Inhibition of PRMT5 triggers synthetic lethality in ARID1A-deficient endometrial cancer cells by promoting aberrant R-loop accumulation

preprint OA: closed
Full text JSON View at publisher
Full text 210,401 characters · extracted from preprint-html · click to expand
Inhibition of PRMT5 triggers synthetic lethality in ARID1A-deficient endometrial cancer cells by promoting aberrant R-loop accumulation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Inhibition of PRMT5 triggers synthetic lethality in ARID1A-deficient endometrial cancer cells by promoting aberrant R-loop accumulation Wan Shu, Kejun Dong, xiaoyu Shen, Xing Zhou, Jiarui Zhang, Shuyang Yu, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7702632/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 09 Mar, 2026 Read the published version in Molecular Cancer → Version 1 posted 12 You are reading this latest preprint version Abstract Background: Endometrial cancer (EC) is a common malignancy of the female reproductive system. The 5-year survival rate for advanced-stage EC patients is less than 20%, highlighting an urgent need for novel therapeutic strategies. ARID1A, a key subunit of the SWI/SNF chromatin remodeling complex, is one of the most frequently mutated genes in EC, presenting a potential avenue for synthetic lethal targeting of ARID1A-deficient EC. This study aims to identify novel synthetic lethal targets for ARID1A-deficient EC and to elucidate the underlying molecular mechanisms, thereby providing new insights for clinical treatment. Methods: The PRMT5 inhibitor JNJ-64619178 was identified via high-throughput compound screening as effectively inducing synthetic lethality in ARID1A-deficient EC cells. RNA-seq, comet assays, immunofluorescence, and Dot-blot experiments were employed to investigate DNA damage and R-loop accumulation. IP-MS, Co-IP, and proximity ligation (PLA) assays were used to detect interactions within the PRMT5-DHX9-R-loop axis. Chromatin immunoprecipitation‒PCR (ChIP‒PCR) experiments were performed to confirm that ARID1A directly transcriptionally regulates PRMT5. The synthetic lethal effect between PRMT5 inhibition and ARID1A loss was further validated using EC xenograft mouse models and patient-derived organoid models (PDOs). Results: In this study, based on high-throughput drug screening, we identified that the PRMT5 inhibitor JNJ-64619178 exerts a significant synthetic lethal effect on ARID1A-deficient EC. PRMT5 inhibition promoted DNA damage, apoptosis, and R-loop accumulation in ARID1A-deficient EC. This synthetic lethality was confirmed in ARID1A-deficient mouse models and PDOs. Mechanistically, we identified an association between ARID1A, PRMT5, and DHX9. Mechanistically, ARID1A directly binds the PRMT5 promoter and regulates its expression. ARID1A loss downregulates PRMT5, impairing arginine methylation and R-loop recruitment of DHX9—a key factor in R-loop resolution. Consequently, ARID1A-deficient cells become dependent on residual PRMT5 activity to maintain R-loop homeostasis. Inhibition of PRMT5 exacerbates R-loop accumulation and DNA damage, leading to synthetic lethality. Conclusion: This study identifies a novel synthetic lethal strategy for ARID1A-deficient EC, demonstrating that the PRMT5 inhibitor JNJ-64619178 acts by disrupting R-loop homeostasis. Our findings highlight the critical role of the ARID1A-PRMT5-DHX9 axis in tumor progression, thereby providing a novel molecular target and theoretical foundation for the precision treatment of ARID1A-deficient EC. ARID1A PRMT5 DHX9 R-loop Endometrial cancer synthetic lethality Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 1. Introduction Endometrial cancer (EC) is one of the most common malignancies of the female reproductive tract, predominantly occurring in perimenopausal and postmenopausal women [ 1 ]. With changing lifestyles, the global incidence of EC has been steadily increasing, with approximately 380,000 new cases reported worldwide in 2020, alongside a trend toward younger-onset disease [ 2 ]. Most EC patients are diagnosed when the tumor is confined to the uterus, resulting in a favorable prognosis with a 5-year survival rate of 80%–90%. However, advanced-stage (III–IV) or recurrent EC is associated with poor outcomes, with a 5-year survival rate below 20% [ 3 ]. The standard first-line treatment for advanced or recurrent EC consists of platinum-based chemotherapy (carboplatin plus paclitaxel), but its efficacy is often limited by chemoresistance [ 4 ]. Thus, there is an urgent clinical need to develop novel targeted therapies to improve survival outcomes in EC patients. Synthetic lethality refers to a genetic interaction between two or more genes, where a single gene defect does not compromise cell viability, but simultaneous defects in multiple genes result in lethality [ 5 ]. Given the prevalence of loss-of-function mutations in tumor suppressor genes, which are challenging to target directly, exploiting synthetic lethal relationships is promising for treating cancers driven by such mutations. Targeting synthetic lethal partners or pathways of mutated genes can selectively eliminate cancer cells [ 6 ]. The AT-rich interaction domain 1A (ARID1A) gene encodes BAF250, a critical subunit of the SWI/SNF chromatin remodeling complex [ 7 ]. The SWI/SNF complex utilizes ATP hydrolysis to remodel nucleosomes and regulate gene transcription. ARID1A is a frequently mutated tumor suppressor gene in various malignancies, including ovarian clear cell carcinoma (OCCC) [ 8 ], gastric cancer [ 9 ], and bladder cancer [ 10 ], and plays a pivotal role in epigenetic regulation, metabolic reprogramming, and DNA damage repair via chromatin accessibility modulation [ 11 ]. ARID1A mutations, reported in 37% of EC cases, are among the most common genetic alterations in EC and are associated with oncogenic cell transformation and a poor prognosis [ 12 ]. ARID1A mutations confer unique dependency characteristics in tumor cells, and this vulnerability, coupled with its high mutation frequency, positions ARID1A as one of the most promising molecular targets for synthetic lethality-based therapeutic strategies [ 13 ]. Several synthetic lethal targets that interact with ARID1A have been identified. ARID1A-deficient cells have been shown to be sensitive to EZH2 inhibitors in various tumor models, including colon and bladder cancer models [ 14 ]. Similar to EZH2, HDAC inhibitors, which modulate histone acetylation, have also demonstrated selective cytotoxicity against ARID1A-deficient tumors [ 15 ]. Additionally, ATR inhibitors exhibit synthetic lethality in ARID1A-deficient tumors [ 16 ], and accumulating evidence suggests that ARID1A deficiency impairs both nonhomologous end joining (NHEJ) and homologous recombination (HR) repair pathways. Consequently, ARID1A-deficient cells become critically dependent on PARP1-mediated DNA repair [ 17 ]. However, the significance of ARID1A in EC and its synthetic lethal targets remain insufficiently explored. Thus, investigating effective synthetic lethal strategies targeting ARID1A-deficient EC has the potential to yield novel clinical therapeutic approaches. Beyond its role in DNA damage repair and chromatin remodeling, ARID1A deficiency also render cancer cells vulnerable to perturbations in other epigenetic regulators. Arginine methylation is among the most common posttranslational modifications (PTMs) catalyzed by members of the arginine methylase family and plays a role in maintaining various biological functions [ 18 ]. Among these family members, type II protein arginine methyltransferase (PRMT5) mainly catalyzes the symmetric dimethylation of arginine (Arg, R) residues on histones and nonhistone proteins, which regulates important pathways of gene transcription, protein translation and signaling [ 19 ]. Based on the involvement of PRMT5 in a variety of biological functions, such as cell proliferation, the cell cycle, immune escape, chemotherapeutic resistance, and DNA damage, PRMT5 has become a promising anticancer target [ 20 ]. A variety of PRMT5 inhibitors have been developed for early clinical trials and have shown clinical promise in tumor-targeted therapy and immunotherapy [ 21 , 22 ]. Therefore, targeting PRMT5 may offer a promising therapeutic modality for cancer treatment. Given the high frequency of ARID1A mutations in EC and the lack of effective targeted therapies, we aimed to identify novel synthetic lethal vulnerabilities specific to ARID1A-deficient EC that could be exploited for the development of clinical therapies. Through high-throughput screening and mechanistic validation, we discovered that PRMT5 inhibitor JNJ-64619178 selectively kills ARID1A-deficient EC cells by disrupting R-loop homeostasis and causing DNA damage. Our findings demonstrate that ARID1A directly regulates PRMT5 expression, and PRMT5-mediated dimethylation enables the recruitment of DHX9 to resolve R-loops. ARID1A deficiency impairs this pathway, creating a dependency on PRMT5. The inhibition of PRMT5 exacerbates R-loop accumulation and synthetic lethality in ARID1A-deficient EC models. Our results reveal the ARID1A-PRMT5-DHX9 axis as a novel therapeutic target and provide a precision strategy for the precise treatment of ARID1A-deficient EC. 2. Materials and Methods 2.1. Cell Lines STR-authenticated Ishikawa, HEC-1-A, SKOV3, HEK293T, and human endometrial epithelial cells (hEECs) were obtained from Zhongqiao Xinzhou Biotechnology. Ishikawa cells were incubated in F12 medium (Servicebio, China), and SKOV3 cells were incubated in high-glucose DMEM medium (Servicebio, China), HEK293T cells were incubated in DMEM medium (Servicebio, China), HEC-1-A cells were incubated in McCoy's 5A medium (Servicebio, China), human endometrial epithelial cells (hEECs) were incubated in Specialized culture medium (Zhongqiao Xinzhou Biotechnology, China). All cells were cultured in medium supplemented with 10% fetal bovine serum and penicillin/streptomycin at 37°C under a humidified 5% CO2 atmosphere. All cells were treated with mycoplasma elimination agents. 2.2. Knockout of ARID1A by CRISPR-Cas9 Three sgRNA target sequences against ARID1A were designed: sgRNA1: 5′-ATGGTCATCGGGTACCGCTG-3′, sgRNA2:5′-CCCCTCAATGACCTCCAGTA-3′, sgRNA3: 5′-TCCTTCGCTCAGCAGCGCTT-3′. The sgRNAs were cloned into the CAS9-sgRNA-tag-EGFP vector (GeneChem; Shanghai; China). Plasmids were transfected into hEECs and Ishikawa cells using Lipofectamine 2000 (Invitrogen). Forty-eight hours post-transfection, EGFP-positive single cells were sorted by fluorescence-activated cell sorting (FACS) and plated into 96-well plates. Upon reaching sufficient density, cells were expanded. ARID1A knockout efficiency was validated by Western blot and Sanger sequencing. 2.3. Compound Library Screening A compound library containing 996 bioactive compounds was provided by TargetMol. ARID1A-deficient and ARID1A-WT hEECs and Ishikawa cells were seeded in 96-well plates at a density of 3000 cells per well. In the primary screening, ARID1A-deficient hEECs and Ishikawa cells were incubated with DMSO or 20 µM compound for 72 hours. Cell viability was measured using the CCK8 Assay to exclude compounds with limited efficacy in ARID1A-deficient cells (Cell viability > 50%). In the secondary screening, both ARID1A-deficient and ARID1A-WT hEECs were treated with the selected compounds at a concentration of 2.5 µM for 72h. The differences in inhibition rates between ARID1A-deficient and ARID1A-WT cells were calculated and ranked. The top 16 compounds exhibiting the greatest differential effects were advanced to half-maximal inhibitory concentration (IC50) determination. Finally, the synthetic lethal effects were evaluated by calculating the sensitivity index (SI).SI = the IC50 of ARID1A-WT cells / the IC50 of ARID1A- deficient cells. 2.4. CCK-8 Assay Cells were seeded at an appropriate density in 96-well plates at 3000 cells per well. After attachment, cells were treated with specified concentrations of drugs for indicated durations. Then, 10% CCK-8 reagent (Target Mol, C0005) was added and incubated at 37°C for 1–2 hours. The OD450 was measured using a microplate reader, and cell viability was calculated based on the average of triplicate wells. 2.5. Colony Formation Assay A total of 1,000 cells was seeded per well in 6-well plates. After compound treatment or siRNA transfection, the medium was replaced with fresh medium every 3 days for 12 days. Cells were fixed with 4% paraformaldehyde (Servicebio, China), for 15 minutes, stained with 0.1% crystal violet (Servicebio, China) for 30 minutes, and washed with PBS until the background was clear. Colonies were photographed and counted. 2.6. 5-Ethynyl-2′-deoxyuridine (EdU) assays Cells were incubated with 10 mM EdU at 37°C for 2 hours according to the manufacturer’s instructions (C0075S; Beyotime Biotechnology, China). After removal of the medium, cells were fixed for 15 minutes, permeabilized with 0.3% Triton X-100 for 15 minutes, incubated with Click Additive Solution in the dark for 30 minutes, and finally stained with Hoechst 33342 for 10 minutes. Images were captured using a fluorescence microscope. 2.7. Apoptosis Assay Apoptosis was detected using an apoptosis detection kit (C1062S; Beyotime Biotechnology). Cells were digested with EDTA-free trypsin (Servicebio, China), resuspended in 195 µL 1× Binding Buffer, and stained with 10 µL propidium iodide (PI) and 5 µL Annexin V-FITC in the dark for 30 minutes. Samples were analyzed by flow cytometry, and apoptosis rates were quantified using FlowJo software. 2.8. Quantitative Real-Time PCR (qRT-PCR) Total RNA was extracted using TRIzol (Takara, Japan). cDNA was synthesized using the Hieff Canace PCR Master Mix (10137ES; Yeasen Biotechnology, China). qRT-PCR was performed using Hieff Unicon® qPCR TaqMan Probe Master Mix (10138ES; Yeasen Biotechnology) on a Bio-Rad CFX96 system. Gene expression was normalized and calculated using the 2 −ΔΔCt method. PRMT5 forward primer:5'-CGATCAGACCTACTGCTGTCA-3', PRMT5 reverse primer: 5'-CTCGGAGTTCCTGCGAATCT-3' 2.9. Western Blotting Cells were lysed on ice for 30 minutes using RIPA buffer containing cocktail protease inhibitors, PMSF, and phosphatase inhibitors (Beyotime Biotechnology; Shanghai; China). Lysates were centrifuged at 12,000 rpm for 15 minutes. Proteins were separated by SDS-PAGE and transferred to PVDF membranes. Membranes were blocked with 5% skim milk for 2 hours, incubated with primary antibodies at 4°C overnight, and then with HRP-conjugated secondary antibodies for 1–2 hours. Protein bands were visualized using an ECL detection system. We obtained the following antibodies from the respective suppliers: 1:1,000-diluted anti-ARID1A (abcam, ab182560), anti-PRMT5(Proteintech,18436-1-AP), anti-DHX9(Proteintech,17721-1-AP), anti-SRSF1(Proteintech,12929-2-AP), anti-Symmetric Di-Methyl Arginine Motif (CST,13222), anti-cleaved caspase-3 (CST,9664), anti-cleaved-PARP(ABclonal,A27147), anti-p-ATM-S1981(ABclonal,AP0008), anti-phospho-histone H2A.X (Ser139) (Abmart,TA3187), and anti-Alpha Tubulin (Proteintech,14555-1-AP). 1:10,000 diluted anti-beta Actin (Proteintech,66009-1-Ig). 2.10. Small interfering RNA (siRNA) transfection The siRNAs targeting PRMT5 and ARID1A were designed, and synthesized (TsingkeBiotechnology; Beijing; China). The siRNAs were transfected into cells using LipoRNAi™ (C0535; Beyotime Biotechnology) for 48 hours. Knockdown efficiency was confirmed by Western blot. siRNA sequences: ARID1A siRNA1: 5′- GGUGACCUGAUUGCAGUAUTT-3′, ARID1A siRNA2: 5′- GCAGCAAGCAGCUGUUUAUTT-3′, PRMT5 siRNA1: 5′- GGAACCAAAGAUCAUACAUTT-3′, PRMT5 siRNA2: 5′- GCAGCAAACCUCAGGGAAATT-3′. 2.11. Immunofluorescence Cells cultured on coverslips were fixed with paraformaldehyde and permeabilized with 0.1% Triton X-100 (P0096; Beyotime Biotechnology). After blocking with 2% BSA for 1 hour, cells were incubated with anti-S9.6 (ENH001, Kerafast; diluted 1:200), anti-phospho-histone H2A.X (Ser139) (Abmart,TA3187;diluted 1:200), or anti-53BP1(Proteintech,20002-1-AP; diluted 1:200) antibodies at 4°C overnight, followed by secondary antibody incubation for 2 hours. Nuclei were stained with DAPI. Images were acquired using an Olympus FluoView™ FV1000 microscope. 2.12. Comet Assay The comet assay was performed using a comet assay kit (KGA1302-50; KeyGEN Bio TECH; Nanjing; China) following the manufacturer's protocol. A three-layer agarose was prepared on slides: the first layer consisted of 100 µL of 1% normal melting point agarose; the second layer contained 10⁴ cells embedded in 0.7% low melting point agarose; and the third layer was formed by adding another 100 µL of 0.7% low melting point agarose. The slides were solidified at 4°C for 30 minutes and then lysed using Lysis Buffer at 4°C for 2 hours. Subsequently, the slides were electrophoresed at 25volts for 25 min in alkaline buffer (0.186 g EDTA, 6 g NaOH, and 500 mL H₂O). The solution was neutralised using 0.4 mM Tris-HCl (pH 7.5) buffer. The slides were then stained with 10 µL of propidium iodide (PI) in the dark for 10 minutes. Finally, the slides were observed and imaged under a fluorescence microscope. 2.13. Co-Immunoprecipitation (Co-IP) Cells were lysed on ice for 30 minutes with IP lysis buffer (C0075S; Beyotime Biotechnology, China) supplemented with PMSF and phosphatase inhibitors (1:1:100). The protein lysate was collected after centrifugation at 12,000 rpm for 15 minutes. The Protein A/G magnetic beads (MedChemExpress; Shanghai; China)) were washed three times for 1 minute using IP wash buffer. The magnetic beads were added to the protein lysate. The protein lysate was then incubated with antibodies or control IgG overnight at 4°C with rotation. The beads were washed with wash buffer, and the bead-protein complexes were resuspended in 1× loading buffer. After heating at 95°C for 10 minutes, the magnetic beads were separated using a magnetic rack, and the protein complexes were collected. 2.14. Mass Spectrometry Analysis Mass spectrometry analysis was performed by Beijing Spectrum Union Biotechnology Co., Ltd. (1) Sample Preparation Proteins were denatured, reduced, and alkylated in the reaction buffer (1% SDC/100 mM Tris-HCl, pH = 8.5/10 mM TCEP/40 mM CAA) at 95°C for 10 minutes. After centrifugation, the supernatant was collected and diluted with an equal volume of ddH₂O. Trypsin was added, and the mixture was incubated overnight at 37°C with shaking for enzymatic digestion. (2) Mass Spectrometry Analysis All samples were analyzed on an UltiMate 3000 RSLCnano system coupled on-line with Q Exactive HF mass spectrometer through a Nanospray Flex ion source (Thermo). Peptide samples were injected into a C18 Trap column (75 µm*2 cm, 3 µm particle size, 100 Å pore size, Thermo), and separated in a reversed-phase C18 analytical column packed in-house with ReproSil-Pur C18-AQ resin (75 µm*25 cm, 1.9 µm particle size, 100 Å pore size). Mobile phase A (0.1% formic acid/3% DMSO/97% H2O) and mobile phase B (0.1% formic acid/3% DMSO/97% ACN) were used to establish the seperation gradient at a flow rate of 300 nL/min.Data were acquired in data-dependent acquisition (DDA) mode. (3) Database Search and Bioinformatic Analysis Raw mass spectrometry data were processed using MaxQuant (version 1.6.6.0) with the built-in Andromeda search engine. The search was performed against the human protein sequence database downloaded from UniProt (release 20230619). Bioinformatics analysis and visualization were conducted using R. Protein-protein interaction (PPI) networks were generated using the STRING database, and the resulting interaction files were imported into Cytoscape version 3.7.2 ( https://cytoscape.org/download.html ) for network construction and visualization. 2.15. Proximity Ligation Assay (PLA) The Duolink® In Situ PLA Kit (DUO92101, Sigma-Aldrich) was used according to the manufacturer’s instructions. Cells on slides were fixed, permeabilized, and blocked with Duolink® blocking buffer at 37°C for 60 minutes. S9.6 (ENH001, Kerafast) and DHX9(Proteintech,17721-1-AP) were diluted in Duolink antibody diluent and applied to the slides for 2 hours at 37°C. Slides were washed twice for 5 minutes using 1× Wash Buffer A. Duolink PLA probes (anti-rabbit minus (DUO92005) and anti-mouse plus (DUO92001)) were applied to the slides for 60 minutes at 37°C. After washing with 1× Wash Buffer A, the ligation solution was added and incubated for 30 minutes at 37°C. Slides were washed again, and the amplification solution was applied for 100 minutes at 37°C. Final washes were performed with 1× Wash Buffer B and 0.01× Wash Buffer B. Slides were mounted with Duolink In Situ containing DAPI and analyzed after 15 minutes using fluorescence or confocal microscopy. Average PLA foci were calculated by examining at least 50 cells per treatment in three different experiments. The number of PLA foci per nucleus were quantified using ImageJ. 2.16. R-Loop Dot Blot Assay Genomic DNA was isolated from cells using the DNeasy Blood & Tissue Kit (TsingkeBiotechnology; Beijing; China). The DNA concentration was serially diluted to 250 ng/µL, 125 ng/µL, and 62.5 ng/µL. A control group was treated with 5 units of RNase H (M0297, New England Biolabs). 2µL DNA were spotted onto a nitrocellulose membrane and crosslinked under UV light. The membrane was blocked with 5% non-fat milk for 1 hour, followed by overnight incubation at 4°C with the R-loop-specific antibody S9.6 (ENH001, Kerafast; diluted 1:200). After washing three times, the membrane was incubated with HRP-conjugated goat anti-mouse IgG secondary antibody. R-loop signals were visualized using enhanced chemiluminescence (ECL) substrate, and methylene blue staining was used as a loading control. 2.17. Plasmid Transfection Flag-PRMT5, mCherry-RNASEH1, HA-DHX9, HA-DHX9 mutants (R1219K, R1223K, R1227K), and Flag-ARID1A plasmids were provided by GenChem (Shanghai; China). Transfection was performed using Lipofectamine 2000 (Invitrogen; 11668019). 2.18. RNA Sequencing RNA was extracted using TRIzol. Libraries were prepared using the Optimal Dual-mode mRNA Library Prep Kit (BGI) and sequenced on an MGISEQ-2000 (CapitalBio). Differential expression was defined as |log2FC| ≥ 1 and FDR < 0.05. The Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways was analyzed using R software with a significance threshold of P < 0.05. 2.19. Protein Docking The crystal structure of PRMT5 (PDB ID: 3UA4) was retrieved from the Protein Data Bank (PDB). The sequence of DHX9 (UniProt ID: Q08211, human) was obtained from UniProt, and its three-dimensional structure was predicted using AlphaFold. Both protein structures were subjected to preprocessing, including regeneration of native ligand states, hydrogen bond assignment optimization, protein energy minimization, and removal of water molecules. Protein-protein docking was performed using the Piper module within the Schrödinger suite, and the corresponding binding energy was calculated. 2.20. Multiplex Immunohistochemistry Paraffin sections were deparaffinized, rehydrated, and subjected to antigen retrieval using microwave treatment. Sections were blocked with peroxidase blocking buffer and immunohistochemical blocking buffer (C0075S; Beyotime Biotechnology, China) for 20–30 minutes. The anti-ARID1A (abcam, ab182560; diluted 1:200) and anti-PRMT5 (Proteintech,18436-1-AP; diluted 1:200) were applied overnight at 4°C, followed by HRP-conjugated secondary antibodies for 30 minutes. After repeated antigen retrieval, subsequent antibodies were stained sequentially. Nuclei were stained with DAPI, and slides were mounted with anti-fade mounting medium. Fluorescence signals were scanned and quantified. 