Chemokine treatment in growth plate fracture: a pivotal role of CCL9

Chemokine treatment in growth plate fracture: a pivotal role of CCL9 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Chemokine treatment in growth plate fracture: a pivotal role of CCL9 Zhaobo Zhu, Zhen Kong, Yuanjing Liao, Ziwei Wan, Yue Zhang, Yulan Wan, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7127377/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 8 You are reading this latest preprint version Abstract Growth plate fractures present a significant challenge to the healing process due to the formation of bone bridges. However, the microenvironment and the regulatory mechanisms underlying growth plate fracture healing remain poorly understood. In this study, we analyzed growth plate and cortical bone tissues from mice at various stages, before and after bone callus formation, using RNA sequencing to compare gene expression profiles. A distinct chemokine activity signature was observed in growth plate injuries, with CCL9 emerging as a dynamically regulated chemokine. Recombinant CCL9 was found to inhibit osteogenesis, promote osteoclast formation under non-inflammatory conditions, and induce macrophage activation ex vivo. Notably, treatment with CCL9 in growth plate injuries preserved chondrocyte activity and significantly reduced the accumulation of bony matrix. These findings collectively suggest a potential protective role for CCL9 in growth plate injuries, likely through the suppression of bone turnover and the enhancement of cartilage anabolism. Elevating CCL9 levels during the appropriate remodeling phase may offer novel opportunities for promoting cartilage regeneration. Biological sciences/Genetics/Gene regulation Biological sciences/Genetics/Gene expression Growth plate CCL9 Fracture microenvironment Chondrocyte Bone bridge formation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction The growth plate is particularly susceptible to injury, which can lead to growth arrest in children [1,2]. In addition to the limited regenerative capacity of growth plate cartilage, the formation of a bone bridge at the site of injury is a key factor contributing to the cessation of longitudinal growth [3,4], often resulting in uneven or misaligned limbs. Consequently, understanding the regulatory mechanisms underlying the various phases of the injury response is crucial. During the phase of bone bridge formation, there is a loss of chondrogenic marker protein expression, while the expression of genes associated with ossification increases [5,6]. Previous studies have classified growth plate injury into four distinct phases of injury response [7]; however, the biological events associated with bone bridge formation at the fracture site remain unclear. The growth plate contains chondrocytes at various stages of differentiation [8], and upon injury, these chondrocytes, which are typically isolated from the bone marrow cavity, come into direct contact with a variety of immune and non-immune cells. This suggests that the remodeling process at the injured site may occur within a unique microenvironment, distinct from that of cortical bone fractures. In this study, we compared two mouse models of bone injury and performed transcript profiling of the affected tissues. We identified a clear distinction in the biological mechanisms underlying the healing processes of growth plate fractures and cortical bone fractures. Notably, the chemokine CCL9, which is known to play a role in immune responses [10,11], was significantly reduced during the bone bridge formation phase. Ex vivo, while CCL9 promoted BMSC migration, it inhibited their osteogenic differentiation. CCL9 administration suppressed osteoclast formation and protected against cartilage degeneration, thereby enhancing chondrocyte anabolism in ex vivo-cultured injured growth plate explants. Moreover, recombinant CCL9 significantly upregulated the expression of arginine metabolism enzymes in macrophages. Importantly, the administration of CCL9 to the injured growth plate effectively inhibited bone bridge formation. These findings highlight the complex biological role of CCL9 in the unique microenvironment of fracture repair and underscore the need for a more nuanced approach to the regulation of epiphyseal injuries. Based on our RNA-sequencing results, therapeutic strategies solely aimed at promoting osteogenesis may not be suitable for growth plate injuries and should be carefully reconsidered. Results Contrasting the microenvironment of growth plate injuries with that of cortical bone fracture injuries To investigate the molecular mechanism of physeal bony bridge formation during growth plate fractures, we established a mice model with growth plate drill-hole injury in the middle-portion of the physis to mimic the bone bridge formation responses occurring on 1, 3, 7, 14 and 28 days postsurgery, respectively (Fig. 1 A). By safranin O-fast green staining of femoral bone sections, no detectable fibrous bone created in the disrupted portions at post-injury day 1, and the fracture site filled with fibroblast-like cells at post-injury day 3, but at day 7, bony callus was present (Fig. 1 C). These data suggest that the phase between days 3 to 7 post-fracture is critical for the initiation or promotion of bone bridge formation and maturation. Understanding the microenvironment events involved in this process is essential. Taking the healing process of bone fracture as an example (Supplemental Fig. 1A), accumulating studies indicate that the immune microenvironment is crucial in determining the outcome of bone repair 12,13 . To further investigate how microenvironment dynamics influence the healing process in growth plate injuries, we performed RNA-sequencing analysis of tissues within the fracture site collected from mice with growth plate drill-hole injury or long bone cortical hole drilling, at day 3 or day 7 after the fracture, respectively (Supplemental Fig. 1B). In the healing process of growth plate injuries, gene ontology (GO) enrichment analysis reveals that receptor binding and chemokine activity are among the top 10 significantly enriched biological processes between days 3 and 7 (Fig. 1 D), unlike in the context of bone fractures (Fig. 1 E), suggesting a distinct microenvironment with molecular complexity. By comparing differentially expressed genes identified during osteogenic differentiation or osteoclastogenesis, we found that genes involved in these processes were upregulated in growth plate injuries but not in cortical bone injuries (Figs. 1 F, 1 B), suggesting a much more active bone turnover behavior governing the repair process in growth plate injuries. Moreover, genes associated with chondrogenesis are also upregulated (Fig. 1 G), making it clear that despite bone bridge formation occurring, cartilage function is not completely lost but may even be in an active state. This finding suggests that there is a distinctly different microenvironment conducive for bone bridge formation during the process of growth plate fracture repair. Identifying key factors involved in this microenvironment could help solve the problem of bone bridge growth. CCL9 shows potential to support cartilage repair To identify factors related to bone bridge formation, we conducted further analysis of differentially expressed genes encoding secretory proteins. The expression of the chemokine CCL9 was significantly reduced at day 7 after the fracture compared to day 3 (Fig. 2 A). The reduced level of CCL9 during phases