Mechanism of action of IHH in ameliorating thin endometrium.

The expression of IHH in the uterine tissues of rats in each group was detected using RT-qPCR, western blotting, and immunohistochemistry. The model group showed reduced IHH expression relative to the sham group; compared with the model + AAV-NC group, the model + AAV-IHH group showed increased IHH expression, indicating that IHH was successfully overexpressed ( Fig. 1A–C Fig. 1. IHH promotes tissue repair in rats with thin endometrium. (A–B) RT-qPCR (A) and western blotting (B) detection of IHH mRNA and protein expression; (C) Immunohistochemical detection of IHH expression; (D) Observation of uterine morphology; (E) H&E staining to detect endometrial histological features and changes in endothelial thickness; (F) Number of endometrial glands; (G) Number of endometrial vessels. N = 5; ** P < 0.01, compared with the sham group; ## P < 0.01, compared with the model group. , P < 0.05). The uterine tissue in the sham group was normal in appearance, red, and elastic. However, the uterine tissue in the model group showed obstruction, stenosis, and fluid accumulation. The edema and bruises caused by ethanol in rats in the model + AAV-IHH group generally subsided, and their uteri turned rosy and shiny ( Fig. 1D ), indicating that IHH could repair the morphology and appearance of damaged uterine tissue. H&E staining was then performed to detect endometrial changes. The endometrium of the model rats was thinned. The model + AAV-IHH group showed increased endometrial thickness ( Fig. 1E ) and an increased number of glands and vessels ( Fig. 1F–G , P < 0.05). Based on the above experimental results, IHH can increase endometrial thickness and promote glandular and vascular regeneration. IHH promotes tissue repair in rats with thin endometrium. (A–B) RT-qPCR (A) and western blotting (B) detection of IHH mRNA and protein expression; (C) Immunohistochemical detection of IHH expression; (D) Observation of uterine morphology; (E) H&E staining to detect endometrial histological features and changes in endothelial thickness; (F) Number of endometrial glands; (G) Number of endometrial vessels. N = 5; ** P < 0.01, compared with the sham group; ## P < 0.01, compared with the model group. After Masson’s trichrome staining, the fibers in the endometrial tissue were stained blue. The model rats exhibited increased endometrial fibrosis. Endometrial fibrosis in the model rats was alleviated by AAV-IHH treatment ( Fig. 2A Fig. 2. IHH reduces fibrosis in thin endometrium. (A) Masson staining of endometrial tissue (40 ×, 200 ×); (B) Immunohistochemistry to detect endometrial α-SMA (100 ×, 200 ×). N = 5; ** P < 0.01, compared with sham group; ## P < 0.01, compared with model group. , P < 0.05). α-SMA is a marker for myofibroblasts and an indicator of fibrosis. Using immunohistochemistry, we detected α-SMA expression in the endometrium of the model rats. However, no significant α-SMA expression was observed in the endometrium of rats in the model + AAV-IHH group ( Fig. 2B ). This indicates that IHH can slow the development of fibrosis in the thin endometrium. IHH reduces fibrosis in thin endometrium. (A) Masson staining of endometrial tissue (40 ×, 200 ×); (B) Immunohistochemistry to detect endometrial α-SMA (100 ×, 200 ×). N = 5; ** P < 0.01, compared with sham group; ## P < 0.01, compared with model group. This study found that the collagen content of damaged endometrial tissues increased. Moreover, H&E staining revealed fluctuations in the number of cells and vessels. Western blotting was used to detect the angiogenic protein marker vWF and the cell proliferation markers PCNA and vim to evaluate injury-induced cellular and vascular changes in the endometrium. The levels of vWF, PCNA, and vim in the endometrium of the model group were lower than those in the sham group. The model + AAV-IHH group exhibited increased expression of vWF, PCNA, and vim compared with the model + AAV-NC group ( Fig. 3A Fig. 3. IHH promotes endothelial cell proliferation and angiogenic marker expression. (A) Western blotting to detect the expression of vWF, PCNA, and vim proteins; (B–C) Immunohistochemical staining to detect the expression of CK19 (B) and MUC-1 (C) in endometrial glandular epithelial cells. N = 5; * P < 0.05 and ** P < 0.01, compared with the sham group; # P < 0.05 and ## P < 0.01, compared with the model group. , P < 0.05). Immunohistochemical staining of the endometrial tissue further showed that the model group expressed CK19 and MUC-1 at lower levels than the sham group. CK19 and MUC-1 levels were elevated by AAV-IHH treatment