TLR3-Dependent Polarization of Adipose-Derived Mesenchymal Stem Cells Regulates Pancreatic Cancer Cell Behavior in an Indirect Co-culture Model

TLR3-Dependent Polarization of Adipose-Derived Mesenchymal Stem Cells Regulates Pancreatic Cancer Cell Behavior in an Indirect Co-culture Model | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article TLR3-Dependent Polarization of Adipose-Derived Mesenchymal Stem Cells Regulates Pancreatic Cancer Cell Behavior in an Indirect Co-culture Model Demet Kaçaroğlu, Ayşegül Yılmaz, Züleyha Taş, Seher Yaylacı This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8384537/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Purpose Toll-like receptor 3 (TLR3) signaling is known to regulate the interactions between mesenchymal stem cells (MSCs) and tumor cells; however, its functional impact in the context of pancreatic cancer remains insufficiently defined. This study investigated how pharmacological activation or inhibition of TLR3 in adipose-derived MSCs (ADMSCs) modulates cellular inflammatory responses and alters the paracrine effects exerted on Panc-1 cells. Methods ADMSCs were phenotypically validated by flow cytometry and subsequently exposed to graded doses of the TLR3 agonist Poly(A:U) and the antagonist CU-CPT4a. Optimal doses were identified through cell viability (MTT) assays and expression analyses of IL6, TNFA, IL10, and TGFB1. These doses were then applied in indirect transwell co-culture models at MSC:Panc-1 ratios of 10:1, 1:1, and 1:10 to determine the optimal co-culture condition. At the selected MSC:Panc-1 = 10:1 ratio, Panc-1 cell proliferation (Calcein AM), apoptosis (Annexin V/PI), cell cycle distribution, colony-forming capacity, EMT-related genes (CD44, ZEB1, VIM, CDH1, CLDN1), and metastasis-associated genes (MMP2, MMP9, TIMP1, VEGFR2, PLAU) were evaluated. Results TLR3 activation induced a dose-dependent, biphasic pro-inflammatory response in ADMSCs while maintaining viability at 1 µg/mL. In contrast, TLR3 inhibition generated a strong anti-inflammatory phenotype, with maximal induction of TGFB1 and IL10 at 0.5 µg/mL. In co-culture, MSCs -particularly T3 + MSCs -significantly reduced Panc-1 viability, proliferation, and colony formation; increased G1/S retention; and enhanced apoptotic death. At the gene level, TLR3 activation promoted epithelial stabilization and reduced extracellular matrix degradation, whereas TLR3 inhibition favored a more mesenchymal and invasive phenotype. Conclusion Overall, the findings identify TLR3 signaling in ADMSCs as a critical regulator of tumor-stroma interactions and demonstrate that controlled TLR3 activation may enhance the antitumor potential of MSC-based therapeutic strategies in pancreatic cancer. Adipose-derived mesenchymal stem cells (ADMSCs) Toll-like receptor 3 (TLR3) pancreatic cancer indirect co-culture epithelial mesenchymal transition (EMT) Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Pancreatic cancer is one of the most lethal malignancies worldwide and is projected to become the second leading cause of cancer-related mortality by 2030 due to its aggressive nature, late diagnosis, and resistance to standard therapies [ 1 , 2 ]. The dense desmoplastic tumor microenvironment (TME) is a major contributor to this therapeutic resistance and has emerged as a key target for new treatment approaches [ 3 ]. The pancreatic TME consists of cancer cells, extracellular matrix (ECM), and various stromal populations that collectively regulate tumor initiation, invasion, metastasis, chemoresistance, and immune escape [ 4 ]. Under pathological conditions, stromal cells undergo functional reprogramming and begin secreting cytokines, chemokines, growth factors, and proteases that support tumor progression [ 5 ]. Among stromal components, cancer-associated fibroblasts (CAFs), frequently derived from mesenchymal stem cells (MSCs), play central roles in ECM remodeling, angiogenesis, and tumor–immune interactions [ 6 ]. Understanding the dynamic interplay between pancreatic cancer cells and stromal components is therefore essential for developing new therapeutic strategies. Mesenchymal stem cells are multipotent stromal cells with regenerative and immunomodulatory capacities, isolated from various tissues including bone marrow, adipose tissue, and umbilical cord [ 7 , 8 ]. Adipose-derived MSCs (ADMSCs) are particularly attractive owing to minimally invasive isolation, high yield, and strong applicability in research and clinical practice [ 9 ]. However, their effects on tumor cells are highly context-dependent: MSCs may suppress tumor proliferation and induce apoptosis, or conversely support tumor growth and metastasis through paracrine signaling [ 10 , 11 ]. In pancreatic cancer, MSCs have been shown to affect ECM remodeling, collagen deposition, and MMP expression, thereby influencing tumor stiffness, invasion, and metastatic behavior [ 12 , 13 ]. Toll-like receptors (TLRs) are key regulators of MSC function. MSCs express several TLRs -including TLR3 which recognizes double-stranded RNA and activates NF-κB and IRF3 signaling, shaping cytokine release and inflammatory behavior [ 14 , 15 ]. TLR stimulation can polarize MSCs into distinct functional phenotypes with divergent effects on tumor progression. For instance, TLR4-activated MSCs often display antitumor activity, whereas TLR3-stimulated MSCs may enhance colony formation or alter migration depending on the model [ 16 , 17 ]. TLR3 activation has also been linked to increased MSC migration in vivo and context-dependent modulation of tumor growth [ 18 , 19 ]. These findings suggest that TLR3-driven MSC polarization may critically influence tumor-stroma interactions, although this mechanism remains poorly defined in pancreatic cancer. Given these gaps, the present study investigates how pharmacological activation or inhibition of TLR3 modulates the inflammatory phenotype of ADMSCs and how these polarized MSCs regulate Panc-1 pancreatic cancer cell behavior in an indirect co-culture model. In this study, Panc-1 cells, derived from the most common and aggressive form of PDAC, were used as the cancer model. ADMSCs were treated with a TLR3 agonist or antagonist according to established protocols to determine optimal concentration and exposure conditions. These MSC, TLR3-activated MSC, and TLR3-inhibited MSC groups were then introduced into indirect co-culture systems at three different MSC:Panc-1 ratios (1:10, 1:1, and 10:1), and cell viability was assessed at 24 and 72 hours. The most effective ratio, MSC:Panc-1 = 10:1, was further used to examine proliferation, apoptosis, cell cycle dynamics, colony-forming ability, EMT markers, and metastasis-related gene expression. Based on the current literature, this study provides new mechanistic and molecular insights into the effects of TLR3-modulated ADMSCs on pancreatic cancer cells. Given the highly aggressive and therapy-resistant nature of pancreatic cancer, understanding stromal interactions is of critical importance. This study provides meaningful insight into the functional role of MSCs within the pancreatic tumor microenvironment and contributes to the development of future MSC-based therapeutic strategies. Materials and Methods Culture and Characterization of Adipose Tissue Derived Mesenchymal Stem Cells Commercially available adipose-derived mesenchymal stem cells (AD-MSCs; ATCC No: PCS-500-011™) were cultured in Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12; Capricorn, Germany) supplemented with 20% fetal bovine serum (FBS; Capricorn, Germany), 2 mM L-glutamine (Sigma-Aldrich), and 1% antibiotic-antimycotic solution (BIOIND, Israel). Cells were maintained at 37°C in a humidified incubator with 5% CO₂, and the medium was refreshed until reaching 70–80% confluency. A total of 50,000 cells were harvested using a cell scraper and centrifuged at 1000 × g for 5 min. The pellet was stained using the MSC Marker Verification Kit (R&D Systems, Cat. #FMC020). Cells were incubated with 10 µL each of positive antibodies (anti-CD90, anti-CD105, anti-CD73) and a negative cocktail (anti-CD45, anti-CD34, anti-CD11b, anti-HLA-DR, and anti-CD79) along with an isotype control for 45 min at room temperature in the dark. After washing with staining buffer, cells were centrifuged and resuspended in 100 µL buffer for flow cytometric analysis. Fluorescence data were acquired using a BD flow cytometer and analyzed with CellQuest Pro software (BD Biosciences, San Jose, CA). The percentages of CD90⁺, CD73⁺, and CD105⁺ cells were determined relative to isotype controls [ 20 ]. Preparation of TLR3 Agonist/Antagonist and MTT Assay for Evaluation of Cell Viability The TLR3 agonist Poly(A:U) (InvivoGen, Cat. No. tlrl-pau, 10 mg) and the TLR3 antagonist CU-CPT4a (Cayman Chemical, Cat. No. 30951, 1 mg) were obtained commercially. Prior to application, the agonist was dissolved in physiological water at a concentration of 10 mg/mL, and the antagonist was prepared in DMSO at a concentration of 1 mg/mL, according to the manufacturers’ recommendations. Working concentrations used in the experiments were obtained by diluting the stock solutions with the cell culture medium to the desired final concentrations. To assess the effects of TLR3 signaling on cell viability, ADMSC were seeded into 96-well plates at a density of 3,000 cells per well. Five different concentrations (0.01, 0.1, 1, 10, and 100 µg/mL) of the TLR3 agonist and antagonist were applied. Cell viability was evaluated at 24 and 48 hours post-treatment using the MTT assay. At the end of each incubation period, 10 µL of MTT solution (final concentration: 0.5 mg/mL) and 90 µL of fresh DMEM were added to each well. The plates were incubated for 4 hours at 37°C in a humidified atmosphere containing 5% CO₂, protected from light, to allow for formazan crystal formation. Following incubation, 100 µL of DMSO was added to each well to dissolve the formazan crystals, and the contents were mixed thoroughly by pipetting. Absorbance values were measured at 570 nm using a microplate reader (BioTek Synergy H1, BioTek Instruments, Winooski, VT, USA). The optical density (OD) readings were normalized to control groups, and cell viability percentages were calculated accordingly [ 21 ]. Gene Expression Analysis Following TLR3 Agonist and Antagonist Treatment ADMSCs were seeded into 24-well culture plates at a density of 5 × 10⁴ cells per well and incubated for 24 hours to allow surface attachment. Each experimental group was plated in six wells. After incubation, cells were washed twice with phosphate-buffered saline (PBS) and experimental treatments were initiated. For TLR3 modulation, AD-MSCs were treated with the TLR3 agonist at concentrations of 0.1, 1, 5, and 10 µg/mL, and with the TLR3 antagonist at 0.01, 0.1, 0.5, and 1 µg/mL for 24 hours. Total RNA was isolated using TRIzol reagent (ABP Bioscience, Wuhan, China) according to the manufacturer’s instructions. Gene expression analysis was performed to evaluate the expression levels of IL-6 , IL-10 , TGF-β , and TNF-α in relation to TLR3 agonist and antagonist concentrations, compared to the untreated control group. Quantitative real-time PCR (qPCR) analyses were carried out using the LightCycler® 96 System (Roche, Germany) with A.B.T.™ 2X qPCR SYBR-Green Master Mix (ATLAS Biotechnology, Türkiye). GAPDH was used as the reference gene, and specific primer pairs were employed for each target gene (Table 1 ). Each 20 µL qPCR reaction consisted of 10 µL SYBR Green Master Mix, 7 µL nuclease-free water, 0.5 µL forward primer, 0.5 µL reverse primer, and 2 µL RNA sample. The reactions were loaded into strip tubes and run on the LightCycler® 96 instrument following the manufacturer’s recommended program for cDNA synthesis and qPCR cycling. The annealing step of the qPCR reaction was set at 60°C. All reactions were performed in triplicate. The qPCR data were analyzed using the LightCycler® 96 software. The mean threshold cycle values were calculated for each sample and normalized to GAPDH . Relative gene expression levels were quantified using the 2^−ΔΔCt method [ 22 ]. Culture of Panc-1 Cells and Establishment of Indirect Co-Culture with ADMSCs To evaluate the effects of AD-MSCs on pancreatic cancer cell viability and to investigate the potential impact of TLR3 agonist and antagonist, an indirect co-culture experiment was established. Panc-1 cells (ATCC® CRL-1469™) were obtained commercially and cultured in complete DMEM supplemented with 10% FBS, 1% L-glutamine, and 1% antibiotic-antimycotic solution. Panc-1 cells were seeded in 24-well plates for co-culture with ADMSCs at ratios of 10:1, 1:1, and 1:10. To allow paracrine interactions without direct cell contact, transwell inserts with 0.4 µm pore membranes (NEST, Cat. No. 725101) were used. Panc-1 cells were first plated in the wells and incubated to allow attachment: 3,000 cells per well for 1:10 and 1:1 ratios, and 30,000 cells per well for the 10:1 ratio. Simultaneously, ADMSCs were seeded on the bottom of transwell inserts: 30,000 cells per insert for 1:1 and 10:1 ratios, and 3,000 cells per insert for the 1:10 ratio, followed by 24 hours of incubation. Each experimental group was performed in triplicate. After the incubation period, the polarization medium was removed, and inserts containing control ADMSCs, TLR3 agonist-treated ADMSCs, or TLR3 antagonist-treated ADMSCs were placed into wells containing Panc-1 cells. Co-cultures were maintained for 24 and 72 hours, after which samples were collected for downstream analyses. Cell Viability Analysis of Panc-1 Cells in the Indirect Co-Culture Model This experiment was performed to compare the viability of Panc-1 cells co-cultured with ADMSCs, TLR3 agonist-treated MSCs, and TLR3 antagonist-treated MSCs against control Panc-1 cells cultured alone. The cell viability assay was performed at three different co-culture ratios (10:1, 1:1, and 1:10) for 24 and 72 hours. After 24 and 72 hours of co-culture, MTT solution was added to each well to achieve a final concentration of 0.5 mg/mL, and the assay was carried out as described in the cell viability protocol. The obtained OD values were normalized by setting the OD of the control group containing only Panc-1 cells as 100%, and relative viability percentages of the other groups were calculated accordingly. The concentration showing the most pronounced reduction in viability was used as a reference for subsequent analyses [ 21 ]. Analyses Performed on Panc-1 Cells in the Indirect Co-Culture Model at MSC:Panc-1 Ratio of 10:1 Proliferation, apoptosis, cell cycle, colony formation, and ICC analyses were conducted using an indirect co-culture system at a MSC:Panc-1 = 10:1. ratio after 72 hours of incubation. Panc-1 cells were first seeded at 3,000 cells per well and incubated for 24 hours to allow attachment. Subsequently, MSCs from each experimental group (naïve, TLR3 agonist-treated, and TLR3 antagonist-treated) were seeded into the upper compartment of transwell inserts at 30,000 cells per insert, establishing the 10:1 co-culture ratio. After 72 hours of co-culture, Panc-1 cells were collected for downstream analyses. ● Proliferation Analysis of Panc-1 Cells Using Calcein AM Staining At the end of the 72-hour indirect co-culture period conducted at an MSC:Panc-1 = 10:1, cells were prepared for proliferation analysis. Calcein AM solution (Cat. No: E-CK-A164) was diluted 1:1000 in PBS and added to the cells. The plates were incubated at 37°C for 20 minutes in the dark. Following