2.21. Chromatin Immunoprecipitation (ChIP) ChIP was performed using a ChIP assay kit (P2078, Beyotime) following the manufacturer's protocol. Cells were crosslinked with 1% formaldehyde at room temperature for 10 min, and the reaction was terminated by adding glycine. Cells were then lysed on ice for 10 min using SDS lysis buffer containing PMSF, followed by chromatin fragmentation through sonication for 10 min. The sheared chromatin was immunoprecipitated with ARID1A (CST, #12354) or control IgG (B900610, Proteintech, China) at 4°C overnight. Pre-washed Protein A/G magnetic beads were added to capture the complexes and incubated at 4°C overnight. After washing the beads to remove non-specific binding, DNA was purified and dissolved in TE buffer. The Chip DNA was quantified by qRT-PCR. The FIMO was used to predict potential binding sites on the PRMT5 promoter using the ARID1A binding motif from the HOCOMOCOv13 database. Based on the location of these predicted binding sites, corresponding primers were designed. The primers targeting PRMT5 promoter used for ChIP-qPCR were: PRMT5 site1 forward primer: GGCACTGTTTCTCTCCGTGA, PRMT5 site1 reverse primer: CCACCAATCTCAGGGTCTGG, PRMT5 site2-4 forward primer: CATGGCTGCATAACCCAACC, PRMT5 site2-4 reverse primer : AGATTCCAGGTTCGACTCCT , PRMT5 site3-6 forward primer: TCACTAGGAAGTAGTAGCTGAGT, PRMT5 site3-6 reverse primer: CCGTAACTACCCTCAAAAGTGTTT, PRMT5 site5 forward primer: TGTCTTTCCTTGCTTCCTTCCT, PRMT5 site5 reverse primer: ACACACACACACACCTCAAGA. 2.22. Patient Samples EC and normal endometrial tissues were obtained from Union Hospital, Huazhong University of Science and Technology. All participants provided written informed consent. The study was approved by the Institutional Ethics Committee (No. 2020-S218) and conducted in accordance with the Declaration of Helsinki. 2.23. Establishment of Patient-Derived Organoids (PDOs) Fresh EC tumor tissues were collected to establish PDOs. The tissues were cut into small pieces, rinsed three times with ice-cold DPBS supplemented with streptomycin and penicillin, and digested for 1 hour at 37°C using MasterAim® Tissue Digestion Buffer I and II (AimingMed, Hangzhou, China). The suspension was filtered through a 70 µm strainer and washed with DPBS, followed by centrifugation at 400g for 5 minutes. The cells were then resuspended in MasterAim® Matrix (AimingMed, Hangzhou, China) and seeded into pre-warmed 24-well plates. After gelation at 37°C for 10 minutes, 500 µL of specialized organoid culture medium (AimingMed, Hangzhou, China) was added to each well. For hematoxylin and eosin (H&E) staining, fixed organoids were pre-embedded in 2% agarose, followed by dehydration, clearing, and paraffin infiltration. The samples were then embedded in paraffin, and 4 µm-thick sections were prepared. These sections were subsequently deparaffinized, rehydrated, and stained with H&E. The establishment of PDOs was reviewed and approved by the Ethics Committee (CTOB-2025-0917). 2.24. Xenograft Model Six-week-old female BALB/c nude mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. Subcutaneous xenografts were established by injecting 5×10⁵ Luciferase-labeled ARID1A WT or ARID1A-deficient Ishikawa cells. When tumor volume reached ~ 100 mm³, the mice were randomized into four groups (n = 6): ARID1A WT + saline; ARID1A WT + 10 mg/kg JNJ-64619178; ARID1A-deficient + saline; ARID1A-deficient + 10 mg/kg JNJ-64619178. Treatments were administered every two days for 18 days. Tumor volume was measured every three days using the formula: (length × width²)/2. In vivo fluorescence imaging was performed weekly. Body weight was monitored regularly. Mice were sacrificed after 25 days, and tumors were weighed, fixed in formalin, paraffin-embedded, and subjected to H&E staining and immunohistochemical analysis. All animal procedures were approved by the Ethics Committee of Union Hospital, Huazhong University of Science and Technology (2024–4794). 2.25. Statistical analysis Data analysis and visualizations were performed using GraphPad Prism 9. All data were expressed as mean ± SD deviation. T-test was used to compare two groups, and one-way ANOVA was used to compare multiple groups. Statistical significance was defined at P < 0.05. Significance was indicated as follows: *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. ns, non-significant. 3. Results 3.1. ARID1A mutational signatures in endometrial cancer (EC) To investigate the landscape of ARID1A mutations in EC, we analyzed MSK-IMPACT clinical sequencing data from 1,022 EC patients using the cBioPortal platform ( http://www.cbioportal.org/ ) [ 23 ]. ARID1A ranks among the top three most frequently mutated genes in EC (62.8%) (Fig. 1 A- 1 B). We further analyzed the mutation frequencies and types of ARID1A across four molecular subtypes: CN-L/NSMP (56.1%), MSI-H (80.3%), POLE-mutant (64.9%), and CN-H/TP53 (19.4%). Strikingly, truncating mutations (indicated by black bars) constituted the predominant variant type in all molecular subtypes, resulting in functional inactivation of the ARID1A protein (Fig. 1 C). 3.2. High-throughput drug screening identifies PRMT5 inhibition JNJ-64619178 as a synthetic lethal strategy in ARID1A-deficient EC cells. To further explore synthetic lethal targets of ARID1A, we generated ARID1A knockout cell models using CRISPR-Cas9 system in ARID1A-WT human endometrial epithelial cells (hEECs) and Ishikawa cells (Fig. 2 A). To identify druggable vulnerabilities, we conducted high-throughput screening in ARID1A-WT hEECs and Ishikawa cells (Fig. 2 B). A library of 966 bioactive compounds was screened to identify compounds inducing synthetic lethality in ARID1A-deficient cells. Initial screening at 20 µM for 72h in ARID1A-deficient Ishikawa cells and hEECs excluded compounds with less than 50% inhibition, yielding 294 candidates for further evaluation (Fig. 2 C). These compounds were then tested at 2.5 µM to compare the inhibition rates between ARID1A-deficient and ARID1A WT Ishikawa cells (Fig. 2 D). The top 16 compounds showing the greatest differential inhibition were selected for half-maximal inhibitory concentration (IC50) determination (Fig. 2 E). We then calculated the sensitivity index for the 16 compounds (IC50 of ARID1A WT cells/IC50 of ARID1A-deficient cells). Seven candidate compounds with sensitivity indices (SI) ≥ 3 were ultimately identified: HDAC6 inhibitor (CAY10603), HMGCR inhibitor (Simvastatin), JAK/STAT3 inhibitor (Homoharringtonine), BET inhibitor((R)-(-)-JQ1 Enantiomer), PRMT5 inhibitors (JNJ-64619178, MRTX9768), ATR inhibitors (Ceralasertib) (Fig. 2 E). As shown in the IC50 curves, the PRMT5 inhibitor JNJ-64619178 exhibited the highest sensitivity index (7.62;9.60) and significantly inhibited the viability of ARID1A-deficient hEECs (IC50 = 1.03µM) and Ishikawa cells (IC50 = 0.70µM) (Fig. 2 F). Based on these results, our study selected JNJ-64619178 as the core synthetic lethal compound targeting ARID1A-deficient EC. 3.3. PRMT5 inhibition exhibits synthetic lethality in ARID1A-deficient EC cells. We further validated the synthetic lethal effect of JNJ-64619178 in ARID1A-deficient hEECs and Ishikawa cells. Colony formation assays demonstrated that the PRMT5 inhibitor suppressed colony formation in ARID1A-deficient hEECs and Ishikawa cells in a dose-dependent manner, with significant anticancer effects observed at 2.5 µM (Fig. 3 A). Similar effects were observed in ARID1A-mutated SKOV3 and HEC-1-A cells (Fig. 3 B). EdU assays further confirmed that JNJ-64619178 markedly inhibited the proliferation of ARID1A-deficient cells (Fig. 3 C). These results indicate that JNJ-64619178 selectively inhibits the proliferation of ARID1A-deficient cells. To confirm that PRMT5 is the key mediator of synthetic lethality in ARID1A-deficient cells, we knocked down PRMT5 using siRNA in ARID1A-deficient hEECs and Ishikawa cells (Fig. 3 D). CCK-8 (Fig. 3 E) and colony formation (Fig. 3 F) assays revealed that PRMT5 knockdown significantly reduced cell viability and colony formation in ARID1A-deficient hEECs and Ishikawa cells but did not significantly inhibited ARID1A-WT cells. To determine whether the synthetic lethal effect of PRMT5 inhibition depends on the ARID1A status, we reintroduced WT ARID1A into ARID1A-deficient hEECs and Ishikawa cells (Fig. 3 G). CCK-8 (Fig. 3 H) and colony formation (Fig. 3 I) assays demonstrated that ARID1A overexpression reversed the anticancer effects of PRMT5 inhibition. These findings confirm a synthetic lethal interaction between ARID1A and PRMT5. 3.4. PRMT5 inhibition promotes apoptosis in ARID1A-deficient EC cells To elucidate the mechanism by which PRMT5 inhibition induces apoptosis in ARID1A-deficient cells, we performed transcriptomic sequencing of ARID1A-deficient Ishikawa cells treated with JNJ-64619178. Gene Ontology (GO) enrichment analysis revealed that PRMT5 inhibition regulates the DNA damage response in ARID1A-deficient cells (Fig. 4 A). Concurrently, KEGG pathway analysis indicated significant enrichment of apoptosis-related pathways (Fig. 4 B). Flow cytometry apoptosis assays confirmed that JNJ-64619178 markedly increased the proportion of late apoptosis cells in ARID1A-deficient Ishikawa cells (from 3.45% to 30.72%, p < 0.0001) and ARID1A-deficient hEECs (from 3.9% to 25.33%, p < 0.0001) but had no significant proapoptotic effect on ARID1A-WT Ishikawa cells or hEECs (Fig. 4 C). Additionally, JNJ-64619178 enhanced late apoptosis in HEC-1-A and SKOV3 cells. WB analysis revealed that JNJ-64619178 upregulated the expression of the apoptosis markers cleaved caspase-3 and cleaved PARP in ARID1A-deficient cells (Fig. 4 D). These results demonstrate that JNJ-64619178 specifically promotes apoptosis in ARID1A-deficient cells. 3.5. PRMT5 inhibition promotes DNA damage in ARID1A-deficient EC cells To investigate whether PRMT5 inhibition induces DNA damage in ARID1A-deficient EC cells, we assessed the expression of the DNA damage markers γ-H2AX and 53BP1 by immunofluorescence. Both JNJ-64619178 and PRMT5 knockdown promoted the formation of γ-H2AX and 53BP1 foci in ARID1A-deficient Ishikawa and hEECs, with no significant DNA damage foci observed in ARID1A-WT cells (Fig. 5 A). Comet assays further revealed that JNJ-64619178 increased DNA tail length in ARID1A-deficient cells (Fig. 5 B). WB analysis revealed that compared with ARID1A-WT cells, PRMT5 inhibition upregulated γ-H2AX and p-ATM expression in ARID1A-deficient cells in a dose-dependent manner (Fig. 5 C). Collectively, these findings indicate that PRMT5 inhibition induces significant DNA damage in ARID1A-deficient EC cells. 3.6. PRMT5 inhibition-induced DNA damage is associated with aberrant R-loop accumulation Given that PRMT5 is a key arginine methyltransferase, we sought to explore the mechanism underlying its role in DNA damage induction. We performed pull-down assays coupled with mass spectrometry to identify PRMT5-interacting proteins in Ishikawa cells. Protein network analysis revealed that PRMT5 regulates various proteins involved in RNA metabolism and processing (Fig. 6 A), many of which are closely associated with R-loop regulation (including DHX9, SRSF1, DDX21, NAT10, TOP2A, and TOP1). To determine whether PRMT5 inhibition leads to an increase in R-loop levels, we assessed R-loop accumulation using dot-blot assays and immunofluorescence with the S9.6 antibody [ 24 ]. Immunofluorescence experiments demonstrated that both PRMT5 knockdown and JNJ-64619178 significantly increased R-loop accumulation in ARID1A-deficient Ishikawa cells and hEECs compared with that in ARID1A-WT cells (Fig. 6 B). Dot-blot assays indicated that JNJ-64619178 promotes R-loop accumulation in ARID1A-deficient cells (Fig. 6 C). These results demonstrated that PRMT5 inhibition induces excessive accumulation of R-loops in ARID1A-deficient cells. Previous studies have established that pathological R-loop accumulation is a major cause of replication stress [ 25 ]. We therefore hypothesized that PRMT5 inhibition promotes DNA damage and apoptosis by regulating R-loops. To test this hypothesis, we overexpressed RNase H1(an enzyme that specifically resolves R-loop accumulation) [ 26 ] to reduce R-loop accumulation. The results showed that RNase H1 overexpression significantly attenuated R-loops accumulation induced by PRMT5 inhibition in ARID1A-deficient cells (Fig. 6 B- 6 C). Consistent with this effect, overexpression of RNase H1 not only reduced DNA tail length (Fig. 6 D) but also suppressed the expression of γ-H2AX and 53BP1, as revealed by immunofluorescence staining in ARID1A-deficient Ishikawa cells and hEECs (Fig. 6 E). Furthermore, RNase H1 downregulated the expression of γ-H2AX, cleaved caspase-3, and cleaved PARP in ARID1A-deficient cells (Fig. 6 F). These results collectively indicate that R-loop regulation plays a critical role in PRMT5 inhibition-induced DNA damage and apoptosis in ARID1A-deficient cells. 3.7. PRMT5 Regulates R-Loop Resolution by Binding and Methylating DHX9 We next investigated the mechanism by which PRMT5 inhibition promotes R-loop accumulation in ARID1A-deficient cells. PRMT5 is a type II enzyme primarily responsible for symmetric dimethylarginine (SDMA) modification. Using the PhosphoSitePlus database (phosphosite.org), we analyzed arginine dimethylation sites on PRMT5-interacting R-loop regulatory proteins (including DHX9, SRSF1, DDX21, NAT10, TOP2A, and TOP1) and identified multiple potential SDMA sites on DHX9 and SRSF1. Endogenous co-IP assays in Ishikawa cells and hEECs confirmed interactions between PRMT5 and both DHX9 and SRSF1(Fig. 7 A). To further determine whether PRMT5 regulates SDMA of DHX9 and SRSF1, we examined the arginine dimethylation levels of DHX9 and SRSF1 in PRMT5-inhibited Ishikawa and hEECs using an anti-SDMA antibody. Subsequent analysis of the SDMA levels revealed that compared with SRSF1, JNJ-64619178 and PRMT5 knockdown caused a more pronounced reduction in the arginine methylation of DHX9 (Fig. 7 B). We therefore focused on the PRMT5–DHX9 axis. Exogenous immunoprecipitation experiments were performed by co-expressing FLAG-tagged PRMT5 and HA-tagged DHX9, the results further validated the interaction between PRMT5 and DHX9 (Fig. 7 C). Recent studies indicate that DHX9 can be recruited to R-loops, facilitating R-loops resolution and contributing to genomic stability (25). We therefore hypothesized that PRMT5 inhibition impairs the recruitment of DHX9 to R-loops. A proximity ligation assay (PLA) revealed that JNJ-64619178 and PRMT5 knockdown significantly reduced the number of nuclear DHX9-R-loop PLA foci, indicating that the interaction between DHX9 and R-loops was impaired (Fig. 7 D). Thus, we propose that PRMT5 inhibition reduces the arginine methylation of DHX9, decreasing its recruitment to R-loops and leading to R-loop accumulation. 3.8. Arginine methylation of DHX9 mediated by PRMT5 suppresses R-loop accumulation and DNA damage To identify specific arginine methylation sites on DHX9, we performed protein‒protein docking (Fig. 8 A) and used PhosphoSitePlus to predict potential arginine methylation sites (Fig. 8 B). Four arginine(R)-to-lysine (K) mutations (R1175K, R1219K, R1223K, and R1227K) and DHX9 wild-type (WT) were generated and co-transfected with Flag-PRMT5 in HEK293T cells. Mutations at residues 1219, 1223, and 1227 reduced the arginine methylation level of DHX9, compared to DHX9-WT. A triple mutation (DHX9-3RK: R1219K/R1223K/R1227K) significantly suppressed the SDMA of DHX9 (Fig. 8 C). We next sought to determine whether methylation at residues R1219, R1223, and R1227 of DHX9 influences its recruitment to R-loop structures. We transfected the DHX9-WT and DHX9-3RK in hEECs treated with siPRMT5. The results showed that overexpressed of the DHX9-WT, but not the DHX9-3RK, restored DHX9 recruitment to R-loops, as assessed by PLA, indicating that R1219, R1223, and R1227 are critical sites for the PRMT5-mediated methylation of DHX9 (Fig. 8 D- 8 E). We further reintroduced the DHX9-WT or DHX9-3RK in ARID1A-deficient Ishikawa cells and hEECs treated with siPRMT5 or JNJ-64619178. Dot-blot assays (Fig. 8 F) and S9.6 immunofluorescence staining (Fig. 8 G) demonstrated that overexpression of DHX9-WT, but not DHX9-3RK, significantly suppressed R-loop accumulation. Consistent with this finding, DHX9-WT expression also attenuated PRMT5 inhibition-induced DNA damage, as indicated by shorter comet tail lengths (Fig. 8 I) and reduced γ-H2AX expression (Fig. 8 I- 8 J). In contrast, the DHX9-3RK failed to confer such protective effects. These findings demonstrate that arginine methylation at residues R1219, R1223, and R1227 of DHX9 plays a crucial role in the PRMT5-mediated maintenance of R-loop homeostasis and facilitation of DNA damage repair. 3.9. ARID1A deficiency leads to a reliance on PRMT5 for R-loop homeostasis due to impaired direct activation of the PRMT5 promoter. Finally, we explored why ARID1A-deficient cells exhibit heightened vulnerability to PRMT5 inhibition compared with ARID1A-WT cells. Analysis of data from the GEPIA database revealed a positive correlation between ARID1A and PRMT5 expression (Fig. 9 A). PCR (Fig. 9 B) and WB assays (Fig. 9 C-CE) further revealed that ARID1A knockdown downregulated PRMT5 expression at both the mRNA and protein levels in Ishikawa cells and hEECs, whereas ARID1A overexpression upregulated PRMT5 expression in ARID1A-deficient Ishikawa cells and hEECs. Multiplex IHC of clinical samples revealed revealed that the expression levels of both ARID1A and PRMT5 were significantly downregulated in EC tissues compared to normal endometrial tissues (Fig. 9 F). A positive correlation was observed between ARID1A and PRMT5 expression. These findings suggest that ARID1A may transcriptionally regulate PRMT5 to maintain R-loop homeostasis. Using the ARID1A binding motif from HOCOMOCOv13 data base, potential binding sites on the PRMT5 promoter were predicted by FIMO (Fig. 9 G). We then designed four pairs of primers covering the potential binding sites of PRMT5 (Fig. 9 H). ChIP assays were performed to determine whether PRMT5 is a direct transcriptional target of ARID1A. The results demonstrated that ARID1A binds to all four predicted regions (primer sets 1–4), with the highest enrichment observed for primer set 2 ( the region from − 1476 to -1633 bp upstream of the transcription start site), while the other regions showed relatively weaker binding signals(Fig. 9 I- 9 J). These results indicate that ARID1A directly binds to the PRMT5 promoter region. Thus, ARID1A loss leads to reduced PRMT5 expression, which may contribute to baseline R-loop accumulation. Subsequent PRMT5 inhibition further exacerbates R-loop accumulation by impairing the function of DHX9, ultimately leading to DNA damage and apoptosis specifically in ARID1A-deficient cells. 3.10. Validation of the synthetic lethal interaction between PRMT5 and ARID1A in patient-derived organoids (PDOs) and xenografts. To further validate the synthetic lethal interaction between PRMT5 inhibition and ARID1A deficiency in EC, we established EC PDOs (Fig. 10 A). The successful formation of PDOs was confirmed by H&E staining, as well as by IHC for Ki-67 and CD133 (Fig. 10 B). We knocked down ARID1A in the EC PDOs and treated both ARID1A-WT and ARID1A-knockdown EC PDOs with 2.5 µM JNJ-64619178. The results demonstrated that JNJ-64619178 significantly inhibited the proliferation of ARID1A-knockdown PDOs, further supporting the synthetic lethal interaction between ARID1A and PRMT5 (Fig. 10 C). To evaluate the antitumor efficacy of JNJ-64619178 in vivo, we utilized a xenograft mouse model. Luciferase-labeled ARID1A-deficient or ARID1A-WT Ishikawa cells were subcutaneously injected into nude mice (Fig. 10 D). When the tumor volume reached approximately 100 mm³, the mice were randomly divided into four groups and treated with either 10 mg/kg JNJ-64619178 or an equivalent volume of saline control every other day for 18 days, and tumor growth was monitored. In vivo bioluminescence imaging demonstrated that JNJ-4619178 significantly suppressed the growth of ARID1A-deficient tumors compared with ARID1A-WT tumors (Fig. 10 E- 10 F). The imaging of xenograft tumors after mouse sacrifice further confirmed that JNJ-64619178 markedly inhibited the proliferation of ARID1A-KO tumors (Fig. 10 G) and reduced the weight of xenografts (Fig. 10 H). Immunohistochemistry analysis revealed that JNJ-64619178 promoted the expression of γ-H2AX and decreased the expression of Ki-67 (Fig. 10 I). These in vivo results are consistent with the synthetic lethality observed in vitro, collectively demonstrating that JNJ-64619178 induces synthetic lethality in ARID1A-deficient EC both in vitro and in vivo. In terms of safety, compared with the normal control group, mice treated with JNJ-4619178 showed no significant body weight loss (Fig. 10 J). Moreover, histopathological examination of the heart, liver, spleen, lungs, and kidneys indicated that JNJ-64619178 was well-tolerated without causing significant toxicity (Fig. 1 S). 4. Discussion ARID1A, a specific subunit of the PBAF chromatin remodeling complex, is frequently mutated in EC. However, effectively treating ARID1A-deficient tumors remains a clinical challenge. A synthetic lethality strategy has been employed to target tumor suppressor gene-mutated cancers. To identify novel approaches for targeting ARID1A-deficient cancers, we conducted high-throughput screening and, for the first time, discovered that ARID1A-deficient cells are sensitive to PRMT5 inhibitors. The PRMT5 inhibitor JNJ-64619178 also demonstrated efficacy in ARID1A-deficient EC xenograft mouse models and organoid models. Specifically, we found that PRMT5 inhibition promotes DNA damage and apoptosis in ARID1A-deficient cells. Aberrant R-loop accumulation is the primary driver of synthetic lethality. ARID1A deficiency downregulates PRMT5 expression by acting on its promoter, leading to replication stress in tumor cells. PRMT5 inhibition further disrupts DHX9-mediated R-loop homeostasis, resulting in excessive R-loop accumulation in ARID1A-deficient tumors and subsequent DNA damage. In summary, our discovery provides a novel therapeutic strategy for targeting ARID1A-deficient EC. Recent studies have demonstrated that targeting the DNA damage response (DDR) pathway represents a promising synthetic lethal strategy for selectively eliminating ARID1A-deficient tumors. For example, Zihuan Wang et al. reported that, compared with ARID1A-wildtype (WT) cells, RITA is more likely to trigger p53 activation and DNA damage accumulation in ARID1A-deficient cancer cells[ 27 ]. Cheng Xiang et al. reported that the anticancer drug FUDR induces DNA damage and promotes apoptosis in ARID1A-deficient colorectal cancer (CRC) cells [ 28 ]. Through high-throughput compound screening, we found that PRMT5 induces synthetic lethality in ARID1A-deficient cells by promoting DNA damage accumulation. PRMT5, an epigenetic regulator, is aberrantly expressed in various cancers and promotes tumor progression through multiple mechanisms. PRMT5 binds to EZH2 and promotes colorectal cancer progression through the epigenetic inhibition of CDKN2B expression[ 29 ]. In addition, PRMT5 has been shown to maintain genomic stability by regulating DNA replication, cell cycle progression, and double-strand break (DSB) repair [ 30 ]. A FACS-based genome-wide CRISPR screen revealed that PRMT5 is a key regulator of DNA damage signaling, with PRMT5 inhibition significantly downregulating ATM expression and sensitizing cells to DNA-damaging inducers [ 31 ]. To elucidate the mechanism underlying PRMT5 inhibitor-induced synthetic lethality in ARID1A-mutated EC cells, we performed RNA-seq and KEGG and GO enrichment analyses, which revealed significant enrichment in pathways related to DNA damage and apoptosis. Further validation by immunofluorescence and comet assays revealed that PRMT5 inhibition increased γ-H2AX foci and comet tail length in ARID1A-deficient cells, accompanied by increased apoptosis. Thus, we conclude that PRMT5 inhibition induces synthetic lethality in ARID1A-deficient cells primarily by triggering DNA damage responses. R-loops are three-stranded nucleic acid structures composed of RNA: DNA hybrids and single-stranded DNA, and their aberrant accumulation leads to genomic instability and DNA damage [ 32 , 33 ]. Selectively targeting cancer cells dependent on R-loop regulation has emerged as a novel synthetic lethality strategy in recent years. In cancers driven by specific genetic alterations (e.g., MYC amplification, ARID1A deficiency, or BRCA mutation), promoting pathological R-loop accumulation by modulating R-loop regulatory genes can suppress tumor progression. In MYC-driven breast cancers, TOP1 inhibitors induce synthetic