of growth plate injury was further confirmed using Q-PCR. CCL9 expression was increased in the initial phase of the fracture (day 1 to 3) and then gradually decreased from post-fracture day 3 to 14 (Fig. 2 B). These data indicate that the chemokine CCL9 may play a critical role in the subsequent cartilaginous or osteogenic events. To investigate the role of CCL9 in the regulation of chondrocyte function, we obtained growth plate tissue explants from newborn mice and drilled in a middle of the epiphyseal plates to mimic a drilling-hole model in vivo (Supplemental Fig. 2A). The explants were then cultured in a culture medium with or without homologous recombinant CCL9. Immunoblotting analysis showed that SOX9 and COL2 protein levels in drilling-hole cartilage explants significant decrease (Fig. 2 C), although the ex vivo chondrogenesis of limb chondrocytes was not impacted in the presence of recombinant CCL9 (Supplemental Fig. 2B). Consistently, immunohistochemistry staining data showed that drilling-hole fractures caused a significant decrease in the levels of the transcription factor SOX9, which regulates chondrogenesis (Figs. 2 D, 2 E), and COL2, mainly synthesized by chondrocytes (Fig. 2 F, 2 G) in growth plate proliferative chondrocytes. However, the expression of SOX9 and COL2 were retained in the basal levels in the CCL9-incubated groups. These data indicate that CCL9 serves as a potential protective factor for chondrogenesis to counteract cartilage loss. CCL9 suppresses BMSC osteogenic differentiation but promote non-inflammatory osteoclast formation Published studies have indicated that chemokines play a role in attracting stem cells to form a niche system that promotes fracture healing 14–16 , In this study, we examined the potential roles of CCL9 in stem cells chemotaxis by performing an ex vivo scratch-wound assay to determine whether bone marrow mesenchymal stem cells (BMSCs) from murine or rat can generate a migratory response to CCL9. After incubation for 12h, 24h and 36h with recombinant CCL9, BMSCs migrated noticeably faster than those in the BSA-incubated control groups (Supplemental Fig. 3). Given that mesenchymal stem cells have been considered to differentiate into osteoblasts subsequently at the growth plate injured site following migration and chemotaxis 17,18 and a recent finding indicated that CCL9 inhibition is an effective way for accelerating bone healing in vivo 19 , we aimed to determine if additional CCL9 would affect the osteogenic fate of BMSCs. To investigate this, we performed an ex vivo osteogenesis assay. CCL9 was shown to suppress osteogenic differentiation and osteogenic alkaline phosphatase activity in murine BMSCs (Figs. 3 A, 3 B) but not in primary cranial osteoblastic progenitors (Figs. 3 C, 3 D), indicating that CCL9 is more effective in cells with multipotent capacity in inhibiting osteogenesis. Consistent with these findings, expression levels of the bone-specific genes, including osterix (OSX) 20 , RUNX2 21 , and osteocalcin (OCN) 22,23 , were all significantly decreased in osteoblast-differentiating BMSCs incubated in osteogenic-conditioned medium containing recombinant CCL9, in comparison to the BSA controls (Fig. 3 E). In addition, type 1 collagen 24 , which is synthesized for subsequent mineralization, was reduced upon CCL9 incubation during BMSC differentiating into osteoblasts, accompanied by a minor reduction in the level of OCN (Figs. 3 F, 3 G). These results suggest that CCL9 can inhibit the osteogenic capacity of BMSCs and indicate a potential resistance mechanism of CCL9 against the osteogenesis process, which may be beneficial for damaged cartilage during growth plate injury. Interestingly, we observed a signature of suppressed osteoclast formation during the early stage of bone bridge formation (Fig. 3 H), which is similar to the observations in the early stage of cortical bone fracture repair (Fig. 3 I), despite the osteoclast number beginning to increase as inflammation fades (Supplemental Fig. 4A). Considering that in the initial phase of growth plate fracture, inflammatory responses and increased CCL9 are the major events, we next investigated whether CCL9 contributes to osteoclast formation. In bone marrow-derived monocyte/macrophage (BMDM) cultures, CCL9 significantly promotes multinuclear TRAP-positive cell formation but plays a suppressive role in the presence of IL-1β (Figs. 3 J, 3 K), suggesting a dual role of CCL9 in osteoclasts. CCL9 activates macrophage while inhibiting proinflammatory response Experimental mouse bone fractures have demonstrated that the healing process depends on tissue repair-associated macrophages 25,26 . As CCL9 is a monokine with inflammatory and chemokinetic properties, we next determined whether CCL9 plays a role in regulating inflammatory response or macrophage polarization. Following an additional 24-hour incubation with CCL9, IL-1ß and TNF-ɑ levels in LPS-induced M1 macrophages decreased (Fig. 4 A), while they remained constant in macrophages without LPS stimulation compared to BSA-incubated controls (Fig. 4 B). This suggests an anti-inflammatory effect of exogenous CCL9. In the context of bone fractures, increased recruitment of M2-like macrophages has been identified as a response to support remodeling. In our study, we observed a significant increase in the markers for the M2 anti-inflammatory subset, arginase-1 (Arg-1), and CD206, in macrophages treated with recombinant CCL9 Fig. 4 C). CCL9 also induced higher levels of Arg-1 and CD206 in M2-type macrophages (Fig. 4 D). Interestingly, recombinant CCL9 also induced inducible Nitric oxide synthase (iNOS) expression in macrophages under both inflammatory and non-inflammatory conditions (Figs. 4 E, 4 F). The positive effect of CCL9 on the expression of the arginine metabolism enzyme in macrophages may be beneficial for inhibiting bone bridge formation in injured growth plates. CCL9 administration during the initial phase of fractures can mitigate bone bridge formation To assess the in vivo effect of CCL9, we employed continuous delivery to the injured site in drilling-hole mice. By day 5 post-injury, CCL9 treatment significantly induced osteoclastogenesis at the injured site compared to controls. Conversely, osteoclast formation was reduced when a CCL9 receptor CCR1 was co-administered with CCL9 (Figs. 5 A, 5 B). In contrast to the detection of bone bridge formation in the non-treated groups, bony callus was significantly reduced by CCL9 administration (Fig. 5 C). A previous study has indicated that CCL9 can counteract kidney fibrosis 27 , supporting a positive role of CCL9 in tissue repair. The effect of CCL9 in our current growth plate drilling-hole model suggests that it acts as a governor to slow down bone turnover. These results suggest that increasing the CCL9 level in the injured microenvironment may provide more space and time for cartilage regeneration. Consistent with our ex vivo observations, CCL9 administration to the injured growth plate induced SOX9 expression in chondrocytes to the basal level; however, in the presence of a CCR1 antagonist, the SOX9 level was decreased (Figs. 5 D, 5 E). These findings demonstrate the essential role of CCL9 levels in the injured site for growth plate fracture repair. CCL9 benefits damaged cartilage, likely by reducing bone turnover and protecting against cartilage loss to resist bone bridge formation. Discussion Growth plate damage that penetrates the subchondral bone typically results in extensive bony bridge formation, leading to angulation