incubation, fluorescent images were captured from three randomly selected fields per well using an inverted fluorescence microscope (Leica DM IL) with excitation at 490 nm and emission at 520 nm. The captured images were analyzed using NIH ImageJ software to quantify Panc-1 cells. The mean cell number for each group was calculated and expressed as a percentage relative to the untreated control group [ 23 ]. ● Apoptosis Analysis of Panc-1 Cells After 72 hours of co-culture, Panc-1 cells were harvested from the bottom of the wells and divided for flow cytometry analyses. For flow cytometry, cells were processed using the Annexin V Apoptosis Detection Kit (Tonbo Biosciences, Cat. No. 35-6410). Cell pellets were washed twice with cold PBS, resuspended in 100 µL PBS, and 5 µL each of Annexin V and propidium iodide were added, followed by 20 minutes of incubation at room temperature in the dark. Subsequently, 250 µL of Annexin V binding buffer was added, and samples were analyzed within 30 minutes using the NovoCyte flow cytometer. All analyses were performed in triplicate, and data were evaluated using NovoExpress Software (v1.6.1) to generate histograms representing the percentages of live, early apoptotic, late apoptotic, and necrotic Panc-1 cells [ 23 ]. ● Cell Cycle Analysis of Panc-1 Cells At the end of the 72-hour co-culture period, Panc-1 cells in the lower wells were harvested and prepared for analysis according to the Cell Cycle Analysis Kit protocol (THOR-CCK-100, Thorvacs Biotechnology, Turkey). Cell suspensions were centrifuged at 1,000 × g for 5 minutes to obtain a pellet, and cell counting was performed. For fixation, 70% ethanol was added to the pellet with vortexing, followed by centrifugation at 800 × g for 5 minutes. Cells were washed twice with 1× PBS and then incubated with 50 µL per sample of 1× enzyme solution from the kit at 37°C for 15 minutes. Subsequently, 200 µL of 1× propidium iodide (PI) staining solution was added to each sample, and the cells were incubated in the dark for 30 minutes. All analyses were performed in triplicate. Stained samples were analyzed using the NovoCyte flow cytometer, and cell cycle distribution data were evaluated with NovoExpress Software (v1.6.1) and presented as histograms [ 23 ]. ● Colony Formation Assay of Panc-1 Cells This assay was performed to evaluate the effects of naïve MSCs, TLR3 agonist-treated MSCs, and TLR3 antagonist-treated MSCs on the colony-forming ability of Panc-1 cells. Panc-1 cells were seeded into 24-well plates at a density of 200 cells per well in triplicate. MSCs from each experimental group were placed into transwell inserts at a density of 2,000 cells per insert, and the co-cultures were incubated at 37°C for 14 days. At the end of the incubation period, cells were fixed with a methanol:acetic acid solution and stained with 0.5% (w/v) crystal violet. Colonies were visualized and counted using an inverted light microscope (Leica DM IL, Leica, Wetzlar, Germany). In addition, the absorbance of the stained colonies was measured at 595 nm using a spectrophotometer. Optical density (OD) values were normalized by setting the control Panc-1 monoculture group as 100%, and relative colony formation was calculated accordingly [ 23 ]. • Gene Expression Analysis of Panc-1 Cells This experiment was conducted to evaluate the effects of naïve MSCs, TLR3 agonist-treated MSCs (T3 + MSCs), and TLR3 antagonist-treated MSCs (T3–MSCs) on the gene expression profile of Panc-1 cells. Co-cultures were maintained for 72 hours, after which Panc-1 cells were collected using TRIzol reagent. Six-well culture plates with appropriate transwell inserts were used, with 50,000 Panc-1 cells seeded per well and 500,000 MSCs added per well (MSC:Panc-1 = 10:1). RNA was isolated from Panc-1 cells co-cultured with each MSC group.For qPCR analysis, primers specific for cancer stem cell marker ( CD44 ), epithelial markers ( E-Cadherin , Claudin ), mesenchymal markers ( Vimentin , ZEB1 ), and metastasis-associated genes ( MMP-9 , MMP-2 , TIMP1 , VEGFR , uPA ) were used (Table 2 ). GAPDH was included as the reference gene. Single-step qPCR reactions were prepared using a SYBR Green master mix, 30 ng/µL RNA, nuclease-free water, and sense/antisense primers. Reaction mixtures were pipetted into 8-strip tubes, and all reactions were performed in triplicate. qPCR was conducted on a LightCycler® 96 instrument (Roche Diagnostics). Ct values were normalized to GAPDH, and relative gene expression levels were quantified using the 2^−ΔΔCt method [ 24 ]. ● Immunocytochemistry (ICC) of Panc-1 Cells This analysis was performed to evaluate the effects of naïve MSCs, TLR3 agonist-treated MSCs, and TLR3 antagonist-treated MSCs on the protein expression of CD44, Vimentin, and E-cadherin in Panc-1 cells. For immunocytochemistry (ICC) staining, Panc-1 cells were cultured on 13 mm uncoated glass coverslips for 24 hours. After removing the medium, cells were fixed and permeabilized using 4% paraformaldehyde (SERVA, Germany) and 0.1% Triton X-100, and nonspecific binding was blocked with 1% bovine serum albumin. Cells were then incubated with primary antibodies—CD44 (DF6392, Affinity Biosciences), E-cadherin (E-AB-31261, Elabscience), and Vimentin (E-AB-67478, Elabscience)—at 1:200 dilution for 1 hour. Detection was performed using the 2-step plus Poly-HRP Anti-Rabbit IgG Detection System with DAB solution (Cat. no: E-IR-R215) according to the manufacturer’s protocol. Finally, cells were counterstained with hematoxylin (SERVA, Germany). Images of stained samples were captured using a Nikon Eclipse E200 upright microscope [ 24 ]. Statistical Analysis For all variables, mean values and standard deviations (SD) were calculated. Differences between groups were analyzed using two-way ANOVA followed by Tukey’s post hoc test. A p-value < 0.05 was considered statistically significant. All statistical analyses and graphical representations were performed using GraphPad Prism software (version 8; GraphPad Software, San Diego, CA, USA). Table 1 Genes and Primer Sequences Used for Gene Expression Analysis in ADMSCs Gene Forward Primer (5′ → 3′) Reverse Primer (5′ → 3′) GAPDH GTCTCCTCTGACTTCAACAGCG ACCACCCTGTTGCTGTAGCCAA TGF-β TACAGCAACAATTCCTGGCG GTGAACCCGTTGATGTCCAC IL-10 CCTGCCTAACATGCTTCGAG GAGTTCACATGCGCCTTGAT IL-6 CTCCACAAGCGCCTTCGGT GAATCTTCTCCTGGGGGTACTGG TNF-α GCCCATGTTGTAGCAAACCCTC GGTTATCTCTCAGCTCCACGCC Table 2 Genes and Primer Sequences Used for Gene Expression Analysis in Panc-1 Cells Gene Forward Primer (5′ → 3′) Reverse Primer (5′ → 3′) GAPDH GTCTCCTCTGACTTCAACAGCG ACCACCCTGTTGCTGTAGCCAA CD44 CACACGAAGGAAAGCAGGAC CCAGAGGTTGTGTTTGCTCC CDH1 TTAGAGGTCAGCGTGTGTGA CTTCTCCGCCTCCTTCTTCA CLDN1 TGCTTGGAAGACGATGAGGT GAGCCTGACCAAATTCGTACC VIM CTGCCAACCGGAACAATGAC TAGTTAGCAGCTTCAACGGC ZEB1 AGGAGCCACAAAAGGACAGT TGGGGAATCAGAATCGTTTGC MMP9 GACGAGGGCCTGGAGTGT TGTGCTGTAGGAAGCTCATCTC MMP2 TTCATTTGGCGGACTGTGAC GTGCTGGCTGAGTAGATCCA TIMP1 ACCCCTGGAGCACGGCT CCCACCTTCCAAGTTAGTGACA VEGFR2 (KDR) ATCTGTGACTTTGGCTTGGC TCCCACAGCAAAACACCAAA uPA (PLAU) GCCACACACTGCTTCATTGA TATACATCGAGGGCAGGCAG Results 1- ADMSC Characterization Typical fibroblast-like ADMSCs were successfully expanded in culture (Fig. 1 a). Flow cytometry analysis (Fig. 1 b) included 45,686 labeled events, of which 91.4% fell within the defined MSC gate. Within this gated population, the cells exhibited the expected mesenchymal stem cell immunophenotype: they were negative for the hematopoietic lineage cocktail (anti-CD45, anti-CD34, anti-CD11b, anti-HLA-DR, and anti-CD79) and strongly positive for MSC markers with 99.9% CD73, 99.4% CD90, and 99.9% CD105 expression. This immunophenotypic profile is consistent with the minimal criteria defined by the International Society for Cellular Therapy (ISCT, 2006) for human mesenchymal stem cells [ 25 ]. 2- Effects of TLR3 Agonists and Antagonists at Different Concentrations on Cell Viability and Inflammatory Gene Expression in ADMSCs The TLR3 agonist and antagonist produced distinctly different viability responses in ADMSCs (Fig. 2 a). The TLR3 agonist induced a dose-dependent reduction in cell viability at 24 hours; however, by 48 hours, a partial recovery was observed, with low and intermediate doses approaching control levels. In contrast, the TLR3 antagonist caused marked cytotoxicity at 24 hours, particularly at 10 and 100 µg/mL, and although a slight recovery occurred at lower doses by 48 hours, high-dose toxicity remained pronounced (Fig. 2 a). Collectively, these patterns indicate that ADMSCs exhibit an adaptive response to TLR3 activation, whereas TLR3 blockade renders the cells more susceptible to sustained viability loss, especially at higher concentrations. TLR3 agonist stimulation produced a dose-dependent and multidirectional modulation of inflammatory gene expression in ADMSCs. TGFB1 expression remained unchanged at 0.1 µg/mL, but was almost completely suppressed at 1 and 5 µg/mL (~ 0.002-fold), with a partial recovery at 10 µg/mL (~ 0.17-fold). IL10 showed a fluctuating pattern: a pronounced induction at low concentration, moderate responses at intermediate doses, and a mild increase at the highest dose. The agonist induced a sharp IL6 increase at 0.1 µg/mL (~ 3.6-fold), followed by a progressive reduction at higher concentrations, demonstrating a strong pro-inflammatory activation at low dose. Similarly, TNFA expression increased significantly at 0.1–1 µg/mL, remained above control at 5 µg/mL, and then fell below baseline at 10 µg/mL, suggesting biphasic regulation. Overall, 1 µg/mL elicited robust biological responses across multiple genes without inducing cytotoxicity and was therefore selected as the optimal TLR3 agonist dose (Fig. 2 b). TLR3 antagonism shifted ADMSCs toward a strongly anti-inflammatory phenotype. TGFB1 expression increased steadily from 0.01 µg/mL (~ 1.5-fold) to 0.1 µg/mL (~ 3.3-fold), reaching its maximum at 0.5 µg/mL (~ 6-fold), and remained elevated at 1 µg/mL. IL10 followed a similar pattern, increasing approximately 3-fold at 0.01 µg/mL, 6-fold at 0.1 µg/mL, and peaking at 0.5 µg/mL (~ 12-fold) before decreasing at 1 µg/mL. In contrast, pro-inflammatory genes were markedly suppressed: IL6 was reduced in all groups and nearly eliminated at 0.1 µg/mL, while TNFA decreased consistently across all doses, reaching the lowest level at 1 µg/mL. The concentration of 0.5 µg/mL provided the strongest anti-inflammatory shift with minimal cytotoxicity and was identified as the optimal antagonist dose (Fig. 2 c). In summary, TLR3 activation and inhibition produced opposite immunomodulatory patterns in ADMSCs. The agonist triggered strong pro-inflammatory responses at low doses and suppressed gene expression at higher doses, whereas the antagonist markedly enhanced anti-inflammatory genes (TGFB1, IL10) and consistently reduced IL6 and TNFA. These results highlight TLR3 signaling as a key regulator of inflammatory balance in ADMSCs and support the use of 1 µg/mL agonist and 0.5 µg/mL antagonist as optimal concentrations for further experiments. 3- Effects of MSC, TLR3-Activated MSCs (T3 + MSC), and TLR3-Inhibited MSCs (T3-MSC) on Panc-1 Cell Viability and Proliferation The effects of MSC, T3 + MSC, and T3-MSC on Panc-1 cell viability were assessed at 24 h and 72 h using three MSC:Panc-1 ratios (10:1, 1:1, 1:10) (Fig. 3 a,b). Untreated Panc-1 cells were used as the 100% reference control. At 24h, a strong suppressive effect was observed at the 10:1 ratio, where MSC (87.7%) and particularly T3 + MSC (82.4%) significantly reduced Panc-1 viability (****p < 0.0001). T3–MSC showed only a mild decrease (95.7%). At the 1:1 ratio, MSC markedly increased viability (111.6%, ****p < 0.0001), T3 + MSC produced a moderate increase (103.4%), while T3–MSC reduced cell viability (94.4%, p < 0.01). At 1:10, all groups demonstrated significantly elevated viability (108–111%, ****p < 0.0001), indicating enhanced survival at lower MSC proportions. At 72 h, similar ratio-dependent trends were observed. Under the 10:1 condition, MSC (88.9%) and T3 + MSC (85.9%) continued to significantly inhibit viability (****p < 0.0001), whereas T3–MSC (102.9%) remained comparable to the control (ns). At the 1:1 ratio, MSC (98.5%) and T3–MSC (102.5%) maintained viability near control levels, and only T3 + MSC exhibited a slight but significant reduction (96.1%, *p < 0.05). At 1:10, MSC (88.3%) and T3 + MSC (87.6%) again significantly reduced viability (****p < 0.0001), while T3–MSC (101.8%) showed no significant change. Proliferation analysis at 72 h (Fig. 3 c) demonstrated that MSC and T3 + MSC markedly reduced Panc-1 proliferation at 10:1 (****p < 0.0001), consistent with viability data. At the 10:1 (≈ 5:1) co-culture ratio, untreated Panc-1 cells showed 99.7 ± 8.5% proliferation, whereas MSC (64.9 ± 4.9%) and T3 + MSC (45.7 ± 7.5%) induced strong suppression. T3–MSC (93.0 ± 5.0%) largely preserved Panc-1 proliferation, remaining close to control levels. Representative fluorescence images support these findings, showing reduced cell density in MSC and T3 + MSC groups, particularly under high MSC:Panc-1 ratios (Fig. 3 d). 4-Effects of TLR3 Polarization Indirect MSC-Panc-1 (10:1) co-culture on Panc-1 Cell cycle and apoptosis Cell cycle profiling demonstrated that co-culture with MSCs and TLR3-modulated MSCs induced marked shifts in the phase distribution of Panc-1 cells (Fig. 4 a,b). The S phase fraction increased from 23% in control Panc-1 cells to 28.56% (MSC), 26.27% T3 + MSC, and 23.69% (T3–MSC), and this elevation was statistically significant for all co-culture conditions (p < 0.01–0.0001). Conversely, the G2 population decreased sharply in the MSC (8.78%) and T3 + MSC (8.55%) groups compared to control (19.75%), indicating a significant reduction in G2-phase progression (p < 0.0001). The G1 phase increased in the MSC (61.86%) and T3 + MSC (61.45%) groups relative to control (51.61%), while the T3–MSC condition (53.56%) remained similar to baseline. Statistical analysis confirmed significant G1 enrichment in the MSC and T3–MSC groups (p < 0.0001), suggesting that MSCs tend to retain Panc-1 cells in the G1 phase. Super-G2 populations varied mildly across groups but did not show statistical significance. Overall, these findings indicate that MSCs and TLR3 activation influence Panc-1 proliferation dynamics by promoting S/G1-phase retention while reducing G2-phase progression. Apoptosis profiling revealed distinct effects of MSC co-culture and TLR3 modulation on Panc-1 cell survival (Fig. 4 c,d). In control Panc-1 cells, the proportions of live, early apoptotic, late apoptotic, and necrotic cells were 61.14%, 15.86%, 10.03%, and 12.98%, respectively. Co-culture with MSCs reduced cell viability to 46.67% while increasing early (21.66%) and late apoptosis (13.45%), as well as necrosis (18.21%), indicating that MSCs enhance both apoptotic and necrotic cell death. Notably, T3 + MSC exerted the strongest anti-tumor effect, resulting in the lowest viability (41.09%) and the highest early apoptosis rate (31.79%), demonstrating that TLR3 stimulation amplifies MSC-mediated cytotoxicity toward Panc-1 cells. In contrast, TLR3 antagonism (T3–MSC) produced viability (59.16%) and apoptotic fractions comparable to the control condition, suggesting that inhibition of TLR3 suppresses the anti-tumor capacity of MSCs. Together, these data indicate that TLR3 signaling is a critical modulator of MSC-induced apoptosis in Panc-1 cells. 