lethality by promoting aberrant R-loop accumulation [ 34 ]. The inactivation of polybromine 1 (PBRM1), a specific subunit of the PBAF chromatin remodeling complex, frequently occurs in cancer. PBRM1-deficient tumors exhibit high levels of replication stress, micronuclei, and R-loops, rendering them vulnerable to PARP and ATR inhibitors, which exacerbate these phenotypes [ 35 ]. In our study, we found that PRMT5 interacts with multiple R-loop regulatory genes and that pathological R-loops can trigger DNA damage responses. We therefore demonstrated that PRMT5 inhibition led to R-loop accumulation and subsequent DNA damage. Our results revealed that compared with either ARID1A deficiency or PRMT5 inhibition alone, PRMT5 inhibition in ARID1A-deficient EC cells significantly increased R-loop accumulation. The overexpression of RNase H1 suppressed R-loop accumulation and attenuated PRMT5 inhibition-induced γ-H2AX expression and DNA comet tail elongation. These findings demonstrate that R-loop dysregulation is the core mechanism of synthetic lethality, as combined ARID1A and PRMT5 depletion disrupted R-loop homeostasis, leading to severe DNA damage responses and cell death. DHX9, a DExH-box DNA/RNA helicase, is a key R-loop regulator that modulates R-loop formation and resolution [ 36 ]. Posttranslational modifications of DHX9 are critical for maintaining R-loop homeostasis. SUMOylation of DHX9 at K120 enhances its interaction with R-loop-associated factors to maintain genomic integrity [ 37 ]. ATR phosphorylates DHX9 at Ser321 and Ser688 to promote R-loop resolution, and inhibiting DHX9 phosphorylation prevents its binding to R-loops, resulting in stress-induced R-loop accumulation and DNA damage [ 38 ]. AKT interacts with DHX9 to facilitate its recruitment to R-loops, and AKT inhibitors (AKTis) promote R-loop-mediated replication stress by impairing DHX9 localization [ 25 ]. DNYLRB2-AS1 stabilizes the DHX9 protein to prevent aberrant R-loop accumulation and DNA damage, thereby conferring resistance to gemcitabine (GEM) [ 39 ]. However, no study has reported whether the arginine methylation of DHX9 has a specific effect on the function of DHX9 in regulating R-loops. Through mass spectrometry and coimmunoprecipitation assays, our study is the first to reveal that PRMT5 regulates R-loop homeostasis by interacting with and methylating DHX9. PRMT5 inhibition reduces the degree of arginine dimethylation in DHX9, impairing its recruitment to R-loops and thus triggering pathological R-loop accumulation and DNA damage. This discovery expands the understanding of R-loop regulatory networks and provides new insights for targeted interventions. Recent studies have reported that ARID1A maintains R-loop homeostasis to ensure genomic stability. ARID1A recruits METTL3 to local DSBs to initiate m6A modification of R-loops, facilitating their recognition and resolution [ 40 ]. ARID1A deficiency increases R-loop abundance and replication stress [ 41 ], a finding corroborated by our study. As a chromatin regulator, ARID1A plays a pivotal role in controlling the expression of downstream target genes, including PIK3IP1[ 42 ], SLC7A11 [ 43 ], HMGCR [ 44 ], PTGS1/2 [ 45 ], and PKM2 [ 46 ]. Here, we found that ARID1A deficiency downregulates PRMT5 expression, and ChIP assays confirmed that ARID1A directly binds to the PRMT5 promoter. Clinical sample analyses further validated the correlation between ARID1A and PRMT5 expression. This regulatory relationship explains the heightened sensitivity of ARID1A-mutated cells to PRMT5 inhibition. ARID1A deficiency inherently reduces PRMT5 expression, compromising R-loop homeostasis, and PRMT5 inhibition exacerbates DHX9 dysfunction, resulting in a “double-hit” effect. Our study is the first to reveal that PRMT5 inhibition induces synthetic lethality in ARID1A-deficient EC cells by disrupting R-loop dynamic equilibrium. Specifically, the PRMT5 inhibitor JNJ-64619178 interferes with DHX9-mediated R-loop homeostasis, triggering synergistic R-loop accumulation and DNA damage in ARID1A-deficient EC. Our findings elucidate the key role of the ARID1A–PRMT5–DHX9 signaling axis in genomic stability and provide a novel targeted therapeutic strategy and scientific basis for treating ARID1A-deficient EC. Declarations Ethics approval and consent to participate The study was approved by the Animal Ethics Committee of the Tongji Medical College, Huazhong University of Science and Technology (Approval ID:2024-4794). Endometrial cancer and normal endometrial tissues were obtained from Union Hospital, Huazhong University of Science and Technology. All participants provided written informed consent. The study was approved by the Institutional Ethics Committee (No. 2020-S218) and conducted in accordance with the Declaration of Helsinki. The establishment of PDOs was reviewed and approved by the Ethics Committee (CTOB-2025-0917). Consent for publication All authors have read the manuscript and agree to publish. Author Contributions Statement H.W. and J.Z. designed the research. W.S., K.D., and X.S. conducted the assays and wrote the manuscript. J.Z., X.Z., S.Y., and S.C. prepared figures. T.Z., G.C., and G.Z. performed the statistical analyses. H.W. and J.Z. revised the paper. All authors read and approved the manuscript. Data availability Data will be made available on request. Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Funding This work was supported by grants from National key research and development plan (No. 2023YFC2705400), National Natural Science Foundation of China (Nos. 82472965, 82203684) References B.R. Corr, B.K. Erickson, E.L. Barber, C.M. Fisher, B. Slomovitz, Advances in the management of endometrial cancer, BMJ (Clinical research ed.), 388 (2025) e080978. A. Luzarraga Aznar, R. Canton, G. Loren, J. Carvajal, I. de la Calle, C. Masferrer-Ferragutcasas, F. Serra, V. Bebia, G. Bonaldo, M.A. Angeles, S. Cabrera, N. Palomar, C. Vilarmau, M. Martí, M. Rigau, E. Colas, A. Gil-Moreno, Current challenges and emerging tools in endometrial cancer diagnosis, International journal of gynecological cancer : official journal of the International Gynecological Cancer Society, 35 (2025) 100056. A.A. Francoeur, N. Ayoub, D. Greenberg, K.S. Tewari, Drug discovery in advanced and recurrent endometrial cancer: Recent advances, Oncology research, 33 (2025) 1511-1530. R.N. Eskander, M.W. Sill, L. Beffa, R.G. Moore, J.M. Hope, F.B. Musa, R.S. Mannel, M.S. Shahin, G.H. Cantuaria, E. Girda, E. Lokich, J. Kavecansky, C.A. Leath, 3rd, L.T. Gien, E.M. Hinchcliff, S.B. Lele, L.M. Landrum, F. Backes, R.E. O'Cearbhaill, T.A. Baghdadi, E.K. Hill, P.H. Thaker, V.S. John, S. Welch, A.N. Fader, M.A. Powell, C. Aghajanian, Pembrolizumab plus chemotherapy in advanced or recurrent endometrial cancer: overall survival and exploratory analyses of the NRG GY018 phase 3 randomized trial, Nature medicine, 31 (2025) 1539-1546. C.J. Ryan, L.P.S. Devakumar, S.J. Pettitt, C.J. Lord, Complex synthetic lethality in cancer, Nature genetics, 55 (2023) 2039-2048. N.J. Fu, Y.W. Sheng, Z. Fan, Z. Wu, L.Y. Li, R.Y. Xi, X.K. Shi, G.L. Zhang, F. Wang, Synthetic Lethality of SHP2 and XIAP Suppresses Proliferation and Metastasis in KRAS-mutant Nonsmall Cell Lung Cancer, Advanced science (Weinheim, Baden-Wurttemberg, Germany), 12 (2025) e2411642. H. Yamashita, K. Nakayama, K. Kanno, T. Ishibashi, M. Ishikawa, K. Iida, S. Razia, T. Kiyono, S. Kyo, Evaluation of ARID1A as a Potential Biomarker for Predicting Response to Immune Checkpoint Inhibitors in Patients with Endometrial Cancer, Cancers, 16 (2024). J.M. Perez, J. Ryu, H. Khan, M. Shetty, E. Parker, P. D'Arcy, S. Zhu, M. Bazzaro, S.N. Thomas, Proteomic Analysis of ARID1A-Deficient Ovarian Clear Cell Carcinoma Cells Reveals Differential Mitochondria ETC Subunit Abundances and Targetable Mitochondrial Pathways, International journal of molecular sciences, 26 (2025). Y. Gu, P. Zhang, J. Wang, C. Lin, H. Liu, H. Li, H. He, R. Li, H. Zhang, W. Zhang, Somatic ARID1A mutation stratifies patients with gastric cancer to PD-1 blockade and adjuvant chemotherapy, Cancer immunology, immunotherapy : CII, 72 (2023) 1199-1208. M.P. Scholtes, M. Akbarzadeh, A. Galaras, J.A. Nakauma-Gonzáles, A. Bazrafshan, V. Solanki, B. Torenvliet, L. Beikmohammadi, V. Lozovanu, S. Romal, P. Moulos, N. Vavouraki, T.W. Kan, M. Algoe, M.E. van Royen, A. Sacchetti, T.P.P. van den Bosch, B. Eussen, A. de Klein, G. van Leenders, J.L. Boormans, P. Hatzis, R.J. Palstra, T.C.M. Zuiverloon, T. Mahmoudi, Integrative analysis of patient-derived tumoroids and ex vivo organoid modelling of ARID1A loss in bladder cancer reveals therapeutic molecular targets, Cancer letters, 614 (2025) 217506. R. Mathur, ARID1A loss in cancer: Towards a mechanistic understanding, Pharmacology & therapeutics, 190 (2018) 15-23. M.R. Wilson, J.J. Reske, J. Holladay, G.E. Wilber, M. Rhodes, J. Koeman, M. Adams, B. Johnson, R.W. Su, N.R. Joshi, A.L. Patterson, H. Shen, R.E. Leach, J.M. Teixeira, A.T. Fazleabas, R.L. Chandler, ARID1A and PI3-kinase pathway mutations in the endometrium drive epithelial transdifferentiation and collective invasion, Nature communications, 10 (2019) 3554. K.Z. Hein, B. Stephen, S. Fu, Therapeutic Role of Synthetic Lethality in ARID1A-Deficient Malignancies, Journal of immunotherapy and precision oncology, 7 (2024) 41-52. B.G. Bitler, K.M. Aird, A. Garipov, H. Li, M. Amatangelo, A.V. Kossenkov, D.C. Schultz, Q. Liu, M. Shih Ie, J.R. Conejo-Garcia, D.W. Speicher, R. Zhang, Synthetic lethality by targeting EZH2 methyltransferase activity in ARID1A-mutated cancers, Nature medicine, 21 (2015) 231-238. S. Gupta, D.J. Albertson, T.J. Parnell, A. Butterfield, A. Weston, L.M. Pappas, B. Dalley, J.M. O'Shea, W.T. Lowrance, B.R. Cairns, J.D. Schiffman, S. Sharma, Histone Deacetylase Inhibition Has Targeted Clinical Benefit in ARID1A-Mutated Advanced Urothelial Carcinoma, Molecular cancer therapeutics, 18 (2019) 185-195. C.T. Williamson, R. Miller, H.N. Pemberton, S.E. Jones, J. Campbell, A. Konde, N. Badham, R. Rafiq, R. Brough, A. Gulati, C.J. Ryan, J. Francis, P.B. Vermulen, A.R. Reynolds, P.M. Reaper, J.R. Pollard, A. Ashworth, C.J. Lord, ATR inhibitors as a synthetic lethal therapy for tumours deficient in ARID1A, Nature communications, 7 (2016) 13837. Z.C. Yu, T. Li, E. Tully, P. Huang, C.N. Chen, P. Oberdoerffer, S. Gaillard, I.M. Shih, T.L. Wang, Temozolomide Sensitizes ARID1A-Mutated Cancers to PARP Inhibitors, Cancer research, 83 (2023) 2750-2762. M. Liu, B. Yao, T. Gui, C. Guo, X. Wu, J. Li, L. Ma, Y. Deng, P. Xu, Y. Wang, D. Yang, Q. Li, X. Zeng, X. Li, R. Hu, J. Ge, Z. Yu, Y. Chen, B. Chen, J. Ju, Q. Zhao, PRMT5-dependent transcriptional repression of c-Myc target genes promotes gastric cancer progression, Theranostics, 10 (2020) 4437-4452. S. Fu, Q. Zheng, D. Zhang, C. Lin, L. Ouyang, J. Zhang, L. Chen, Medicinal chemistry strategies targeting PRMT5 for cancer therapy, European journal of medicinal chemistry, 244 (2022) 114842. Z. Wang, R. Li, N. Hou, J. Zhang, T. Wang, P. Fan, C. Ji, B. Zhang, L. Liu, Y. Wang, J. Kong, Q. Yao, J. Duan, G. Zhao, R. Ling, J. Zhang, PRMT5 reduces immunotherapy efficacy in triple-negative breast cancer by methylating KEAP1 and inhibiting ferroptosis, Journal for immunotherapy of cancer, 11 (2023). J. Elurbide, L. Colyn, M.U. Latasa, I. Uriarte, S. Mariani, A. Lopez-Pascual, E. Valbuena, B. Castello-Uribe, R. Arnes-Benito, E. Adan-Villaescusa, L.A. Martinez-Perez, M. Azkargorta, F. Elortza, H. Wu, M. Krawczyk, K.M. Schneider, B. Sangro, L. Aldrighetti, F. Ratti, A. Casadei Gardini, J.J.G. Marin, I. Amat, J.M. Urman, M. Arechederra, M.L. Martinez-Chantar, C. Trautwein, M. Huch, F.J. Cubero, C. Berasain, G.F.-B. M, M.A. Avila, Identification of PRMT5 as a therapeutic target in cholangiocarcinoma, Gut, 74 (2024) 116-127. J. Carter, M. Hulse, M. Sivakumar, J. Burtell, V. Thodima, M. Wang, A. Agarwal, K. Vykuntam, J. Spruance, N. Bhagwat, J. Rager, B. Ruggeri, P. Scherle, K. Ito, PRMT5 Inhibitors Regulate DNA Damage Repair Pathways in Cancer Cells and Improve Response to PARP Inhibition and Chemotherapies, Cancer research communications, 3 (2023) 2233-2243. B. Weigelt, A. Marra, P. Selenica, E. Rios-Doria, A. Momeni-Boroujeni, M.F. Berger, K. Arora, D. Nemirovsky, A. Iasonos, D. Chakravarty, N.R. Abu-Rustum, A. Da Cruz Paula, K. Dessources, L.H. Ellenson, Y.L. Liu, C. Aghajanian, C.L. Brown, Molecular Characterization of Endometrial Carcinomas in Black and White Patients Reveals Disparate Drivers with Therapeutic Implications, Cancer discovery, 13 (2023) 2356-2369. L.A. Sanz, F. Chédin, High-resolution, strand-specific R-loop mapping via S9.6-based DNA-RNA immunoprecipitation and high-throughput sequencing, Nature protocols, 14 (2019) 1734-1755. T.T. Huang, C.Y. Chiang, J.R. Nair, K.M. Wilson, K. Cheng, J.M. Lee, AKT1 interacts with DHX9 to Mitigate R Loop-Induced Replication Stress in Ovarian Cancer, Cancer research, 84 (2024) 887-904. R. Arora, Y. Lee, H. Wischnewski, C.M. Brun, T. Schwarz, C.M. Azzalin, RNaseH1 regulates TERRA-telomeric DNA hybrids and telomere maintenance in ALT tumour cells, Nature communications, 5 (2014) 5220. Z. Wang, X. Zhang, Y. Luo, Y. Song, C. Xiang, Y. He, K. Wang, Y. Yu, Z. Wang, W. Peng, Y. Ding, S. Liu, C. Wu, Therapeutic targeting of ARID1A-deficient cancer cells with RITA (Reactivating p53 and inducing tumor apoptosis), Cell death & disease, 15 (2024) 375. C. Xiang, Z. Wang, Y. Yu, Z. Han, J. Lu, L. Pan, X. Zhang, Z. Wang, Y. He, K. Wang, W. Peng, S. Liu, Y. Song, C. Wu, ARID1A loss sensitizes colorectal cancer cells to floxuridine, Neoplasia (New York, N.Y.), 58 (2024) 101069. L. Yang, D.W. Ma, Y.P. Cao, D.Z. Li, X. Zhou, J.F. Feng, J. Bao, PRMT5 functionally associates with EZH2 to promote colorectal cancer progression through epigenetically repressing CDKN2B expression, Theranostics, 11 (2021) 3742-3759. P.J. Hamard, G.E. Santiago, F. Liu, D.L. Karl, C. Martinez, N. Man, A.K. Mookhtiar, S. Duffort, S. Greenblatt, R.E. Verdun, S.D. Nimer, PRMT5 Regulates DNA Repair by Controlling the Alternative Splicing of Histone-Modifying Enzymes, Cell reports, 24 (2018) 2643-2657. M. Huang, F. Yao, L. Nie, C. Wang, D. Su, H. Zhang, S. Li, M. Tang, X. Feng, B. Yu, Z. Chen, S. Wang, L. Yin, L. Mou, T. Hart, J. Chen, FACS-based genome-wide CRISPR screens define key regulators of DNA damage signaling pathways, Molecular cell, 83 (2023) 2810-2828.e2816. S. Zhang, Y. Liu, Y. Sun, Q. Liu, Y. Gu, Y. Huang, Z. Zeng, F. Tang, Y. Ouyang, Aberrant R-loop-mediated immune evasion, cellular communication, and metabolic reprogramming affect cancer progression: a single-cell analysis, Molecular cancer, 23 (2024) 11. M.P. Crossley, M. Bocek, K.A. Cimprich, R-Loops as Cellular Regulators and Genomic Threats, Molecular cell, 73 (2019) 398-411. P. Lin, C. Lourenco, J. Cruickshank, L. Palomero, J.E. van Leeuwen, A.H.Y. Tong, K. Chan, S. El Ghamrasni, M.A. Pujana, D.W. Cescon, J. Moffat, L.Z. Penn, Topoisomerase 1 Inhibition in MYC-Driven Cancer Promotes Aberrant R-Loop Accumulation to Induce Synthetic Lethality, Cancer research, 83 (2023) 4015-4029. R.M. Chabanon, D. Morel, T. Eychenne, L. Colmet-Daage, I. Bajrami, N. Dorvault, M. Garrido, C. Meisenberg, A. Lamb, C. Ngo, S.R. Hopkins, T.I. Roumeliotis, S. Jouny, C. Hénon, A. Kawai-Kawachi, C. Astier, A. Konde, E. Del Nery, C. Massard, S.J. Pettitt, R. Margueron, J.S. Choudhary, G. Almouzni, J.C. Soria, E. Deutsch, J.A. Downs, C.J. Lord, S. Postel-Vinay, PBRM1 Deficiency Confers Synthetic Lethality to DNA Repair Inhibitors in Cancer, Cancer research, 81 (2021) 2888-2902. X. Ren, Q. Liu, P. Zhou, T. Zhou, D. Wang, Q. Mei, R.A. Flavell, Z. Liu, M. Li, W. Pan, S. Zhu, DHX9 maintains epithelial homeostasis by restraining R-loop-mediated genomic instability in intestinal stem cells, Nature communications, 15 (2024) 3080. B.Z. Yang, M.Y. Liu, K.L. Chiu, Y.L. Chien, C.A. Cheng, Y.L. Chen, L.Y. Tsui, K.R. Lin, H.C. Chu, C.P. Wu, DHX9 SUMOylation is required for the suppression of R-loop-associated genome instability, Nature communications, 15 (2024) 6009. M.Y. Liu, K.R. Lin, Y.L. Chien, B.Z. Yang, L.Y. Tsui, H.C. Chu, C.P. Wu, ATR phosphorylates DHX9 at serine 321 to suppress R-loop accumulation upon genotoxic stress, Nucleic acids research, 52 (2024) 204-222. K.L. Chen, S.W. Huang, J.J. Yao, S.W. He, S. Gong, X.R. Tan, Y.L. Liang, J.Y. Li, S.Y. Huang, Y.Q. Li, Y. Zhao, H. Qiao, S. Xu, S. Zang, J. Ma, N. Liu, LncRNA DYNLRB2-AS1 promotes gemcitabine resistance of nasopharyngeal carcinoma by inhibiting the ubiquitination degradation of DHX9 protein, Drug resistance updates : reviews and commentaries in antimicrobial and anticancer chemotherapy, 76 (2024) 101111. J. Zhang, F. Chen, M. Tang, W. Xu, Y. Tian, Z. Liu, Y. Shu, H. Yang, Q. Zhu, X. Lu, B. Peng, X. Liu, X. Xu, M. Gullerova, W.G. Zhu, The ARID1A-METTL3-m6A axis ensures effective RNase H1-mediated resolution of R-loops and genome stability, Cell reports, 43 (2024) 113779. M.B. Maxwell, M.S. Hom-Tedla, J. Yi, S. Li, S.A. Rivera, J. Yu, M.J. Burns, H.M. McRae, B.T. Stevenson, K.E. Coakley, J. Ho, K.B. Gastelum, J.C. Bell, A.C. Jones, R.N. Eskander, E.C. Dykhuizen, G.S. Shadel, S.M. Kaech, D.C. Hargreaves, ARID1A suppresses R-loop-mediated STING-type I interferon pathway activation of anti-tumor immunity, Cell, 187 (2024) 3390-3408.e3319. H. Rehman, D.S. Chandrashekar, C. Balabhadrapatruni, S. Nepal, S.A.H. Balasubramanya, A.K. Shelton, K.R. Skinner, A.H. Ma, T. Rao, S. Agarwal, M.L. Eich, A.D. Robinson, G. Naik, U. Manne, G.J. Netto, C.R. Miller, C.X. Pan, G. Sonpavde, S. Varambally, J.E. Ferguson, 3rd, ARID1A-deficient bladder cancer is dependent on PI3K signaling and sensitive to EZH2 and PI3K inhibitors, JCI insight, 7 (2022). H. Ogiwara, K. Takahashi, M. Sasaki, T. Kuroda, H. Yoshida, R. Watanabe, A. Maruyama, H. Makinoshima, F. Chiwaki, H. Sasaki, T. Kato, A. Okamoto, T. Kohno, Targeting the Vulnerability of Glutathione Metabolism in ARID1A-Deficient Cancers, Cancer cell, 35 (2019) 177-190.e178. W. Zhou, H. Liu, Z. Yuan, J. Zundell, M. Towers, J. Lin, S. Lombardi, H. Nie, B. Murphy, T. Yang, C. Wang, L. Liao, A.R. Goldman, T. Kannan, A.V. Kossenkov, R. Drapkin, L.J. Montaner, D.T. Claiborne, N. Zhang, S. Wu, R. Zhang, Targeting the mevalonate pathway suppresses ARID1A-inactivated cancers by promoting pyroptosis, Cancer cell, 41 (2023) 740-756.e710. L. Cui, R. Liu, S. Han, C. Zhang, B. Wang, Y. Ruan, X. Yu, Y. Li, Y. Yao, X. Guan, Y. Liao, D. Su, Y. Ma, S. Li, C. Liu, Y. Zhang, Targeting Arachidonic Acid Metabolism Enhances Immunotherapy Efficacy in ARID1A-Deficient Colorectal Cancer, Cancer research, 85 (2025) 925-941. X. Liu, Z. Li, Z. Wang, F. Liu, L. Zhang, J. Ke, X. Xu, Y. Zhang, Y. Yuan, T. Wei, Q. Shan, Y. Chen, W. Huang, J. Gao, N. Wu, F. Chen, L. Sun, Z. Qiu, Y. Deng, X. Wang, Chromatin Remodeling Induced by ARID1A Loss in Lung Cancer Promotes Glycolysis and Confers JQ1 Vulnerability, Cancer research, 82 (2022) 791-804. Additional Declarations No competing interests reported. Supplementary Files supplementfigure.docx abstract.png Graphical abstract OR1.tif OR2.tif OR3.tif Cite Share Download PDF Status: Published Journal Publication published 09 Mar, 2026 Read the published version in Molecular Cancer → Version 1 posted Editorial decision: Revision requested 19 Oct, 2025 Reviews received at journal 11 Oct, 2025 Reviews received at journal 07 Oct, 2025 Reviewers agreed at journal 07 Oct, 2025 Reviews received at journal 07 Oct, 2025 Reviewers agreed at journal 07 Oct, 2025 Reviewers agreed at journal 07 Oct, 2025 Reviewers agreed at journal 07 Oct, 2025 Reviewers invited by journal 07 Oct, 2025 Editor assigned by journal 29 Sep, 2025 Submission checks completed at journal 29 Sep, 2025 First submitted to journal 24 Sep, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7702632","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":531878122,"identity":"27e6e3ec-0029-4478-a880-89f2f7e0b895","order_by":0,"name":"Wan Shu","email":"","orcid":"","institution":"Wuhan Union Hospital","correspondingAuthor":false,"prefix":"","firstName":"Wan","middleName":"","lastName":"Shu","suffix":""},{"id":531878123,"identity":"dc8b1b3d-4ff2-4e33-9b36-473361d54d14","order_by":1,"name":"Kejun Dong","email":"","orcid":"","institution":"Wuhan Union Hospital","correspondingAuthor":false,"prefix":"","firstName":"Kejun","middleName":"","lastName":"Dong","suffix":""},{"id":531878126,"identity":"bb0b7a9d-21c2-4f87-8012-f567fbcb9777","order_by":2,"name":"xiaoyu Shen","email":"","orcid":"","institution":"Wuhan Union Hospital","correspondingAuthor":false,"prefix":"","firstName":"xiaoyu","middleName":"","lastName":"Shen","suffix":""},{"id":531878129,"identity":"8a8c2ae0-d9c8-4001-9cf1-ff3c9a2feb37","order_by":3,"name":"Xing Zhou","email":"","orcid":"","institution":"Wuhan Union Hospital","correspondingAuthor":false,"prefix":"","firstName":"Xing","middleName":"","lastName":"Zhou","suffix":""},{"id":531878132,"identity":"16eef443-fa61-4a02-a64a-7626fff7ecb4","order_by":4,"name":"Jiarui Zhang","email":"","orcid":"","institution":"Wuhan Union Hospital","correspondingAuthor":false,"prefix":"","firstName":"Jiarui","middleName":"","lastName":"Zhang","suffix":""},{"id":531878135,"identity":"3024544b-5272-4bac-9376-37f444f3ef54","order_by":5,"name":"Shuyang Yu","email":"","orcid":"","institution":"Wuhan Union Hospital","correspondingAuthor":false,"prefix":"","firstName":"Shuyang","middleName":"","lastName":"Yu","suffix":""},{"id":531878137,"identity":"75c1b80a-690e-453e-8998-34d2ac21cc76","order_by":6,"name":"Shuangshuang Cheng","email":"","orcid":"","institution":"Wuhan Union Hospital","correspondingAuthor":false,"prefix":"","firstName":"Shuangshuang","middleName":"","lastName":"Cheng","suffix":""},{"id":531878141,"identity":"a79965f2-1b28-4842-b9d9-b1452d516862","order_by":7,"name":"Tangansu Zhang","email":"","orcid":"","institution":"Wuhan Union Hospital","correspondingAuthor":false,"prefix":"","firstName":"Tangansu","middleName":"","lastName":"Zhang","suffix":""},{"id":531878142,"identity":"cfbb3513-ecac-472d-b612-6006bb7ac263","order_by":8,"name":"Guanxiao Chen","email":"","orcid":"","institution":"Wuhan Union Hospital","correspondingAuthor":false,"prefix":"","firstName":"Guanxiao","middleName":"","lastName":"Chen","suffix":""},{"id":531878143,"identity":"be54930e-de7d-47aa-929d-2fd6c6a2b6d9","order_by":9,"name":"Guanglei Zhong","email":"","orcid":"","institution":"Wuhan Union Hospital","correspondingAuthor":false,"prefix":"","firstName":"Guanglei","middleName":"","lastName":"Zhong","suffix":""},{"id":531878144,"identity":"ca96e342-58e7-4532-a85d-916e3fbdeee9","order_by":10,"name":"Jun Zhang","email":"","orcid":"","institution":"Wuhan Union Hospital","correspondingAuthor":false,"prefix":"","firstName":"Jun","middleName":"","lastName":"Zhang","suffix":""},{"id":531878145,"identity":"9ddba5e8-f17c-47f6-ba89-242c7f2b58ed","order_by":11,"name":"Hongbo Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8UlEQVRIiWNgGAWjYDCCAxAygZ+9+RhUKIFILZI9x9KADAMStBjMyDEjTgvf7TOGnwt+3ckzkMj59pjnzx8GfvYcA4afO3BrkTyXYyw9s+9ZsTnP2+3GvG0GDJI9bwwYe8/g1mJwhneDNG/P4cSd7bnbpHkbDBgMbuQYMDO24dWy+TdIy4YDOc+kef4YMNgToWWbNM8PoJYTOWzSPGxAWyQIaJE8w//NmrfhcDEwkM0k57YZ80iceVZwsBePFr4zbMm3ef4czgNG5TOJN3/k5Pjbkzc++IlHCxggO4MHRBwgoAEI/hBWMgpGwSgYBSMYAABhCFdIKurWBQAAAABJRU5ErkJggg==","orcid":"","institution":"Wuhan Union Hospital","correspondingAuthor":true,"prefix":"","firstName":"Hongbo","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2025-09-24 10:38:25","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7702632/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7702632/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12943-026-02629-2","type":"published","date":"2026-03-09T15:57:37+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":93941514,"identity":"8c0d08f5-cd20-46d2-a146-187059b7d6b5","added_by":"auto","created_at":"2025-10-20 13:40:09","extension":"tif","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2291596,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.tif","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/0559a75af37a941e1f69f936.tif"},{"id":93941512,"identity":"dbde7ea8-729b-42a8-bf5f-0dfb742841c1","added_by":"auto","created_at":"2025-10-20 