in model rats ( Fig. 3B–C ). These data demonstrate that IHH can promote endothelial cell proliferation and angiogenesis. IHH promotes endothelial cell proliferation and angiogenic marker expression. (A) Western blotting to detect the expression of vWF, PCNA, and vim proteins; (B–C) Immunohistochemical staining to detect the expression of CK19 (B) and MUC-1 (C) in endometrial glandular epithelial cells. N = 5; * P < 0.05 and ** P < 0.01, compared with the sham group; # P < 0.05 and ## P < 0.01, compared with the model group. To evaluate the therapeutic potential of IHH in recovering fertility in the thin endometrial rat model, rats were sacrificed 14 days after mating to examine their pregnancy results. The number of gestational sacs was lower in the model group than in the sham group. The model + AAV-IHH group showed an increase in the number of gestational sacs relative to the model + AAV-NC group ( Fig. 4 Fig. 4. Number of gestational sacs in rats. , P < 0.05; Table 2 Table 2. Reproductive results of experimental rats sham group (n = 5) Model group (n = 5) Model + AAV-NC group (n = 5) Model + AAV-IHH group (n = 5) Pregnancy rate (%) 100 40 ** 40 ** 80 ## Number of embryos 10.6 ± 1.0 4.5 ± 0.5 ** 5.0 ± 1.0 ** 7.3 ± 0.8 *# * P < 0.05 and ** P < 0.01, compared with the sham group; # P < 0.05 and ## P < 0.01, compared with the model group. ), indicating that IHH can enhance the fertility of rats with a thin endometrium. Number of gestational sacs in rats. * P < 0.05 and ** P < 0.01, compared with the sham group; # P < 0.05 and ## P < 0.01, compared with the model group. Hedgehog is a novel endogenous damage signal that can activate multiple beneficial functions in human endometrial stem cells [ 12 ]. Hedgehog signaling activation can promote endometrial hyperplasia [ 16 ]. Moreover, the PathCards database shows that IHH is involved in the regulation of Hedgehog signaling. Therefore, we speculated that IHH might promote endometrial repair by regulating Hedgehog signaling. Western blotting showed a decrease in the expression of the Hedgehog signaling-related proteins SMO, GLI1, and GLI3 in model rats. The expression of SMO, GLI1, and GLI3 in model rats increased following AAV-IHH treatment ( Fig. 5 Fig. 5. IHH promotes Hedgehog signaling activation. Western blotting was used to detect the expression of the Hedgehog signaling-related proteins SMO, GLI1, and GLI3 in each group of rats. N = 5; * P < 0.05 and ** P < 0.01, compared with the sham group; # P < 0.05 and ## P < 0.01, compared with the model group. , P < 0.05). Taken together, these data indicate that IHH increases endometrial thickness and reproductive capacity by regulating Hedgehog signaling activation. IHH promotes Hedgehog signaling activation. Western blotting was used to detect the expression of the Hedgehog signaling-related proteins SMO, GLI1, and GLI3 in each group of rats. N = 5; * P < 0.05 and ** P < 0.01, compared with the sham group; # P < 0.05 and ## P < 0.01, compared with the model group.

Endometrial thickness, an important clinical indicator, is closely related to pregnancy outcomes regardless of whether fertilization occurs in vivo or in vitro . An endometrial thickness of ≤ 7 mm (thin endometrium) can lead to low clinical pregnancy rates, high spontaneous abortion rates, and low live birth rates. Current methods for treating thin endometria have not yielded ideal results. Therefore, the pathogenic landscape of thin endometria should be explored to identify novel targets for therapeutic intervention. This study found that AAV-IHH treatment repaired ethanol-injured uteri and enhanced fertility in rats. Notably, IHH increased endometrial thickness and the number of endometrial glands and vessels. Specifically, IHH upregulated the levels of PCNA, vWF, vim, MUC-1, and CK19 in the endometrium. PCNA is an essential factor in DNA replication and repair and is a marker of cell proliferation [ 17 ]. Given its crucial role in normal hemostasis, vWF has been widely used as a reliable marker of endothelial cell activation and injury [ 18 ]. Vim is expressed in mesenchymal cells [ 19 ], which support endothelial cells in the process of new vessel formation during tissue regeneration [ 20 ]. Therefore, IHH may stimulate vascular regeneration in the thin endometrium by promoting cell proliferation and endothelial angiogenesis. MUC-1 is a transmembrane glycoprotein expressed on the surface of all epithelial cells, forming a tight mesh that protects cells from environmental insults [ 21 ]. CK19, an epithelial cytoskeletal marker, maintains luminal epithelial integrity and guarantees the proliferation