5-Effects of TLR3 Polarization ındirect MSC-Panc-1 (10:1) co-culture on Panc-1 Cell EMT, Stemness and Metastasis Gene expression analysis of epithelial–mesenchymal transition (EMT)-related markers (CD44, CDH1, CLDN1, VIM, ZEB1) demonstrated condition-dependent modulation (Fig. 5 a). CD44 expression was significantly downregulated in the T3 + MSC group but elevated in the MSC co-culture without TLR3 modulation. CDH1 expression markedly increased in the presence of MSCs but was suppressed under T3–MSC conditions. CLDN1 was strongly upregulated, particularly under T3 + MSC stimulation, while VIM increased only in the T3–MSC group. ZEB1 expression rose with MSC co-culture yet declined following TLR3 inhibition. These results indicate that MSCs enhance epithelial traits (via CDH1 and CLDN1 upregulation) while simultaneously inducing partial EMT, whereas TLR3 activation favors epithelial stabilization and its inhibition promotes mesenchymal transition. Further analysis of matrix remodeling, angiogenesis, and invasion markers (MMP9, MMP2, TIMP1, VEGFR2, PLAU) corroborated these findings (Fig. 5 b). MMP9 and MMP2 expressions were reduced in MSC co-cultures, particularly under T3 + MSC conditions, while TIMP1 expression was markedly increased in all MSC-treated groups, reaching its highest level in T3–MSC. VEGFR2 was strongly upregulated in the presence of MSCs, reflecting enhanced angiogenic signaling, and PLAU expression was robustly induced across all groups, especially in T3–MSC, consistent with an invasive phenotype. Collectively, MSCs suppressed matrix-degrading MMPs while elevating TIMP1, VEGFR2, and PLAU, thereby regulating ECM remodeling and invasion potential in Panc-1 cells. TLR3 activation limited ECM degradation and supported epithelial integrity, whereas its inhibition promoted mesenchymal and invasive characteristics. The colony-forming capacity of Panc-1 cells was evaluated after co-culture with mesenchymal stem cells (MSCs) and modulation of the TLR3 pathway (Fig. 5 c,d). In the control group, Panc-1 cells alone exhibited a colony formation rate of 101.3 ± 3.5%, whereas co-culture with MSCs significantly reduced this rate to 77.3 ± 3.0%, indicating an inhibitory effect on proliferative potential. Stimulation of TLR3 in MSCs (T3 + MSC) further enhanced this suppressive activity, decreasing colony formation to 71.7 ± 1.5%. Conversely, inhibition of TLR3 signaling (T3–MSC) partially reversed the effect, increasing colony formation to 88.3 ± 3.0%. Overall, MSCs decreased Panc-1 colony formation by approximately 24%, with TLR3 activation strengthening and TLR3 inhibition attenuating this suppressive influence. In conclusion, these findings demonstrate that MSCs significantly modulate Panc-1 cell behavior through both direct interaction and TLR3 pathway regulation. While MSC co-culture suppresses colony formation and partially enhances epithelial features, TLR3 activation further reinforces this epithelial phenotype and limits extracellular matrix degradation. Conversely, TLR3 inhibition shifts the balance toward a more mesenchymal and invasive state, characterized by elevated PLAU and TIMP1 expression. Collectively, the data suggest that TLR3 signaling in MSCs acts as a critical regulator of the tumor–stroma interaction, influencing EMT plasticity, matrix remodeling, and the invasive potential of pancreatic cancer cells. Discussion PDAC remains one of the deadliest malignancies worldwide, largely due to its dense desmoplastic stroma, aggressive biological behavior, and poor response to conventional therapies. Increasing evidence highlights that the stromal compartment, rather than acting solely as a passive scaffold, actively shapes tumor progression, immune evasion, metastasis, and therapeutic resistance. Among stromal components, MSCs occupy a central position due to their immunomodulatory plasticity, paracrine activity, and dynamic responsiveness to microenvironmental cues. The present study demonstrates that TLR3 signaling is a critical determinant of ADMSC polarization and profoundly influences their paracrine interactions with Panc-1 pancreatic cancer cells in an indirect co-culture model. Our findings show that pharmacological activation and inhibition of TLR3 generate distinct inflammatory profiles in ADMSCs. TLR3 activation induced a dose-dependent biphasic response: low-dose stimulation promoted pro-inflammatory IL6 and TNFA expression, whereas higher doses suppressed TGFB1 and partially modulated IL10. Conversely, TLR3 inhibition shifted ADMSCs toward a strongly anti-inflammatory phenotype, characterized by elevated TGFB1 and IL10 and reduced IL6 and TNFA expression, consistent with previous reports describing TLR3-dependent induction of immunosuppressive MSC2 characteristics [ 17 ]. Importantly, 1 µg/mL Poly(A:U) and 0.5 µg/mL CU-CPT4a emerged as optimal concentrations, balancing cellular viability and immunomodulatory activity. These dose-dependent effects confirm that TLR3 acts not merely as a pro-inflammatory sensor but as a bidirectional molecular switch controlling stem cell phenotype and secretory programs. The viability and proliferation analyses in co-culture demonstrated that MSC-based effects on Panc-1 cells are highly dependent on MSC-to-cancer cell ratios. At the highest MSC:Panc-1 = 10:1, both naïve MSCs and TLR3-activated MSCs strongly reduced Panc-1 viability and proliferation at 24 and 72 hours, consistent with studies showing MSC-induced growth inhibition in PDAC models [ 26 , 27 ]. T3 + MSC exhibited the strongest antitumor effect, confirming that inflammatory priming can enhance the cytotoxic potential of MSCs toward certain cancer types. In contrast, TLR3-inhibited MSCs maintained Panc-1 viability near baseline, revealing that anti-inflammatory polarization attenuates MSC-mediated tumor suppression. This aligns with the concept that MSC phenotypes have dual and context-dependent roles, either supporting tumor suppression (MSC1-like) or enhancing tumor-promoting processes (MSC2-like) [ 28 ]. Cell cycle analyses further supported these antiproliferative effects. Co-culture with MSCs—particularly T3 + MSC—led to retention of Panc-1 cells in the G1 and S phases, with a marked reduction in G2, indicating disrupted progression through mitosis. These results complement earlier reports of MSC-induced cell cycle arrest in pancreatic cancer cells via cyclin-dependent kinase regulation [ 26 , 27 ]. However, our observation of simultaneous G1 and S-phase accumulation suggests a more complex regulatory mechanism involving partial DNA synthesis without full proliferative commitment, potentially reflecting secretome-mediated modulation of checkpoint proteins. Apoptosis data revealed that naïve MSCs increased early and late apoptotic fractions of Panc-1 cells, while TLR3 activation significantly amplified this effect, supporting the hypothesis that inflammatory priming enhances the antitumor properties of MSCs. Similar proapoptotic effects were previously observed in amniotic MSC–PDAC co-culture models, where MSCs induced apoptosis through caspase activation and p21 upregulation [ 29 ]. In contrast, TLR3-inhibited MSCs failed to significantly increase apoptosis, further illustrating that TLR3 signaling is a decisive regulator of MSC-induced cytotoxicity. A key strength of this work lies in the comprehensive profiling of EMT and metastasis-associated gene expression. Naïve MSCs produced a mixed EMT response, increasing both epithelial (CDH1, CLDN1) and mesenchymal (VIM) markers, reflecting the complex, dualistic nature of MSC interactions within the PDAC microenvironment. Notably, TLR3-activated MSCs promoted epithelial stabilization, increasing CDH1 and CLDN1 expression while reducing CD44 and ZEB1, consistent with reduced invasive potential. Conversely, TLR3-inhibited MSCs favored a mesenchymal/invasive phenotype, upregulating VIM and PLAU, indicating that anti-inflammatory MSC phenotypes may inadvertently enhance tumor plasticity and invasion. Suppression of MMP2 and MMP9 by MSCs—especially T3 + MSC—further supports an anti-invasive role, aligning with previous studies reporting MSC-mediated regulation of ECM remodeling enzymes in pancreatic cancer [ 12 ]. Colony formation assays corroborated these findings: MSCs reduced clonogenicity, and TLR3 activation enhanced this inhibitory effect, while TLR3 inhibition partially restored colony-forming potential. Together, these findings support a model in which TLR3 signaling governs the paracrine regulatory axis through which MSCs influence PDAC progression. The strong suppressive effects observed in our study—where TLR3 activation drove a pro-inflammatory MSC phenotype that markedly reduced Panc-1 cell proliferation, enhanced apoptosis, and diminished colony formation—are consistent with the findings of Wang et al., who demonstrated that Poly(I:C)-primed MSCs acquire enhanced antitumor capacity through increased secretion of IL-6, CXCL10, and CCL5, thereby generating a more robust immunostimulatory and antitumor microenvironment [ 30 ]. This parallel supports the notion that TLR3-mediated inflammatory priming represents a key mechanism by which MSCs strengthen their paracrine antitumor activity. Similarly, the enhanced antitumor effects observed in our TLR3-activated MSC group align with the findings of Sun et al., who demonstrated that TLR3-stimulated MSCs release small extracellular vesicles with a more immunostimulatory profile, capable of suppressing tumor cell proliferation and colony formation while promoting CD8⁺ T-cell activation and NK-cell cytotoxicity. These results support the interpretation that TLR3 activation not only reshapes MSC immunobiology but also amplifies their paracrine antitumor signaling , thereby strengthening their therapeutic potential against pancreatic cancer [ 31 ]. Overall, this study provides the first mechanistic evidence that TLR3-mediated polarization of ADMSCs significantly alters their secretome-driven effects on Panc-1 cancer cells, shaping viability, proliferation, apoptosis, EMT dynamics, ECM remodeling, and metastatic potential. The data highlight the therapeutic relevance of controlled TLR3 activation to potentiate the antitumor properties of MSCs. Given that MSC-based stromal modulation strategies are increasingly regarded as promising adjunct therapies in PDAC, these findings contribute to establishing rational approaches for engineering MSC phenotypes to enhance antitumor efficacy. Future studies should focus on proteomic mapping of polarized MSC secretomes, exosome-mediated communication, and in vivo validation to extend these mechanistic insights toward potential translational applications. Declarations Competing Interests and Funding The authors declare that they have no competing interests. This work was supported by the Scientific and Technological Research Council of Turkey (TÜBİTAK), Grant No.124S740 Author Contribution The authors have accepted responsibility for the entire content of this manuscript and approved its submission.Concept – D.K. and S.Y. ; Supervision – A.Y.; Materials –D.K. and S.Y. ; Data Collection and/or Processing – D.K., A.Y. and Z.T.; Analysis and/or Interpretation – D.K. and Z.T.; Writing –D.K. and S.Y. References Y. Sunami, J. Häußler, J. Klee, Cellular heterogeneity of pancreatic stellate cells, mesenchymal stem cells, and cancer-associated fibroblasts in pancreatic cancer. Cancers. 12 , 3770 (2020) R.M. Carr, M.E. Fernandez-Zapico, Pancreatic cancer microenvironment, to target or not to target? EMBO Mol. Med. 8 , 80–82 (2016) C. Feig et al., The pancreas cancer microenvironment. Clin. Cancer Res. 18 , 4266–4276 (2012) D. Hanahan, R.A. Weinberg, Hallmarks of cancer: the next generation. Cell. 144 , 646–674 (2011) M.R. Junttila, De F.J. Sauvage, Influence of tumour micro-environment heterogeneity on therapeutic response. Nature. 501 , 346–354 (2013) T. Murakami et al., Role of the tumor microenvironment in pancreatic cancer. Ann. Gastroenterol. Surg. 3 , 130–137 (2019) I. Pountos, P.V. Giannoudis, Biology of mesenchymal stem cells. Injury. 36 (Suppl 3), S8–S12 (2005) R. Berebichez-Fridman, P.R. Montero-Olvera, Sources and clinical applications of mesenchymal stem cells. Sultan Qaboos Univ. Med. J. 18 , e264–e277 (2018) M. Strioga, S. Viswanathan, A. Darinskas, O. Slaby, J. Michalek, Comparison of adipose tissue-derived versus bone marrow-derived mesenchymal stem cells. Stem Cells Dev. 21 , 2724–2752 (2012) Y. Zhou, Y. Yamamoto, Z. Xiao, T. Ochiya, The immunomodulatory functions of mesenchymal stromal/stem cells. J. Clin. Med. 8 , 1025 (2019) F. Rahmatizadeh et al., Bidirectional and opposite effects of naïve mesenchymal stem cells on tumor progression. Adv. Pharm. Bull. 9 , 539–547 (2019) K. Saito et al., Stromal mesenchymal stem cells facilitate pancreatic cancer progression. J. Cancer. 9 , 2916–2929 (2018) T. Okumura et al., Adipose tissue-derived stromal cells enhance tumor progression by dense collagen matrix. Int. J. Cancer. 144 , 1401–1413 (2019) Y. Chen, J. Lin, Y. Zhao, X. Ma, H. Yi, TLR3 regulation mechanisms and innate immune responses. J. Zhejiang Univ. Sci. B 22 , 609–632 (2021) H.R. Frederiksen, H. Haukedal, K. Freude, Cell type specific expression of Toll-like receptors in human brains. Biomed. Res. Int. 2019, 7420189 (2019) R.S. Waterman, S.L. Henkle, A.M. Betancourt, MSC1 vs. MSC2 polarization and tumor effects. PLoS One. 7 , e45590 (2012) R.S. Waterman et al., Polarization into pro-inflammatory MSC1 or immunosuppressive MSC2 phenotype. PLoS One 5 , e10088 (2010) F. Eskandari et al., TLR3 stimulation improves MSC migration in melanoma model. Mol. Biol. Rep. 50 , 2293–2304 (2023) C.M. Rivera-Cruz, M.L. Figueiredo, TLR3 priming of adipose-derived MSCs and prostate cancer interactions. Cytotherapy. 25 , 33–45 (2023) S. Yaylacı, D. Kaçaroğlu, Ö. Hürkal, A.M. Ulaşlı, An enzyme-free technique enables the isolation of a large number of adipose-derived stem cells at the bedside. Sci. Rep. 13 , 1–14 (2023) D. Kaçaroğlu, S. Yaylacı, Enhancing the regenerative potential of adipose-derived mesenchymal stem cells through TLR4-mediated signaling. Curr. Stem Cell. Res. Ther. (2024) D. Kaçaroğlu, G.D. Kalaycıoğlu, A.K. Özden, Carthamus tinctorius extracts inhibit expression of metastatic genes of MDA-MB-231 breast cancer cells. Cell. Mol. Biol. 69 , 19–25 (2023) D. Kaçaroğlu, S. Yaylacı, N. Gurbuz, Anti-tumorigenic effects of naïve and TLR4-primed adipose-derived mesenchymal stem cells on PDAC cells. Cancer Med. 13 , e6964 (2024) D. Kaçaroğlu, S. Yaylacı, A.M. Ulaşlı, Dual facets of MSC-derived small extracellular vesicles: regulatory insights into antitumor mechanisms in PDAC. Med. Oncol. 42 , 158 (2025) M. Dominici, Le K. Blanc, I. Mueller et al., Minimal criteria for defining multipotent mesenchymal stromal cells. Cytotherapy. 8 , 315–317 (2006) B. Cousin, E. Ravet, S. Poglio et al., Adult stromal cells derived from adipose tissue provoke pancreatic cancer cell death in vitro and in vivo. PLoS One 4 , e6278 (2009) C. Doi, D.K. Maurya, M.M. Pyle, D. Troyer, M. Tamura, Umbilical cord matrix stem cells attenuate growth of pancreatic cancer and increase survival in mice. Cytotherapy. 12 , 408–417 (2010) P. Barcellos-de-Souza, V. Gori, F. Bambi, P. Chiarugi, Tumor microenvironment: bone marrow–mesenchymal stem cells as key players. Biochim. Biophys. Acta Rev. Cancer. 1836 , 321–335 (2013) Y.C. Chen, Y.W. Lan, S.M. Huang et al., Human amniotic fluid mesenchymal stem cells attenuate pancreatic cancer cell proliferation and tumor growth. Stem Cell. Res. Ther. 13 , 1–17 (2022) G. Wang et al., Poly(I:C)-priming enhances the antitumor activity of mesenchymal stem cells through inflammatory polarization. Theranostics. 