13:40:09","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":13681548,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/9a4fd0297b1d9e577c4740cc.docx"},{"id":93941522,"identity":"b731abb8-04f2-4198-ad5e-b3f24eb50030","added_by":"auto","created_at":"2025-10-20 13:40:10","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":16336448,"visible":true,"origin":"","legend":"","description":"","filename":"Figure10.tif","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/9dba74dd9ec44d1529dc0ede.tif"},{"id":93942251,"identity":"aee306f3-24c6-461b-bad4-74ae8f51ded4","added_by":"auto","created_at":"2025-10-20 13:48:09","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4126524,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.tif","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/b9f8118dc128d2b381bf39cd.tif"},{"id":93941543,"identity":"0d9eef81-5727-4cf5-83d2-9fa50bf82689","added_by":"auto","created_at":"2025-10-20 13:40:11","extension":"tif","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12989992,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.tif","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/d6d208359a26951894a39bb5.tif"},{"id":93942275,"identity":"9a6c613c-466f-4b10-9e0b-c6c98a7d65d7","added_by":"auto","created_at":"2025-10-20 13:48:11","extension":"tif","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6481692,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4.tif","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/2cd947ec07bd6ad00722b8fd.tif"},{"id":93943614,"identity":"c29ed5aa-a85a-416e-89d8-27e298e8abd5","added_by":"auto","created_at":"2025-10-20 13:56:12","extension":"tif","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12545476,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.tif","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/bb1f13b5edb3d66333636bcc.tif"},{"id":93941567,"identity":"59215c69-0b0a-414d-9000-4e468bf66b7b","added_by":"auto","created_at":"2025-10-20 13:40:12","extension":"tif","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11669248,"visible":true,"origin":"","legend":"","description":"","filename":"Figure6.tif","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/955e6dcc886b4b57b1abf8da.tif"},{"id":93941563,"identity":"dbd8eae2-fb40-4bdd-8a18-44bf9710a471","added_by":"auto","created_at":"2025-10-20 13:40:11","extension":"tif","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6856636,"visible":true,"origin":"","legend":"","description":"","filename":"Figure7.tif","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/ec4192d32e576843c21806fb.tif"},{"id":93941527,"identity":"c7909b97-ea87-45aa-8204-9c6a4cfb9fac","added_by":"auto","created_at":"2025-10-20 13:40:10","extension":"tif","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":14155048,"visible":true,"origin":"","legend":"","description":"","filename":"Figure8.tif","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/a2283ce7a80cad1063037179.tif"},{"id":93941579,"identity":"c9f7efed-8254-400f-b106-10c37ff15b72","added_by":"auto","created_at":"2025-10-20 13:40:12","extension":"tif","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7181064,"visible":true,"origin":"","legend":"","description":"","filename":"Figure9.tif","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/cf1dbc8f11ef6ae24ceabaa5.tif"},{"id":93942258,"identity":"339ec5e7-580a-4303-8553-fad451576c91","added_by":"auto","created_at":"2025-10-20 13:48:10","extension":"tif","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":14110580,"visible":true,"origin":"","legend":"","description":"","filename":"OR1.tif","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/1aa54e4041ce2216588e449d.tif"},{"id":93941554,"identity":"1ee5540d-41ec-46e9-a6a7-2f814534986c","added_by":"auto","created_at":"2025-10-20 13:40:11","extension":"tif","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12782608,"visible":true,"origin":"","legend":"","description":"","filename":"OR2.tif","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/67b776d0b5c0d77291e40d94.tif"},{"id":93941520,"identity":"6dbf38e5-1d04-4562-a91b-6e0fd10484bc","added_by":"auto","created_at":"2025-10-20 13:40:09","extension":"tif","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10405736,"visible":true,"origin":"","legend":"","description":"","filename":"OR3.tif","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/b7b001b7550d7af03fd26d51.tif"},{"id":93941540,"identity":"f6f29a53-79fb-4a6d-9591-b7cef14b966b","added_by":"auto","created_at":"2025-10-20 13:40:10","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1643913,"visible":true,"origin":"","legend":"","description":"","filename":"abstract.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/c46eb89381128b44d8b4d7f0.png"},{"id":93942271,"identity":"af1702ee-f563-42d5-889e-4911f64e89a2","added_by":"auto","created_at":"2025-10-20 13:48:11","extension":"json","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12766,"visible":true,"origin":"","legend":"","description":"","filename":"2cab3f5f5f754035853c9782affea9ee.json","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/2896437215b33b2f5aa98484.json"},{"id":93941577,"identity":"d2292ca3-76c6-4f5d-92f6-4bc5c3ba2eaa","added_by":"auto","created_at":"2025-10-20 13:40:12","extension":"docx","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3401254,"visible":true,"origin":"","legend":"","description":"","filename":"supplementfigured1.docx","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/5adaa12dd82b09bf7b1bea70.docx"},{"id":93941541,"identity":"e9470be9-2206-46ad-9225-6f2ba46edaff","added_by":"auto","created_at":"2025-10-20 13:40:10","extension":"xml","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":197592,"visible":true,"origin":"","legend":"","description":"","filename":"2cab3f5f5f754035853c9782affea9ee1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/d01ff52a2685e8001a44ae58.xml"},{"id":93941516,"identity":"5cdbccf5-2a46-4119-b076-dcbc944e57dc","added_by":"auto","created_at":"2025-10-20 13:40:09","extension":"tif","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2291596,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.tif","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/dc036de32bdeafa8ee6aa448.tif"},{"id":93942281,"identity":"0b25b1e1-615f-40ae-b90b-d77aa1082a7b","added_by":"auto","created_at":"2025-10-20 13:48:12","extension":"tif","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":16336448,"visible":true,"origin":"","legend":"","description":"","filename":"Figure10.tif","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/2c49a69fb6651dd1d496059f.tif"},{"id":93941531,"identity":"1f871fb1-a9ff-4f9e-b398-56c22f025497","added_by":"auto","created_at":"2025-10-20 13:40:10","extension":"tif","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4126524,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.tif","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/f15e20546f373f0a58b72999.tif"},{"id":93942256,"identity":"19d3e97e-23c6-4e0a-ba93-717a5f75f082","added_by":"auto","created_at":"2025-10-20 13:48:10","extension":"tif","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12989992,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.tif","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/c95825c4f48b4e55c3176f88.tif"},{"id":93942277,"identity":"ea6df38a-e1ee-422d-b4f6-48d83bc123ce","added_by":"auto","created_at":"2025-10-20 13:48:12","extension":"tif","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6481692,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4.tif","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/67549fa6470103776f56a7c3.tif"},{"id":93942254,"identity":"dd8a40c1-3180-4b3b-ac3a-f2896f4997c9","added_by":"auto","created_at":"2025-10-20 13:48:09","extension":"tif","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12545476,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.tif","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/147188762c4c53a63614086d.tif"},{"id":93941592,"identity":"5425724d-6966-4c3a-9801-4f60d90472cb","added_by":"auto","created_at":"2025-10-20 13:40:13","extension":"tif","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11669248,"visible":true,"origin":"","legend":"","description":"","filename":"Figure6.tif","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/76171104f1ab5fc81b24a707.tif"},{"id":93941555,"identity":"745f580f-982a-448c-b92e-f24889aef3b7","added_by":"auto","created_at":"2025-10-20 13:40:11","extension":"tif","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6856636,"visible":true,"origin":"","legend":"","description":"","filename":"Figure7.tif","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/aca15e5917e6ab722d6c6fd6.tif"},{"id":93942325,"identity":"c671203c-9b35-4107-b9a9-ee9955e10676","added_by":"auto","created_at":"2025-10-20 13:48:13","extension":"tif","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":14155048,"visible":true,"origin":"","legend":"","description":"","filename":"Figure8.tif","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/5ab72c8b44a70bd035a8d6e7.tif"},{"id":93941537,"identity":"a2d535c1-efe5-4973-a32d-2192e21fc0cf","added_by":"auto","created_at":"2025-10-20 13:40:10","extension":"tif","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7181064,"visible":true,"origin":"","legend":"","description":"","filename":"Figure9.tif","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/4d27274aec2df825d108bedd.tif"},{"id":93942272,"identity":"200000fa-9eba-4f24-81e3-0e0654580489","added_by":"auto","created_at":"2025-10-20 13:48:11","extension":"tif","order_by":28,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":14110580,"visible":true,"origin":"","legend":"","description":"","filename":"OR1.tif","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/daa4ae4db65998dfe875d99a.tif"},{"id":93943613,"identity":"06690057-a98f-4c3b-83f6-c95c789db2dd","added_by":"auto","created_at":"2025-10-20 13:56:12","extension":"tif","order_by":29,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12782608,"visible":true,"origin":"","legend":"","description":"","filename":"OR2.tif","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/ada3a8b7f6c6c6af5f9ffa49.tif"},{"id":93941581,"identity":"70bb3386-92f6-4263-a28e-07455c1865d2","added_by":"auto","created_at":"2025-10-20 13:40:12","extension":"tif","order_by":30,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10405736,"visible":true,"origin":"","legend":"","description":"","filename":"OR3.tif","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/828ce9a4247f2b713af198f9.tif"},{"id":93941529,"identity":"91e8b2db-348e-424a-b729-29e84379d91a","added_by":"auto","created_at":"2025-10-20 13:40:10","extension":"png","order_by":31,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1643913,"visible":true,"origin":"","legend":"","description":"","filename":"abstract.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/c511dd176ac14246cff0e08f.png"},{"id":93942278,"identity":"a086ef21-dc2e-44d1-a022-2e66c8f3ef68","added_by":"auto","created_at":"2025-10-20 13:48:12","extension":"png","order_by":32,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":143357,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/b6b79e370ee79cf177c68ebb.png"},{"id":93942262,"identity":"ec29789e-84ed-4015-b5d5-62c224685110","added_by":"auto","created_at":"2025-10-20 13:48:10","extension":"jpeg","order_by":33,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1086346,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage10.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/13e61596d64f96b68379cb92.jpeg"},{"id":93942257,"identity":"46bb60d9-3585-4c72-8642-569c6dbb68c5","added_by":"auto","created_at":"2025-10-20 13:48:10","extension":"jpeg","order_by":34,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2264544,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage11.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/3c2471c279af6ca5498f3a58.jpeg"},{"id":93941549,"identity":"04bd5be7-f1eb-407e-8ca3-d928d89e0751","added_by":"auto","created_at":"2025-10-20 13:40:11","extension":"jpeg","order_by":35,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":400420,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/f00318225ce76a8cc7b7d99d.jpeg"},{"id":93944105,"identity":"9e176f60-a066-42a5-8b0b-538becebd408","added_by":"auto","created_at":"2025-10-20 14:04:11","extension":"jpeg","order_by":36,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":753846,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/df80073c9b07ea8623a744ee.jpeg"},{"id":93941582,"identity":"08c5ad5f-82db-49f7-9748-9707f0987593","added_by":"auto","created_at":"2025-10-20 13:40:12","extension":"jpeg","order_by":37,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1684556,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/b1b3dac01229dcbc2531822d.jpeg"},{"id":93942263,"identity":"677b9b30-d1f2-4cf3-8f93-98a866343827","added_by":"auto","created_at":"2025-10-20 13:48:10","extension":"jpeg","order_by":38,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1033486,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/84f3e5434a65cba1a5a22901.jpeg"},{"id":93942259,"identity":"83a29d51-bab6-44dd-b37c-0335415db3b6","added_by":"auto","created_at":"2025-10-20 13:48:10","extension":"jpeg","order_by":39,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1715084,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/f71211c339043fa552fa65cd.jpeg"},{"id":93942264,"identity":"b3d5b609-056b-4d9d-a62b-575c24cd0241","added_by":"auto","created_at":"2025-10-20 13:48:11","extension":"jpeg","order_by":40,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1541602,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/1e31b03aeb9248ec1736ceb9.jpeg"},{"id":93942261,"identity":"9e0b5206-07f4-4084-976d-595cef4625eb","added_by":"auto","created_at":"2025-10-20 13:48:10","extension":"jpeg","order_by":41,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1148456,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage8.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/292a14f3531690effa6c69ff.jpeg"},{"id":93941571,"identity":"585f04ef-c2a1-49ef-b4bb-c2601d175fd0","added_by":"auto","created_at":"2025-10-20 13:40:12","extension":"jpeg","order_by":42,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1754600,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage9.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/394ad17b1c028f21c49625fc.jpeg"},{"id":93941586,"identity":"befb7c5a-e76c-4656-823a-b294a8c39cec","added_by":"auto","created_at":"2025-10-20 13:40:12","extension":"png","order_by":43,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":262485,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/bf19c5bfa7a2a9497d2c76f9.png"},{"id":93942276,"identity":"8d5db9e9-b9a4-4573-8d35-90c92d8eeeba","added_by":"auto","created_at":"2025-10-20 13:48:12","extension":"png","order_by":44,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1790619,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure10.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/98d96d39e4765d76ef0b7b1c.png"},{"id":93941570,"identity":"eaa3c29b-83aa-4011-b927-f4e8f314a909","added_by":"auto","created_at":"2025-10-20 13:40:12","extension":"png","order_by":45,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":644882,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/f33cee1273c04d1a18d93c10.png"},{"id":93942324,"identity":"c3cbd589-d230-4f02-ba59-7b0be9bbcba5","added_by":"auto","created_at":"2025-10-20 13:48:12","extension":"png","order_by":46,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1678436,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/7455ee6311de73b30ae22b38.png"},{"id":93941535,"identity":"1dec0e0b-3850-4082-9e94-0a5a35b606ab","added_by":"auto","created_at":"2025-10-20 13:40:10","extension":"png","order_by":47,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":968611,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/67962a05c967974cbc741bf4.png"},{"id":93942267,"identity":"66ddf196-c344-4784-aa92-1687f5fc6133","added_by":"auto","created_at":"2025-10-20 13:48:11","extension":"png","order_by":48,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1063539,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/d75d8462c9b46deefbf0a2f4.png"},{"id":93941534,"identity":"140283da-d234-4393-8dd6-a5c7424f004f","added_by":"auto","created_at":"2025-10-20 13:40:10","extension":"png","order_by":49,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1111667,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure6.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/d6aea813a3546c3a3e8894f8.png"},{"id":93942274,"identity":"11b62d0d-a51a-4ad8-84c7-1f1959a03674","added_by":"auto","created_at":"2025-10-20 13:48:11","extension":"png","order_by":50,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":991879,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure7.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/1730b1539e4e9f2ada860846.png"},{"id":93941544,"identity":"594c4f65-257b-4285-bbda-74d6f152e39d","added_by":"auto","created_at":"2025-10-20 13:40:11","extension":"png","order_by":51,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1340220,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure8.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/1621b4ba9088fd494fab2d3e.png"},{"id":93941552,"identity":"945bdb8f-fa61-47ff-a43a-27864ecc2a89","added_by":"auto","created_at":"2025-10-20 13:40:11","extension":"png","order_by":52,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":863057,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure9.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/4e7d2bd50b7130faac0111a0.png"},{"id":93941538,"identity":"2ef0e9e2-ddea-4e03-b43e-a5938abaac85","added_by":"auto","created_at":"2025-10-20 13:40:10","extension":"png","order_by":53,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1925993,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineOR1.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/18d431139f28d235883f125d.png"},{"id":93941562,"identity":"98b889e1-7e3c-406a-9681-8c45733aa7d0","added_by":"auto","created_at":"2025-10-20 13:40:11","extension":"png","order_by":54,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1778091,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineOR2.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/129766274fba768f3d717993.png"},{"id":93942273,"identity":"92381aa4-0284-48b9-b922-175cab43e0d4","added_by":"auto","created_at":"2025-10-20 13:48:11","extension":"png","order_by":55,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1404705,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineOR3.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/1e7cc2345e0e62f4dfca7de9.png"},{"id":93941580,"identity":"ba4fb116-da2b-4254-b9bf-97a625678d8e","added_by":"auto","created_at":"2025-10-20 13:40:12","extension":"png","order_by":56,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":303879,"visible":true,"origin":"","legend":"","description":"","filename":"Onlineabstract.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/d1ebe1aaddbe191c390eb4a5.png"},{"id":93941565,"identity":"0621c75d-6cbc-4c91-85c8-b4e10cebbfcc","added_by":"auto","created_at":"2025-10-20 13:40:11","extension":"png","order_by":57,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":37490,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/f3bef2c1cc5f7f354b28b479.png"},{"id":93942270,"identity":"68239b56-6951-4c71-a999-18124e47715a","added_by":"auto","created_at":"2025-10-20 13:48:11","extension":"png","order_by":58,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":159076,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage10.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/28cd4d4b41250d179b70c183.png"},{"id":93941564,"identity":"4ed89d56-eef2-4cad-87d1-f5231bb34e2a","added_by":"auto","created_at":"2025-10-20 13:40:11","extension":"png","order_by":59,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":284210,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage11.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/47e7ea1426c8ea5b26df1ec6.png"},{"id":93943615,"identity":"6b17ffa4-7a2b-48f3-b489-37033f75338b","added_by":"auto","created_at":"2025-10-20 13:56:12","extension":"png","order_by":60,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":49889,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/9d3dc04b71fed42269ace1d4.png"},{"id":93941573,"identity":"a5ed641b-e674-4d3e-acf3-08e3b4178531","added_by":"auto","created_at":"2025-10-20 13:40:12","extension":"png","order_by":61,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":119502,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/529aec4fdd8f48dd2bf8c636.png"},{"id":93941587,"identity":"17665cd4-2317-4862-b75c-e69cde637910","added_by":"auto","created_at":"2025-10-20 13:40:13","extension":"png","order_by":62,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":229979,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/d85f18f5fb3c4f7b33d0ca1a.png"},{"id":93942269,"identity":"f5bb0704-4c92-4fe7-a506-d07697352ebf","added_by":"auto","created_at":"2025-10-20 13:48:11","extension":"png","order_by":63,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":167287,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/128cf712b7a55dfc01318fcf.png"},{"id":93941589,"identity":"a9ac9f7f-ec9d-4e23-b2cd-a5c2f86078bb","added_by":"auto","created_at":"2025-10-20 13:40:13","extension":"png","order_by":64,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":182518,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/b2b67bfabe9b77e3695bfe92.png"},{"id":93942323,"identity":"f88c4baf-69a3-4b21-98ec-5bd6196e46ec","added_by":"auto","created_at":"2025-10-20 13:48:12","extension":"png","order_by":65,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":182997,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/88790d6db3a7346774b137d6.png"},{"id":93942268,"identity":"2d7e09a6-f59d-40d3-adf4-f01b318032c7","added_by":"auto","created_at":"2025-10-20 13:48:11","extension":"png","order_by":66,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":176515,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/239cbf014bdfa3629c22f423.png"},{"id":93941542,"identity":"b49a85ac-86f0-468b-8029-1b6e479ba199","added_by":"auto","created_at":"2025-10-20 13:40:11","extension":"png","order_by":67,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":210805,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage9.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/a57e417b358874bdcfe3e747.png"},{"id":93941585,"identity":"b9be4570-7d98-41b2-9d57-5bc93b817422","added_by":"auto","created_at":"2025-10-20 13:40:12","extension":"xml","order_by":68,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":194846,"visible":true,"origin":"","legend":"","description":"","filename":"2cab3f5f5f754035853c9782affea9ee1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/5fdc303720c921d697144b7a.xml"},{"id":93941556,"identity":"e99f3aac-79f0-474a-99fa-b2825fc6f276","added_by":"auto","created_at":"2025-10-20 13:40:11","extension":"html","order_by":69,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":211462,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/79a9a563b256e339d51cbbe7.html"},{"id":93941513,"identity":"a7d02ed1-b1b1-40d7-a18c-12be22345136","added_by":"auto","created_at":"2025-10-20 13:40:09","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":3151930,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGenomic landscape of ARID1A in EC.\u003c/strong\u003e (A)The top 5 mutated genes in EC from MSK-IMPACT clinical sequencing data. (B) Landscape of ARID1A mutations in EC. (C) Mutation frequencies of ARID1A in four EC molecular subtypes.