deformity. Therefore, clarifying the microenvironment involving cartilage function loss and enhanced osteogenesis will aid in developing improved therapeutic approaches for physeal fracture healing. In our current study, we compared growth plate fracture repair with bone cortex fracture. We observed that chemokine activity is a dominant phenotype during bony bridge formation, which differs from the cortical bone healing process at the same stage. We screened for differential expression of the chemokine CCL9 in the injured growth plate and presented evidence that recombinant CCL9 has the potential to suppress bone turnover, serving as a chondroprotective factor after growth plate injury. CCL9 belongs to the MIP-1 CC chemokine subfamily and possesses chemotactic and inflammatory properties 9,28,29 . Although the roles of CCL9 in diseases or fracture repair have been observed in previous studies, how CCL9 is involved in cartilage injury has not been determined. It is known that timely recruitment of progenitors to the injured site is required for tissue regeneration 30–34 . However, the dominant chemotactic factor that actually drives cellular events underlying the healing process in the injured growth plate remains unknown. Osteogenesis induction of pluripotent progenitors during cortical bone fracture healing is beneficial for subsequent bone formation 35–37 . However, in growth plate injuries, progenitor cells eventually differentiating into the osteoblastic lineage may not be conducive to cartilage regeneration. In our experiments, recombinant CCL9 significantly promoted BMSCs migration but suppressed their capacity to differentiate into the osteogenic lineage. This observation is consistent with a recent finding that identified a pro-osteogenic function of anti-CCL9 antibody for bone fracture repair 19 . Notably, these data suggest a potential application of CCL9 in mesenchymal stem cell therapy for physeal repair, recruiting possible cell sources for the regeneration of cartilage. Highly progressive of osteogenesis in growth plate fractures leads to accumulation of excess calcified extracellular matrix components, causing misshapen bones and cartilage malfunctions. Considering the cellular composition of bone, osteoclast is a significant cell population which located adjacent to chondrocytes, osteoblasts and their progenitors, play a crucial role in absorbing and removing calcified extracellular matrix components. However, few studies have addressed the involvement of osteoclasts in growth plate injury. Our study indicated that CCL9 promotes osteoclast differentiation under non-inflammatory conditions, suggesting a potential therapeutic capacity of CCL9 that target bone turnover rate. The suppressive effects of CCL9 on osteoclasts in the context of pro-inflammation response supports our observations of a near absence of osteoclasts in the initial phase of the fracture. We hypothesize that this inhibitory effect on osteoclasts in the initial phase may facilitate the initiation of osteogenesis. Notable differences between physeal fracture and bone cortex fracture are chemokine and cytokine activities, and function by binding to their receptors. Chemokines and cytokines are functional secreted proteins that regulate or determine cell trafficking and immune responses 38 . However, each factor may have a completely different function, depending on the specific phase of the immune response or location where it is presented. Transcription profiling of the injured growth plate at post-injury days 3 and 7 revealed that several chemokines are decreased, suggesting the possibility that the natural recruitment of cell sources for regeneration is insufficient, and the local microenvironment is hostile after injury. Although numerous studies have reported on the mechanisms of M2-polarized macrophage accumulation being beneficial for bone regeneration 39–43 , we determined that exogenous CCL9 impacts macrophages without affecting pro-inflammatory responses but can elevate the inflammatory mediator, inducible nitric oxide synthase (iNOS) level. Xian et al. has been indicated that iNOS may play a role in promoting MSC differentiation to cartilaginous cells 44 . The effects of CCL9 on macrophages and protective effects of CCL9 shown in experiments on explant tissue culture suggest an applicable strategy to injuries involving growth plates, however, future investigations are necessary to validate in vivo . Moreover, in humans, there is no highly homologous gene to CCL9; only CCL15 and CCL23 are moderately similar to rodent CCL9 45 . Therefore, it is important to elucidate the functional receptor with high affinity to CCL9 on stem cells during physeal injury, providing more information to improve strategies in stem cell therapy. Limitations of the study Although this study has uncovered that CCL9 suppressed ex vivo cartilaginous degeneration and are reinforced chondrocyte anabolism, while the underlying mechanism remains to be fully elucidated. Therefore, future studies are needed to include a more detailed and in-depth analysis the potential mechanism. Another limitation is that all in vivo data were obtained in mice. Testing in clinical specimens or other species particularly nonhuman primates is required to assess the potential protective role of CCL9 for growth plate injuries. Experimental Model and Study Participant Detailss Animal model The growth plate injury model of distal femoral was established in 4-week-old wild-type (WT) C57BL/6J mice (Laboratory Animal Centre of Southern Medical University, Guangzhou, China). Before surgery, the mice were anaesthetized by intraperitoneal injection of 2.5% avertin. A 0.5-cm incision was performed on the anterior aspect of left knee and the distal femoral trochlear groove were exposed. And then, a defect (0.6-mm diameter) was made across the physis of the distal femur using a microdrill. Subsequently, the patella was relocated to its original position, the incision was closed with 5-0 vicryl suture. Similarly, a bone defect was constructed in the metaphysis of the left femur in the laterale direction. Mice were died of cervical dislocation afer anesthesia with 2.5% avertin at day 1, 3, 7, 14 and 28 post-surgeries (n = 6 per group). Ethics statement All animal experiments were submitted for review to the Animal Ethics Management Center of Southern Medical University and were subsequently approved by the Animal Ethics Committee of Southern Medical University. All procedures involving animals adhered to the Guidelines for the Care and Use of Laboratory Animals established by the U.S. National Institutes of Health. RNA-sequencing analysis Post-injury tissues collected from mice and total RNA from each sample was isolated and extracted. Libraries were constructed and cDNA of ~200bp in size were pair-end sequenced using an Illumina Novaseq platform. Genes for which the expression differed in the day 7 post-injury groups compared with day 3 post-injury groups were identified. Fold changes (>2 or < 2) are set as the threshold for up- or down-regulated transcripts. Adjusted P values were calculated using the Benjamini-Hochberg method. A q-value < 0.05 was considered significant. Histology Femur tissues were fixed in 4% paraformaldehyde for 24 h and decalcified for 21 days. The decalcification solution was replaced every 3 days. Specimens then dehydrated and embedded in paraffin (4 μm thick sections) or cryosection (10 μm thick sections). For cryosections, specimens were dehydrated in 30% sucrose overnight at 