10 , 3681–3696 (2020) L. Sun et al., TLR3-activated MSC-derived extracellular vesicles modulate the tumor immune microenvironment and suppress tumor progression. Theranostics. 12 , 1236–1253 (2022) Additional Declarations No competing interests reported. Supplementary Files graphabtract.jpg Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8384537","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":561703004,"identity":"681f1959-164a-4764-87bf-40833ae2e431","order_by":0,"name":"Demet Kaçaroğlu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABVklEQVRIie3QPUvDQBgH8CcEksFLu16ptl/hQsClSL5KQvGyWHAq2RSE62Cla138DCmF6hg5qEtS15QKWoRuhQwOcSh4aVVMo86C+S/P3T387g2gSJE/GHNTrPfpMdRKoKQjH7CcViVH9NN1+4MQMJQcQVlC/C1is08CP5C7c/s5Blovd8L5/IVwh6ns0Hu9eahVOjsWxG0OZtXPkCAcipOO9H7gGMYu4S2GxuPpRbAwqrLmSf0JB1SyMiRqjbAPruQBVao4Jdhhkca4fSWILAaAsjcjj8vrRBDTKy/WxFEEma4YP1mT1Tck0kbiqUe2h6lSiQm3FEzHM7G5lV5MlvJE77aGOCC02Y8WsgHE0cVb6GyPcf3yTPNuuxMHoSBDTDUcxK7bPOj1qDRP3Ea9rLL96ZLxOr4PB09Ju1FTu5AP2RQZbTfS380tfo2U/NYtUqRIkX+bN8MyfEGSSFUCAAAAAElFTkSuQmCC","orcid":"","institution":"Lokman Hekim Üniversitesi","correspondingAuthor":true,"prefix":"","firstName":"Demet","middleName":"","lastName":"Kaçaroğlu","suffix":""},{"id":561703005,"identity":"ebc0a644-d1cd-4e71-acc2-394f81ce9b50","order_by":1,"name":"Ayşegül Yılmaz","email":"","orcid":"","institution":"Lokman Hekim Üniversitesi","correspondingAuthor":false,"prefix":"","firstName":"Ayşegül","middleName":"","lastName":"Yılmaz","suffix":""},{"id":561703006,"identity":"b0402ffa-333c-4c75-aa57-7ec32712b397","order_by":2,"name":"Züleyha Taş","email":"","orcid":"","institution":"Hacettepe University","correspondingAuthor":false,"prefix":"","firstName":"Züleyha","middleName":"","lastName":"Taş","suffix":""},{"id":561703008,"identity":"34022772-34b7-4bcb-bdac-97fc758442f5","order_by":3,"name":"Seher Yaylacı","email":"","orcid":"","institution":"Lokman Hekim Üniversitesi","correspondingAuthor":false,"prefix":"","firstName":"Seher","middleName":"","lastName":"Yaylacı","suffix":""}],"badges":[],"createdAt":"2025-12-17 10:23:37","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8384537/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8384537/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":98623513,"identity":"d074b023-365e-42b3-9645-ff61d30bcb4a","added_by":"auto","created_at":"2025-12-19 17:06:45","extension":"json","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6434,"visible":true,"origin":"","legend":"","description":"","filename":"e6803f34664d4ce88fe9d5aaab857007.json","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/2b996e1a771bed4b0f2c9149.json"},{"id":98492703,"identity":"dbb3df86-01dc-405d-8644-78e2eaf42e71","added_by":"auto","created_at":"2025-12-18 08:20:37","extension":"xml","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":98824,"visible":true,"origin":"","legend":"","description":"","filename":"e6803f34664d4ce88fe9d5aaab8570071enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/7d2632d5d2238a9d296ddde6.xml"},{"id":98492702,"identity":"1912d4bc-eb8c-41f2-a796-c485a43edd78","added_by":"auto","created_at":"2025-12-18 08:20:37","extension":"jpg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":299106,"visible":true,"origin":"","legend":"","description":"","filename":"FIGURE1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/a325200c3a288ff5b88b43a4.jpg"},{"id":98624424,"identity":"bdf2e331-1973-4688-8b84-c00e7c765a73","added_by":"auto","created_at":"2025-12-19 17:08:24","extension":"jpg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":135290,"visible":true,"origin":"","legend":"","description":"","filename":"FIGURE2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/960296081e7f57c097e34c99.jpg"},{"id":98624044,"identity":"772e9975-078c-4dc5-874d-cdde77bad368","added_by":"auto","created_at":"2025-12-19 17:07:56","extension":"jpg","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":115725,"visible":true,"origin":"","legend":"","description":"","filename":"FIGURE3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/57da37d7c44f64f11c75b81c.jpg"},{"id":98623910,"identity":"7639dcd8-9735-4de1-aabb-7d023519ebd1","added_by":"auto","created_at":"2025-12-19 17:07:47","extension":"jpg","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":479023,"visible":true,"origin":"","legend":"","description":"","filename":"FIGURE4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/f21ec0a894460a499076d289.jpg"},{"id":98625348,"identity":"41f559b2-a4f0-4800-bcf5-37d53e69bcf3","added_by":"auto","created_at":"2025-12-19 17:09:03","extension":"jpg","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":199198,"visible":true,"origin":"","legend":"","description":"","filename":"FIGURE5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/e8e466af25b64543c4714512.jpg"},{"id":98624350,"identity":"8baa0b50-1167-49e3-9173-020e086544e3","added_by":"auto","created_at":"2025-12-19 17:08:20","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":734534,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/8c4446cef672be8ffc529bcc.png"},{"id":98492724,"identity":"26589348-fb05-4b0f-8f70-042c9201bbee","added_by":"auto","created_at":"2025-12-18 08:20:38","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":69030,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/d8462788ef8176413381dba1.png"},{"id":98492705,"identity":"63c6ac6b-5979-4574-bcd6-43eb7e77ec7b","added_by":"auto","created_at":"2025-12-18 08:20:37","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":189327,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/46981f786910a39a9f6f31ad.png"},{"id":98624852,"identity":"9487b3d1-9b09-4bcb-a40d-cd00320b974e","added_by":"auto","created_at":"2025-12-19 17:08:46","extension":"jpeg","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":936520,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/c2c442903a8711404a203047.jpeg"},{"id":98624369,"identity":"582a1d54-2cff-4235-ad0c-d12d03496cf1","added_by":"auto","created_at":"2025-12-19 17:08:22","extension":"jpeg","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":684694,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/de35293a267d5d898cb52e21.jpeg"},{"id":98625152,"identity":"eb7f066c-7604-46ff-b8d5-83885f4f561d","added_by":"auto","created_at":"2025-12-19 17:08:58","extension":"jpg","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":122755,"visible":true,"origin":"","legend":"","description":"","filename":"graphabtract.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/54931d7da789259b90b1a760.jpg"},{"id":98492726,"identity":"6182213d-5818-4a1c-ab8b-5630d82795de","added_by":"auto","created_at":"2025-12-18 08:20:38","extension":"png","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":148075,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFIGURE1.png","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/6468634baa3acd16ed4e2180.png"},{"id":98624722,"identity":"d840ae40-0ea9-4a1c-8fc6-fb2e5e18f5de","added_by":"auto","created_at":"2025-12-19 17:08:40","extension":"png","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":36420,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFIGURE2.png","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/dfe3de8ad2a7d8ad4d74db17.png"},{"id":98492728,"identity":"6d04282f-b2bb-4ae4-8f42-13345009ef5e","added_by":"auto","created_at":"2025-12-18 08:20:38","extension":"png","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":42139,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFIGURE3.png","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/d8f2846ab6fe6c949be97dc3.png"},{"id":98492710,"identity":"c786a21e-960e-4ae9-bd67-a4ee512e3758","added_by":"auto","created_at":"2025-12-18 08:20:37","extension":"png","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":257349,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFIGURE4.png","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/3d5bd4e531a872fa4782eb80.png"},{"id":98492718,"identity":"73b49e8c-77fb-4dd3-ad41-ded872c50553","added_by":"auto","created_at":"2025-12-18 08:20:37","extension":"png","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":86489,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFIGURE5.png","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/9c86798b657c431b78a6f9cd.png"},{"id":98492711,"identity":"fdf7e744-72c1-4ded-9572-3795bb46abae","added_by":"auto","created_at":"2025-12-18 08:20:37","extension":"png","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":131845,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/2fc7a1d49ff0d9bae07c2d8b.png"},{"id":98624514,"identity":"7316d882-791f-42bc-bfba-c20bafd99cbc","added_by":"auto","created_at":"2025-12-19 17:08:29","extension":"png","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":33119,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/b02df3ff7e130b1fbdd85cb2.png"},{"id":98492715,"identity":"196ba920-57d3-4c3a-bed3-9bdfd399bd01","added_by":"auto","created_at":"2025-12-18 08:20:37","extension":"png","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":34862,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/5d6f98035af57924fe85ffe3.png"},{"id":98624843,"identity":"57bedaf3-300b-413f-b34f-79a64b55d407","added_by":"auto","created_at":"2025-12-19 17:08:45","extension":"png","order_by":28,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":253185,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/8e88c669c4a78542557e23eb.png"},{"id":98492720,"identity":"00c4bb37-458c-47a7-b2b2-6881a759a77e","added_by":"auto","created_at":"2025-12-18 08:20:38","extension":"png","order_by":29,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":167140,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/15f43070d4e9d867f2c1caef.png"},{"id":98624561,"identity":"f45b435d-045c-456f-ac94-773cf99ba764","added_by":"auto","created_at":"2025-12-19 17:08:30","extension":"png","order_by":30,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":57423,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinegraphabtract.png","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/456307991e213eb6d5c28d6a.png"},{"id":98492716,"identity":"e07cc800-6498-4f12-80ee-7483cbf21ab0","added_by":"auto","created_at":"2025-12-18 08:20:37","extension":"xml","order_by":31,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":97855,"visible":true,"origin":"","legend":"","description":"","filename":"e6803f34664d4ce88fe9d5aaab8570071structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/01e4c911c11bf59440b1e4c1.xml"},{"id":98492719,"identity":"6f573cfb-ce43-41d7-a5da-56422e9f829a","added_by":"auto","created_at":"2025-12-18 08:20:38","extension":"html","order_by":32,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":104961,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/ab62cacc09a97f52d7e17966.html"},{"id":98624523,"identity":"1d2fbc61-48a6-4b6e-9b6c-607d72f97e6c","added_by":"auto","created_at":"2025-12-19 17:08:29","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":299106,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eADMSC Morphology and Flow Cytometric Characterization. \u003c/strong\u003ePhase-contrast images showing typical spindle-shaped, fibroblast-like ADMSC morphology at 5× and 10× magnification (a). Flow cytometry profile of ADMSCs (b). A total of 45,686 events were acquired, with 91.4% of cells within the MSC gate. Cells were negative for the hematopoietic lineage cocktail and strongly positive for CD73, CD90, and CD105.\u003c/p\u003e","description":"","filename":"FIGURE1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/245efe2c4b400c2209c5e0dc.jpg"},{"id":98492696,"identity":"08c9f4a3-d3a4-4627-8fa8-7490095504a8","added_by":"auto","created_at":"2025-12-18 08:20:37","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":135290,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of TLR3 Agonist and Antagonist on Viability and Inflammatory Gene Expression in ADMSCs. \u003c/strong\u003eCell viability of ADMSCs treated with increasing concentrations of the TLR3 agonist and antagonist for 24 h and 48 h, showing dose-dependent and opposite effects on metabolic activity (n = 3, mean ± SD) (a). Relative mRNA expression levels of TGFB1, IL10, IL6, and TNFA following treatment with the TLR3 agonist (b). Relative mRNA expression levels of the same genes following treatment with the TLR3 antagonist (c). Gene expression values were normalized to GAPDH and presented as mean ± SD (n = 3). Statistical significance: *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001, ****p \u0026lt; 0.0001, ns: not significant.\u003c/p\u003e","description":"","filename":"FIGURE2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/2868578e76f9dfcf896bcc9c.jpg"},{"id":98492697,"identity":"2930905f-8b42-4c2a-8aaf-77ce86ebc6ff","added_by":"auto","created_at":"2025-12-18 08:20:37","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":115725,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of MSC, TLR3-activated MSCs (T3+MSC), and TLR3-inhibited MSCs (T3–MSC) on Panc-1 viability and proliferation. \u003c/strong\u003ePanc-1 cell viability at 24 h following co-culture with MSC, T3+MSC, or T3–MSC at MSC:Panc-1 ratios of 10:1, 1:1, and 1:10 (mean ± SD, n=3) (a). Panc-1 viability at 72 h under identical co-culture conditions, demonstrating ratio-dependent suppression by MSCs and enhanced inhibition under TLR3 activation, while TLR3 blockade attenuated MSC-mediated effects (mean ± SD, n=3) (b) . Panc-1 proliferation at 72 h in the 10:1 condition, showing strong inhibitory effects of MSC and T3+MSC, with T3–MSC maintaining proliferation near control levels (mean ± SD, n=3) (c ). Representative fluorescence images of Panc-1 cells co-cultured with MSC, T3+MSC, and T3–MSC at the 10:1 ratio (10× magnification) (d) . Scale bar: 200 µm. Statistical significance: *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001, ****p \u0026lt; 0.0001, ns: not significant.\u003c/p\u003e","description":"","filename":"FIGURE3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/f72409de56a4d3953070fbf5.jpg"},{"id":98492699,"identity":"3d3733f5-23e5-4f53-8ec7-ee99abade000","added_by":"auto","created_at":"2025-12-18 08:20:37","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":479023,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of MSC Co-culture and TLR3 Modulation on Cell Cycle and Apoptosis in Panc-1 Cells. (a)\u003c/strong\u003eQuantitative analysis of cell cycle phase distribution (S, G2, G1 and Super-G2) in Panc-1 cells cultured alone or co-cultured with MSCs, T3+MSC, or T3–MSC. Co-culture with MSCs and T3+MSC increased S-phase and G1-phase fractions while significantly reducing the G2-phase population. Representative cell cycle histograms for each experimental group, showing phase segmentation profiles \u003cstrong\u003e(b)\u003c/strong\u003e. Flow cytometry–based quantification of live, early apoptotic, late apoptotic, and necrotic Panc-1 cells under the same culture conditions. MSCs and particularly T3+MSC reduced viability and increased apoptotic fractions, whereas T3–MSC maintained levels similar to control \u003cstrong\u003e(c)\u003c/strong\u003e. Dot-plot representations of apoptosis quadrants (live, early apoptotic, late apoptotic, and necrotic) corresponding to each treatment group \u003cstrong\u003e(d)\u003c/strong\u003e. Statistical significance: *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001, ****p \u0026lt; 0.0001, ns: not significant.