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/fbb14ba219cb44ac90c740b0.png"},{"id":93941519,"identity":"18a0d9f7-9d16-496f-8f03-edc865fab31f","added_by":"auto","created_at":"2025-10-20 13:40:09","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":10610261,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSynthetic lethality drug screening in ARID1A-deficient EC cells. \u003c/strong\u003e(A)Successful ARID1A knockout confirmed by Sanger sequencing and Western blotting (WB). (B) Schematic workflow of the compound screening. (C) Cell viability of ARID1A-deficient Ishikawa cells and hEECs treated with 20 µM 966 bioactive small-molecule compounds for 72 h. A Venn diagram was used to identify compounds that exhibited inhibitory effects on both ARID1A-deficient Ishikawa cells and hEECs. (D) Cell viability comparison of ARID1A-deficient and ARID1A-WT cells treated with the top 16 compounds at 2.5 µM for 72 h. (E) Sensitivity index for the 16 compounds (IC50 of ARID1A WT cells/IC50 of ARID1A-deficient cells). (F) IC50 curves: HDAC6 inhibitor (CAY10603), HMGCR inhibitor (Simvastatin), JAK/STAT3 inhibitor (Homoharringtonine), BET inhibitor((R)-(-)-JQ1 Enantiomer), PRMT5 inhibitors (JNJ-64619178, MRTX9768), ATR inhibitors (Ceralasertib).\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/1e55ca171e2d66f9cee72c71.png"},{"id":93942253,"identity":"62f5dc31-5b66-4efb-a28f-f93eab05641f","added_by":"auto","created_at":"2025-10-20 13:48:09","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":25196974,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSynthetic lethal effect between ARID1A loss and PRMT5 inhibition\u003c/strong\u003e. (A) Representative colony formation images of ARID1A-deficient hEECs and Ishikawa cells after incubation with JNJ-64619178 at a range of concentrations for 48 h. (B) Representative colony formation images of SKOV3 and HEC-1-A cells after incubation with JNJ-64619178 at a range of concentrations for 48 h. (C) EdU assays show the effect of JNJ-64619178 on ARID1A-deficient or ARID1A-WT hEECs and Ishikawa cells after incubation with 2.5μM JNJ-64619178 for 48 h. Scale bar = 50 μm. (D-F) ARID1A-deficient or ARID1A-WT hEECs and Ishikawa cells transfected with siPRMT5. (D) Western blot analysis was performed to assess the expression of ARID1A and PRMT5. (E) Cell viability. (F) Representative colony formation images. (G-I) ARID1A-deficient or ARID1A-WT hEECs and Ishikawa cells transfected with siPRMT5 and/or vector ARID1A. (G) Western blot analysis was performed to assess the expression of ARID1A. (H) Cell viability. (I) Representative colony formation images. Data are presented as mean ± SD. ***P \u0026lt; 0.001, **** P \u0026lt; 0.0001. (n = 3 per group).\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/75da2403e02a44446166eaca.png"},{"id":93941525,"identity":"13a873bd-ec4d-4827-addc-a7355a1e0cbd","added_by":"auto","created_at":"2025-10-20 13:40:10","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":12560614,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePRMT5 inhibition promotes apoptosis in ARID1A-deficient EC cells. \u003c/strong\u003e(A-B)The transcriptomic sequencing of ARID1A-deficient Ishikawa cells treated with 2.5 μM JNJ-64619178 for 48 h. (A) KEGG pathway enrichment and GO enrichment analysis. (B) Evaluation of apoptotic cells treated with 2.5 µM JNJ-64619178 for 48 h. (C) Western blot analysis was performed to detect the expression of caspase-3, cleaved caspase-3, and cleaved PARP in ARID1A-deficient or ARID1A-WT hEECs and Ishikawa cells, as well as SKOV3 and HEC-1-A cells, treated with JNJ-64619178 for 48 h. Data are presented as mean ± SD. **** P \u0026lt; 0.0001. ns, non-significant. (n = 3 per group).\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/eb382015ea280e8acac34b5d.png"},{"id":93943609,"identity":"d1ba1d06-fdc8-48ac-b940-1a3c9e6e4650","added_by":"auto","created_at":"2025-10-20 13:56:10","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":23926563,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePRMT5 inhibition induces DNA damage in ARID1A-deficient cells. \u003c/strong\u003e(A) Representative images of immunofluorescence staining for phosphorylated γ-H2AX (Ser139) and 53BP1 in ARID1A-deficient or ARID1A-WT hEECs and Ishikawa cells treated with 2.5 µM JNJ-64619178 and siPRMT5. Scale bar = 10 μm. (B) Representative images of comet assays of ARID1A-deficient or ARID1A-WT hEECs and Ishikawa cells, as well as SKOV3 and HEC-1-A cells, treated with 2.5 µM JNJ-64619178 for 48 h. Scale bar = 100 μm. (C) Western blot analysis was performed to detect the expression of γ-H2AX (Ser139) and p-ATM in ARID1A-deficient or ARID1A-WT hEECs and Ishikawa cells, as well as SKOV3 and HEC-1-A cells, treated with JNJ-64619178 for 48 h.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/fc72eae5938fd7bec57ff7c5.png"},{"id":93941560,"identity":"608ffa89-5a3c-4fe6-ae65-a38406603db4","added_by":"auto","created_at":"2025-10-20 13:40:11","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":19914784,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePRMT5 inhibition induced DNA damage in ARID1A-deficient cells by aberrant R-loop accumulation. \u003c/strong\u003e(A) Network analysis of PRMT5 interactomes. (B) Dot-blot assays measuring R-loop accumulation in ARID1A-WT hEECs and Ishikawa cells treated with 2.5 µM JNJ-64619178 for 48 h. RNase H1 treatment was included as a negative control. (C) Representative images of S9.6 immunofluorescence staining in ARID1A-deficient or ARID1A-WT hEECs and Ishikawa cells treated with 2.5 µM JNJ-64619178 and siPRMT5. (D) Representative images of immunofluorescence staining for phosphorylated γ-H2AX (Ser139) in ARID1A-deficient hEECs and Ishikawa cells transfected with siPRMT5 and/or RNaseH. Scale bar = 10 μm. (E) Representative images of comet assays of ARID1A-deficient hEECs and Ishikawa cells transfected with siPRMT5 and/or RNaseH. Scale bar = 100 μm. (F) Representative images of S9.6 immunofluorescence staining in ARID1A-deficient hEECs and Ishikawa cells transfected with siPRMT5 and/or RNaseH. Scale bar = 10 μm. (G) Western blot analysis to assess γ-H2AX (Ser139) and caspase-3 expression in ARID1A-deficient or ARID1A-WT hEECs and Ishikawa cells transfected with siPRMT5 and/or RNaseH.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/c93a0b722f796a5915b1e797.png"},{"id":93941536,"identity":"0cfbc9db-198f-4a4b-8146-97be04a75cb8","added_by":"auto","created_at":"2025-10-20 13:40:10","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":14632914,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePRMT5 regulates the interaction between DHX9 and R-Loops. (A) \u003c/strong\u003eCoimmunoprecipitation (Co-IP) assays for detecting interactions of endogenous PRMT5 with DHX9 and SRSF1 in hEECs (left) and Ishikawa cells (right). \u003cstrong\u003e(B) \u003c/strong\u003eCo-IP assays for detecting the SDMA of DHX9 or SRSF1 in Ishikawa cells and hEECs treated with siPRMT5 or 2.5 µM JNJ-64619178 for 48 h. \u003cstrong\u003e(C) \u003c/strong\u003eCo-IP assays for detecting interactions between exogenous Flag-PRMT5 and HA-DHX9 in Ishikawa cells (left) and hEECs (right). \u003cstrong\u003e(D) \u003c/strong\u003ePLA was performed to detect the interactions between R-loops and DHX9 in ARID1A-deficient or ARID1A-WT hEECs and Ishikawa cells treated with siPRMT5 or JNJ-6461917. Representative immunofluorescence images of DHX9-R-loops PLA foci (red) and DAPI (blue). Scale bar = 10 μm. Number of PLA nuclear foci was counted and plotted (right). Data are presented as mean ± SD. **** P \u0026lt; 0.0001. (n = 3 per group).\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/979ceb5efd8ccc9a2a76680e.png"},{"id":93941511,"identity":"d8749baa-5acf-4c98-a6b9-1c5f14cbd14d","added_by":"auto","created_at":"2025-10-20 13:40:09","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":26019652,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eArginine methylation of DHX9 suppresses R-loop accumulation and DNA damage. \u003c/strong\u003e(A) Model of binding between PRMT5 and DHX9. (B) DHX9 orthologs in different species. DHX9 methylation sites are displayed in the protein sequences. (C) SDMA of exogenous HA-DHX9-WT, -R1219K, -R1223K, -R1227K and -3RK in Flag-PRMT5-transduced HEK293T cells. (D) PLA was performed to detect the interactions between R-loops and DHX9 in hEECs transfected with HA-DHX9-WT or HA-DHX9-3RK and treated with siPRMT5. Representative immunofluorescence images of DHX9-R-loops PLA foci (red) and DAPI (blue). Scale bar = 10 μm.(E) Number of PLA nuclear foci were counted and plotted. (F) ARID1A-deficient hEECs and Ishikawa cells treated with siPRMT5 were transfected with DHX9-WT or DHX9-3RK. Dot-blot assays to quantify R-loops. Methylene blue staining was used as a loading control. (G-J) ARID1A-deficient hEECs and Ishikawa cells treated with 2.5 µM JNJ-64619178 for 48 h were transfected with DHX9-WT or DHX9-3RK. (G) Representative images of immunofluorescent staining for S9.6. Scale bar = 10 μm. (H) Representative images of comet assays. Scale bar = 100 μm. (I) Representative images of immunofluorescence staining for phosphorylated γ-H2AX (Ser139). Scale bar = 10 μm. (J) Western blot analysis to assess DHX9 and γ-H2AX (Ser139). Data are presented as mean ± SD. **** P \u0026lt; 0.0001. (n = 3 per group).\u003c/p\u003e","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/44b790b7b23e82e16dfdb8e8.png"},{"id":93943608,"identity":"844eb958-ade2-4512-983a-b6c47a0b17df","added_by":"auto","created_at":"2025-10-20 13:56:09","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":15347421,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePRMT5 is a direct transcriptional target of ARID1A. \u003c/strong\u003e(A) GEPIA database results showing the correlation between ARID1A and PRMT5.\u003cstrong\u003e \u003c/strong\u003e(B) The qPCR results showing PRMT5 expression in ARID1A-overexpressing or ARID1A-deficient hEECs and Ishikawa cells.\u003cstrong\u003e \u003c/strong\u003e(C) Western blotting of PRMT5 expression in ARID1A-overexpressing or ARID1A-deficient hEECs and Ishikawa cells.\u003cstrong\u003e \u003c/strong\u003e(D-E) Quantitative analysis of ARID1A and PRMT5.\u003cstrong\u003e \u003c/strong\u003e(F) Multiplex IHC of ARID1A and PRMT5 in clinical samples. (G)\u003cstrong\u003e \u003c/strong\u003ePotential binding sites for ARID1A on the PRMT5 promoter were predicted using FIMO. (H) Primer design based on the predicted binding sites. (I) Association of ARID1A with the PRMT5 promoter in Ishikawa cells as assessed by ChIP. (J) A representative image showing results of PCR performed on DNA samples precipitated with anti-ARID1A\u003cstrong\u003e. \u003c/strong\u003eData are presented as mean ± SD. **P \u0026lt; 0.01, ***P \u0026lt; 0.001, **** P \u0026lt; 0.0001. (n = 3 per group).\u003c/p\u003e","description":"","filename":"Figure9.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/056fd8031ca05eab0efbcf92.png"},{"id":93942250,"identity":"1a916e4e-647e-48d3-bf0c-3dc946dfca22","added_by":"auto","created_at":"2025-10-20 13:48:09","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":29196126,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eJNJ-64619178 potentiates therapeutic efficacy in ARID1A-knockdowned PDOs and ARID1A-deficient xenografts.\u003c/strong\u003e (A) Workflow for PDO establishment. (B) Representative images of H\u0026amp;E staining and IHC staining for Ki-67 and CD133 in PDOs. (C) Representative images of ARID1A-WT and ARID1A-knockdowned PDOs treated with 2.5 μM JNJ-64619178 for 48 h. (D) The schedule of JNJ-64619178 treated xenograft tumor model. (E) Representative bioluminescence images of mice at day 7,14, and 35. (F) Tumor xenograft volumes were measured every three days. (G) The representative images of tumor xenografts. (H) The weight of the tumor xenografts. (I)The representative images of IHC staining for Ki-67 and γ-H2AX (Ser139) in tumor xenografts. Scale bar = 50 μm. (J) The body weight of tumor-bearing mice. Data are presented as mean ± SD. *P \u0026lt; 0.05, ***P \u0026lt; 0.001, **** P \u0026lt; 0.0001. ns, non-significant. (n = 3 per group).\u003c/p\u003e","description":"","filename":"Figure10.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/76f3a12b952f24edca2a1a07.png"},{"id":96238927,"identity":"422d55ae-db66-475b-b95b-b4e4968b74f9","added_by":"auto","created_at":"2025-11-19 06:51:15","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":114276395,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/7bb4c1e8-695d-44fd-b36f-e4cbd77e7211.pdf"},{"id":93941509,"identity":"20c27bd7-2bdd-4c73-8a8c-f47ccfd74cec","added_by":"auto","created_at":"2025-10-20 13:40:09","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":3401254,"visible":true,"origin":"","legend":"","description":"","filename":"supplementfigure.docx","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/ccdbbf82f90a0e5c06edc91d.docx"},{"id":93941508,"identity":"554a44b2-bbfe-4a36-b242-a2a9d33035bc","added_by":"auto","created_at":"2025-10-20 13:40:09","extension":"png","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":1643913,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGraphical abstract\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"abstract.png","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/4c742b9df1e25bb0da65ade9.png"},{"id":93941507,"identity":"e44c4704-9106-4795-8bd5-7dc1bd55cd77","added_by":"auto","created_at":"2025-10-20 13:40:08","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":98373,"visible":true,"origin":"","legend":"","description":"","filename":"OR1.tif","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/94c1c720547f2aadca00def4.tif"},{"id":93943610,"identity":"226fe340-1a4e-4969-bb5f-c3413f705739","added_by":"auto","created_at":"2025-10-20 13:56:10","extension":"tif","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":12782608,"visible":true,"origin":"","legend":"","description":"","filename":"OR2.tif","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/7b302b3bc8d7e203a53a791b.tif"},{"id":93943611,"identity":"b1e625af-42cc-405c-8473-dc8123919188","added_by":"auto","created_at":"2025-10-20 13:56:11","extension":"tif","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":10405736,"visible":true,"origin":"","legend":"","description":"","filename":"OR3.tif","url":"https://assets-eu.researchsquare.com/files/rs-7702632/v1/5e17a3e494392d34a63be18e.tif"}],"financialInterests":"No competing interests reported.","formattedTitle":"Inhibition of PRMT5 triggers synthetic lethality in ARID1A-deficient endometrial cancer cells by promoting aberrant R-loop accumulation","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eEndometrial cancer (EC) is one of the most common malignancies of the female reproductive tract, predominantly occurring in perimenopausal and postmenopausal women [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. With changing lifestyles, the global incidence of EC has been steadily increasing, with approximately 380,000 new cases reported worldwide in 2020, alongside a trend toward younger-onset disease [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Most EC patients are diagnosed when the tumor is confined to the uterus, resulting in a favorable prognosis with a 5-year survival rate of 80%\u0026ndash;90%. However, advanced-stage (III\u0026ndash;IV) or recurrent EC is associated with poor outcomes, with a 5-year survival rate below 20% [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The standard first-line treatment for advanced or recurrent EC consists of platinum-based chemotherapy (carboplatin plus paclitaxel), but its efficacy is often limited by chemoresistance [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Thus, there is an urgent clinical need to develop novel targeted therapies to improve survival outcomes in EC patients.\u003c/p\u003e\u003cp\u003eSynthetic lethality refers to a genetic interaction between two or more genes, where a single gene defect does not compromise cell viability, but simultaneous defects in multiple genes result in lethality [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Given the prevalence of loss-of-function mutations in tumor suppressor genes, which are challenging to target directly, exploiting synthetic lethal relationships is promising for treating cancers driven by such mutations. Targeting synthetic lethal partners or pathways of mutated genes can selectively eliminate cancer cells [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The AT-rich interaction domain 1A (ARID1A) gene encodes BAF250, a critical subunit of the SWI/SNF chromatin remodeling complex [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. The SWI/SNF complex utilizes ATP hydrolysis to remodel nucleosomes and regulate gene transcription. ARID1A is a frequently mutated tumor suppressor gene in various malignancies, including ovarian clear cell carcinoma (OCCC) [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], gastric cancer [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], and bladder cancer [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], and plays a pivotal role in epigenetic regulation, metabolic reprogramming, and DNA damage repair via chromatin accessibility modulation [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. ARID1A mutations, reported in 37% of EC cases, are among the most common genetic alterations in EC and are associated with oncogenic cell transformation and a poor prognosis [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. ARID1A mutations confer unique dependency characteristics in tumor cells, and this vulnerability, coupled with its high mutation frequency, positions ARID1A as one of the most promising molecular targets for synthetic lethality-based therapeutic strategies [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eSeveral synthetic lethal targets that interact with ARID1A have been identified. ARID1A-deficient cells have been shown to be sensitive to EZH2 inhibitors in various tumor models, including colon and bladder cancer models [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Similar to EZH2, HDAC inhibitors, which modulate histone acetylation, have also demonstrated selective cytotoxicity against ARID1A-deficient tumors [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Additionally, ATR inhibitors exhibit synthetic lethality in ARID1A-deficient tumors [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], and accumulating evidence suggests that ARID1A deficiency impairs both nonhomologous end joining (NHEJ) and homologous recombination (HR) repair pathways. Consequently, ARID1A-deficient cells become critically dependent on PARP1-mediated DNA repair [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. However, the significance of ARID1A in EC and its synthetic lethal targets remain insufficiently explored. Thus, investigating effective synthetic lethal strategies targeting ARID1A-deficient EC has the potential to yield novel clinical therapeutic approaches.\u003c/p\u003e\u003cp\u003eBeyond its role in DNA damage repair and chromatin remodeling, ARID1A deficiency also render cancer cells vulnerable to perturbations in other epigenetic regulators. Arginine methylation is among the most common posttranslational modifications (PTMs) catalyzed by members of the arginine methylase family and plays a role in maintaining various biological functions [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Among these family members, type II protein arginine methyltransferase (PRMT5) mainly catalyzes the symmetric dimethylation of arginine (Arg, R) residues on histones and nonhistone proteins, which regulates important pathways of gene transcription, protein translation and signaling [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Based on the involvement of PRMT5 in a variety of biological functions, such as cell proliferation, the cell cycle, immune escape, chemotherapeutic resistance, and DNA damage, PRMT5 has become a promising anticancer target [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. A variety of PRMT5 inhibitors have been developed for early clinical trials and have shown clinical promise in tumor-targeted therapy and immunotherapy [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Therefore, targeting PRMT5 may offer a promising therapeutic modality for cancer treatment.\u003c/p\u003e\u003cp\u003eGiven the high frequency of ARID1A mutations in EC and the lack of effective targeted therapies, we aimed to identify novel synthetic lethal vulnerabilities specific to ARID1A-deficient EC that could be exploited for the development of clinical therapies. Through high-throughput screening and mechanistic validation, we discovered that PRMT5 inhibitor JNJ-64619178 selectively kills ARID1A-deficient EC cells by disrupting R-loop homeostasis and causing DNA damage. Our findings demonstrate that ARID1A directly regulates PRMT5 expression, and PRMT5-mediated dimethylation enables the recruitment of DHX9 to resolve R-loops. ARID1A deficiency impairs this pathway, creating a dependency on PRMT5. The inhibition of PRMT5 exacerbates R-loop accumulation and synthetic lethality in ARID1A-deficient EC models. Our results reveal the ARID1A-PRMT5-DHX9 axis as a novel therapeutic target and provide a precision strategy for the precise treatment of ARID1A-deficient EC.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1. Cell Lines\u003c/h2\u003e\u003cp\u003eSTR-authenticated Ishikawa, HEC-1-A, SKOV3, HEK293T, and human endometrial epithelial cells (hEECs) were obtained from Zhongqiao Xinzhou Biotechnology. Ishikawa cells were incubated in F12 medium (Servicebio, China), and SKOV3 cells were incubated in high-glucose DMEM medium (Servicebio, China), HEK293T cells were incubated in DMEM medium (Servicebio, China), HEC-1-A cells were incubated in McCoy's 5A medium (Servicebio, China), human endometrial epithelial cells (hEECs) were incubated in Specialized culture medium (Zhongqiao Xinzhou Biotechnology, China). All cells were cultured in medium supplemented with 10% fetal bovine serum and penicillin/streptomycin at 37\u0026deg;C under a humidified 5% CO2 atmosphere. All cells were treated with mycoplasma elimination agents.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2. Knockout of ARID1A by CRISPR-Cas9\u003c/h2\u003e\u003cp\u003eThree sgRNA target sequences against ARID1A were designed: sgRNA1: 5\u0026prime;-ATGGTCATCGGGTACCGCTG-3\u0026prime;, sgRNA2:5\u0026prime;-CCCCTCAATGACCTCCAGTA-3\u0026prime;, sgRNA3: 5\u0026prime;-TCCTTCGCTCAGCAGCGCTT-3\u0026prime;. The sgRNAs were cloned into the CAS9-sgRNA-tag-EGFP vector (GeneChem; Shanghai; China). Plasmids were transfected into hEECs and Ishikawa cells using Lipofectamine 2000 (Invitrogen). Forty-eight hours post-transfection, EGFP-positive single cells were sorted by fluorescence-activated cell sorting (FACS) and plated into 96-well plates. Upon reaching sufficient density, cells were expanded. ARID1A knockout efficiency was validated by Western blot and Sanger sequencing.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3. Compound Library Screening\u003c/h2\u003e\u003cp\u003eA compound library containing 996 bioactive compounds was provided by TargetMol. ARID1A-deficient and ARID1A-WT hEECs and Ishikawa cells were seeded in 96-well plates at a density of 3000 cells per well. In the primary screening, ARID1A-deficient hEECs and Ishikawa cells were incubated with DMSO or 20 \u0026micro;M compound for 72 hours. Cell viability was measured using the CCK8 Assay to exclude compounds with limited efficacy in ARID1A-deficient cells (Cell viability\u0026thinsp;\u0026gt;\u0026thinsp;50%). In the secondary screening, both ARID1A-deficient and ARID1A-WT hEECs were treated with the selected compounds at a concentration of 2.5 \u0026micro;M for 72h. The differences in inhibition rates between ARID1A-deficient and ARID1A-WT cells were calculated and ranked. The top 16 compounds exhibiting the greatest differential effects were advanced to half-maximal inhibitory concentration (IC50) determination. Finally, the synthetic lethal effects were evaluated by calculating the sensitivity index (SI).SI\u0026thinsp;=\u0026thinsp;the IC50 of ARID1A-WT cells / the IC50 of ARID1A- deficient cells.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4. CCK-8 Assay\u003c/h2\u003e\u003cp\u003eCells were seeded at an appropriate density in 96-well plates at 3000 cells per well. After attachment, cells were treated with specified concentrations of drugs for indicated durations. Then, 10% CCK-8 reagent (Target Mol, C0005) was added and incubated at 37\u0026deg;C for 1\u0026ndash;2 hours. The OD450 was measured using a microplate reader, and cell viability was calculated based on the average of triplicate wells.