4 °C and processed for SAKURA Tissue-Tek® O.C.T. Compound (4583, Sakura Finetek, Torrance, CA, USA). The tissue sections were stained with Safranin O, and fast green (Solarbio, Beijing, China), hematoxylin, and eosin (H&E) (Solarbio, Beijing, China), toluidine blue (Solarbio, Beijing, China) for morphological observation. The Immunostaining was performed on the serial tissue sections. Paraffin sections were deparaffinized and rehydrated at first. All slides were washed three times in PBS for 5 minutes each time. Antigen retrieval was performed by citric buffer (Sigma) in a 60 °C water bath for 14h. Subsequently, the endogenous peroxidase activity of tissue slices were reduced by 3% hydrogen peroxide (Sigma) at room temperature for 10 min. After washing three times in PBS, the tissue sections were blocked with goat serum (Solarbio, Beijing, China) for 60 min and then incubated with the indicated antibodies at 4 °C overnight. The primary antibodies used for IHC staining were: rabbit anti-COL2 (1:100, ab34712, Abcam), rabbit anti-SOX9 (1:100, A19170, Abclonal). On the second day, the tissue sections were washed with PBS and incubated with the horseradish peroxidase for 1 h at room temperature, then sections were stained with DAB and hematoxylin. Images were obtained using Zeiss LSM 780 confocal microscope (Carl Zeiss Microscopy, LLC,White Plains, NY, USA). BMSCs isolation and culture Bone marrow mesenchymal stem cells (BMSCs) were isolated from femurs and tibiae of 8-week-old C57BL/6J mouse. After the mice were euthanized, the femurs, tibias were separated under sterile condition and the attached soft tissue was stripped carefully. Then, the both ends of femur and tibia were cut off, and the bone marrow was flushed out by Minimum Essential Medium Alpha (α-MEM) using a 5 ml syringe. Subsequently, the bone marrow was centrifuged for 5 min at 1000 r/min, and the cells was re-suspended after the supernatants was remove. Whole bone marrow cells were cultured in α-MEM containing 10% Fetal Bovine Serum (FBS, corning) and 100μg/ml penicillin-streptomycin (Gibco, Carlsbad, CA, USA) at 37 °C in a 5% CO2 incubator. After 24 h, non-adherent cells were removed by washed with PBS. RAW264.7 monocytes (ATCC, Mana ssas, VA, USA) were cultured in RPMI 1640 (Gibco) with 10% FBS and 1% penicillin-streptomycin. Calvarial osteoblasts ex vivo culture Calvarial osteoblasts were isolated from C57BL/6J mouse embryos at postnatal day 2. The parietal bone was separated and the surface soft tissue were removed under sterile condition. Then, the cranium was minced, and digested with 0.25% trypsin (Gibco) in a 37℃ shaker, set at 80rpm for 30min. Discarding the trypsin, the rest of tissues were washed with 1×PBS, and digested with 0.2% collagenase type II (C6885, Sigma-Aldrich, Germany) in the 37℃ shaker for 60min. Subsequently, the collagenase solution was collected and centrifuged. After the supernatant was removed, the cells were re-suspended in complete α-MEM and seeded in a 6-cm2 Petri dish. Scratching experiment To verify the effect of migration of BMSCs, a scratch wound healing assay was performed. BMSCs were seeded in 6-well plates and cultured to 80% confluence. A scratch wound was made with 1ml pipette tips. The wound was rinsed with PBS and then cultured in complete α-MEM. The process of cell migration was observed and recorded at 0 h, 6h, 12 h, 24 h and 36 h using an inverted microscope (BX53, Olympus). The gap closure rate was analyzed and quantified using Image J. Ex vivo osteoblast differentiation assay BMSCs/calvarial osteoblasts were seeded at 1 × 106/well density on 6-well plate and cultured in complete α-MEM. Subsequently, the complete medium was changed with osteogenic medium (MUBMX-90021, Cyagen, China) after the cells cultured to 70% confluence. The medium was changed every 3 days. On days 21, cells were fixed in 4% paraformaldehyde and stained with Alkaline Phosphatase (ALP) to detect their osteogenic abilities. Ex vivo osteoclast differentiation assay Bone marrow derived monocyte/macrophages (BMDMs) were seeded onto the plates and cultured in the α-MEM supplemented with 10% fetal bovine serum, 20ng/mL M-CSF and 40ng/mL RANKL. After incubation at 37 °C for 3 days, cells were fixed for TRAP staining assay or lysed for Q-PCR detection. Image were quantified using Image J. Growth plate explants ex vivo culture model The 2-day-old C57 mice were euthanized to isolate femur explants. And then, the growth plate injury of distal femur was performed using a 1ml syringe. Explants were cultured for 5 days in complete DMEM/F12. Real-time (RT)-PCR Total RNA was isolated using TRIzol reagent (Accurate Biology,Hunan, China), followed 1 mg total RNA was reverse-transcripted into cDNA using the cDNA Reverse Transcription Kit (Vazyme Biotech, Nanjing, China). The qPCR reaction was performed with SYBR Green Master Mix (Vazyme). All reactionss were performed in triplicate. The primer sequences in this study are summarized in Table 1. Western blot analysis Cells were lysed on ice with RIPA (Fude Biological) buffer supplemented with 1% protease inhibitors (Biosharp) and 1% phosphatase inhibitors (Biosharp). The mixture was then centrifuged at 12000r/min, 4℃ for 15 min, and collected the supernatant. Proteins were quantified using the BCA kit (Fude Biological), and mixed with loading buffer (Fude Biological). Equal volume of protein (10μg) was supplemented and separated on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and then transferred to polyvinylidene difluoride (PVDF, Beyotime) membranes. The PVDF membrane was incubated with primary antibodies overnight at 4 °C after blocked with QuickBlock Blocking Buffer (P0231, Beyotime) for 15 min. After washing with Tris-buffered saline containing 0.1% Tween-20 (TBST), the membranes were incubated with secondary antibodies (1:1000 dilution, Beyotime) for 1 h at RT. Images were obtained with the FDbio-Dura ECL (FDbio science, Hangzhou, China). The primary antibodies used in WB were rabbit anti-Col I (1:1000 dilution, Abcam, ab270933), rabbit anti-osteocalcin (1:100 dilution, Abcam, ab93876), mouse anti-actin (1:5000 dilution, Beijing Ray Antibody Biotech, RM2001). Statistical analysis The experimental data were presented as the mean ± SD. For comparisons of two groups, unpaired Student’s t-test was performed. For data involving multiple groups analyses were performed with one-way analysis of variance (ANOVA) followed by Turkey’s post-hoc test. P < 0.05 was accepted as statistically significant. Declarations Author Contributions Conceptualization, Ruolian Ye. and Dehong Yang.; Methodology, Zhaobo Zhu. and Yuelun Ji.; Investigation, Yuelun Ji. and Zhen Kong.; Validation, Yuanjing Liao., Zhaobo Zhu.and Zhen Kong.; Data Curation, Zhaobo Zhu., Yuelun Ji. and Zhen Kong.; Writing-Original Draft, Zhaobo Zhu. and Yuelun Ji.; Funding Acquisition, Ruolian Ye.; Supervision, Ruolian Ye. and Dehong Yang. Funding Declaration This work was supported by the Natural Science Foundation of Guangdong Province, China (grant numbers 2023A1515010372). Data availability All data included in this study are available from the Corresponding author. Conflict of interests The authors declare no conflicts of interest. References Kao, S.C., and Smith, W.L. (1997). Skeletal injuries in the pediatric patient. Radiol. Clin. N. Am. 35 , 727-746. Jones, I.E., and Williams, S.M., and Dow, N., and Goulding, A. (2002). How many children remain fracture-free during growth? A longitudinal study of children and adolescents participating in the dunedin multidisciplinary health and development study. Osteoporos. Int. 13 , 990-995. 