\u003c/p\u003e","description":"","filename":"FIGURE4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/44cdb4126eb8de7252aa7aed.jpg"},{"id":98624886,"identity":"9a9a6791-efea-446d-a1ac-77f83aaed534","added_by":"auto","created_at":"2025-12-19 17:08:47","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":199198,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of MSC Co-culture and TLR3 Modulation on Panc-1 Cells\u003cbr\u003e\n \u003c/strong\u003e\u0026nbsp;(a) Relative mRNA expression of epithelial–mesenchymal transition (EMT) and adhesion-related genes (CD44, CDH1, CLDN1, VIM, ZEB1) in Panc-1 cells following co-culture with MSCs, T3+MSC, and T3–MSC. Expression levels were normalized to GAPDH. (b) Relative expression of genes associated with extracellular matrix remodeling and invasion (MMP9, MMP2, TIMP1, VEGFR2, and PLAU) under the same experimental conditions. (c) Quantitative analysis of colony formation capacity (CFU assay, OD₅₅₅ nm) after 14 days of co-culture at a MSC:Panc-1= 10:1. (d) Representative crystal violet-stained CFU images showing colony density and morphology of Panc-1 cells cultured alone or with MSC, T3+MSC, and T3–MSC. (e) Immunohistochemical staining of CD44, Vimentin, and E-cadherin in Panc-1 cells under different co-culture conditions, demonstrating differential expression of epithelial and mesenchymal markers. Data are presented as mean ± SD from three independent experiments. Statistical significance: *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001, ****p \u0026lt; 0.0001, ns = not significant.\u003c/p\u003e","description":"","filename":"FIGURE5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/458a88664724036e305b34cd.jpg"},{"id":98774892,"identity":"12da0096-3285-474c-9c97-e9c0f91e8808","added_by":"auto","created_at":"2025-12-22 12:16:18","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2492695,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/33e70ccd-e62a-42d9-b88c-199bed9d0cde.pdf"},{"id":98492698,"identity":"5ab9eeaf-53b2-44c2-a472-c8b98cbb58cb","added_by":"auto","created_at":"2025-12-18 08:20:37","extension":"jpg","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":122755,"visible":true,"origin":"","legend":"","description":"","filename":"graphabtract.jpg","url":"https://assets-eu.researchsquare.com/files/rs-8384537/v1/024be8fd1ba9d076e6d53e6f.jpg"}],"financialInterests":"No competing interests reported.","formattedTitle":"TLR3-Dependent Polarization of Adipose-Derived Mesenchymal Stem Cells Regulates Pancreatic Cancer Cell Behavior in an Indirect Co-culture Model","fulltext":[{"header":"Introduction","content":"\u003cp\u003ePancreatic cancer is one of the most lethal malignancies worldwide and is projected to become the second leading cause of cancer-related mortality by 2030 due to its aggressive nature, late diagnosis, and resistance to standard therapies [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The dense desmoplastic tumor microenvironment (TME) is a major contributor to this therapeutic resistance and has emerged as a key target for new treatment approaches [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The pancreatic TME consists of cancer cells, extracellular matrix (ECM), and various stromal populations that collectively regulate tumor initiation, invasion, metastasis, chemoresistance, and immune escape [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Under pathological conditions, stromal cells undergo functional reprogramming and begin secreting cytokines, chemokines, growth factors, and proteases that support tumor progression [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Among stromal components, cancer-associated fibroblasts (CAFs), frequently derived from mesenchymal stem cells (MSCs), play central roles in ECM remodeling, angiogenesis, and tumor\u0026ndash;immune interactions [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Understanding the dynamic interplay between pancreatic cancer cells and stromal components is therefore essential for developing new therapeutic strategies.\u003c/p\u003e \u003cp\u003eMesenchymal stem cells are multipotent stromal cells with regenerative and immunomodulatory capacities, isolated from various tissues including bone marrow, adipose tissue, and umbilical cord [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Adipose-derived MSCs (ADMSCs) are particularly attractive owing to minimally invasive isolation, high yield, and strong applicability in research and clinical practice [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. However, their effects on tumor cells are highly context-dependent: MSCs may suppress tumor proliferation and induce apoptosis, or conversely support tumor growth and metastasis through paracrine signaling [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. In pancreatic cancer, MSCs have been shown to affect ECM remodeling, collagen deposition, and MMP expression, thereby influencing tumor stiffness, invasion, and metastatic behavior [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eToll-like receptors (TLRs) are key regulators of MSC function. MSCs express several TLRs -including TLR3 which recognizes double-stranded RNA and activates NF-κB and IRF3 signaling, shaping cytokine release and inflammatory behavior [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. TLR stimulation can polarize MSCs into distinct functional phenotypes with divergent effects on tumor progression. For instance, TLR4-activated MSCs often display antitumor activity, whereas TLR3-stimulated MSCs may enhance colony formation or alter migration depending on the model [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. TLR3 activation has also been linked to increased MSC migration in vivo and context-dependent modulation of tumor growth [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. These findings suggest that TLR3-driven MSC polarization may critically influence tumor-stroma interactions, although this mechanism remains poorly defined in pancreatic cancer.\u003c/p\u003e \u003cp\u003eGiven these gaps, the present study investigates how pharmacological activation or inhibition of TLR3 modulates the inflammatory phenotype of ADMSCs and how these polarized MSCs regulate Panc-1 pancreatic cancer cell behavior in an indirect co-culture model. In this study, Panc-1 cells, derived from the most common and aggressive form of PDAC, were used as the cancer model. ADMSCs were treated with a TLR3 agonist or antagonist according to established protocols to determine optimal concentration and exposure conditions. These MSC, TLR3-activated MSC, and TLR3-inhibited MSC groups were then introduced into indirect co-culture systems at three different MSC:Panc-1 ratios (1:10, 1:1, and 10:1), and cell viability was assessed at 24 and 72 hours. The most effective ratio, MSC:Panc-1\u0026thinsp;=\u0026thinsp;10:1, was further used to examine proliferation, apoptosis, cell cycle dynamics, colony-forming ability, EMT markers, and metastasis-related gene expression. Based on the current literature, this study provides new mechanistic and molecular insights into the effects of TLR3-modulated ADMSCs on pancreatic cancer cells. Given the highly aggressive and therapy-resistant nature of pancreatic cancer, understanding stromal interactions is of critical importance. This study provides meaningful insight into the functional role of MSCs within the pancreatic tumor microenvironment and contributes to the development of future MSC-based therapeutic strategies.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCulture and Characterization of Adipose Tissue Derived Mesenchymal Stem Cells\u003c/h2\u003e \u003cp\u003eCommercially available adipose-derived mesenchymal stem cells (AD-MSCs; ATCC No: PCS-500-011\u0026trade;) were cultured in Dulbecco\u0026rsquo;s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12; Capricorn, Germany) supplemented with 20% fetal bovine serum (FBS; Capricorn, Germany), 2 mM L-glutamine (Sigma-Aldrich), and 1% antibiotic-antimycotic solution (BIOIND, Israel). Cells were maintained at 37\u0026deg;C in a humidified incubator with 5% CO₂, and the medium was refreshed until reaching 70\u0026ndash;80% confluency. A total of 50,000 cells were harvested using a cell scraper and centrifuged at 1000 \u0026times; g for 5 min. The pellet was stained using the MSC Marker Verification Kit (R\u0026amp;D Systems, Cat. #FMC020). Cells were incubated with 10 \u0026micro;L each of positive antibodies (anti-CD90, anti-CD105, anti-CD73) and a negative cocktail (anti-CD45, anti-CD34, anti-CD11b, anti-HLA-DR, and anti-CD79) along with an isotype control for 45 min at room temperature in the dark. After washing with staining buffer, cells were centrifuged and resuspended in 100 \u0026micro;L buffer for flow cytometric analysis. Fluorescence data were acquired using a BD flow cytometer and analyzed with CellQuest Pro software (BD Biosciences, San Jose, CA). The percentages of CD90⁺, CD73⁺, and CD105⁺ cells were determined relative to isotype controls [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003ePreparation of TLR3 Agonist/Antagonist and MTT Assay for Evaluation of Cell Viability\u003c/h3\u003e\n\u003cp\u003eThe TLR3 agonist Poly(A:U) (InvivoGen, Cat. No. tlrl-pau, 10 mg) and the TLR3 antagonist CU-CPT4a (Cayman Chemical, Cat. No. 30951, 1 mg) were obtained commercially. Prior to application, the agonist was dissolved in physiological water at a concentration of 10 mg/mL, and the antagonist was prepared in DMSO at a concentration of 1 mg/mL, according to the manufacturers\u0026rsquo; recommendations. Working concentrations used in the experiments were obtained by diluting the stock solutions with the cell culture medium to the desired final concentrations. To assess the effects of TLR3 signaling on cell viability, ADMSC were seeded into 96-well plates at a density of 3,000 cells per well. Five different concentrations (0.01, 0.1, 1, 10, and 100 \u0026micro;g/mL) of the TLR3 agonist and antagonist were applied. Cell viability was evaluated at 24 and 48 hours post-treatment using the MTT assay. At the end of each incubation period, 10 \u0026micro;L of MTT solution (final concentration: 0.5 mg/mL) and 90 \u0026micro;L of fresh DMEM were added to each well. The plates were incubated for 4 hours at 37\u0026deg;C in a humidified atmosphere containing 5% CO₂, protected from light, to allow for formazan crystal formation. Following incubation, 100 \u0026micro;L of DMSO was added to each well to dissolve the formazan crystals, and the contents were mixed thoroughly by pipetting. Absorbance values were measured at 570 nm using a microplate reader (BioTek Synergy H1, BioTek Instruments, Winooski, VT, USA). The optical density (OD) readings were normalized to control groups, and cell viability percentages were calculated accordingly [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e\n\u003ch3\u003eGene Expression Analysis Following TLR3 Agonist and Antagonist Treatment\u003c/h3\u003e\n\u003cp\u003eADMSCs were seeded into 24-well culture plates at a density of 5 \u0026times; 10⁴ cells per well and incubated for 24 hours to allow surface attachment. Each experimental group was plated in six wells. After incubation, cells were washed twice with phosphate-buffered saline (PBS) and experimental treatments were initiated. For TLR3 modulation, AD-MSCs were treated with the TLR3 agonist at concentrations of 0.1, 1, 5, and 10 \u0026micro;g/mL, and with the TLR3 antagonist at 0.01, 0.1, 0.5, and 1 \u0026micro;g/mL for 24 hours. Total RNA was isolated using TRIzol reagent (ABP Bioscience, Wuhan, China) according to the manufacturer\u0026rsquo;s instructions. Gene expression analysis was performed to evaluate the expression levels of \u003cem\u003eIL-6\u003c/em\u003e, \u003cem\u003eIL-10\u003c/em\u003e, \u003cem\u003eTGF-β\u003c/em\u003e, and \u003cem\u003eTNF-α\u003c/em\u003e in relation to TLR3 agonist and antagonist concentrations, compared to the untreated control group. Quantitative real-time PCR (qPCR) analyses were carried out using the LightCycler\u0026reg; 96 System (Roche, Germany) with A.B.T.\u0026trade; 2X qPCR SYBR-Green Master Mix (ATLAS Biotechnology, T\u0026uuml;rkiye). GAPDH was used as the reference gene, and specific primer pairs were employed for each target gene (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Each 20 \u0026micro;L qPCR reaction consisted of 10 \u0026micro;L SYBR Green Master Mix, 7 \u0026micro;L nuclease-free water, 0.5 \u0026micro;L forward primer, 0.5 \u0026micro;L reverse primer, and 2 \u0026micro;L RNA sample. The reactions were loaded into strip tubes and run on the LightCycler\u0026reg; 96 instrument following the manufacturer\u0026rsquo;s recommended program for cDNA synthesis and qPCR cycling. The annealing step of the qPCR reaction was set at 60\u0026deg;C. All reactions were performed in triplicate. The qPCR data were analyzed using the LightCycler\u0026reg; 96 software. The mean threshold cycle values were calculated for each sample and normalized to \u003cem\u003eGAPDH\u003c/em\u003e. Relative gene expression levels were quantified using the 2^\u0026minus;ΔΔCt method [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e].\u003c/p\u003e\n\u003ch3\u003eCulture of Panc-1 Cells and Establishment of Indirect Co-Culture with ADMSCs\u003c/h3\u003e\n\u003cp\u003eTo evaluate the effects of AD-MSCs on pancreatic cancer cell viability and to investigate the potential impact of TLR3 agonist and antagonist, an indirect co-culture experiment was established. Panc-1 cells (ATCC\u0026reg; CRL-1469\u0026trade;) were obtained commercially and cultured in complete DMEM supplemented with 10% FBS, 1% L-glutamine, and 1% antibiotic-antimycotic solution. Panc-1 cells were seeded in 24-well plates for co-culture with ADMSCs at ratios of 10:1, 1:1, and 1:10. To allow paracrine interactions without direct cell contact, transwell inserts with 0.4 \u0026micro;m pore membranes (NEST, Cat. No. 725101) were used. Panc-1 cells were first plated in the wells and incubated to allow attachment: 3,000 cells per well for 1:10 and 1:1 ratios, and 30,000 cells per well for the 10:1 ratio. Simultaneously, ADMSCs were seeded on the bottom of transwell inserts: 30,000 cells per insert for 1:1 and 10:1 ratios, and 3,000 cells per insert for the 1:10 ratio, followed by 24 hours of incubation. Each experimental group was performed in triplicate. After the incubation period, the polarization medium was removed, and inserts containing control ADMSCs, TLR3 agonist-treated ADMSCs, or TLR3 antagonist-treated ADMSCs were placed into wells containing Panc-1 cells. Co-cultures were maintained for 24 and 72 hours, after which samples were collected for downstream analyses.