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5. Colony Formation Assay\u003c/h2\u003e\u003cp\u003eA total of 1,000 cells was seeded per well in 6-well plates. After compound treatment or siRNA transfection, the medium was replaced with fresh medium every 3 days for 12 days. Cells were fixed with 4% paraformaldehyde (Servicebio, China), for 15 minutes, stained with 0.1% crystal violet (Servicebio, China) for 30 minutes, and washed with PBS until the background was clear. Colonies were photographed and counted.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.6. 5-Ethynyl-2\u0026prime;-deoxyuridine (EdU) assays\u003c/h2\u003e\u003cp\u003eCells were incubated with 10 mM EdU at 37\u0026deg;C for 2 hours according to the manufacturer\u0026rsquo;s instructions (C0075S; Beyotime Biotechnology, China). After removal of the medium, cells were fixed for 15 minutes, permeabilized with 0.3% Triton X-100 for 15 minutes, incubated with Click Additive Solution in the dark for 30 minutes, and finally stained with Hoechst 33342 for 10 minutes. Images were captured using a fluorescence microscope.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003e2.7. Apoptosis Assay\u003c/h2\u003e\u003cp\u003eApoptosis was detected using an apoptosis detection kit (C1062S; Beyotime Biotechnology). Cells were digested with EDTA-free trypsin (Servicebio, China), resuspended in 195 \u0026micro;L 1\u0026times; Binding Buffer, and stained with 10 \u0026micro;L propidium iodide (PI) and 5 \u0026micro;L Annexin V-FITC in the dark for 30 minutes. Samples were analyzed by flow cytometry, and apoptosis rates were quantified using FlowJo software.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003e2.8. Quantitative Real-Time PCR (qRT-PCR)\u003c/h2\u003e\u003cp\u003eTotal RNA was extracted using TRIzol (Takara, Japan). cDNA was synthesized using the Hieff Canace PCR Master Mix (10137ES; Yeasen Biotechnology, China). qRT-PCR was performed using Hieff Unicon\u0026reg; qPCR TaqMan Probe Master Mix (10138ES; Yeasen Biotechnology) on a Bio-Rad CFX96 system. Gene expression was normalized and calculated using the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method. PRMT5 forward primer:5'-CGATCAGACCTACTGCTGTCA-3', PRMT5 reverse primer: 5'-CTCGGAGTTCCTGCGAATCT-3'\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e2.9. Western Blotting\u003c/h2\u003e\u003cp\u003eCells were lysed on ice for 30 minutes using RIPA buffer containing cocktail protease inhibitors, PMSF, and phosphatase inhibitors (Beyotime Biotechnology; Shanghai; China). Lysates were centrifuged at 12,000 rpm for 15 minutes. Proteins were separated by SDS-PAGE and transferred to PVDF membranes. Membranes were blocked with 5% skim milk for 2 hours, incubated with primary antibodies at 4\u0026deg;C overnight, and then with HRP-conjugated secondary antibodies for 1\u0026ndash;2 hours. Protein bands were visualized using an ECL detection system. We obtained the following antibodies from the respective suppliers: 1:1,000-diluted anti-ARID1A (abcam, ab182560), anti-PRMT5(Proteintech,18436-1-AP), anti-DHX9(Proteintech,17721-1-AP), anti-SRSF1(Proteintech,12929-2-AP), anti-Symmetric Di-Methyl Arginine Motif (CST,13222), anti-cleaved caspase-3 (CST,9664), anti-cleaved-PARP(ABclonal,A27147), anti-p-ATM-S1981(ABclonal,AP0008), anti-phospho-histone H2A.X (Ser139) (Abmart,TA3187), and anti-Alpha Tubulin (Proteintech,14555-1-AP). 1:10,000 diluted anti-beta Actin (Proteintech,66009-1-Ig).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e2.10. Small interfering RNA (siRNA) transfection\u003c/h2\u003e\u003cp\u003eThe siRNAs targeting PRMT5 and ARID1A were designed, and synthesized (TsingkeBiotechnology; Beijing; China). The siRNAs were transfected into cells using LipoRNAi\u0026trade; (C0535; Beyotime Biotechnology) for 48 hours. Knockdown efficiency was confirmed by Western blot. siRNA sequences:\u003c/p\u003e\u003cp\u003eARID1A siRNA1: 5\u0026prime;- GGUGACCUGAUUGCAGUAUTT-3\u0026prime;,\u003c/p\u003e\u003cp\u003eARID1A siRNA2: 5\u0026prime;- GCAGCAAGCAGCUGUUUAUTT-3\u0026prime;,\u003c/p\u003e\u003cp\u003ePRMT5 siRNA1: 5\u0026prime;- GGAACCAAAGAUCAUACAUTT-3\u0026prime;,\u003c/p\u003e\u003cp\u003ePRMT5 siRNA2: 5\u0026prime;- GCAGCAAACCUCAGGGAAATT-3\u0026prime;.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003e2.11. Immunofluorescence\u003c/h2\u003e\u003cp\u003eCells cultured on coverslips were fixed with paraformaldehyde and permeabilized with 0.1% Triton X-100 (P0096; Beyotime Biotechnology). After blocking with 2% BSA for 1 hour, cells were incubated with anti-S9.6 (ENH001, Kerafast; diluted 1:200), anti-phospho-histone H2A.X (Ser139) (Abmart,TA3187;diluted 1:200), or anti-53BP1(Proteintech,20002-1-AP; diluted 1:200) antibodies at 4\u0026deg;C overnight, followed by secondary antibody incubation for 2 hours. Nuclei were stained with DAPI. Images were acquired using an Olympus FluoView\u0026trade; FV1000 microscope.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e2.12. Comet Assay\u003c/h2\u003e\u003cp\u003eThe comet assay was performed using a comet assay kit (KGA1302-50; KeyGEN Bio TECH; Nanjing; China) following the manufacturer's protocol. A three-layer agarose was prepared on slides: the first layer consisted of 100 \u0026micro;L of 1% normal melting point agarose; the second layer contained 10⁴ cells embedded in 0.7% low melting point agarose; and the third layer was formed by adding another 100 \u0026micro;L of 0.7% low melting point agarose. The slides were solidified at 4\u0026deg;C for 30 minutes and then lysed using Lysis Buffer at 4\u0026deg;C for 2 hours. Subsequently, the slides were electrophoresed at 25volts for 25 min in alkaline buffer (0.186 g EDTA, 6 g NaOH, and 500 mL H₂O). The solution was neutralised using 0.4 mM Tris-HCl (pH 7.5) buffer. The slides were then stained with 10 \u0026micro;L of propidium iodide (PI) in the dark for 10 minutes. Finally, the slides were observed and imaged under a fluorescence microscope.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003e2.13. Co-Immunoprecipitation (Co-IP)\u003c/h2\u003e\u003cp\u003eCells were lysed on ice for 30 minutes with IP lysis buffer (C0075S; Beyotime Biotechnology, China) supplemented with PMSF and phosphatase inhibitors (1:1:100). The protein lysate was collected after centrifugation at 12,000 rpm for 15 minutes. The Protein A/G magnetic beads (MedChemExpress; Shanghai; China)) were washed three times for 1 minute using IP wash buffer. The magnetic beads were added to the protein lysate. The protein lysate was then incubated with antibodies or control IgG overnight at 4\u0026deg;C with rotation. The beads were washed with wash buffer, and the bead-protein complexes were resuspended in 1\u0026times; loading buffer. After heating at 95\u0026deg;C for 10 minutes, the magnetic beads were separated using a magnetic rack, and the protein complexes were collected.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003e2.14. Mass Spectrometry Analysis\u003c/h2\u003e\u003cp\u003eMass spectrometry analysis was performed by Beijing Spectrum Union Biotechnology Co., Ltd.\u003c/p\u003e\u003cp\u003e\u003cb\u003e(1) Sample Preparation\u003c/b\u003e\u003c/p\u003e\u003cp\u003eProteins were denatured, reduced, and alkylated in the reaction buffer (1% SDC/100 mM Tris-HCl, pH\u0026thinsp;=\u0026thinsp;8.5/10 mM TCEP/40 mM CAA) at 95\u0026deg;C for 10 minutes. After centrifugation, the supernatant was collected and diluted with an equal volume of ddH₂O. Trypsin was added, and the mixture was incubated overnight at 37\u0026deg;C with shaking for enzymatic digestion.\u003c/p\u003e\u003cp\u003e\u003cb\u003e(2) Mass Spectrometry Analysis\u003c/b\u003e\u003c/p\u003e\u003cp\u003eAll samples were analyzed on an UltiMate 3000 RSLCnano system coupled on-line with Q Exactive HF mass spectrometer through a Nanospray Flex ion source (Thermo). Peptide samples were injected into a C18 Trap column (75 \u0026micro;m*2 cm, 3 \u0026micro;m particle size, 100 \u0026Aring; pore size, Thermo), and separated in a reversed-phase C18 analytical column packed in-house with ReproSil-Pur C18-AQ resin (75 \u0026micro;m*25 cm, 1.9 \u0026micro;m particle size, 100 \u0026Aring; pore size). Mobile phase A (0.1% formic acid/3% DMSO/97% H2O) and mobile phase B (0.1% formic acid/3% DMSO/97% ACN) were used to establish the seperation gradient at a flow rate of 300 nL/min.Data were acquired in data-dependent acquisition (DDA) mode.\u003c/p\u003e\u003cp\u003e\u003cb\u003e(3) Database Search and Bioinformatic Analysis\u003c/b\u003e\u003c/p\u003e\u003cp\u003eRaw mass spectrometry data were processed using MaxQuant (version 1.6.6.0) with the built-in Andromeda search engine. The search was performed against the human protein sequence database downloaded from UniProt (release 20230619). Bioinformatics analysis and visualization were conducted using R. Protein-protein interaction (PPI) networks were generated using the STRING database, and the resulting interaction files were imported into Cytoscape version 3.7.2 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://cytoscape.org/download.html\u003c/span\u003e\u003cspan address=\"https://cytoscape.org/download.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) for network construction and visualization.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003e2.15. Proximity Ligation Assay (PLA)\u003c/h2\u003e\u003cp\u003eThe \u003cem\u003eDuolink\u0026reg; In Situ PLA Kit\u003c/em\u003e (DUO92101, Sigma-Aldrich) was used according to the manufacturer\u0026rsquo;s instructions. Cells on slides were fixed, permeabilized, and blocked with \u003cem\u003eDuolink\u0026reg; blocking buffer\u003c/em\u003e at 37\u0026deg;C for 60 minutes. S9.6 (ENH001, Kerafast) and DHX9(Proteintech,17721-1-AP) were diluted in Duolink antibody diluent and applied to the slides for 2 hours at 37\u0026deg;C. Slides were washed twice for 5 minutes using 1\u0026times; Wash Buffer A. Duolink PLA probes (anti-rabbit minus (DUO92005) and anti-mouse plus (DUO92001)) were applied to the slides for 60 minutes at 37\u0026deg;C. After washing with 1\u0026times; Wash Buffer A, the ligation solution was added and incubated for 30 minutes at 37\u0026deg;C. Slides were washed again, and the amplification solution was applied for 100 minutes at 37\u0026deg;C. Final washes were performed with 1\u0026times; Wash Buffer B and 0.01\u0026times; Wash Buffer B. Slides were mounted with \u003cem\u003eDuolink In Situ\u003c/em\u003e containing DAPI and analyzed after 15 minutes using fluorescence or confocal microscopy. Average PLA foci were calculated by examining at least 50 cells per treatment in three different experiments. The number of PLA foci per nucleus were quantified using ImageJ.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003e2.16. R-Loop Dot Blot Assay\u003c/h2\u003e\u003cp\u003eGenomic DNA was isolated from cells using the DNeasy Blood \u0026amp; Tissue Kit (TsingkeBiotechnology; Beijing; China). The DNA concentration was serially diluted to 250 ng/\u0026micro;L, 125 ng/\u0026micro;L, and 62.5 ng/\u0026micro;L. A control group was treated with 5 units of RNase H (M0297, New England Biolabs). 2\u0026micro;L DNA were spotted onto a nitrocellulose membrane and crosslinked under UV light. The membrane was blocked with 5% non-fat milk for 1 hour, followed by overnight incubation at 4\u0026deg;C with the R-loop-specific antibody S9.6 (ENH001, Kerafast; diluted 1:200). After washing three times, the membrane was incubated with HRP-conjugated goat anti-mouse IgG secondary antibody. R-loop signals were visualized using enhanced chemiluminescence (ECL) substrate, and methylene blue staining was used as a loading control.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003e2.17. Plasmid Transfection\u003c/h2\u003e\u003cp\u003eFlag-PRMT5, mCherry-RNASEH1, HA-DHX9, HA-DHX9 mutants (R1219K, R1223K, R1227K), and Flag-ARID1A plasmids were provided by GenChem (Shanghai; China). Transfection was performed using Lipofectamine 2000 (Invitrogen; 11668019).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003e2.18. RNA Sequencing\u003c/h2\u003e\u003cp\u003eRNA was extracted using TRIzol. Libraries were prepared using the Optimal Dual-mode mRNA Library Prep Kit (BGI) and sequenced on an MGISEQ-2000 (CapitalBio). Differential expression was defined as |log2FC| \u0026ge; 1 and FDR\u0026thinsp;\u0026lt;\u0026thinsp;0.05. The Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways was analyzed using R software with a significance threshold of P\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003e2.19. Protein Docking\u003c/h2\u003e\u003cp\u003eThe crystal structure of PRMT5 (PDB ID: 3UA4) was retrieved from the Protein Data Bank (PDB). The sequence of DHX9 (UniProt ID: Q08211, human) was obtained from UniProt, and its three-dimensional structure was predicted using AlphaFold. Both protein structures were subjected to preprocessing, including regeneration of native ligand states, hydrogen bond assignment optimization, protein energy minimization, and removal of water molecules. Protein-protein docking was performed using the Piper module within the Schr\u0026ouml;dinger suite, and the corresponding binding energy was calculated.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\u003ch2\u003e2.20. Multiplex Immunohistochemistry\u003c/h2\u003e\u003cp\u003eParaffin sections were deparaffinized, rehydrated, and subjected to antigen retrieval using microwave treatment. Sections were blocked with peroxidase blocking buffer and immunohistochemical blocking buffer (C0075S; Beyotime Biotechnology, China) for 20\u0026ndash;30 minutes. The anti-ARID1A (abcam, ab182560; diluted 1:200) and anti-PRMT5\u003c/p\u003e\u003cp\u003e(Proteintech,18436-1-AP; diluted 1:200) were applied overnight at 4\u0026deg;C, followed by HRP-conjugated secondary antibodies for 30 minutes. After repeated antigen retrieval, subsequent antibodies were stained sequentially. Nuclei were stained with DAPI, and slides were mounted with anti-fade mounting medium. Fluorescence signals were scanned and quantified.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec23\" class=\"Section2\"\u003e\u003ch2\u003e2.21. Chromatin Immunoprecipitation (ChIP)\u003c/h2\u003e\u003cp\u003eChIP was performed using a ChIP assay kit (P2078, Beyotime) following the manufacturer's protocol. Cells were crosslinked with 1% formaldehyde at room temperature for 10 min, and the reaction was terminated by adding glycine. Cells were then lysed on ice for 10 min using SDS lysis buffer containing PMSF, followed by chromatin fragmentation through sonication for 10 min. The sheared chromatin was immunoprecipitated with ARID1A (CST, #12354) or control IgG (B900610, Proteintech, China) at 4\u0026deg;C overnight. Pre-washed Protein A/G magnetic beads were added to capture the complexes and incubated at 4\u0026deg;C overnight. After washing the beads to remove non-specific binding, DNA was purified and dissolved in TE buffer. The Chip DNA was quantified by qRT-PCR. The FIMO was used to predict potential binding sites on the PRMT5 promoter using the ARID1A binding motif from the HOCOMOCOv13 database. Based on the location of these predicted binding sites, corresponding primers were designed. The primers targeting PRMT5 promoter used for ChIP-qPCR were:\u003c/p\u003e\u003cp\u003ePRMT5 site1 forward primer: GGCACTGTTTCTCTCCGTGA,\u003c/p\u003e\u003cp\u003ePRMT5 site1 reverse primer: CCACCAATCTCAGGGTCTGG,\u003c/p\u003e\u003cp\u003ePRMT5 site2-4 forward primer: CATGGCTGCATAACCCAACC,\u003c/p\u003e\u003cp\u003ePRMT5 site2-4 reverse primer : AGATTCCAGGTTCGACTCCT ,\u003c/p\u003e\u003cp\u003ePRMT5 site3-6 forward primer: TCACTAGGAAGTAGTAGCTGAGT,\u003c/p\u003e\u003cp\u003ePRMT5 site3-6 reverse primer: CCGTAACTACCCTCAAAAGTGTTT,\u003c/p\u003e\u003cp\u003ePRMT5 site5 forward primer: TGTCTTTCCTTGCTTCCTTCCT,\u003c/p\u003e\u003cp\u003ePRMT5 site5 reverse primer: ACACACACACACACCTCAAGA.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec24\" class=\"Section2\"\u003e\u003ch2\u003e2.22. Patient Samples\u003c/h2\u003e\u003cp\u003eEC and normal endometrial tissues were obtained from Union Hospital, Huazhong University of Science and Technology. All participants provided written informed consent. The study was approved by the Institutional Ethics Committee (No. 2020-S218) and conducted in accordance with the Declaration of Helsinki.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec25\" class=\"Section2\"\u003e\u003ch2\u003e2.23. Establishment of Patient-Derived Organoids (PDOs)\u003c/h2\u003e\u003cp\u003eFresh EC tumor tissues were collected to establish PDOs. The tissues were cut into small pieces, rinsed three times with ice-cold DPBS supplemented with streptomycin and penicillin, and digested for 1 hour at 37\u0026deg;C using MasterAim\u0026reg; Tissue Digestion Buffer I and II (AimingMed, Hangzhou, China). The suspension was filtered through a 70 \u0026micro;m strainer and washed with DPBS, followed by centrifugation at 400g for 5 minutes. The cells were then resuspended in MasterAim\u0026reg; Matrix (AimingMed, Hangzhou, China) and seeded into pre-warmed 24-well plates. After gelation at 37\u0026deg;C for 10 minutes, 500 \u0026micro;L of specialized organoid culture medium (AimingMed, Hangzhou, China) was added to each well. For hematoxylin and eosin (H\u0026amp;E) staining, fixed organoids were pre-embedded in 2% agarose, followed by dehydration, clearing, and paraffin infiltration. The samples were then embedded in paraffin, and 4 \u0026micro;m-thick sections were prepared. These sections were subsequently deparaffinized, rehydrated, and stained with H\u0026amp;E. The establishment of PDOs was reviewed and approved by the Ethics Committee (CTOB-2025-0917).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec26\" class=\"Section2\"\u003e\u003ch2\u003e2.24. Xenograft Model\u003c/h2\u003e\u003cp\u003eSix-week-old female BALB/c nude mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. Subcutaneous xenografts were established by injecting 5\u0026times;10⁵ Luciferase-labeled ARID1A WT or ARID1A-deficient Ishikawa cells. When tumor volume reached\u0026thinsp;~\u0026thinsp;100 mm\u0026sup3;, the mice were randomized into four groups (n\u0026thinsp;=\u0026thinsp;6): ARID1A WT\u0026thinsp;+\u0026thinsp;saline; ARID1A WT\u0026thinsp;+\u0026thinsp;10 mg/kg JNJ-64619178; ARID1A-deficient\u0026thinsp;+\u0026thinsp;saline; ARID1A-deficient\u0026thinsp;+\u0026thinsp;10 mg/kg JNJ-64619178. Treatments were administered every two days for 18 days. Tumor volume was measured every three days using the formula: (length \u0026times; width\u0026sup2;)/2. In vivo fluorescence imaging was performed weekly. Body weight was monitored regularly. Mice were sacrificed after 25 days, and tumors were weighed, fixed in formalin, paraffin-embedded, and subjected to H\u0026amp;E staining and immunohistochemical analysis. All animal procedures were approved by the Ethics Committee of Union Hospital, Huazhong University of Science and Technology (2024\u0026ndash;4794).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec27\" class=\"Section2\"\u003e\u003ch2\u003e2.25. Statistical analysis\u003c/h2\u003e\u003cp\u003eData analysis and visualizations were performed using GraphPad Prism 9. All data were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD deviation. T-test was used to compare two groups, and one-way ANOVA was used to compare multiple groups. Statistical significance was defined at P\u0026thinsp;\u0026lt;\u0026thinsp;0.05. Significance was indicated as follows: *P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **P\u0026thinsp;\u0026lt;\u0026thinsp;0.01, ***P\u0026thinsp;\u0026lt;\u0026thinsp;0.001, ****P\u0026thinsp;\u0026lt;\u0026thinsp;0.0001. ns, non-significant.\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec29\" class=\"Section2\"\u003e\u003ch2\u003e3.1. ARID1A mutational signatures in endometrial cancer (EC)\u003c/h2\u003e\u003cp\u003eTo investigate the landscape of ARID1A mutations in EC, we analyzed MSK-IMPACT clinical sequencing data from 1,022 EC patients using the cBioPortal platform (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.cbioportal.org/\u003c/span\u003e\u003cspan address=\"http://www.cbioportal.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. ARID1A ranks among the top three most frequently mutated genes in EC (62.8%) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA-\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). We further analyzed the mutation frequencies and types of ARID1A across four molecular subtypes: CN-L/NSMP (56.1%), MSI-H (80.3%), POLE-mutant (64.9%), and CN-H/TP53 (19.4%). Strikingly, truncating mutations (indicated by black bars) constituted the predominant variant type in all molecular subtypes, resulting in functional inactivation of the ARID1A protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003e3.2. High-throughput drug screening identifies PRMT5 inhibition JNJ-64619178 as a synthetic lethal strategy in ARID1A-deficient EC cells.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo further explore synthetic lethal targets of ARID1A, we generated ARID1A knockout cell models using CRISPR-Cas9 system in ARID1A-WT human endometrial epithelial cells (hEECs) and Ishikawa cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). To identify druggable vulnerabilities, we conducted high-throughput screening in ARID1A-WT hEECs and Ishikawa cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). A library of 966 bioactive compounds was screened to identify compounds inducing synthetic lethality in ARID1A-deficient cells. Initial screening at 20 \u0026micro;M for 72h in ARID1A-deficient Ishikawa cells and hEECs excluded compounds with less than 50% inhibition, yielding 294 candidates for further evaluation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC). These compounds were then tested at 2.5 \u0026micro;M to compare the inhibition rates between ARID1A-deficient and ARID1A WT Ishikawa cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). The top 16 compounds showing the greatest differential inhibition were selected for half-maximal inhibitory concentration (IC50) determination (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). We then calculated the sensitivity index for the 16 compounds (IC50 of ARID1A WT cells/IC50 of ARID1A-deficient cells). Seven candidate compounds with sensitivity indices (SI)\u0026thinsp;\u0026ge;\u0026thinsp;3 were ultimately identified: HDAC6 inhibitor (CAY10603), HMGCR inhibitor (Simvastatin), JAK/STAT3 inhibitor (Homoharringtonine), BET inhibitor((R)-(-)-JQ1 Enantiomer), PRMT5 inhibitors (JNJ-64619178, MRTX9768), ATR inhibitors (Ceralasertib) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). As shown in the IC50 curves, the PRMT5 inhibitor JNJ-64619178 exhibited the highest sensitivity index (7.62;9.60) and significantly inhibited the viability of ARID1A-deficient hEECs (IC50\u0026thinsp;=\u0026thinsp;1.03\u0026micro;M) and Ishikawa cells (IC50\u0026thinsp;=\u0026thinsp;0.70\u0026micro;M) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). Based on these results, our study selected JNJ-64619178 as the core synthetic lethal compound targeting ARID1A-deficient EC.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec30\" class=\"Section2\"\u003e\u003ch2\u003e3.3. PRMT5 inhibition exhibits synthetic lethality in ARID1A-deficient EC cells.\u003c/h2\u003e\u003cp\u003eWe further validated the synthetic lethal effect of JNJ-64619178 in ARID1A-deficient hEECs and Ishikawa cells. Colony formation assays demonstrated that the PRMT5 inhibitor suppressed colony formation in ARID1A-deficient hEECs and Ishikawa cells in a dose-dependent manner, with significant anticancer effects observed at 2.5 \u0026micro;M (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Similar effects were observed in ARID1A-mutated SKOV3 and HEC-1-A cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). EdU assays further confirmed that JNJ-64619178 markedly inhibited the proliferation of ARID1A-deficient cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). These results indicate that JNJ-64619178 selectively inhibits the proliferation of ARID1A-deficient cells.