:18","video":"","vorDoi":"10.1007/s11010-024-05125-7","vorDoiUrl":"https://doi.org/10.1007/s11010-024-05125-7","workflowStages":[]},"version":"v1","identity":"rs-4371143","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4371143","identity":"rs-4371143","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}