\u003c/p\u003e\n\u003ch3\u003eCell Viability Analysis of Panc-1 Cells in the Indirect Co-Culture Model\u003c/h3\u003e\n\u003cp\u003eThis experiment was performed to compare the viability of Panc-1 cells co-cultured with ADMSCs, TLR3 agonist-treated MSCs, and TLR3 antagonist-treated MSCs against control Panc-1 cells cultured alone. The cell viability assay was performed at three different co-culture ratios (10:1, 1:1, and 1:10) for 24 and 72 hours. After 24 and 72 hours of co-culture, MTT solution was added to each well to achieve a final concentration of 0.5 mg/mL, and the assay was carried out as described in the cell viability protocol. The obtained OD values were normalized by setting the OD of the control group containing only Panc-1 cells as 100%, and relative viability percentages of the other groups were calculated accordingly. The concentration showing the most pronounced reduction in viability was used as a reference for subsequent analyses [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eAnalyses Performed on Panc-1 Cells in the Indirect Co-Culture Model at MSC:Panc-1 Ratio of 10:1\u003c/h2\u003e \u003cp\u003eProliferation, apoptosis, cell cycle, colony formation, and ICC analyses were conducted using an indirect co-culture system at a MSC:Panc-1\u0026thinsp;=\u0026thinsp;10:1. ratio after 72 hours of incubation. Panc-1 cells were first seeded at 3,000 cells per well and incubated for 24 hours to allow attachment. Subsequently, MSCs from each experimental group (na\u0026iuml;ve, TLR3 agonist-treated, and TLR3 antagonist-treated) were seeded into the upper compartment of transwell inserts at 30,000 cells per insert, establishing the 10:1 co-culture ratio. After 72 hours of co-culture, Panc-1 cells were collected for downstream analyses.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003e● Proliferation Analysis of Panc-1 Cells Using Calcein AM Staining\u003c/h3\u003e\n\u003cp\u003eAt the end of the 72-hour indirect co-culture period conducted at an MSC:Panc-1\u0026thinsp;=\u0026thinsp;10:1, cells were prepared for proliferation analysis. Calcein AM solution (Cat. No: E-CK-A164) was diluted 1:1000 in PBS and added to the cells. The plates were incubated at 37\u0026deg;C for 20 minutes in the dark. Following incubation, fluorescent images were captured from three randomly selected fields per well using an inverted fluorescence microscope (Leica DM IL) with excitation at 490 nm and emission at 520 nm. The captured images were analyzed using NIH ImageJ software to quantify Panc-1 cells. The mean cell number for each group was calculated and expressed as a percentage relative to the untreated control group [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e\n\u003ch3\u003e● Apoptosis Analysis of Panc-1 Cells\u003c/h3\u003e\n\u003cp\u003eAfter 72 hours of co-culture, Panc-1 cells were harvested from the bottom of the wells and divided for flow cytometry analyses. For flow cytometry, cells were processed using the Annexin V Apoptosis Detection Kit (Tonbo Biosciences, Cat. No. 35-6410). Cell pellets were washed twice with cold PBS, resuspended in 100 \u0026micro;L PBS, and 5 \u0026micro;L each of Annexin V and propidium iodide were added, followed by 20 minutes of incubation at room temperature in the dark. Subsequently, 250 \u0026micro;L of Annexin V binding buffer was added, and samples were analyzed within 30 minutes using the NovoCyte flow cytometer. All analyses were performed in triplicate, and data were evaluated using NovoExpress Software (v1.6.1) to generate histograms representing the percentages of live, early apoptotic, late apoptotic, and necrotic Panc-1 cells [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e● Cell Cycle Analysis of Panc-1 Cells\u003c/h2\u003e \u003cp\u003eAt the end of the 72-hour co-culture period, Panc-1 cells in the lower wells were harvested and prepared for analysis according to the Cell Cycle Analysis Kit protocol (THOR-CCK-100, Thorvacs Biotechnology, Turkey). Cell suspensions were centrifuged at 1,000 \u0026times; g for 5 minutes to obtain a pellet, and cell counting was performed. For fixation, 70% ethanol was added to the pellet with vortexing, followed by centrifugation at 800 \u0026times; g for 5 minutes. Cells were washed twice with 1\u0026times; PBS and then incubated with 50 \u0026micro;L per sample of 1\u0026times; enzyme solution from the kit at 37\u0026deg;C for 15 minutes. Subsequently, 200 \u0026micro;L of 1\u0026times; propidium iodide (PI) staining solution was added to each sample, and the cells were incubated in the dark for 30 minutes. All analyses were performed in triplicate. Stained samples were analyzed using the NovoCyte flow cytometer, and cell cycle distribution data were evaluated with NovoExpress Software (v1.6.1) and presented as histograms [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e● Colony Formation Assay of Panc-1 Cells\u003c/h2\u003e \u003cp\u003eThis assay was performed to evaluate the effects of na\u0026iuml;ve MSCs, TLR3 agonist-treated MSCs, and TLR3 antagonist-treated MSCs on the colony-forming ability of Panc-1 cells. Panc-1 cells were seeded into 24-well plates at a density of 200 cells per well in triplicate. MSCs from each experimental group were placed into transwell inserts at a density of 2,000 cells per insert, and the co-cultures were incubated at 37\u0026deg;C for 14 days. At the end of the incubation period, cells were fixed with a methanol:acetic acid solution and stained with 0.5% (w/v) crystal violet. Colonies were visualized and counted using an inverted light microscope (Leica DM IL, Leica, Wetzlar, Germany). In addition, the absorbance of the stained colonies was measured at 595 nm using a spectrophotometer. Optical density (OD) values were normalized by setting the control Panc-1 monoculture group as 100%, and relative colony formation was calculated accordingly [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e\u0026bull; Gene Expression Analysis of Panc-1 Cells\u003c/h2\u003e \u003cp\u003eThis experiment was conducted to evaluate the effects of na\u0026iuml;ve MSCs, TLR3 agonist-treated MSCs (T3\u0026thinsp;+\u0026thinsp;MSCs), and TLR3 antagonist-treated MSCs (T3\u0026ndash;MSCs) on the gene expression profile of Panc-1 cells. Co-cultures were maintained for 72 hours, after which Panc-1 cells were collected using TRIzol reagent. Six-well culture plates with appropriate transwell inserts were used, with 50,000 Panc-1 cells seeded per well and 500,000 MSCs added per well (MSC:Panc-1\u0026thinsp;=\u0026thinsp;10:1). RNA was isolated from Panc-1 cells co-cultured with each MSC group.For qPCR analysis, primers specific for cancer stem cell marker (\u003cem\u003eCD44\u003c/em\u003e), epithelial markers (\u003cem\u003eE-Cadherin\u003c/em\u003e, \u003cem\u003eClaudin\u003c/em\u003e), mesenchymal markers (\u003cem\u003eVimentin\u003c/em\u003e, \u003cem\u003eZEB1\u003c/em\u003e), and metastasis-associated genes (\u003cem\u003eMMP-9\u003c/em\u003e, \u003cem\u003eMMP-2\u003c/em\u003e, \u003cem\u003eTIMP1\u003c/em\u003e, \u003cem\u003eVEGFR\u003c/em\u003e, \u003cem\u003euPA\u003c/em\u003e) were used (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). GAPDH was included as the reference gene. Single-step qPCR reactions were prepared using a SYBR Green master mix, 30 ng/\u0026micro;L RNA, nuclease-free water, and sense/antisense primers. Reaction mixtures were pipetted into 8-strip tubes, and all reactions were performed in triplicate. qPCR was conducted on a LightCycler\u0026reg; 96 instrument (Roche Diagnostics). Ct values were normalized to GAPDH, and relative gene expression levels were quantified using the 2^\u0026minus;ΔΔCt method [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e● Immunocytochemistry (ICC) of Panc-1 Cells\u003c/h2\u003e \u003cp\u003eThis analysis was performed to evaluate the effects of na\u0026iuml;ve MSCs, TLR3 agonist-treated MSCs, and TLR3 antagonist-treated MSCs on the protein expression of CD44, Vimentin, and E-cadherin in Panc-1 cells. For immunocytochemistry (ICC) staining, Panc-1 cells were cultured on 13 mm uncoated glass coverslips for 24 hours. After removing the medium, cells were fixed and permeabilized using 4% paraformaldehyde (SERVA, Germany) and 0.1% Triton X-100, and nonspecific binding was blocked with 1% bovine serum albumin. Cells were then incubated with primary antibodies\u0026mdash;CD44 (DF6392, Affinity Biosciences), E-cadherin (E-AB-31261, Elabscience), and Vimentin (E-AB-67478, Elabscience)\u0026mdash;at 1:200 dilution for 1 hour. Detection was performed using the 2-step plus Poly-HRP Anti-Rabbit IgG Detection System with DAB solution (Cat. no: E-IR-R215) according to the manufacturer\u0026rsquo;s protocol. Finally, cells were counterstained with hematoxylin (SERVA, Germany). Images of stained samples were captured using a Nikon Eclipse E200 upright microscope [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eFor all variables, mean values and standard deviations (SD) were calculated. Differences between groups were analyzed using two-way ANOVA followed by Tukey\u0026rsquo;s post hoc test. A p-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant. All statistical analyses and graphical representations were performed using GraphPad Prism software (version 8; GraphPad Software, San Diego, CA, USA).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eGenes and Primer Sequences Used for Gene Expression Analysis in ADMSCs\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward Primer (5\u0026prime; \u0026rarr; 3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse Primer (5\u0026prime; \u0026rarr; 3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTCTCCTCTGACTTCAACAGCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACCACCCTGTTGCTGTAGCCAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTGF-β\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTACAGCAACAATTCCTGGCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTGAACCCGTTGATGTCCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCTGCCTAACATGCTTCGAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAGTTCACATGCGCCTTGAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIL-6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTCCACAAGCGCCTTCGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAATCTTCTCCTGGGGGTACTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTNF-α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCCCATGTTGTAGCAAACCCTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGTTATCTCTCAGCTCCACGCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eGenes and Primer Sequences Used for Gene Expression Analysis in Panc-1 Cells\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward Primer (5\u0026prime; \u0026rarr; 3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse Primer (5\u0026prime; \u0026rarr; 3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTCTCCTCTGACTTCAACAGCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACCACCCTGTTGCTGTAGCCAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCD44\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCACACGAAGGAAAGCAGGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCAGAGGTTGTGTTTGCTCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCDH1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTAGAGGTCAGCGTGTGTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTTCTCCGCCTCCTTCTTCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCLDN1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGCTTGGAAGACGATGAGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAGCCTGACCAAATTCGTACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVIM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCTGCCAACCGGAACAATGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTAGTTAGCAGCTTCAACGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eZEB1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGGAGCCACAAAAGGACAGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGGGAATCAGAATCGTTTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMMP9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGACGAGGGCCTGGAGTGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGTGCTGTAGGAAGCTCATCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMMP2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTCATTTGGCGGACTGTGAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTGCTGGCTGAGTAGATCCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTIMP1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACCCCTGGAGCACGGCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCCACCTTCCAAGTTAGTGACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eVEGFR2 (KDR)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATCTGTGACTTTGGCTTGGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCCCACAGCAAAACACCAAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003euPA (PLAU)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCCACACACTGCTTCATTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTATACATCGAGGGCAGGCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003e1- ADMSC Characterization\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTypical fibroblast-like ADMSCs were successfully expanded in culture (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). Flow cytometry analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb) included 45,686 labeled events, of which 91.4% fell within the defined MSC gate. Within this gated population, the cells exhibited the expected mesenchymal stem cell immunophenotype: they were negative for the hematopoietic lineage cocktail (anti-CD45, anti-CD34, anti-CD11b, anti-HLA-DR, and anti-CD79) and strongly positive for MSC markers with 99.9% CD73, 99.4% CD90, and 99.9% CD105 expression.\u003c/p\u003e \u003cp\u003eThis immunophenotypic profile is consistent with the minimal criteria defined by the International Society for Cellular Therapy (ISCT, 2006) for human mesenchymal stem cells [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e2- Effects of TLR3 Agonists and Antagonists at Different Concentrations on Cell Viability and Inflammatory Gene Expression in ADMSCs\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe TLR3 agonist and antagonist produced distinctly different viability responses in ADMSCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). The TLR3 agonist induced a dose-dependent reduction in cell viability at 24 hours; however, by 48 hours, a partial recovery was observed, with low and intermediate doses approaching control levels. In contrast, the TLR3 antagonist caused marked cytotoxicity at 24 hours, particularly at 10 and 100 \u0026micro;g/mL, and although a slight recovery occurred at lower doses by 48 hours, high-dose toxicity remained pronounced (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). Collectively, these patterns indicate that ADMSCs exhibit an adaptive response to TLR3 activation, whereas TLR3 blockade renders the cells more susceptible to sustained viability loss, especially at higher concentrations.\u003c/p\u003e \u003cp\u003eTLR3 agonist stimulation produced a dose-dependent and multidirectional modulation of inflammatory gene expression in ADMSCs. TGFB1 expression remained unchanged at 0.1 \u0026micro;g/mL, but was almost completely suppressed at 1 and 5 \u0026micro;g/mL (~\u0026thinsp;0.002-fold), with a partial recovery at 10 \u0026micro;g/mL (~\u0026thinsp;0.17-fold). IL10 showed a fluctuating pattern: a pronounced induction at low concentration, moderate responses at intermediate doses, and a mild increase at the highest dose. The agonist induced a sharp IL6 increase at 0.1 \u0026micro;g/mL (~\u0026thinsp;3.6-fold), followed by a progressive reduction at higher concentrations, demonstrating a strong pro-inflammatory activation at low dose. Similarly, TNFA expression increased significantly at 0.1\u0026ndash;1 \u0026micro;g/mL, remained above control at 5 \u0026micro;g/mL, and then fell below baseline at 10 \u0026micro;g/mL, suggesting biphasic regulation. Overall, 1 \u0026micro;g/mL elicited robust biological responses across multiple genes without inducing cytotoxicity and was therefore selected as the optimal TLR3 agonist dose (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb).\u003c/p\u003e \u003cp\u003eTLR3 antagonism shifted ADMSCs toward a strongly anti-inflammatory phenotype. TGFB1 expression increased steadily from 0.01 \u0026micro;g/mL (~\u0026thinsp;1.5-fold) to 0.1 \u0026micro;g/mL (~\u0026thinsp;3.3-fold), reaching its maximum at 0.5 \u0026micro;g/mL (~\u0026thinsp;6-fold), and remained elevated at 1 \u0026micro;g/mL. IL10 followed a similar pattern, increasing approximately 3-fold at 0.01 \u0026micro;g/mL, 6-fold at 0.1 \u0026micro;g/mL, and peaking at 0.5 \u0026micro;g/mL (~\u0026thinsp;12-fold) before decreasing at 1 \u0026micro;g/mL. In contrast, pro-inflammatory genes were markedly suppressed: IL6 was reduced in all groups and nearly eliminated at 0.1 \u0026micro;g/mL, while TNFA decreased consistently across all doses, reaching the lowest level at 1 \u0026micro;g/mL. The concentration of 0.5 \u0026micro;g/mL provided the strongest anti-inflammatory shift with minimal cytotoxicity and was identified as the optimal antagonist dose (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec). In summary, TLR3 activation and inhibition produced opposite immunomodulatory patterns in ADMSCs. The agonist triggered strong pro-inflammatory responses at low doses and suppressed gene expression at higher doses, whereas the antagonist markedly enhanced anti-inflammatory genes (TGFB1, IL10) and consistently reduced IL6 and TNFA. These results highlight TLR3 signaling as a key regulator of inflammatory balance in ADMSCs and support the use of 1 \u0026micro;g/mL agonist and 0.5 \u0026micro;g/mL antagonist as optimal concentrations for further experiments.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e3- Effects of MSC, TLR3-Activated MSCs (T3\u0026thinsp;+\u0026thinsp;MSC), and TLR3-Inhibited MSCs (T3-MSC) on Panc-1 Cell Viability and Proliferation\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe effects of MSC, T3\u0026thinsp;+\u0026thinsp;MSC, and T3-MSC on Panc-1 cell viability were assessed at 24 h and 72 h using three MSC:Panc-1 ratios (10:1, 1:1, 1:10) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea,b). Untreated Panc-1 cells were used as the 100% reference control. At 24h, a strong suppressive effect was observed at the 10:1 ratio, where MSC (87.7%) and particularly T3\u0026thinsp;+\u0026thinsp;MSC (82.4%) significantly reduced Panc-1 viability (****p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). T3\u0026ndash;MSC showed only a mild decrease (95.7%). At the 1:1 ratio, MSC markedly increased viability (111.6%, ****p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), T3\u0026thinsp;+\u0026thinsp;MSC produced a moderate increase (103.4%), while T3\u0026ndash;MSC reduced cell viability (94.4%, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01). At 1:10, all groups demonstrated significantly elevated viability (108\u0026ndash;111%, ****p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), indicating enhanced survival at lower MSC proportions. At 72 h, similar ratio-dependent trends were observed. Under the 10:1 condition, MSC (88.9%) and T3\u0026thinsp;+\u0026thinsp;MSC (85.9%) continued to significantly inhibit viability (****p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), whereas T3\u0026ndash;MSC (102.9%) remained comparable to the control (ns). At the 1:1 ratio, MSC (98.5%) and T3\u0026ndash;MSC (102.5%) maintained viability near control levels, and only T3\u0026thinsp;+\u0026thinsp;MSC exhibited a slight but significant reduction (96.1%, *p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). At 1:10, MSC (88.3%) and T3\u0026thinsp;+\u0026thinsp;MSC (87.6%) again significantly reduced viability (****p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), while T3\u0026ndash;MSC (101.8%) showed no significant change.\u003c/p\u003e \u003cp\u003eProliferation analysis at 72 h (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec) demonstrated that MSC and T3\u0026thinsp;+\u0026thinsp;MSC markedly reduced Panc-1 proliferation at 10:1 (****p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), consistent with viability data. At the 10:1 (\u0026asymp;\u0026thinsp;5:1) co-culture ratio, untreated Panc-1 cells showed 99.7\u0026thinsp;\u0026plusmn;\u0026thinsp;8.5% proliferation, whereas MSC (64.9\u0026thinsp;\u0026plusmn;\u0026thinsp;4.9%) and T3\u0026thinsp;+\u0026thinsp;MSC (45.7\u0026thinsp;\u0026plusmn;\u0026thinsp;7.5%) induced strong suppression. T3\u0026ndash;MSC (93.0\u0026thinsp;\u0026plusmn;\u0026thinsp;5.0%) largely preserved Panc-1 proliferation, remaining close to control levels. Representative fluorescence images support these findings, showing reduced cell density in MSC and T3\u0026thinsp;+\u0026thinsp;MSC groups, particularly under high MSC:Panc-1 ratios (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e4-Effects of TLR3 Polarization Indirect MSC-Panc-1 (10:1) co-culture on Panc-1 Cell cycle and apoptosis\u003c/b\u003e \u003c/p\u003e \u003cp\u003eCell cycle profiling demonstrated that co-culture with MSCs and TLR3-modulated MSCs induced marked shifts in the phase distribution of Panc-1 cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea,b). The S phase fraction increased from 23% in control Panc-1 cells to 28.56% (MSC), 26.27% T3\u0026thinsp;+\u0026thinsp;MSC, and 23.69% (T3\u0026ndash;MSC), and this elevation was statistically significant for all co-culture conditions (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01\u0026ndash;0.0001). Conversely, the G2 population decreased sharply in the MSC (8.78%) and T3\u0026thinsp;+\u0026thinsp;MSC (8.55%) groups compared to control (19.75%), indicating a significant reduction in G2-phase progression (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001). The G1 phase increased in the MSC (61.86%) and T3\u0026thinsp;+\u0026thinsp;MSC (61.45%) groups relative to control (51.61%), while the T3\u0026ndash;MSC condition (53.56%) remained similar to baseline. Statistical analysis confirmed significant G1 enrichment in the MSC and T3\u0026ndash;MSC groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), suggesting that MSCs tend to retain Panc-1 cells in the G1 phase. Super-G2 populations varied mildly across groups but did not show statistical significance. Overall, these findings indicate that MSCs and TLR3 activation influence Panc-1 proliferation dynamics by promoting S/G1-phase retention while reducing G2-phase progression.\u003c/p\u003e \u003cp\u003eApoptosis profiling revealed distinct effects of MSC co-culture and TLR3 modulation on Panc-1 cell survival (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec,d). In control Panc-1 cells, the proportions of live, early apoptotic, late apoptotic, and necrotic cells were 61.14%, 15.86%, 10.03%, and 12.98%, respectively. Co-culture with MSCs reduced cell viability to 46.67% while increasing early (21.66%) and late apoptosis (13.45%), as well as necrosis (18.21%), indicating that MSCs enhance both apoptotic and necrotic cell death. Notably, T3\u0026thinsp;+\u0026thinsp;MSC exerted the strongest anti-tumor effect, resulting in the lowest viability (41.09%) and the highest early apoptosis rate (31.79%), demonstrating that TLR3 stimulation amplifies MSC-mediated cytotoxicity toward Panc-1 cells. In contrast, TLR3 antagonism (T3\u0026ndash;MSC) produced viability (59.16%) and apoptotic fractions comparable to the control condition, suggesting that inhibition of TLR3 suppresses the anti-tumor capacity of MSCs. Together, these data indicate that TLR3 signaling is a critical modulator of MSC-induced apoptosis in Panc-1 cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003e5-Effects of TLR3 Polarization ındirect MSC-Panc-1 (10:1) co-culture on Panc-1 Cell EMT, Stemness and Metastasis\u003c/b\u003e \u003c/p\u003e \u003cp\u003eGene expression analysis of epithelial\u0026ndash;mesenchymal transition (EMT)-related markers (CD44, CDH1, CLDN1, VIM, ZEB1) demonstrated condition-dependent modulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea). CD44 expression was significantly downregulated in the T3\u0026thinsp;+\u0026thinsp;MSC group but elevated in the MSC co-culture without TLR3 modulation. CDH1 expression markedly increased in the presence of MSCs but was suppressed under T3\u0026ndash;MSC conditions. CLDN1 was strongly upregulated, particularly under T3\u0026thinsp;+\u0026thinsp;MSC stimulation, while VIM increased only in the T3\u0026ndash;MSC group. ZEB1 expression rose with MSC co-culture yet declined following TLR3 inhibition. These results indicate that MSCs enhance epithelial traits (via CDH1 and CLDN1 upregulation) while simultaneously inducing partial EMT, whereas TLR3 activation favors epithelial stabilization and its inhibition promotes mesenchymal transition.\u003c/p\u003e \u003cp\u003eFurther analysis of matrix remodeling, angiogenesis, and invasion markers (MMP9, MMP2, TIMP1, VEGFR2, PLAU) corroborated these findings (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb). MMP9 and MMP2 expressions were reduced in MSC co-cultures, particularly under T3\u0026thinsp;+\u0026thinsp;MSC conditions, while TIMP1 expression was markedly increased in all MSC-treated groups, reaching its highest level in T3\u0026ndash;MSC. VEGFR2 was strongly upregulated in the presence of MSCs, reflecting enhanced angiogenic signaling, and PLAU expression was robustly induced across all groups, especially in T3\u0026ndash;MSC, consistent with an invasive phenotype. Collectively, MSCs suppressed matrix-degrading MMPs while elevating TIMP1, VEGFR2, and PLAU, thereby regulating ECM remodeling and invasion potential in Panc-1 cells. TLR3 activation limited ECM degradation and supported epithelial integrity, whereas its inhibition promoted mesenchymal and invasive characteristics.\u003c/p\u003e \u003cp\u003eThe colony-forming capacity of Panc-1 cells was evaluated after co-culture with mesenchymal stem cells (MSCs) and modulation of the TLR3 pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ec,d). In the control group, Panc-1 cells alone exhibited a colony formation rate of 101.3\u0026thinsp;\u0026plusmn;\u0026thinsp;3.5%, whereas co-culture with MSCs significantly reduced this rate to 77.3\u0026thinsp;\u0026plusmn;\u0026thinsp;3.0%, indicating an inhibitory effect on proliferative potential. Stimulation of TLR3 in MSCs (T3\u0026thinsp;+\u0026thinsp;MSC) further enhanced this suppressive activity, decreasing colony formation to 71.7\u0026thinsp;\u0026plusmn;\u0026thinsp;1.5%. Conversely, inhibition of TLR3 signaling (T3\u0026ndash;MSC) partially reversed the effect, increasing colony formation to 88.3\u0026thinsp;\u0026plusmn;\u0026thinsp;3.0%. Overall, MSCs decreased Panc-1 colony formation by approximately 24%, with TLR3 activation strengthening and TLR3 inhibition attenuating this suppressive influence.\u003c/p\u003e \u003cp\u003eIn conclusion, these findings demonstrate that MSCs significantly modulate Panc-1 cell behavior through both direct interaction and TLR3 pathway regulation. While MSC co-culture suppresses colony formation and partially enhances epithelial features, TLR3 activation further reinforces this epithelial phenotype and limits extracellular matrix degradation. Conversely, TLR3 inhibition shifts the balance toward a more mesenchymal and invasive state, characterized by elevated PLAU and TIMP1 expression. Collectively, the data suggest that TLR3 signaling in MSCs acts as a critical regulator of the tumor\u0026ndash;stroma interaction, influencing EMT plasticity, matrix remodeling, and the invasive potential of pancreatic cancer cells.\u003c/p\u003e "},{"header":"Discussion","content":"\u003cp\u003ePDAC remains one of the deadliest malignancies worldwide, largely due to its dense desmoplastic stroma, aggressive biological behavior, and poor response to conventional therapies. Increasing evidence highlights that the stromal compartment, rather than acting solely as a passive scaffold, actively shapes tumor progression, immune evasion, metastasis, and therapeutic resistance. Among stromal components, MSCs occupy a central position due to their immunomodulatory plasticity, paracrine activity, and dynamic responsiveness to microenvironmental cues. The present study demonstrates that TLR3 signaling is a critical determinant of ADMSC polarization and profoundly influences their paracrine interactions with Panc-1 pancreatic cancer cells in an indirect co-culture model.\u003c/p\u003e \u003cp\u003eOur findings show that pharmacological activation and inhibition of TLR3 generate distinct inflammatory profiles in ADMSCs. TLR3 activation induced a dose-dependent biphasic response: low-dose stimulation promoted pro-inflammatory IL6 and TNFA expression, whereas higher doses suppressed TGFB1 and partially modulated IL10. Conversely, TLR3 inhibition shifted ADMSCs toward a strongly anti-inflammatory phenotype, characterized by elevated TGFB1 and IL10 and reduced IL6 and TNFA expression, consistent with previous reports describing TLR3-dependent induction of immunosuppressive MSC2 characteristics [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Importantly, 1 \u0026micro;g/mL Poly(A:U) and 0.5 \u0026micro;g/mL CU-CPT4a emerged as optimal concentrations, balancing cellular viability and immunomodulatory activity. These dose-dependent effects confirm that TLR3 acts not merely as a pro-inflammatory sensor but as a bidirectional molecular switch controlling stem cell phenotype and secretory programs.\u003c/p\u003e \u003cp\u003eThe viability and proliferation analyses in co-culture demonstrated that MSC-based effects on Panc-1 cells are highly dependent on MSC-to-cancer cell ratios. At the highest MSC:Panc-1\u0026thinsp;=\u0026thinsp;10:1, both na\u0026iuml;ve MSCs and TLR3-activated MSCs strongly reduced Panc-1 viability and proliferation at 24 and 72 hours, consistent with studies showing MSC-induced growth inhibition in PDAC models [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. T3\u0026thinsp;+\u0026thinsp;MSC exhibited the strongest antitumor effect, confirming that inflammatory priming can enhance the cytotoxic potential of MSCs toward certain cancer types. In contrast, TLR3-inhibited MSCs maintained Panc-1 viability near baseline, revealing that anti-inflammatory polarization attenuates MSC-mediated tumor suppression. This aligns with the concept that MSC phenotypes have dual and context-dependent roles, either supporting tumor suppression (MSC1-like) or enhancing tumor-promoting processes (MSC2-like) [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eCell cycle analyses further supported these antiproliferative effects. Co-culture with MSCs\u0026mdash;particularly T3\u0026thinsp;+\u0026thinsp;MSC\u0026mdash;led to retention of Panc-1 cells in the G1 and S phases, with a marked reduction in G2, indicating disrupted progression through mitosis. These results complement earlier reports of MSC-induced cell cycle arrest in pancreatic cancer cells via cyclin-dependent kinase regulation [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. However, our observation of simultaneous G1 and S-phase accumulation suggests a more complex regulatory mechanism involving partial DNA synthesis without full proliferative commitment, potentially reflecting secretome-mediated modulation of checkpoint proteins.\u003c/p\u003e \u003cp\u003eApoptosis data revealed that na\u0026iuml;ve MSCs increased early and late apoptotic fractions of Panc-1 cells, while TLR3 activation significantly amplified this effect, supporting the hypothesis that inflammatory priming enhances the antitumor properties of MSCs. Similar proapoptotic effects were previously observed in amniotic MSC\u0026ndash;PDAC co-culture models, where MSCs induced apoptosis through caspase activation and p21 upregulation [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. In contrast, TLR3-inhibited MSCs failed to significantly increase apoptosis, further illustrating that TLR3 signaling is a decisive regulator of MSC-induced cytotoxicity.