\u003c/p\u003e\u003cp\u003eTo confirm that PRMT5 is the key mediator of synthetic lethality in ARID1A-deficient cells, we knocked down PRMT5 using siRNA in ARID1A-deficient hEECs and Ishikawa cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). CCK-8 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE) and colony formation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF) assays revealed that PRMT5 knockdown significantly reduced cell viability and colony formation in ARID1A-deficient hEECs and Ishikawa cells but did not significantly inhibited ARID1A-WT cells. To determine whether the synthetic lethal effect of PRMT5 inhibition depends on the ARID1A status, we reintroduced WT ARID1A into ARID1A-deficient hEECs and Ishikawa cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG). CCK-8 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH) and colony formation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eI) assays demonstrated that ARID1A overexpression reversed the anticancer effects of PRMT5 inhibition. These findings confirm a synthetic lethal interaction between ARID1A and PRMT5.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec31\" class=\"Section2\"\u003e\u003ch2\u003e3.4. PRMT5 inhibition promotes apoptosis in ARID1A-deficient EC cells\u003c/h2\u003e\u003cp\u003eTo elucidate the mechanism by which PRMT5 inhibition induces apoptosis in ARID1A-deficient cells, we performed transcriptomic sequencing of ARID1A-deficient Ishikawa cells treated with JNJ-64619178. Gene Ontology (GO) enrichment analysis revealed that PRMT5 inhibition regulates the DNA damage response in ARID1A-deficient cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Concurrently, KEGG pathway analysis indicated significant enrichment of apoptosis-related pathways (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Flow cytometry apoptosis assays confirmed that JNJ-64619178 markedly increased the proportion of late apoptosis cells in ARID1A-deficient Ishikawa cells (from 3.45% to 30.72%, p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) and ARID1A-deficient hEECs (from 3.9% to 25.33%, p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) but had no significant proapoptotic effect on ARID1A-WT Ishikawa cells or hEECs (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Additionally, JNJ-64619178 enhanced late apoptosis in HEC-1-A and SKOV3 cells. WB analysis revealed that JNJ-64619178 upregulated the expression of the apoptosis markers cleaved caspase-3 and cleaved PARP in ARID1A-deficient cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). These results demonstrate that JNJ-64619178 specifically promotes apoptosis in ARID1A-deficient cells.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec32\" class=\"Section2\"\u003e\u003ch2\u003e3.5. PRMT5 inhibition promotes DNA damage in ARID1A-deficient EC cells\u003c/h2\u003e\u003cp\u003eTo investigate whether PRMT5 inhibition induces DNA damage in ARID1A-deficient EC cells, we assessed the expression of the DNA damage markers γ-H2AX and 53BP1 by immunofluorescence. Both JNJ-64619178 and PRMT5 knockdown promoted the formation of γ-H2AX and 53BP1 foci in ARID1A-deficient Ishikawa and hEECs, with no significant DNA damage foci observed in ARID1A-WT cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Comet assays further revealed that JNJ-64619178 increased DNA tail length in ARID1A-deficient cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). WB analysis revealed that compared with ARID1A-WT cells, PRMT5 inhibition upregulated γ-H2AX and p-ATM expression in ARID1A-deficient cells in a dose-dependent manner (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). Collectively, these findings indicate that PRMT5 inhibition induces significant DNA damage in ARID1A-deficient EC cells.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec33\" class=\"Section2\"\u003e\u003ch2\u003e3.6. PRMT5 inhibition-induced DNA damage is associated with aberrant R-loop accumulation\u003c/h2\u003e\u003cp\u003eGiven that PRMT5 is a key arginine methyltransferase, we sought to explore the mechanism underlying its role in DNA damage induction. We performed pull-down assays coupled with mass spectrometry to identify PRMT5-interacting proteins in Ishikawa cells. Protein network analysis revealed that PRMT5 regulates various proteins involved in RNA metabolism and processing (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA), many of which are closely associated with R-loop regulation (including DHX9, SRSF1, DDX21, NAT10, TOP2A, and TOP1). To determine whether PRMT5 inhibition leads to an increase in R-loop levels, we assessed R-loop accumulation using dot-blot assays and immunofluorescence with the S9.6 antibody [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Immunofluorescence experiments demonstrated that both PRMT5 knockdown and JNJ-64619178 significantly increased R-loop accumulation in ARID1A-deficient Ishikawa cells and hEECs compared with that in ARID1A-WT cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). Dot-blot assays indicated that JNJ-64619178 promotes R-loop accumulation in ARID1A-deficient cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). These results demonstrated that PRMT5 inhibition induces excessive accumulation of R-loops in ARID1A-deficient cells. Previous studies have established that pathological R-loop accumulation is a major cause of replication stress [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. We therefore hypothesized that PRMT5 inhibition promotes DNA damage and apoptosis by regulating R-loops. To test this hypothesis, we overexpressed RNase H1(an enzyme that specifically resolves R-loop accumulation) [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e] to reduce R-loop accumulation. The results showed that RNase H1 overexpression significantly attenuated R-loops accumulation induced by PRMT5 inhibition in ARID1A-deficient cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB-\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). Consistent with this effect, overexpression of RNase H1 not only reduced DNA tail length (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD) but also suppressed the expression of γ-H2AX and 53BP1, as revealed by immunofluorescence staining in ARID1A-deficient Ishikawa cells and hEECs (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE). Furthermore, RNase H1 downregulated the expression of γ-H2AX, cleaved caspase-3, and cleaved PARP in ARID1A-deficient cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF). These results collectively indicate that R-loop regulation plays a critical role in PRMT5 inhibition-induced DNA damage and apoptosis in ARID1A-deficient cells.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec34\" class=\"Section2\"\u003e\u003ch2\u003e3.7. PRMT5 Regulates R-Loop Resolution by Binding and Methylating DHX9\u003c/h2\u003e\u003cp\u003eWe next investigated the mechanism by which PRMT5 inhibition promotes R-loop accumulation in ARID1A-deficient cells. PRMT5 is a type II enzyme primarily responsible for symmetric dimethylarginine (SDMA) modification. Using the PhosphoSitePlus database (phosphosite.org), we analyzed arginine dimethylation sites on PRMT5-interacting R-loop regulatory proteins (including DHX9, SRSF1, DDX21, NAT10, TOP2A, and TOP1) and identified multiple potential SDMA sites on DHX9 and SRSF1. Endogenous co-IP assays in Ishikawa cells and hEECs confirmed interactions between PRMT5 and both DHX9 and SRSF1(Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA). To further determine whether PRMT5 regulates SDMA of DHX9 and SRSF1, we examined the arginine dimethylation levels of DHX9 and SRSF1 in PRMT5-inhibited Ishikawa and hEECs using an anti-SDMA antibody. Subsequent analysis of the SDMA levels revealed that compared with SRSF1, JNJ-64619178 and PRMT5 knockdown caused a more pronounced reduction in the arginine methylation of DHX9 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB). We therefore focused on the PRMT5\u0026ndash;DHX9 axis. Exogenous immunoprecipitation experiments were performed by co-expressing FLAG-tagged PRMT5 and HA-tagged DHX9, the results further validated the interaction between PRMT5 and DHX9 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC). Recent studies indicate that DHX9 can be recruited to R-loops, facilitating R-loops resolution and contributing to genomic stability (25). We therefore hypothesized that PRMT5 inhibition impairs the recruitment of DHX9 to R-loops. A proximity ligation assay (PLA) revealed that JNJ-64619178 and PRMT5 knockdown significantly reduced the number of nuclear DHX9-R-loop PLA foci, indicating that the interaction between DHX9 and R-loops was impaired (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD). Thus, we propose that PRMT5 inhibition reduces the arginine methylation of DHX9, decreasing its recruitment to R-loops and leading to R-loop accumulation.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec35\" class=\"Section2\"\u003e\u003ch2\u003e3.8. Arginine methylation of DHX9 mediated by PRMT5 suppresses R-loop accumulation and DNA damage\u003c/h2\u003e\u003cp\u003eTo identify specific arginine methylation sites on DHX9, we performed protein‒protein docking (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA) and used PhosphoSitePlus to predict potential arginine methylation sites (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB). Four arginine(R)-to-lysine (K) mutations (R1175K, R1219K, R1223K, and R1227K) and DHX9 wild-type (WT) were generated and co-transfected with Flag-PRMT5 in HEK293T cells. Mutations at residues 1219, 1223, and 1227 reduced the arginine methylation level of DHX9, compared to DHX9-WT. A triple mutation (DHX9-3RK: R1219K/R1223K/R1227K) significantly suppressed the SDMA of DHX9 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC). We next sought to determine whether methylation at residues R1219, R1223, and R1227 of DHX9 influences its recruitment to R-loop structures. We transfected the DHX9-WT and DHX9-3RK in hEECs treated with siPRMT5. The results showed that overexpressed of the DHX9-WT, but not the DHX9-3RK, restored DHX9 recruitment to R-loops, as assessed by PLA, indicating that R1219, R1223, and R1227 are critical sites for the PRMT5-mediated methylation of DHX9 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eD-\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eE).\u003c/p\u003e\u003cp\u003eWe further reintroduced the DHX9-WT or DHX9-3RK in ARID1A-deficient Ishikawa cells and hEECs treated with siPRMT5 or JNJ-64619178. Dot-blot assays (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eF) and S9.6 immunofluorescence staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eG) demonstrated that overexpression of DHX9-WT, but not DHX9-3RK, significantly suppressed R-loop accumulation. Consistent with this finding, DHX9-WT expression also attenuated PRMT5 inhibition-induced DNA damage, as indicated by shorter comet tail lengths (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eI) and reduced γ-H2AX expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eI-\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eJ). In contrast, the DHX9-3RK failed to confer such protective effects. These findings demonstrate that arginine methylation at residues R1219, R1223, and R1227 of DHX9 plays a crucial role in the PRMT5-mediated maintenance of R-loop homeostasis and facilitation of DNA damage repair.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003e3.9. ARID1A deficiency leads to a reliance on PRMT5 for R-loop homeostasis due to impaired direct activation of the PRMT5 promoter.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eFinally, we explored why ARID1A-deficient cells exhibit heightened vulnerability to PRMT5 inhibition compared with ARID1A-WT cells. Analysis of data from the GEPIA database revealed a positive correlation between ARID1A and PRMT5 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eA). PCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eB) and WB assays (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eC-CE) further revealed that ARID1A knockdown downregulated PRMT5 expression at both the mRNA and protein levels in Ishikawa cells and hEECs, whereas ARID1A overexpression upregulated PRMT5 expression in ARID1A-deficient Ishikawa cells and hEECs. Multiplex IHC of clinical samples revealed revealed that the expression levels of both ARID1A and PRMT5 were significantly downregulated in EC tissues compared to normal endometrial tissues (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eF). A positive correlation was observed between ARID1A and PRMT5 expression. These findings suggest that ARID1A may transcriptionally regulate PRMT5 to maintain R-loop homeostasis.\u003c/p\u003e\u003cp\u003eUsing the ARID1A binding motif from HOCOMOCOv13 data base, potential binding sites on the PRMT5 promoter were predicted by FIMO (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eG). We then designed four pairs of primers covering the potential binding sites of PRMT5 (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eH). ChIP assays were performed to determine whether PRMT5 is a direct transcriptional target of ARID1A. The results demonstrated that ARID1A binds to all four predicted regions (primer sets 1\u0026ndash;4), with the highest enrichment observed for primer set 2 ( the region from \u0026minus;\u0026thinsp;1476 to -1633 bp upstream of the transcription start site), while the other regions showed relatively weaker binding signals(Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eI-\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003eJ). These results indicate that ARID1A directly binds to the PRMT5 promoter region. Thus, ARID1A loss leads to reduced PRMT5 expression, which may contribute to baseline R-loop accumulation. Subsequent PRMT5 inhibition further exacerbates R-loop accumulation by impairing the function of DHX9, ultimately leading to DNA damage and apoptosis specifically in ARID1A-deficient cells.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003e3.10. Validation of the synthetic lethal interaction between PRMT5 and ARID1A in patient-derived organoids (PDOs) and xenografts.\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo further validate the synthetic lethal interaction between PRMT5 inhibition and ARID1A deficiency in EC, we established EC PDOs (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eA). The successful formation of PDOs was confirmed by H\u0026amp;E staining, as well as by IHC for Ki-67 and CD133 (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eB). We knocked down ARID1A in the EC PDOs and treated both ARID1A-WT and ARID1A-knockdown EC PDOs with 2.5 \u0026micro;M JNJ-64619178. The results demonstrated that JNJ-64619178 significantly inhibited the proliferation of ARID1A-knockdown PDOs, further supporting the synthetic lethal interaction between ARID1A and PRMT5 (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eC).\u003c/p\u003e\u003cp\u003eTo evaluate the antitumor efficacy of JNJ-64619178 in vivo, we utilized a xenograft mouse model. Luciferase-labeled ARID1A-deficient or ARID1A-WT Ishikawa cells were subcutaneously injected into nude mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eD). When the tumor volume reached approximately 100 mm\u0026sup3;, the mice were randomly divided into four groups and treated with either 10 mg/kg JNJ-64619178 or an equivalent volume of saline control every other day for 18 days, and tumor growth was monitored. In vivo bioluminescence imaging demonstrated that JNJ-4619178 significantly suppressed the growth of ARID1A-deficient tumors compared with ARID1A-WT tumors (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eE-\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eF). The imaging of xenograft tumors after mouse sacrifice further confirmed that JNJ-64619178 markedly inhibited the proliferation of ARID1A-KO tumors (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eG) and reduced the weight of xenografts (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eH). Immunohistochemistry analysis revealed that JNJ-64619178 promoted the expression of γ-H2AX and decreased the expression of Ki-67 (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eI). These in vivo results are consistent with the synthetic lethality observed in vitro, collectively demonstrating that JNJ-64619178 induces synthetic lethality in ARID1A-deficient EC both in vitro and in vivo. In terms of safety, compared with the normal control group, mice treated with JNJ-4619178 showed no significant body weight loss (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003eJ). Moreover, histopathological examination of the heart, liver, spleen, lungs, and kidneys indicated that JNJ-64619178 was well-tolerated without causing significant toxicity (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eS).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eARID1A, a specific subunit of the PBAF chromatin remodeling complex, is frequently mutated in EC. However, effectively treating ARID1A-deficient tumors remains a clinical challenge. A synthetic lethality strategy has been employed to target tumor suppressor gene-mutated cancers. To identify novel approaches for targeting ARID1A-deficient cancers, we conducted high-throughput screening and, for the first time, discovered that ARID1A-deficient cells are sensitive to PRMT5 inhibitors. The PRMT5 inhibitor JNJ-64619178 also demonstrated efficacy in ARID1A-deficient EC xenograft mouse models and organoid models. Specifically, we found that PRMT5 inhibition promotes DNA damage and apoptosis in ARID1A-deficient cells. Aberrant R-loop accumulation is the primary driver of synthetic lethality. ARID1A deficiency downregulates PRMT5 expression by acting on its promoter, leading to replication stress in tumor cells. PRMT5 inhibition further disrupts DHX9-mediated R-loop homeostasis, resulting in excessive R-loop accumulation in ARID1A-deficient tumors and subsequent DNA damage. In summary, our discovery provides a novel therapeutic strategy for targeting ARID1A-deficient EC.\u003c/p\u003e\u003cp\u003eRecent studies have demonstrated that targeting the DNA damage response (DDR) pathway represents a promising synthetic lethal strategy for selectively eliminating ARID1A-deficient tumors. For example, Zihuan Wang et al. reported that, compared with ARID1A-wildtype (WT) cells, RITA is more likely to trigger p53 activation and DNA damage accumulation in ARID1A-deficient cancer cells[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Cheng Xiang et al. reported that the anticancer drug FUDR induces DNA damage and promotes apoptosis in ARID1A-deficient colorectal cancer (CRC) cells [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Through high-throughput compound screening, we found that PRMT5 induces synthetic lethality in ARID1A-deficient cells by promoting DNA damage accumulation. PRMT5, an epigenetic regulator, is aberrantly expressed in various cancers and promotes tumor progression through multiple mechanisms. PRMT5 binds to EZH2 and promotes colorectal cancer progression through the epigenetic inhibition of CDKN2B expression[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. In addition, PRMT5 has been shown to maintain genomic stability by regulating DNA replication, cell cycle progression, and double-strand break (DSB) repair [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. A FACS-based genome-wide CRISPR screen revealed that PRMT5 is a key regulator of DNA damage signaling, with PRMT5 inhibition significantly downregulating ATM expression and sensitizing cells to DNA-damaging inducers [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. To elucidate the mechanism underlying PRMT5 inhibitor-induced synthetic lethality in ARID1A-mutated EC cells, we performed RNA-seq and KEGG and GO enrichment analyses, which revealed significant enrichment in pathways related to DNA damage and apoptosis. Further validation by immunofluorescence and comet assays revealed that PRMT5 inhibition increased γ-H2AX foci and comet tail length in ARID1A-deficient cells, accompanied by increased apoptosis. Thus, we conclude that PRMT5 inhibition induces synthetic lethality in ARID1A-deficient cells primarily by triggering DNA damage responses.\u003c/p\u003e\u003cp\u003eR-loops are three-stranded nucleic acid structures composed of RNA: DNA hybrids and single-stranded DNA, and their aberrant accumulation leads to genomic instability and DNA damage [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Selectively targeting cancer cells dependent on R-loop regulation has emerged as a novel synthetic lethality strategy in recent years. In cancers driven by specific genetic alterations (e.g., MYC amplification, ARID1A deficiency, or BRCA mutation), promoting pathological R-loop accumulation by modulating R-loop regulatory genes can suppress tumor progression. In MYC-driven breast cancers, TOP1 inhibitors induce synthetic lethality by promoting aberrant R-loop accumulation [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. The inactivation of polybromine 1 (PBRM1), a specific subunit of the PBAF chromatin remodeling complex, frequently occurs in cancer. PBRM1-deficient tumors exhibit high levels of replication stress, micronuclei, and R-loops, rendering them vulnerable to PARP and ATR inhibitors, which exacerbate these phenotypes [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. In our study, we found that PRMT5 interacts with multiple R-loop regulatory genes and that pathological R-loops can trigger DNA damage responses. We therefore demonstrated that PRMT5 inhibition led to R-loop accumulation and subsequent DNA damage. Our results revealed that compared with either ARID1A deficiency or PRMT5 inhibition alone, PRMT5 inhibition in ARID1A-deficient EC cells significantly increased R-loop accumulation. The overexpression of RNase H1 suppressed R-loop accumulation and attenuated PRMT5 inhibition-induced γ-H2AX expression and DNA comet tail elongation. These findings demonstrate that R-loop dysregulation is the core mechanism of synthetic lethality, as combined ARID1A and PRMT5 depletion disrupted R-loop homeostasis, leading to severe DNA damage responses and cell death.\u003c/p\u003e\u003cp\u003eDHX9, a DExH-box DNA/RNA helicase, is a key R-loop regulator that modulates R-loop formation and resolution [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Posttranslational modifications of DHX9 are critical for maintaining R-loop homeostasis. SUMOylation of DHX9 at K120 enhances its interaction with R-loop-associated factors to maintain genomic integrity [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. ATR phosphorylates DHX9 at Ser321 and Ser688 to promote R-loop resolution, and inhibiting DHX9 phosphorylation prevents its binding to R-loops, resulting in stress-induced R-loop accumulation and DNA damage [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. AKT interacts with DHX9 to facilitate its recruitment to R-loops, and AKT inhibitors (AKTis) promote R-loop-mediated replication stress by impairing DHX9 localization [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. DNYLRB2-AS1 stabilizes the DHX9 protein to prevent aberrant R-loop accumulation and DNA damage, thereby conferring resistance to gemcitabine (GEM) [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. However, no study has reported whether the arginine methylation of DHX9 has a specific effect on the function of DHX9 in regulating R-loops. Through mass spectrometry and coimmunoprecipitation assays, our study is the first to reveal that PRMT5 regulates R-loop homeostasis by interacting with and methylating DHX9. PRMT5 inhibition reduces the degree of arginine dimethylation in DHX9, impairing its recruitment to R-loops and thus triggering pathological R-loop accumulation and DNA damage. This discovery expands the understanding of R-loop regulatory networks and provides new insights for targeted interventions.