10.1007/s001980200137. Lee, M.A., and Nissen, T.P., and Otsuka, N.Y. (2000). Utilization of a murine model to investigate the molecular process of transphyseal bone formation. J. Pediatr. Orthop. 20 , 802-806. 10.1097/00004694-200011000-00021. Wattenbarger, J.M., and Gruber, H.E., and Phieffer, L.S. (2002). Physeal fractures, part i: histologic features of bone, cartilage, and bar formation in a small animal model. J. Pediatr. Orthop. 22 , 703-709. Macsai, C.E., and Hopwood, B., and Chung, R., and Foster, B.K., and Xian, C.J. (2011). Structural and molecular analyses of bone bridge formation within the growth plate injury site and cartilage degeneration at the adjacent uninjured area. Bone 49 , 904-912. 10.1016/j.bone.2011.07.024. Macsai, C.E., and Georgiou, K.R., and Foster, B.K., and Zannettino, A.C., and Xian, C.J. (2012). Microarray expression analysis of genes and pathways involved in growth plate cartilage injury responses and bony repair. Bone 50 , 1081-1091. 10.1016/j.bone.2012.02.013. Xian, C.J., and Zhou, F.H., and Mccarty, R.C., and Foster, B.K. (2004). Intramembranous ossification mechanism for bone bridge formation at the growth plate cartilage injury site. J. Orthop. Res. 22 , 417-426. 10.1016/j.orthres.2003.08.003. Salhotra, A., and Shah, H.N., and Levi, B., and Longaker, M.T. (2020). Mechanisms of bone development and repair. Nat. Rev. Mol. Cell Biol. 21 , 696-711. 10.1038/s41580-020-00279-w. Yang, M., and Odgren, P.R. (2005). Molecular cloning and characterization of rat ccl9 (mip-1gamma), the ortholog of mouse ccl9. Cytokine 31 , 94-102. 10.1016/j.cyto.2005.04.001. Li, B., and Zhang, S., and Huang, N., and Chen, H., and Wang, P., and Yang, J., and Li, Z. (2019). Ccl9/ccr1 induces myeloid‑derived suppressor cell recruitment to the spleen in a murine h22 orthotopic hepatoma model. Oncol. Rep. 41 , 608-618. 10.3892/or.2018.6809. Kortlever, R.M., and Sodir, N.M., and Wilson, C.H., and Burkhart, D.L., and Pellegrinet, L., and Brown, S.L., and Littlewood, T.D., and Evan, G.I. (2017). Myc cooperates with ras by programming inflammation and immune suppression. Cell 171 , 1301-1315. 10.1016/j.cell.2017.11.013. Xiong, Y., and Mi, B.B., and Lin, Z., and Hu, Y.Q., and Yu, L., and Zha, K.K., and Panayi, A.C., and Yu, T., and Chen, L., and Liu, Z.P., et al (2022). The role of the immune microenvironment in bone, cartilage, and soft tissue regeneration: from mechanism to therapeutic opportunity. Mil. Med. Res. 9 , 65. 10.1186/s40779-022-00426-8. Wang, Y., and Chen, X., and Cao, W., and Shi, Y. (2014). Plasticity of mesenchymal stem cells in immunomodulation: pathological and therapeutic implications. Nat. Immunol. 15 , 1009-1016. 10.1038/ni.3002. Ortinau, L., and Lei, K., and Jeong, Y., and Park, D. (2020). Real-time imaging of ccl5-induced migration of periosteal skeletal stem cells in mice. J. Vis. Exp. 10.3791/61162. Myers, T.J., and Longobardi, L., and Willcockson, H., and Temple, J.D., and Tagliafierro, L., and Ye, P., and Li, T., and Esposito, A., and Moats-Staats, B.M., and Spagnoli, A. (2015). Bmp2 regulation of cxcl12 cellular, temporal, and spatial expression is essential during fracture repair. J. Bone. Miner. Res. 30 , 2014-2027. 10.1002/jbmr.2548. Granero-Molto, F., and Weis, J.A., and Miga, M.I., and Landis, B., and Myers, T.J., and O'Rear, L., and Longobardi, L., and Jansen, E.D., and Mortlock, D.P., and Spagnoli, A. (2009). Regenerative effects of transplanted mesenchymal stem cells in fracture healing. Stem. Cells. 27 , 1887-1898. 10.1002/stem.103. Garg, P., and Mazur, M.M., and Buck, A.C., and Wandtke, M.E., and Liu, J., and Ebraheim, N.A. (2017). Prospective review of mesenchymal stem cells differentiation into osteoblasts. Orthop. Surg. 9 , 13-19. 10.1111/os.12304. Heino, T.J., and Hentunen, T.A. (2008). Differentiation of osteoblasts and osteocytes from mesenchymal stem cells. Curr. Stem Cell Res. Ther. 3 , 131-145. 10.2174/157488808784223032. Nakayama, M., and Okada, H., and Seki, M., and Suzuki, Y., and Chung, U.I., and Ohba, S., and Hojo, H. (2022). Single-cell rna sequencing unravels heterogeneity of skeletal progenitors and cell-cell interactions underlying the bone repair process. Regen. Ther. 21 , 9-18. 10.1016/j.reth.2022.05.001. Nakashima, K., and Zhou, X., and Kunkel, G., and Zhang, Z., and Deng, J.M., and Behringer, R.R., and de Crombrugghe, B. (2002). The novel zinc finger-containing transcription factor osterix is required for osteoblast differentiation and bone formation. Cell 108 , 17-29. 10.1016/s0092-8674(01)00622-5. Komori, T. (2010). Regulation of osteoblast differentiation by runx2. Adv. Exp. Med. Biol. 658 , 43-49. 10.1007/978-1-4419-1050-9_5. Hauschka, P.V., and Lian, J.B., and Gallop, P.M. (1975). Direct identification of the calcium-binding amino acid, gamma-carboxyglutamate, in mineralized tissue. Proc. Natl. Acad. Sci. U. S. A. 72 , 3925-3929. 10.1073/pnas.72.10.3925. Komori, T. (2020). What is the function of osteocalcin? J. Oral Biosci. 62 , 223-227. 10.1016/j.job.2020.05.004. Shi, S., and Kirk, M., and Kahn, A.J. (1996). The role of type i collagen in the regulation of the osteoblast phenotype. J. Bone. Miner. Res. 11 , 1139-1145. 10.1002/jbmr.5650110813. Shin, R.L., and Lee, C.W., and Shen, O.Y., and Xu, H., and Lee, O.K. (2021). The crosstalk between mesenchymal stem cells and macrophages in bone regeneration: a systematic review. Stem Cells Int. 2021 , 8835156. 10.1155/2021/8835156. Schlundt, C., and El, K.T., and Serra, A., and Dienelt, A., and Wendler, S., and Schell, H., and van Rooijen, N., and Radbruch, A., and Lucius, R., and Hartmann, S., et al (2018). Macrophages in bone fracture healing: their essential role in endochondral ossification. Bone 106 , 78-89. 10.1016/j.bone.2015.10.019. Hemmers, C., and Schulte, C., and Wollenhaupt, J., and Wong, D., and Harlacher, E., and Orth-Alampour, S., and Klinkhammer, B.M., and Schirmer, S.H., and Bohm, M., and Marx, N., et al (2022). Chemokine ccl9 is upregulated early in chronic kidney disease and counteracts kidney inflammation and fibrosis. Biomedicines 10 . 10.3390/biomedicines10020420. Lagergren, A., and Mansson, R., and Zetterblad, J., and Smith, E., and Basta, B., and Bryder, D., and Akerblad, P., and Sigvardsson, M. (2007). The cxcl12, periostin, and ccl9 genes are direct targets for early b-cell factor in op-9 stroma cells. J. Biol. Chem. 282 , 14454-14462. 10.1074/jbc.M610263200. Dawes, J.M., and Kiesewetter, H., and Perkins, J.R., and Bennett, D.L., and Mcmahon, S.B. (2013). Chemokine expression in peripheral tissues from the monosodium iodoacetate model of chronic joint pain. Mol. Pain 9 , 57. 10.1186/1744-8069-9-57. Ko, I.K., and Lee, S.J., and Atala, A., and Yoo, J.J. (2013). In situ tissue regeneration through host stem cell recruitment. Exp. Mol. Med. 45 , e57. 10.1038/emm.2013.118. Baht, G.S., and Vi, L., and Alman, B.A. (2018). The role of the immune cells in fracture healing. Curr. Osteoporos. Rep. 16 , 138-145. 10.1007/s11914-018-0423-2. Herrmann, M., and Stanic, B., and Hildebrand, M., and Alini, M., and Verrier, S. (2019). In vitro simulation of the early proinflammatory phase in fracture healing reveals strong immunomodulatory effects of cd146-positive mesenchymal stromal cells. J. Tissue Eng. Regen. Med. 13 , 1466-1481. 10.1002/term.2902. Ehnert, S., and Relja, B., and Schmidt-Bleek, K., and Fischer, V., and Ignatius, A., and Linnemann, C., and Rinderknecht, H., and Huber-Lang, M., and Kalbitz, M., and Histing, T., and Nussler, A.K. (2021). Effects of immune cells on mesenchymal stem cells during fracture healing. World J. Stem Cells 13 , 1667-1695. 