\u003c/p\u003e \u003cp\u003eA key strength of this work lies in the comprehensive profiling of EMT and metastasis-associated gene expression. Na\u0026iuml;ve MSCs produced a mixed EMT response, increasing both epithelial (CDH1, CLDN1) and mesenchymal (VIM) markers, reflecting the complex, dualistic nature of MSC interactions within the PDAC microenvironment. Notably, TLR3-activated MSCs promoted epithelial stabilization, increasing CDH1 and CLDN1 expression while reducing CD44 and ZEB1, consistent with reduced invasive potential. Conversely, TLR3-inhibited MSCs favored a mesenchymal/invasive phenotype, upregulating VIM and PLAU, indicating that anti-inflammatory MSC phenotypes may inadvertently enhance tumor plasticity and invasion. Suppression of MMP2 and MMP9 by MSCs\u0026mdash;especially T3\u0026thinsp;+\u0026thinsp;MSC\u0026mdash;further supports an anti-invasive role, aligning with previous studies reporting MSC-mediated regulation of ECM remodeling enzymes in pancreatic cancer [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Colony formation assays corroborated these findings: MSCs reduced clonogenicity, and TLR3 activation enhanced this inhibitory effect, while TLR3 inhibition partially restored colony-forming potential. Together, these findings support a model in which TLR3 signaling governs the paracrine regulatory axis through which MSCs influence PDAC progression.\u003c/p\u003e \u003cp\u003eThe strong suppressive effects observed in our study\u0026mdash;where TLR3 activation drove a pro-inflammatory MSC phenotype that markedly reduced Panc-1 cell proliferation, enhanced apoptosis, and diminished colony formation\u0026mdash;are consistent with the findings of Wang et al., who demonstrated that Poly(I:C)-primed MSCs acquire enhanced antitumor capacity through increased secretion of IL-6, CXCL10, and CCL5, thereby generating a more robust immunostimulatory and antitumor microenvironment [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. This parallel supports the notion that TLR3-mediated inflammatory priming represents a key mechanism by which MSCs strengthen their paracrine antitumor activity. Similarly, the enhanced antitumor effects observed in our TLR3-activated MSC group align with the findings of Sun et al., who demonstrated that TLR3-stimulated MSCs release small extracellular vesicles with a more immunostimulatory profile, capable of suppressing tumor cell proliferation and colony formation while promoting CD8⁺ T-cell activation and NK-cell cytotoxicity. These results support the interpretation that \u003cb\u003eTLR3 activation not only reshapes MSC immunobiology but also amplifies their paracrine antitumor signaling\u003c/b\u003e, thereby strengthening their therapeutic potential against pancreatic cancer [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOverall, this study provides the first mechanistic evidence that TLR3-mediated polarization of ADMSCs significantly alters their secretome-driven effects on Panc-1 cancer cells, shaping viability, proliferation, apoptosis, EMT dynamics, ECM remodeling, and metastatic potential. The data highlight the therapeutic relevance of controlled TLR3 activation to potentiate the antitumor properties of MSCs. Given that MSC-based stromal modulation strategies are increasingly regarded as promising adjunct therapies in PDAC, these findings contribute to establishing rational approaches for engineering MSC phenotypes to enhance antitumor efficacy. Future studies should focus on proteomic mapping of polarized MSC secretomes, exosome-mediated communication, and in vivo validation to extend these mechanistic insights toward potential translational applications.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eCompeting Interests and Funding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests. This work was supported by the Scientific and Technological Research Council of Turkey (T\u0026Uuml;BİTAK), Grant No.124S740\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eThe authors have accepted responsibility for the entire content of this manuscript and approved its submission.Concept \u0026ndash; D.K. and S.Y. ; Supervision \u0026ndash; A.Y.; Materials \u0026ndash;D.K. and S.Y. ; Data Collection and/or Processing \u0026ndash; D.K., A.Y. and Z.T.; Analysis and/or Interpretation \u0026ndash; D.K. and Z.T.; Writing \u0026ndash;D.K. and S.Y.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eY. Sunami, J. H\u0026auml;u\u0026szlig;ler, J. Klee, Cellular heterogeneity of pancreatic stellate cells, mesenchymal stem cells, and cancer-associated fibroblasts in pancreatic cancer. Cancers. \u003cb\u003e12\u003c/b\u003e, 3770 (2020)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eR.M. Carr, M.E. Fernandez-Zapico, Pancreatic cancer microenvironment, to target or not to target? EMBO Mol. Med. \u003cb\u003e8\u003c/b\u003e, 80\u0026ndash;82 (2016)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eC. Feig et al., The pancreas cancer microenvironment. Clin. Cancer Res. \u003cb\u003e18\u003c/b\u003e, 4266\u0026ndash;4276 (2012)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eD. Hanahan, R.A. Weinberg, Hallmarks of cancer: the next generation. Cell. \u003cb\u003e144\u003c/b\u003e, 646\u0026ndash;674 (2011)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM.R. Junttila, De F.J. Sauvage, Influence of tumour micro-environment heterogeneity on therapeutic response. Nature. \u003cb\u003e501\u003c/b\u003e, 346\u0026ndash;354 (2013)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eT. Murakami et al., Role of the tumor microenvironment in pancreatic cancer. Ann. Gastroenterol. Surg. \u003cb\u003e3\u003c/b\u003e, 130\u0026ndash;137 (2019)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eI. Pountos, P.V. Giannoudis, Biology of mesenchymal stem cells. Injury. \u003cb\u003e36\u003c/b\u003e(Suppl 3), S8\u0026ndash;S12 (2005)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eR. Berebichez-Fridman, P.R. Montero-Olvera, Sources and clinical applications of mesenchymal stem cells. Sultan Qaboos Univ. Med. J. \u003cb\u003e18\u003c/b\u003e, e264\u0026ndash;e277 (2018)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM. Strioga, S. Viswanathan, A. Darinskas, O. Slaby, J. Michalek, Comparison of adipose tissue-derived versus bone marrow-derived mesenchymal stem cells. Stem Cells Dev. \u003cb\u003e21\u003c/b\u003e, 2724\u0026ndash;2752 (2012)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eY. Zhou, Y. Yamamoto, Z. Xiao, T. Ochiya, The immunomodulatory functions of mesenchymal stromal/stem cells. J. Clin. Med. \u003cb\u003e8\u003c/b\u003e, 1025 (2019)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eF. Rahmatizadeh et al., Bidirectional and opposite effects of na\u0026iuml;ve mesenchymal stem cells on tumor progression. Adv. Pharm. Bull. \u003cb\u003e9\u003c/b\u003e, 539\u0026ndash;547 (2019)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eK. Saito et al., Stromal mesenchymal stem cells facilitate pancreatic cancer progression. J. Cancer. \u003cb\u003e9\u003c/b\u003e, 2916\u0026ndash;2929 (2018)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eT. Okumura et al., Adipose tissue-derived stromal cells enhance tumor progression by dense collagen matrix. Int. J. Cancer. \u003cb\u003e144\u003c/b\u003e, 1401\u0026ndash;1413 (2019)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eY. Chen, J. Lin, Y. Zhao, X. Ma, H. Yi, TLR3 regulation mechanisms and innate immune responses. J. Zhejiang Univ. Sci. B \u003cb\u003e22\u003c/b\u003e, 609\u0026ndash;632 (2021)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eH.R. Frederiksen, H. Haukedal, K. Freude, Cell type specific expression of Toll-like receptors in human brains. Biomed. Res. Int. 2019, 7420189 (2019)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eR.S. Waterman, S.L. Henkle, A.M. Betancourt, MSC1 vs. MSC2 polarization and tumor effects. PLoS One. \u003cb\u003e7\u003c/b\u003e, e45590 (2012)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eR.S. Waterman et al., Polarization into pro-inflammatory MSC1 or immunosuppressive MSC2 phenotype. PLoS One \u003cb\u003e5\u003c/b\u003e, e10088 (2010)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eF. Eskandari et al., TLR3 stimulation improves MSC migration in melanoma model. Mol. Biol. Rep. \u003cb\u003e50\u003c/b\u003e, 2293\u0026ndash;2304 (2023)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eC.M. Rivera-Cruz, M.L. Figueiredo, TLR3 priming of adipose-derived MSCs and prostate cancer interactions. Cytotherapy. \u003cb\u003e25\u003c/b\u003e, 33\u0026ndash;45 (2023)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eS. Yaylacı, D. Ka\u0026ccedil;aroğlu, \u0026Ouml;. H\u0026uuml;rkal, A.M. Ulaşlı, An enzyme-free technique enables the isolation of a large number of adipose-derived stem cells at the bedside. Sci. Rep. \u003cb\u003e13\u003c/b\u003e, 1\u0026ndash;14 (2023)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eD. Ka\u0026ccedil;aroğlu, S. Yaylacı, Enhancing the regenerative potential of adipose-derived mesenchymal stem cells through TLR4-mediated signaling. Curr. Stem Cell. Res. Ther. (2024)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eD. Ka\u0026ccedil;aroğlu, G.D. Kalaycıoğlu, A.K. \u0026Ouml;zden, \u003cem\u003eCarthamus tinctorius\u003c/em\u003e extracts inhibit expression of metastatic genes of MDA-MB-231 breast cancer cells. Cell. Mol. Biol. \u003cb\u003e69\u003c/b\u003e, 19\u0026ndash;25 (2023)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eD. Ka\u0026ccedil;aroğlu, S. Yaylacı, N. Gurbuz, Anti-tumorigenic effects of na\u0026iuml;ve and TLR4-primed adipose-derived mesenchymal stem cells on PDAC cells. Cancer Med. \u003cb\u003e13\u003c/b\u003e, e6964 (2024)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eD. Ka\u0026ccedil;aroğlu, S. Yaylacı, A.M. Ulaşlı, Dual facets of MSC-derived small extracellular vesicles: regulatory insights into antitumor mechanisms in PDAC. Med. Oncol. \u003cb\u003e42\u003c/b\u003e, 158 (2025)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eM. Dominici, Le K. Blanc, I. Mueller et al., Minimal criteria for defining multipotent mesenchymal stromal cells. Cytotherapy. \u003cb\u003e8\u003c/b\u003e, 315\u0026ndash;317 (2006)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eB. Cousin, E. Ravet, S. Poglio et al., Adult stromal cells derived from adipose tissue provoke pancreatic cancer cell death in vitro and in vivo. PLoS One \u003cb\u003e4\u003c/b\u003e, e6278 (2009)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eC. Doi, D.K. Maurya, M.M. Pyle, D. Troyer, M. Tamura, Umbilical cord matrix stem cells attenuate growth of pancreatic cancer and increase survival in mice. Cytotherapy. \u003cb\u003e12\u003c/b\u003e, 408\u0026ndash;417 (2010)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eP. Barcellos-de-Souza, V. Gori, F. Bambi, P. Chiarugi, Tumor microenvironment: bone marrow\u0026ndash;mesenchymal stem cells as key players. Biochim. Biophys. Acta Rev. Cancer. \u003cb\u003e1836\u003c/b\u003e, 321\u0026ndash;335 (2013)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eY.C. Chen, Y.W. Lan, S.M. Huang et al., Human amniotic fluid mesenchymal stem cells attenuate pancreatic cancer cell proliferation and tumor growth. Stem Cell. Res. Ther. \u003cb\u003e13\u003c/b\u003e, 1\u0026ndash;17 (2022)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eG. Wang et al., Poly(I:C)-priming enhances the antitumor activity of mesenchymal stem cells through inflammatory polarization. Theranostics. \u003cb\u003e10\u003c/b\u003e, 3681\u0026ndash;3696 (2020)\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eL. Sun et al., TLR3-activated MSC-derived extracellular vesicles modulate the tumor immune microenvironment and suppress tumor progression. Theranostics. \u003cb\u003e12\u003c/b\u003e, 1236\u0026ndash;1253 (2022)\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Adipose-derived mesenchymal stem cells (ADMSCs), Toll-like receptor 3 (TLR3), pancreatic cancer, indirect co-culture, epithelial mesenchymal transition (EMT)","lastPublishedDoi":"10.21203/rs.3.rs-8384537/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8384537/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003ePurpose\u003c/h2\u003e \u003cp\u003eToll-like receptor 3 (TLR3) signaling is known to regulate the interactions between mesenchymal stem cells (MSCs) and tumor cells; however, its functional impact in the context of pancreatic cancer remains insufficiently defined. This study investigated how pharmacological activation or inhibition of TLR3 in adipose-derived MSCs (ADMSCs) modulates cellular inflammatory responses and alters the paracrine effects exerted on Panc-1 cells.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eADMSCs were phenotypically validated by flow cytometry and subsequently exposed to graded doses of the TLR3 agonist Poly(A:U) and the antagonist CU-CPT4a. Optimal doses were identified through cell viability (MTT) assays and expression analyses of IL6, TNFA, IL10, and TGFB1. These doses were then applied in indirect transwell co-culture models at MSC:Panc-1 ratios of 10:1, 1:1, and 1:10 to determine the optimal co-culture condition. At the selected MSC:Panc-1\u0026thinsp;=\u0026thinsp;10:1 ratio, Panc-1 cell proliferation (Calcein AM), apoptosis (Annexin V/PI), cell cycle distribution, colony-forming capacity, EMT-related genes (CD44, ZEB1, VIM, CDH1, CLDN1), and metastasis-associated genes (MMP2, MMP9, TIMP1, VEGFR2, PLAU) were evaluated.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eTLR3 activation induced a dose-dependent, biphasic pro-inflammatory response in ADMSCs while maintaining viability at 1 \u0026micro;g/mL. In contrast, TLR3 inhibition generated a strong anti-inflammatory phenotype, with maximal induction of TGFB1 and IL10 at 0.5 \u0026micro;g/mL. In co-culture, MSCs -particularly T3\u0026thinsp;+\u0026thinsp;MSCs -significantly reduced Panc-1 viability, proliferation, and colony formation; increased G1/S retention; and enhanced apoptotic death. At the gene level, TLR3 activation promoted epithelial stabilization and reduced extracellular matrix degradation, whereas TLR3 inhibition favored a more mesenchymal and invasive phenotype.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eOverall, the findings identify TLR3 signaling in ADMSCs as a critical regulator of tumor-stroma interactions and demonstrate that controlled TLR3 activation may enhance the antitumor potential of MSC-based therapeutic strategies in pancreatic cancer.\u003c/p\u003e","manuscriptTitle":"TLR3-Dependent Polarization of Adipose-Derived Mesenchymal Stem Cells Regulates Pancreatic Cancer Cell Behavior in an Indirect Co-culture Model","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-18 08:20:29","doi":"10.21203/rs.3.rs-8384537/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"28d92640-abcb-4767-8101-7f133c5a9b77","owner":[],"postedDate":"December 18th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-01-08T16:23:36+00:00","versionOfRecord":[],"versionCreatedAt":"2025-12-18 08:20:29","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8384537","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8384537","identity":"rs-8384537","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}