of glandular epithelial cells [ 22 ]. Thus, IHH protects epithelial cells and facilitates gland formation in the endometrium by upregulating MUC-1 and CK19. Collectively, our findings suggest that IHH improves endometrial repair by affecting various cell types. Following injury, the endometrium develops fibrosis in cases of failed regeneration and forms scars that may interfere with normal endometrial function, leading to infertility [ 2 ]. A previous study shows that IHH released from TNF-activated renal epithelia drives local and remote organ fibrosis by activating canonical Hedgehog signaling in Gli1 + cells, a major source of activated fibroblasts in multiple organs [ 23 ]. However, this study found that AAV-IHH treatment reduced the number of fibers in the endometrium of rats with thin endometrium. The expression of α-SMA was repressed in AAV-IHH-treated model rats. α-SMA is a myofibroblast marker protein that is incorporated into cytoskeletal stress fibers during tissue healing [ 24 ]. As mentioned above, IHH restores the regenerative capacity of the injured endometrium. Consequently, the activation of α-SMA-expressing myofibroblasts and the production of fibers are prevented. As a Hedgehog ligand, IHH promoted endometrial regeneration in rats with a thin endometrium by activating the expression of the Hedgehog signaling-related proteins SMO, GLI1, and GLI3 in this study. A previous study has shown that IHH signaling is required for cyclical uterine remodeling across the estrous cycle and controls muscle fibers in the uterus [ 25 ], which is consistent with our results. The IHH-SMO signaling pathway is a well-known downstream progesterone pathway that suppresses estrogen-dependent epithelial proliferation and stimulates stromal proliferation in the uterus [ 26 ]. IHH signaling is inhibited in progesterone resistance-related endometrial diseases such as endometriosis and adenomyosis, leading to the aberrant activation of endometrial stromal cell autophagy [ 15 ]. IHH signaling also promotes the expression of 11β-hydroxysteroid dehydrogenase 2 to control the level of uterine corticosterone in early pregnancy, providing a suitable environment for embryo implantation [ 27 ]. These findings indicate that IHH is vital for normal endometrial function and uterine homeostasis. Moreover, epithelial IHH stimulates the production of stromal SHH, another Hedgehog ligand, which in turn activates the canonical Hedgehog signaling pathway to promote endometrial decidualization, a remodeling process necessary for successful pregnancy [ 10 ]. Overall, IHH may regulate endometrial remodeling and uterine homeostasis alone, in cooperation with other Hedgehog ligands, or both. In summary, IHH ameliorates ethanol-induced thinning of the endometrium and improves fertility by stimulating the activation of the Hedgehog signaling pathway. This study is the first to elucidate the role of IHH signaling in thin endometrium. IHH signaling may be augmented to improve endometrial repair and enhance fertility in patients with a thin endometrium. Future studies should investigate the mechanisms regulating IHH expression in the thin endometrium to reinforce these findings.

The authors declare that they have no competing interests.

Healthy female Sprague Dawley rats (200–250 g, 6–8 weeks old) were supplied by Hunan SJA Laboratory Animal Co., Ltd. (Changsha, Hunan, China). After 1 week of adaptation, rats undergoing an estrus cycle for 4 consecutive days were used. All animal experiments were approved by the Animal Ethics Committee of Hunan Provincial Maternal and Child Health Care Hospital. Forty female rats were randomly divided into the sham, model, model + adeno-associated virus (AAV)-negative control (NC), and model + AAV-IHH groups (the AAVs were from GeneChem, Shanghai, China). The rats were anesthetized by intraperitoneal injection of 1% sodium pentobarbital (40 mg/kg), followed by uterine exposure. The uterine horns were isolated, and the ovarian and vaginal ends of the uterus were ligated. Subsequently, 95% ethanol (C0691520092, Nanjing Reagent, Nanjing, Jiangsu, China) was slowly injected into each uterine horn until the uterus was full. After 5 min, ethanol was aspirated using a syringe, and the uterine cavity was flushed with saline. The abdomen was closed and the rats were left in a warm place to wake up. Rats in the model + AAV-NC and model + AAV-IHH groups were injected with 10 nmol of AAV-NC and AAV-IHH, respectively, into the bilateral uterine horns before suturing. Rats in the sham group were injected with saline (100017414749, Cofoe, Changsha, Hunan, China). Five