10.4252/wjsc.v13.i11.1667. Zhang, E., and Miramini, S., and Patel, M., and Richardson, M., and Ebeling, P., and Zhang, L. (2022). Role of tnf-alpha in early-stage fracture healing under normal and diabetic conditions. Comput. Methods. Programs. Biomed. 213 , 106536. 10.1016/j.cmpb.2021.106536. Wang, T., and Zhang, X., and Bikle, D.D. (2017). Osteogenic differentiation of periosteal cells during fracture healing. J. Cell. Physiol. 232 , 913-921. 10.1002/jcp.25641. Johnson, P.C., and Mikos, A.G., and Fisher, J.P., and Jansen, J.A. (2007). Strategic directions in tissue engineering. Tissue Eng 13 , 2827-2837. 10.1089/ten.2007.0335. Arvidson, K., and Abdallah, B.M., and Applegate, L.A., and Baldini, N., and Cenni, E., and Gomez-Barrena, E., and Granchi, D., and Kassem, M., and Konttinen, Y.T., and Mustafa, K., et al (2011). Bone regeneration and stem cells. J. Cell. Mol. Med. 15 , 718-746. 10.1111/j.1582-4934.2010.01224.x. Borish, L.C., and Steinke, J.W. (2003). Cytokines and chemokines. J. Allergy. Clin. Immunol. 111 , S460-S475. 10.1067/mai.2003.108. Martin, K.E., and Garcia, A.J. (2021). Macrophage phenotypes in tissue repair and the foreign body response: implications for biomaterial-based regenerative medicine strategies. Acta Biomater. 133 , 4-16. 10.1016/j.actbio.2021.03.038. Toita, R., and Kang, J.H., and Tsuchiya, A. (2022). Phosphatidylserine liposome multilayers mediate the m1-to-m2 macrophage polarization to enhance bone tissue regeneration. Acta Biomater. 154 , 583-596. 10.1016/j.actbio.2022.10.024. Li, Z., and Li, Q., and Tong, K., and Zhu, J., and Wang, H., and Chen, B., and Chen, L. (2022). Bmsc-derived exosomes promote tendon-bone healing after anterior cruciate ligament reconstruction by regulating m1/m2 macrophage polarization in rats. Stem Cell Res. Ther. 13 , 295. 10.1186/s13287-022-02975-0. Mahon, O.R., and Browe, D.C., and Gonzalez-Fernandez, T., and Pitacco, P., and Whelan, I.T., and Von Euw, S., and Hobbs, C., and Nicolosi, V., and Cunningham, K.T., and Mills, K., et al (2020). Nano-particle mediated m2 macrophage polarization enhances bone formation and msc osteogenesis in an il-10 dependent manner. Biomaterials 239 , 119833. 10.1016/j.biomaterials.2020.119833. Gibon, E., and Loi, F., and Cordova, L.A., and Pajarinen, J., and Lin, T., and Lu, L., and Nabeshima, A., and Yao, Z., and Goodman, S.B. (2016). Aging affects bone marrow macrophage polarization: relevance to bone healing. Regen. Eng. Transl. Med. 2 , 98-104. 10.1007/s40883-016-0016-5. Arasapam, G., and Scherer, M., and Cool, J.C., and Foster, B.K., and Xian, C.J. (2006). Roles of cox-2 and inos in the bony repair of the injured growth plate cartilage. J. Cell. Biochem. 99 , 450-461. 10.1002/jcb.20905. Yang, M., and Mailhot, G., and Mackay, C.A., and Mason-Savas, A., and Aubin, J., and Odgren, P.R. (2006). Chemokine and chemokine receptor expression during colony stimulating factor-1-induced osteoclast differentiation in the toothless osteopetrotic rat: a key role for ccl9 (mip-1gamma) in osteoclastogenesis in vivo and in vitro. Blood 107 , 2262-2270. 10.1182/blood-2005-08-3365. Table 1 Table 1. Primer Sequences of genes Name Species Sequence 5' to 3' CCL9（F） mouse TACTGCCCTCTCCTTCCTCA CCL9（R） mouse TTGAAAGCCCATGTGAAACA RUNX2（F） mouse TTTAGGGCGCATTCCTCATC RUNX2（R） mouse TGTCCTTGTGGATTAAAAGGACTTG OSX（F） mouse CTTGTGCCTGATACCTGCACT OSX（R） mouse TCACTCTACCTGACCCGTCATC OCN（F） mouse GACTGTGACGAGTTGGCTGA OCN（R） mouse CTGGAGAGGAGAAGAACTGG IL-1β（F） mouse CACCTTCTTTTCCTTCATCTT IL-1β（R） mouse TCACACACCAGCAGGTTATCATC TNF-α（F） mouse CACAGAAAGCATGATCCGCGA TNF-α（R） mouse TGCCACAAGCAGGAATGAGAAGAG iNOS（F） mouse TCCTCACTGCGACAGCACAGAATG iNOS（R） mouse GTGTCATGCAAAATCTCTCCACTGCC Arg-1（F） mouse GGAATCTGCATGGGCAACCTGTGT Arg-1（R） mouse TCCTGGTGGGCCAGTACTAATTGT CD206（F） mouse CAGGTGTGGGCTCAGGTAGT CD206（R） mouse TGTGGTGAGCTGAAAGGTGA GAPDH（F） mouse CATCACTGCCACCCAGAAGACTG GAPDH（R） mouse ATGCCAGTGAGCTTCCCGTTCAG Additional Declarations There is NO conflict of interest to disclose. There are no conflicts of interest to declare. Supplementary Files SI.docx SUPPLEMENTAL MATERIAl Cite Share Download PDF Status: Under Review Version 1 posted Reviewer # 2 agreed at journal 02 Nov, 2025 Review # 1 received at journal 05 Oct, 2025 Reviewer # 1 agreed at journal 13 Sep, 2025 Reviewers invited by journal 24 Aug, 2025 Submission checks completed at journal 21 Jul, 2025 First submitted to journal 18 Jul, 2025 Unknown event 16 Jul, 2025 Editor assigned by journal 15 Jul, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7127377","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":504815707,"identity":"9b0f305a-e47d-4075-90e0-f9a2f6a79ff7","order_by":0,"name":"Zhaobo Zhu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAy0lEQVRIiWNgGAWjYDACCQYGZgaGA0AW84EDHypI08KWeHDGGdK08Bgf5m0hQof87OaHjwsq7tjrtp/5cIC3gUGeX+wAfi2Mc44ZG88484zZ7EzuhgOSOxgMZ85OwK+FWSLBTJq37TCb2Q3eDQcMzzAkGNwmoIVNIv0bSAuP2Q2eBwcS24jQwiORA7ZFAqiF4cBBYrRISOQUg/xiYHYmzeBgwxkJwn6Rn5G+ERxiZscPP/78p8JGnl+agBYMW0lTPgpGwSgYBaMAOwAArgNIAIa4GXAAAAAASUVORK5CYII=","orcid":"","institution":"The Third Affiliated Hospital, Southern Medical University","correspondingAuthor":true,"prefix":"","firstName":"Zhaobo","middleName":"","lastName":"Zhu","suffix":""},{"id":504815708,"identity":"692b5ae8-4162-4b5f-9601-ecff2602b5b1","order_by":1,"name":"Zhen Kong","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Zhen","middleName":"","lastName":"Kong","suffix":""},{"id":504815709,"identity":"30586309-8a01-44f0-a653-f4d7494f6032","order_by":2,"name":"Yuanjing Liao","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Yuanjing","middleName":"","lastName":"Liao","suffix":""},{"id":504815710,"identity":"996d1507-da51-4ffb-a062-d872ec3a5719","order_by":3,"name":"Ziwei Wan","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Ziwei","middleName":"","lastName":"Wan","suffix":""},{"id":504815711,"identity":"2b964b13-9cbe-49a1-92fa-3027b09157cb","order_by":4,"name":"Yue Zhang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Yue","middleName":"","lastName":"Zhang","suffix":""},{"id":504815712,"identity":"3445cd97-2372-4056-ac4b-4080f5ded341","order_by":5,"name":"Yulan Wan","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Yulan","middleName":"","lastName":"Wan","suffix":""},{"id":504815713,"identity":"254d90f2-fcef-4709-be28-bee5a3c7d7ee","order_by":6,"name":"Dehong Yang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Dehong","middleName":"","lastName":"Yang","suffix":""},{"id":504815714,"identity":"a62bf49e-1bdc-48ca-ad42-544df4deb1c2","order_by":7,"name":"Yuelun Ji","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Yuelun","middleName":"","lastName":"Ji","suffix":""},{"id":504815715,"identity":"ace519b7-6220-4ae2-92c0-f7baeb0c0aaa","order_by":8,"name":"Ruolian Ye","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Ruolian","middleName":"","lastName":"Ye","suffix":""}],"badges":[],"createdAt":"2025-07-15 07:16:03","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7127377/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7127377/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":90342586,"identity":"8db6e38a-ba53-433c-b07d-db58a8b92f11","added_by":"auto","created_at":"2025-09-01 15:36:01","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":3886868,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eContrasting the microenvironment of growth plate injuries with that of cortical bone fracture injuries.