\u003c/p\u003e\u003cp\u003eRecent studies have reported that ARID1A maintains R-loop homeostasis to ensure genomic stability. ARID1A recruits METTL3 to local DSBs to initiate m6A modification of R-loops, facilitating their recognition and resolution [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. ARID1A deficiency increases R-loop abundance and replication stress [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e], a finding corroborated by our study. As a chromatin regulator, ARID1A plays a pivotal role in controlling the expression of downstream target genes, including PIK3IP1[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e], SLC7A11 [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e], HMGCR [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e], PTGS1/2 [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e], and PKM2 [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Here, we found that ARID1A deficiency downregulates PRMT5 expression, and ChIP assays confirmed that ARID1A directly binds to the PRMT5 promoter. Clinical sample analyses further validated the correlation between ARID1A and PRMT5 expression. This regulatory relationship explains the heightened sensitivity of ARID1A-mutated cells to PRMT5 inhibition. ARID1A deficiency inherently reduces PRMT5 expression, compromising R-loop homeostasis, and PRMT5 inhibition exacerbates DHX9 dysfunction, resulting in a \u0026ldquo;double-hit\u0026rdquo; effect.\u003c/p\u003e\u003cp\u003eOur study is the first to reveal that PRMT5 inhibition induces synthetic lethality in ARID1A-deficient EC cells by disrupting R-loop dynamic equilibrium. Specifically, the PRMT5 inhibitor JNJ-64619178 interferes with DHX9-mediated R-loop homeostasis, triggering synergistic R-loop accumulation and DNA damage in ARID1A-deficient EC. Our findings elucidate the key role of the ARID1A\u0026ndash;PRMT5\u0026ndash;DHX9 signaling axis in genomic stability and provide a novel targeted therapeutic strategy and scientific basis for treating ARID1A-deficient EC.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was approved by the Animal Ethics Committee of the Tongji Medical College, Huazhong University of Science and Technology (Approval ID:2024-4794).\u003cbr\u003e\u0026nbsp;Endometrial cancer and normal endometrial tissues were obtained from Union Hospital, Huazhong University of Science and Technology. All participants provided written informed consent. The study was approved by the Institutional Ethics Committee (No. 2020-S218) and conducted in accordance with the Declaration of Helsinki. The establishment of PDOs was reviewed and approved by the Ethics Committee (CTOB-2025-0917).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors have read the manuscript and agree to publish.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eH.W. and J.Z. designed the research. W.S., K.D., and X.S. conducted the assays and wrote the manuscript. J.Z., X.Z., S.Y., and S.C. prepared figures. T.Z., G.C., and G.Z. performed the statistical analyses. H.W. and J.Z. revised the paper. All authors read and approved the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData will be made available on request.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of competing interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by grants from National key research and development plan (No. 2023YFC2705400), National Natural Science Foundation of China (Nos. 82472965, 82203684)\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eB.R. Corr, B.K. Erickson, E.L. Barber, C.M. Fisher, B. Slomovitz, Advances in the management of endometrial cancer, BMJ (Clinical research ed.), 388 (2025) e080978.\u003c/li\u003e\n\u003cli\u003eA. Luzarraga Aznar, R. Canton, G. Loren, J. Carvajal, I. de la Calle, C. Masferrer-Ferragutcasas, F. Serra, V. Bebia, G. Bonaldo, M.A. Angeles, S. Cabrera, N. Palomar, C. Vilarmau, M. Mart\u0026iacute;, M. Rigau, E. Colas, A. Gil-Moreno, Current challenges and emerging tools in endometrial cancer diagnosis, International journal of gynecological cancer : official journal of the International Gynecological Cancer Society, 35 (2025) 100056.\u003c/li\u003e\n\u003cli\u003eA.A. Francoeur, N. Ayoub, D. Greenberg, K.S. Tewari, Drug discovery in advanced and recurrent endometrial cancer: Recent advances, Oncology research, 33 (2025) 1511-1530.\u003c/li\u003e\n\u003cli\u003eR.N. Eskander, M.W. Sill, L. Beffa, R.G. Moore, J.M. Hope, F.B. Musa, R.S. Mannel, M.S. Shahin, G.H. Cantuaria, E. Girda, E. Lokich, J. Kavecansky, C.A. Leath, 3rd, L.T. Gien, E.M. Hinchcliff, S.B. Lele, L.M. Landrum, F. Backes, R.E. O\u0026apos;Cearbhaill, T.A. Baghdadi, E.K. Hill, P.H. Thaker, V.S. John, S. Welch, A.N. Fader, M.A. Powell, C. Aghajanian, Pembrolizumab plus chemotherapy in advanced or recurrent endometrial cancer: overall survival and exploratory analyses of the NRG GY018 phase 3 randomized trial, Nature medicine, 31 (2025) 1539-1546.\u003c/li\u003e\n\u003cli\u003eC.J. Ryan, L.P.S. Devakumar, S.J. Pettitt, C.J. Lord, Complex synthetic lethality in cancer, Nature genetics, 55 (2023) 2039-2048.\u003c/li\u003e\n\u003cli\u003eN.J. Fu, Y.W. Sheng, Z. Fan, Z. Wu, L.Y. Li, R.Y. Xi, X.K. Shi, G.L. Zhang, F. Wang, Synthetic Lethality of SHP2 and XIAP Suppresses Proliferation and Metastasis in KRAS-mutant Nonsmall Cell Lung Cancer, Advanced science (Weinheim, Baden-Wurttemberg, Germany), 12 (2025) e2411642.\u003c/li\u003e\n\u003cli\u003eH. Yamashita, K. Nakayama, K. Kanno, T. Ishibashi, M. Ishikawa, K. Iida, S. Razia, T. Kiyono, S. Kyo, Evaluation of ARID1A as a Potential Biomarker for Predicting Response to Immune Checkpoint Inhibitors in Patients with Endometrial Cancer, Cancers, 16 (2024).\u003c/li\u003e\n\u003cli\u003eJ.M. Perez, J. Ryu, H. Khan, M. Shetty, E. Parker, P. D\u0026apos;Arcy, S. Zhu, M. Bazzaro, S.N. Thomas, Proteomic Analysis of ARID1A-Deficient Ovarian Clear Cell Carcinoma Cells Reveals Differential Mitochondria ETC Subunit Abundances and Targetable Mitochondrial Pathways, International journal of molecular sciences, 26 (2025).\u003c/li\u003e\n\u003cli\u003eY. Gu, P. Zhang, J. Wang, C. Lin, H. Liu, H. Li, H. He, R. Li, H. Zhang, W. Zhang, Somatic ARID1A mutation stratifies patients with gastric cancer to PD-1 blockade and adjuvant chemotherapy, Cancer immunology, immunotherapy : CII, 72 (2023) 1199-1208.\u003c/li\u003e\n\u003cli\u003eM.P. Scholtes, M. Akbarzadeh, A. Galaras, J.A. Nakauma-Gonz\u0026aacute;les, A. Bazrafshan, V. Solanki, B. Torenvliet, L. Beikmohammadi, V. Lozovanu, S. Romal, P. Moulos, N. Vavouraki, T.W. Kan, M. Algoe, M.E. van Royen, A. Sacchetti, T.P.P. van den Bosch, B. Eussen, A. de Klein, G. van Leenders, J.L. Boormans, P. Hatzis, R.J. Palstra, T.C.M. Zuiverloon, T. Mahmoudi, Integrative analysis of patient-derived tumoroids and ex vivo organoid modelling of ARID1A loss in bladder cancer reveals therapeutic molecular targets, Cancer letters, 614 (2025) 217506.\u003c/li\u003e\n\u003cli\u003eR. Mathur, ARID1A loss in cancer: Towards a mechanistic understanding, Pharmacology \u0026amp; therapeutics, 190 (2018) 15-23.\u003c/li\u003e\n\u003cli\u003eM.R. Wilson, J.J. Reske, J. Holladay, G.E. Wilber, M. Rhodes, J. Koeman, M. Adams, B. Johnson, R.W. Su, N.R. Joshi, A.L. Patterson, H. Shen, R.E. Leach, J.M. Teixeira, A.T. Fazleabas, R.L. Chandler, ARID1A and PI3-kinase pathway mutations in the endometrium drive epithelial transdifferentiation and collective invasion, Nature communications, 10 (2019) 3554.\u003c/li\u003e\n\u003cli\u003eK.Z. Hein, B. Stephen, S. Fu, Therapeutic Role of Synthetic Lethality in ARID1A-Deficient Malignancies, Journal of immunotherapy and precision oncology, 7 (2024) 41-52.\u003c/li\u003e\n\u003cli\u003eB.G. Bitler, K.M. Aird, A. Garipov, H. Li, M. Amatangelo, A.V. Kossenkov, D.C. Schultz, Q. Liu, M. Shih Ie, J.R. Conejo-Garcia, D.W. Speicher, R. Zhang, Synthetic lethality by targeting EZH2 methyltransferase activity in ARID1A-mutated cancers, Nature medicine, 21 (2015) 231-238.\u003c/li\u003e\n\u003cli\u003eS. Gupta, D.J. Albertson, T.J. Parnell, A. Butterfield, A. Weston, L.M. Pappas, B. Dalley, J.M. O\u0026apos;Shea, W.T. Lowrance, B.R. Cairns, J.D. Schiffman, S. Sharma, Histone Deacetylase Inhibition Has Targeted Clinical Benefit in ARID1A-Mutated Advanced Urothelial Carcinoma, Molecular cancer therapeutics, 18 (2019) 185-195.\u003c/li\u003e\n\u003cli\u003eC.T. Williamson, R. Miller, H.N. Pemberton, S.E. Jones, J. Campbell, A. Konde, N. Badham, R. Rafiq, R. Brough, A. Gulati, C.J. Ryan, J. Francis, P.B. Vermulen, A.R. Reynolds, P.M. Reaper, J.R. Pollard, A. Ashworth, C.J. Lord, ATR inhibitors as a synthetic lethal therapy for tumours deficient in ARID1A, Nature communications, 7 (2016) 13837.\u003c/li\u003e\n\u003cli\u003eZ.C. Yu, T. Li, E. Tully, P. Huang, C.N. Chen, P. Oberdoerffer, S. Gaillard, I.M. Shih, T.L. Wang, Temozolomide Sensitizes ARID1A-Mutated Cancers to PARP Inhibitors, Cancer research, 83 (2023) 2750-2762.\u003c/li\u003e\n\u003cli\u003eM. Liu, B. Yao, T. Gui, C. Guo, X. Wu, J. Li, L. Ma, Y. Deng, P. Xu, Y. Wang, D. Yang, Q. Li, X. Zeng, X. Li, R. Hu, J. Ge, Z. Yu, Y. Chen, B. Chen, J. Ju, Q. Zhao, PRMT5-dependent transcriptional repression of c-Myc target genes promotes gastric cancer progression, Theranostics, 10 (2020) 4437-4452.\u003c/li\u003e\n\u003cli\u003eS. Fu, Q. Zheng, D. Zhang, C. Lin, L. Ouyang, J. Zhang, L. Chen, Medicinal chemistry strategies targeting PRMT5 for cancer therapy, European journal of medicinal chemistry, 244 (2022) 114842.\u003c/li\u003e\n\u003cli\u003eZ. Wang, R. Li, N. Hou, J. Zhang, T. Wang, P. Fan, C. Ji, B. Zhang, L. Liu, Y. Wang, J. Kong, Q. Yao, J. Duan, G. Zhao, R. Ling, J. Zhang, PRMT5 reduces immunotherapy efficacy in triple-negative breast cancer by methylating KEAP1 and inhibiting ferroptosis, Journal for immunotherapy of cancer, 11 (2023).\u003c/li\u003e\n\u003cli\u003eJ. Elurbide, L. Colyn, M.U. Latasa, I. Uriarte, S. Mariani, A. Lopez-Pascual, E. Valbuena, B. Castello-Uribe, R. Arnes-Benito, E. Adan-Villaescusa, L.A. Martinez-Perez, M. Azkargorta, F. Elortza, H. Wu, M. Krawczyk, K.M. Schneider, B. Sangro, L. Aldrighetti, F. Ratti, A. Casadei Gardini, J.J.G. Marin, I. Amat, J.M. Urman, M. Arechederra, M.L. Martinez-Chantar, C. Trautwein, M. Huch, F.J. Cubero, C. Berasain, G.F.-B. M, M.A. Avila, Identification of PRMT5 as a therapeutic target in cholangiocarcinoma, Gut, 74 (2024) 116-127.\u003c/li\u003e\n\u003cli\u003eJ. Carter, M. Hulse, M. Sivakumar, J. Burtell, V. Thodima, M. Wang, A. Agarwal, K. Vykuntam, J. Spruance, N. Bhagwat, J. Rager, B. Ruggeri, P. Scherle, K. Ito, PRMT5 Inhibitors Regulate DNA Damage Repair Pathways in Cancer Cells and Improve Response to PARP Inhibition and Chemotherapies, Cancer research communications, 3 (2023) 2233-2243.\u003c/li\u003e\n\u003cli\u003eB. Weigelt, A. Marra, P. Selenica, E. Rios-Doria, A. Momeni-Boroujeni, M.F. Berger, K. Arora, D. Nemirovsky, A. Iasonos, D. Chakravarty, N.R. Abu-Rustum, A. Da Cruz Paula, K. Dessources, L.H. Ellenson, Y.L. Liu, C. Aghajanian, C.L. Brown, Molecular Characterization of Endometrial Carcinomas in Black and White Patients Reveals Disparate Drivers with Therapeutic Implications, Cancer discovery, 13 (2023) 2356-2369.\u003c/li\u003e\n\u003cli\u003eL.A. Sanz, F. Ch\u0026eacute;din, High-resolution, strand-specific R-loop mapping via S9.6-based DNA-RNA immunoprecipitation and high-throughput sequencing, Nature protocols, 14 (2019) 1734-1755.\u003c/li\u003e\n\u003cli\u003eT.T. Huang, C.Y. Chiang, J.R. Nair, K.M. Wilson, K. Cheng, J.M. Lee, AKT1 interacts with DHX9 to Mitigate R Loop-Induced Replication Stress in Ovarian Cancer, Cancer research, 84 (2024) 887-904.\u003c/li\u003e\n\u003cli\u003eR. Arora, Y. Lee, H. Wischnewski, C.M. Brun, T. Schwarz, C.M. Azzalin, RNaseH1 regulates TERRA-telomeric DNA hybrids and telomere maintenance in ALT tumour cells, Nature communications, 5 (2014) 5220.\u003c/li\u003e\n\u003cli\u003eZ. Wang, X. Zhang, Y. Luo, Y. Song, C. Xiang, Y. He, K. Wang, Y. Yu, Z. Wang, W. Peng, Y. Ding, S. Liu, C. Wu, Therapeutic targeting of ARID1A-deficient cancer cells with RITA (Reactivating p53 and inducing tumor apoptosis), Cell death \u0026amp; disease, 15 (2024) 375.\u003c/li\u003e\n\u003cli\u003eC. Xiang, Z. Wang, Y. Yu, Z. Han, J. Lu, L. Pan, X. Zhang, Z. Wang, Y. He, K. Wang, W. Peng, S. Liu, Y. Song, C. Wu, ARID1A loss sensitizes colorectal cancer cells to floxuridine, Neoplasia (New York, N.Y.), 58 (2024) 101069.\u003c/li\u003e\n\u003cli\u003eL. Yang, D.W. Ma, Y.P. Cao, D.Z. Li, X. Zhou, J.F. Feng, J. Bao, PRMT5 functionally associates with EZH2 to promote colorectal cancer progression through epigenetically repressing CDKN2B expression, Theranostics, 11 (2021) 3742-3759.\u003c/li\u003e\n\u003cli\u003eP.J. Hamard, G.E. Santiago, F. Liu, D.L. Karl, C. Martinez, N. Man, A.K. Mookhtiar, S. Duffort, S. Greenblatt, R.E. Verdun, S.D. Nimer, PRMT5 Regulates DNA Repair by Controlling the Alternative Splicing of Histone-Modifying Enzymes, Cell reports, 24 (2018) 2643-2657.\u003c/li\u003e\n\u003cli\u003eM. Huang, F. Yao, L. Nie, C. Wang, D. Su, H. Zhang, S. Li, M. Tang, X. Feng, B. Yu, Z. Chen, S. Wang, L. Yin, L. Mou, T. Hart, J. Chen, FACS-based genome-wide CRISPR screens define key regulators of DNA damage signaling pathways, Molecular cell, 83 (2023) 2810-2828.e2816.\u003c/li\u003e\n\u003cli\u003eS. Zhang, Y. Liu, Y. Sun, Q. Liu, Y. Gu, Y. Huang, Z. Zeng, F. Tang, Y. Ouyang, Aberrant R-loop-mediated immune evasion, cellular communication, and metabolic reprogramming affect cancer progression: a single-cell analysis, Molecular cancer, 23 (2024) 11.\u003c/li\u003e\n\u003cli\u003eM.P. Crossley, M. Bocek, K.A. Cimprich, R-Loops as Cellular Regulators and Genomic Threats, Molecular cell, 73 (2019) 398-411.\u003c/li\u003e\n\u003cli\u003eP. Lin, C. Lourenco, J. Cruickshank, L. Palomero, J.E. van Leeuwen, A.H.Y. Tong, K. Chan, S. El Ghamrasni, M.A. Pujana, D.W. Cescon, J. Moffat, L.Z. Penn, Topoisomerase 1 Inhibition in MYC-Driven Cancer Promotes Aberrant R-Loop Accumulation to Induce Synthetic Lethality, Cancer research, 83 (2023) 4015-4029.\u003c/li\u003e\n\u003cli\u003eR.M. Chabanon, D. Morel, T. Eychenne, L. Colmet-Daage, I. Bajrami, N. Dorvault, M. Garrido, C. Meisenberg, A. Lamb, C. Ngo, S.R. Hopkins, T.I. Roumeliotis, S. Jouny, C. H\u0026eacute;non, A. Kawai-Kawachi, C. Astier, A. Konde, E. Del Nery, C. Massard, S.J. Pettitt, R. Margueron, J.S. Choudhary, G. Almouzni, J.C. Soria, E. Deutsch, J.A. Downs, C.J. Lord, S. Postel-Vinay, PBRM1 Deficiency Confers Synthetic Lethality to DNA Repair Inhibitors in Cancer, Cancer research, 81 (2021) 2888-2902.\u003c/li\u003e\n\u003cli\u003eX. Ren, Q. Liu, P. Zhou, T. Zhou, D. Wang, Q. Mei, R.A. Flavell, Z. Liu, M. Li, W. Pan, S. Zhu, DHX9 maintains epithelial homeostasis by restraining R-loop-mediated genomic instability in intestinal stem cells, Nature communications, 15 (2024) 3080.\u003c/li\u003e\n\u003cli\u003eB.Z. Yang, M.Y. Liu, K.L. Chiu, Y.L. Chien, C.A. Cheng, Y.L. Chen, L.Y. Tsui, K.R. Lin, H.C. Chu, C.P. Wu, DHX9 SUMOylation is required for the suppression of R-loop-associated genome instability, Nature communications, 15 (2024) 6009.\u003c/li\u003e\n\u003cli\u003eM.Y. Liu, K.R. Lin, Y.L. Chien, B.Z. Yang, L.Y. Tsui, H.C. Chu, C.P. Wu, ATR phosphorylates DHX9 at serine 321 to suppress R-loop accumulation upon genotoxic stress, Nucleic acids research, 52 (2024) 204-222.\u003c/li\u003e\n\u003cli\u003eK.L. Chen, S.W. Huang, J.J. Yao, S.W. He, S. Gong, X.R. Tan, Y.L. Liang, J.Y. Li, S.Y. Huang, Y.Q. Li, Y. Zhao, H. Qiao, S. Xu, S. Zang, J. Ma, N. Liu, LncRNA DYNLRB2-AS1 promotes gemcitabine resistance of nasopharyngeal carcinoma by inhibiting the ubiquitination degradation of DHX9 protein, Drug resistance updates : reviews and commentaries in antimicrobial and anticancer chemotherapy, 76 (2024) 101111.\u003c/li\u003e\n\u003cli\u003eJ. Zhang, F. Chen, M. Tang, W. Xu, Y. Tian, Z. Liu, Y. Shu, H. Yang, Q. Zhu, X. Lu, B. Peng, X. Liu, X. Xu, M. Gullerova, W.G. Zhu, The ARID1A-METTL3-m6A axis ensures effective RNase H1-mediated resolution of R-loops and genome stability, Cell reports, 43 (2024) 113779.\u003c/li\u003e\n\u003cli\u003eM.B. Maxwell, M.S. Hom-Tedla, J. Yi, S. Li, S.A. Rivera, J. Yu, M.J. Burns, H.M. McRae, B.T. Stevenson, K.E. Coakley, J. Ho, K.B. Gastelum, J.C. Bell, A.C. Jones, R.N. Eskander, E.C. Dykhuizen, G.S. Shadel, S.M. Kaech, D.C. Hargreaves, ARID1A suppresses R-loop-mediated STING-type I interferon pathway activation of anti-tumor immunity, Cell, 187 (2024) 3390-3408.e3319.\u003c/li\u003e\n\u003cli\u003eH. Rehman, D.S. Chandrashekar, C. Balabhadrapatruni, S. Nepal, S.A.H. Balasubramanya, A.K. Shelton, K.R. Skinner, A.H. Ma, T. Rao, S. Agarwal, M.L. Eich, A.D. Robinson, G. Naik, U. Manne, G.J. Netto, C.R. Miller, C.X. Pan, G. Sonpavde, S. Varambally, J.E. Ferguson, 3rd, ARID1A-deficient bladder cancer is dependent on PI3K signaling and sensitive to EZH2 and PI3K inhibitors, JCI insight, 7 (2022).\u003c/li\u003e\n\u003cli\u003eH. Ogiwara, K. Takahashi, M. Sasaki, T. Kuroda, H. Yoshida, R. Watanabe, A. Maruyama, H. Makinoshima, F. Chiwaki, H. Sasaki, T. Kato, A. Okamoto, T. Kohno, Targeting the Vulnerability of Glutathione Metabolism in ARID1A-Deficient Cancers, Cancer cell, 35 (2019) 177-190.e178.\u003c/li\u003e\n\u003cli\u003eW. Zhou, H. Liu, Z. Yuan, J. Zundell, M. Towers, J. Lin, S. Lombardi, H. Nie, B. Murphy, T. Yang, C. Wang, L. Liao, A.R. Goldman, T. Kannan, A.V. Kossenkov, R. Drapkin, L.J. Montaner, D.T. Claiborne, N. Zhang, S. Wu, R. Zhang, Targeting the mevalonate pathway suppresses ARID1A-inactivated cancers by promoting pyroptosis, Cancer cell, 41 (2023) 740-756.e710.\u003c/li\u003e\n\u003cli\u003eL. Cui, R. Liu, S. Han, C. Zhang, B. Wang, Y. Ruan, X. Yu, Y. Li, Y. Yao, X. Guan, Y. Liao, D. Su, Y. Ma, S. Li, C. Liu, Y. Zhang, Targeting Arachidonic Acid Metabolism Enhances Immunotherapy Efficacy in ARID1A-Deficient Colorectal Cancer, Cancer research, 85 (2025) 925-941.\u003c/li\u003e\n\u003cli\u003eX. Liu, Z. Li, Z. Wang, F. Liu, L. Zhang, J. Ke, X. Xu, Y. Zhang, Y. Yuan, T. Wei, Q. Shan, Y. Chen, W. Huang, J. Gao, N. Wu, F. Chen, L. Sun, Z. Qiu, Y. Deng, X. Wang, Chromatin Remodeling Induced by ARID1A Loss in Lung Cancer Promotes Glycolysis and Confers JQ1 Vulnerability, Cancer research, 82 (2022) 791-804.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"molecular-cancer","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"molc","sideBox":"Learn more about [Molecular Cancer](http://gsejournal.biomedcentral.com/)","snPcode":"12943","submissionUrl":"https://submission.nature.com/new-submission/12943/3","title":"Molecular Cancer","twitterHandle":"@SN_Oncology","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"ARID1A, PRMT5, DHX9, R-loop, Endometrial cancer, synthetic lethality","lastPublishedDoi":"10.21203/rs.3.rs-7702632/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7702632/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e Endometrial cancer (EC) is a common malignancy of the female reproductive system. The 5-year survival rate for advanced-stage EC patients is less than 20%, highlighting an urgent need for novel therapeutic strategies. ARID1A, a key subunit of the SWI/SNF chromatin remodeling complex, is one of the most frequently mutated genes in EC, presenting a potential avenue for synthetic lethal targeting of ARID1A-deficient EC. This study aims to identify novel synthetic lethal targets for ARID1A-deficient EC and to elucidate the underlying molecular mechanisms, thereby providing new insights for clinical treatment.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods:\u003c/strong\u003e The PRMT5 inhibitor JNJ-64619178 was identified via high-throughput compound screening as effectively inducing synthetic lethality in ARID1A-deficient EC cells. RNA-seq, comet assays, immunofluorescence, and Dot-blot experiments were employed to investigate DNA damage and R-loop accumulation. IP-MS, Co-IP, and proximity ligation (PLA) assays were used to detect interactions within the PRMT5-DHX9-R-loop axis. Chromatin immunoprecipitation‒PCR (ChIP‒PCR) experiments were performed to confirm that ARID1A directly transcriptionally regulates PRMT5. The synthetic lethal effect between PRMT5 inhibition and ARID1A loss was further validated using EC xenograft mouse models and patient-derived organoid models (PDOs).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e In this study, based on high-throughput drug screening, we identified that the PRMT5 inhibitor JNJ-64619178 exerts a significant synthetic lethal effect on ARID1A-deficient EC. PRMT5 inhibition promoted DNA damage, apoptosis, and R-loop accumulation in ARID1A-deficient EC. This synthetic lethality was confirmed in ARID1A-deficient mouse models and PDOs. Mechanistically, we identified an association between ARID1A, PRMT5, and DHX9. Mechanistically, ARID1A directly binds the PRMT5 promoter and regulates its expression. ARID1A loss downregulates PRMT5, impairing arginine methylation and R-loop recruitment of DHX9—a key factor in R-loop resolution. Consequently, ARID1A-deficient cells become dependent on residual PRMT5 activity to maintain R-loop homeostasis. Inhibition of PRMT5 exacerbates R-loop accumulation and DNA damage, leading to synthetic lethality.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion: \u003c/strong\u003eThis study identifies a novel synthetic lethal strategy for ARID1A-deficient EC, demonstrating that the PRMT5 inhibitor JNJ-64619178 acts by disrupting R-loop homeostasis. Our findings highlight the critical role of the ARID1A-PRMT5-DHX9 axis in tumor progression, thereby providing a novel molecular target and theoretical foundation for the precision treatment of ARID1A-deficient EC.\u003c/p\u003e","manuscriptTitle":"Inhibition of PRMT5 triggers synthetic lethality in ARID1A-deficient endometrial cancer cells by promoting aberrant R-loop accumulation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-20 13:40:03","doi":"10.21203/rs.3.rs-7702632/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-10-19T13:51:52+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-10-11T20:39:47+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-10-07T16:22:06+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"173873992127284153853329653946239790443","date":"2025-10-07T13:32:27+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-10-07T12:52:59+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"7390975157917910327916437790690538580","date":"2025-10-07T12:23:26+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"210289868461230322180977174651548370385","date":"2025-10-07T11:24:21+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"260357457819010832517092701486664054025","date":"2025-10-07T11:22:32+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-10-07T11:13:08+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-09-30T00:37:44+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-09-30T00:36:15+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular Cancer","date":"2025-09-24T10:30:43+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"molecular-cancer","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"molc","sideBox":"Learn more about [Molecular Cancer](http://gsejournal.biomedcentral.com/)","snPcode":"12943","submissionUrl":"https://submission.nature.com/new-submission/12943/3","title":"Molecular Cancer","twitterHandle":"@SN_Oncology","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"7f894485-18e7-4719-9c31-4f1a2e39d091","owner":[],"postedDate":"October 20th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-03-16T16:00:41+00:00","versionOfRecord":{"articleIdentity":"rs-7702632","link":"https://doi.org/10.1186/s12943-026-02629-2","journal":{"identity":"molecular-cancer","isVorOnly":false,"title":"Molecular Cancer"},"publishedOn":"2026-03-09 15:57:37","publishedOnDateReadable":"March 9th, 2026"},"versionCreatedAt":"2025-10-20 13:40:03","video":"","vorDoi":"10.1186/s12943-026-02629-2","vorDoiUrl":"https://doi.org/10.1186/s12943-026-02629-2","workflowStages":[]},"version":"v1","identity":"rs-7702632","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7702632","identity":"rs-7702632","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Outcome instruments

MUSA

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00