rats in each group were euthanized with 70% vol/min CO 2 for uterine tissue collection after three sexual cycles. The rats were sacrificed 14 days after modeling. Collected endometrial tissue was fixed with 4% paraformaldehyde for 24 h, dehydrated, embedded in paraffin, and then sliced (10 μm thick) for conventional H&E (C0105S, Beyotime, Shanghai, China) and Masson (C0189S, Beyotime) staining. Three parts of each uterine specimen were randomly selected. Vertical endometrial thickness was measured at 3, 6, 9, and 12 points in each section. The average of four values for each section was calculated as the normal endometrial layer thickness. The average of the three measurements was used as the final endometrial thickness. The average number of endometrial glands and vessels in the three samples was also calculated. Data analysis was performed using the ImageJ software. Dewaxed sections were immersed in sodium citrate buffer, and heat-induced antigen retrieval was performed. Endogenous peroxidase activity was blocked with 0.3% H 2 O 2 in methanol (322415, Sigma-Aldrich, St. Louis, MO, USA), followed by blocking of nonspecific binding by incubation with 5% bovine serum albumin at 37°C for 30 min. The sections were incubated at 4°C overnight with primary antibodies (anti-IHH, 5 µg/ml, PA5-42706, Invitrogen, Waltham, MA, USA; anti-α-smooth muscle actin [α-SMA], 5 µg/ml, ab5831, Abcam, Cambridge, UK; anti-mucin-1 [MUC-1], 1:500, ab109185, Abcam; anti-cytokeratin 19 [CK19], 1:1000, ab76539, Abcam) and then at 37°C for 1 h with secondary antibodies (1:500, ab6721, Abcam). After 2-s differentiation with hydrochloric acid and alcohol, the sections were dehydrated, cleared, and mounted for observation. Five rats in each group were mated 14 days after modeling at a female-to-male ratio of 3:1. Vaginal plugs were observed on the morning of the second day after mating. If a vaginal plug was found, the day was recorded as GD0. If there was no vaginal plug, a vaginal smear was performed, and the day was recorded as GD0 when the sperms were detected. Fourteen days after mating, female rats were euthanized to examine the uterine horns. Successful pregnancy depended on the presence of embryos in one or both uterine horns. This was included in the fertility analysis. The number of gestational sacs on the right and left sides was averaged. The tissue was lysed in 1 ml of TRIzol (Thermo Fisher Scientific, Waltham, MA, USA) to extract total RNA, which was then reverse-transcribed using M-MLV reverse transcriptase (2641A, Takara, Dalian, China) and random primers (3801, Takara) to obtain cDNA. PCR mixtures were prepared and reaction conditions were set according to the instructions of the Premix Ex Taq™ kit (RR390A, Takara). PCR was performed using an ABI7500 qPCR instrument (Applied Biosystems, Shanghai, China), with β-actin as the mRNA internal reference. Data were analyzed using the 2 -ΔΔCt method: ΔΔCt = (Ct target gene – Ct reference gene ) experimental group – (Ct target gene – Ct reference gene ) control group . The primer sequences are listed in Table 1 Table 1. Primer sequences used in the study Gene symbol Primer sequence IHH-F TGTTGGTCATGGATGGGGTG IHH-R ACTTGGGCTCTAGTGGTCTCA β-actin-F GTGGCTGGCTCAGAAAAAGG β-actin-R GGGGAGATTCAGTGTGGTGG F, forward primer; R, reverse primer. . F, forward primer; R, reverse primer. The total tissue protein was quantified using a BCA kit (23227, Thermo Fisher Scientific). Membranes loaded with gel-separated proteins were first treated with 5% (w/v) powdered milk in PBS (10010023, Gibco, Waltham, MA, USA) for 1 h at 20–25°C and then incubated overnight at 4°C with primary antibodies (anti-IHH, 1.25 µg/ml, anti-GLI1, 1:1000, ab134906, Abcam; anti-GLI3, 1:400, ab181130, Abcam; anti-SMO, 1:1000, pa5-76145, Invitrogen; anti-proliferating cell nuclear antigen [PCNA], 1:3000, ab29, Abcam; anti-vimentin [vim], 1:20000, ab92547, Abcam; anti-von Willebrand factor [vWF], 1:1000, ab287962, Abcam; anti-β-actin, 1:1000, ab8226, Abcam). After the membranes were washed, they were incubated with secondary antibodies (1:5000, ab6721, Abcam) at room temperature for 1 h. Images were captured using a BioSpectrum imaging system (UVP, Upland, CA, USA). GraphPad Prism 8.0 was applied to the statistical analysis. All quantitative data are presented as mean ± SEM. The Shapiro–Wilk test was adopted to test the normality of data. Parameters of ≥ 3 groups were compared using a one-way analysis of variance followed by the Bonferroni test, while differences between 2 groups were analyzed using Student’s t -test. Statistical significance was denoted by P < 0.05.