\u003c/strong\u003e (\u003cstrong\u003eA\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eSchematic image to show an epiphyseal drill-hole model. (\u003cstrong\u003eB\u003c/strong\u003e) Images of Safranin O/Fast Green staining of bone sections prepared from mice with growth plate defects at days 1, 3, 7,14 and 28 after injury. The black arrow indicates the damaged area and is enlarged below it. Scale bars, 500 μm (upper panel) ; 200 μm; 100 μm; 20 μm (lower panel). (\u003cstrong\u003eC\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eGO term analysis of growth plate defects samples by biological process. The biological processes marked in red are the most significant biological processes. Adjusted Q-value for the top 10 significant biological process. (\u003cstrong\u003eD\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eGO term analysis of cortical bone defects samples by biological process. Adjusted Q-value for the top 10 significant biological processes. (\u003cstrong\u003eE\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eHeat map of the differential expressed genes were identified in osteogenesis between bone bridge formation stage within the growth plate injuries (n = 3 per group). The color bar indicates scaled normalized gene expression counts. (\u003cstrong\u003eF\u003c/strong\u003e) Heat map of the differential expressed genes were identified in osteoclastogenesis between bone bridge formation stage within the growth plate injuries (n = 3 per group). The color bar indicates scaled normalized gene expression counts. (\u003cstrong\u003eG\u003c/strong\u003e) Heat map of the differential expressed genes were identified in chondrogenesis between bone bridge formation stage within the growth plate injuries (n = 3 per group). The color bar indicates scaled normalized gene expression counts\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7127377/v1/aeb8fe919fb10071df542436.png"},{"id":90343573,"identity":"28ab7775-0417-4a23-8b2f-d424440a10b8","added_by":"auto","created_at":"2025-09-01 15:44:01","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2732885,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCCL9 shows potential to support cartilage repair.\u003c/strong\u003e (\u003cstrong\u003eA\u003c/strong\u003e) Heat map of the differential expressed genes between bone bridge formation stage within the growth plate injuries (n = 3 per group). The color bar indicates scaled normalized gene expression counts. (\u003cstrong\u003eB\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eQ-PCR analysis of CCL9 mRNA expression level in bone tissues within fracture site during different stages of growth plate injury healing (post-fracture 0, 1, 3, 7, 14, 28 days, n = 3/group). (\u003cstrong\u003eC\u003c/strong\u003e) Immunoblot analysis of SOX9 and COL2 expression levels in drilling-hole explants with or without mCCL9 incubation. α-tubulin as an internal control. (\u003cstrong\u003eD\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eIHC staining analysis of SOX9 expression in injured cartilage explants incubated with or without mCCL9, incubated with BSA of the same working concentration as the negative control. Scale bars, 500 μm (upper panel) ; 200 μm; 100 μm; 20 μm (lower panel). \u0026nbsp;(\u003cstrong\u003eE\u003c/strong\u003e) Statistical analysis of (D). (n = 6/group). (\u003cstrong\u003eF\u003c/strong\u003e) IHC staining of COL2 expression level in injured cartilage explants incubated with or without mCCL9, incubated with BSA of the same working concentration as negative control. Scale bars, 500 μm (upper panel) ; 200 μm; 100 μm; 20 μm (lower panel). (\u003cstrong\u003eG\u003c/strong\u003e) Statistical analysis of (F). (n = 6/group).\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-7127377/v1/a5684eeb30427fd22de2691d.png"},{"id":90342594,"identity":"387110f7-0975-4edb-9e9b-1cec56c469f2","added_by":"auto","created_at":"2025-09-01 15:36:01","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":8467454,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCCL9 suppresses BMSC osteogenic differentiation but promote non-inflammatory osteoclast formation.\u003c/strong\u003e (\u003cstrong\u003eA\u003c/strong\u003e) ALP staining analysis of \u003cem\u003eex vivo\u003c/em\u003eosteogenesis of BMSCs with or without incubation with mCCL9. (\u003cstrong\u003eB\u003c/strong\u003e) Statistical analysis of (A). (\u003cstrong\u003eC\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eALP staining of \u003cem\u003eex vivo\u003c/em\u003eosteogenesis of cranial osteoblasts with or without stimulation with mCCL9. (\u003cstrong\u003eD\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eStatistical analysis of (C). (\u003cstrong\u003eE\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eQ-PCR analysis of levels of OSX, RUNX2 and OCN in osteo-induced murine BMSCs which were treated with or without mCCL9. (\u003cstrong\u003eF\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eWestern blot analysis of levels of collagen I and OCN in osteo-induced BMSCs which were treated with or without mCCL9. Actin as an internal reference gene. (\u003cstrong\u003eG\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eStatistical analysis of (F). (\u003cstrong\u003eH\u003c/strong\u003e) TRAP staining analysis of osteoclast differentiation during different stages of growth plate fracture repair; alcian blue shown the sulfated glycosaminoglycan of the cartilage matrix. (image+statistics). (\u003cstrong\u003eI\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eTRAP staining analysis of osteoclast differentiation during different stages of cortical bone fracture repair; alcian blue shown the sulfated glycosaminoglycan of the cartilage matrix. (image+statistics).\u003cstrong\u003e \u003c/strong\u003e(\u003cstrong\u003eJ\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eTRAP staining analysis of osteoclast differentiation induced by RANKL and M-CSF. Cells were incubated with or without mCCL9 for 3 or 5 days respectively, in the context of 20ng/mL IL-1β stimulation. (\u003cstrong\u003eK\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eAnalysis of osteoclast number in (J)\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7127377/v1/30ad4c33ad4d70c33139443b.png"},{"id":90342590,"identity":"4651307e-8e5c-4288-95ba-63fc3d931870","added_by":"auto","created_at":"2025-09-01 15:36:01","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":469712,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCCL9 activates macrophage while suppressing the proinflammatory response.\u003c/strong\u003e (\u003cstrong\u003eA\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eQ-PCR analysis of levels of IL-1ß and TNF-ɑ in LPS-induced macrophages with or without treatment of mCCL9 for 48 hours.\u003cstrong\u003e \u003c/strong\u003e(\u003cstrong\u003eB\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eQ-PCR analysis of IL-1ß and TNF-ɑ expression levels in M0 macrophages treated with or without mCCL9 for 48 hours. (\u003cstrong\u003eC\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eQ-PCR analysis of Arg1 and CD206 expression levels in M-CSF incubated macrophages which were treated with or without mCCL9 for 48 hours. (\u003cstrong\u003eD\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eQ-PCR analysis of Arg1 and CD206 expression levels in M2-macrophages treated with or without mCCL9 for 48 hours.\u003cstrong\u003e \u003c/strong\u003e(\u003cstrong\u003eE\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eQ-PCR analysis of iNOS mRNA relative expression level in M-CSF incubated macrophages, mCCL9 incubation lasts for 48 hours. (\u003cstrong\u003eF\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eQ-PCR analysis of iNOS mRNA relative expression level in macrophages with LPS stimulation. mCCL9 incubation lasts for 48 hours followed the LPS-treatment\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7127377/v1/2a86323463c5c83da645c0c7.png"},{"id":90342591,"identity":"cae357b2-20e5-4aa5-94df-8d192f50b327","added_by":"auto","created_at":"2025-09-01 15:36:01","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2001516,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCCL9 administration during the initial phase of fractures can mitigate bone bridge formation.\u003c/strong\u003e (\u003cstrong\u003eA\u003c/strong\u003e) Representative images of TRAP staining of bone sections revealing osteoclast activity in conditions of sham, CCL9 treatment, CCR1 treatment, CCL9 treatment with CCR1 antagonist. Alcian blue staining shown the sulfated glycosaminoglycan of the cartilage matrix. (\u003cstrong\u003eB\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eQuantification analysis of osteoclast number in (A). (\u003cstrong\u003eC\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eQuantification analysis of bony matrix in the injured site in (A). (\u003cstrong\u003eD\u003c/strong\u003e) Representative images of IHC staining of SOX9 expression level in growth plate chondrocytes. (\u003cstrong\u003eE\u003c/strong\u003e) \u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eQuantification analysis of (D)\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7127377/v1/60b8de170217858adf4d4bf4.png"},{"id":90344816,"identity":"80a5b8c8-7844-42b6-aca6-aec0d9e73655","added_by":"auto","created_at":"2025-09-01 16:03:57","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":22279672,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7127377/v1/6a610912-cefe-48d3-979a-20595cc12927.pdf"},{"id":90342607,"identity":"00c866d9-f470-432e-924d-b4f498ac98ac","added_by":"auto","created_at":"2025-09-01 15:36:02","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":8448425,"visible":true,"origin":"","legend":"SUPPLEMENTAL MATERIAl","description":"","filename":"SI.docx","url":"https://assets-eu.researchsquare.com/files/rs-7127377/v1/80c4e472efaebf2d17dd1276.docx"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e conflict of interest to disclose.\nThere are no conflicts of interest to declare.","formattedTitle":"Chemokine treatment in growth plate fracture: a pivotal role of CCL9","fulltext":[{"header":"Introduction","content":"\u003cp\u003eThe growth plate is particularly susceptible to injury, which can lead to growth arrest in children [1,2]. In addition to the limited regenerative capacity of growth plate cartilage, the formation of a bone bridge at the site of injury is a key factor contributing to the cessation of longitudinal growth [3,4], often resulting in uneven or misaligned limbs. Consequently, understanding the regulatory mechanisms underlying the various phases of the injury response is crucial.\u003c/p\u003e\u003cp\u003eDuring the phase of bone bridge formation, there is a loss of chondrogenic marker protein expression, while the expression of genes associated with ossification increases [5,6]. Previous studies have classified growth plate injury into four distinct phases of injury response [7]; however, the biological events associated with bone bridge formation at the fracture site remain unclear. The growth plate contains chondrocytes at various stages of differentiation [8], and upon injury, these chondrocytes, which are typically isolated from the bone marrow cavity, come into direct contact with a variety of immune and non-immune cells. This suggests that the remodeling process at the injured site may occur within a unique microenvironment, distinct from that of cortical bone fractures.\u003c/p\u003e\u003cp\u003eIn this study, we compared two mouse models of bone injury and performed transcript profiling of the affected tissues. We identified a clear distinction in the biological mechanisms underlying the healing processes of growth plate fractures and cortical bone fractures. Notably, the chemokine CCL9, which is known to play a role in immune responses [10,11], was significantly reduced during the bone bridge formation phase. Ex vivo, while CCL9 promoted BMSC migration, it inhibited their osteogenic differentiation. CCL9 administration suppressed osteoclast formation and protected against cartilage degeneration, thereby enhancing chondrocyte anabolism in ex vivo-cultured injured growth plate explants. Moreover, recombinant CCL9 significantly upregulated the expression of arginine metabolism enzymes in macrophages. Importantly, the administration of CCL9 to the injured growth plate effectively inhibited bone bridge formation. These findings highlight the complex biological role of CCL9 in the unique microenvironment of fracture repair and underscore the need for a more nuanced approach to the regulation of epiphyseal injuries. Based on our RNA-sequencing results, therapeutic strategies solely aimed at promoting osteogenesis may not be suitable for growth plate injuries and should be carefully reconsidered.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cb\u003eContrasting the microenvironment of growth plate injuries with that of cortical bone fracture injuries\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo investigate the molecular mechanism of physeal bony bridge formation during growth plate fractures, we established a mice model with growth plate drill-hole injury in the middle-portion of the physis to mimic the bone bridge formation responses occurring on 1, 3, 7, 14 and 28 days postsurgery, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). By safranin O-fast green staining of femoral bone sections, no detectable fibrous bone created in the disrupted portions at post-injury day 1, and the fracture site filled with fibroblast-like cells at post-injury day 3, but at day 7, bony callus was present (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). These data suggest that the phase between days 3 to 7 post-fracture is critical for the initiation or promotion of bone bridge formation and maturation. Understanding the microenvironment events involved in this process is essential.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTaking the healing process of bone fracture as an example (Supplemental Fig.\u0026nbsp;1A), accumulating studies indicate that the immune microenvironment is crucial in determining the outcome of bone repair\u003csup\u003e12,13\u003c/sup\u003e. To further investigate how microenvironment dynamics influence the healing process in growth plate injuries, we performed RNA-sequencing analysis of tissues within the fracture site collected from mice with growth plate drill-hole injury or long bone cortical hole drilling, at day 3 or day 7 after the fracture, respectively (Supplemental Fig.\u0026nbsp;1B). In the healing process of growth plate injuries, gene ontology (GO) enrichment analysis reveals that receptor binding and chemokine activity are among the top 10 significantly enriched biological processes between days 3 and 7 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD), unlike in the context of bone fractures (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE), suggesting a distinct microenvironment with molecular complexity. By comparing differentially expressed genes identified during osteogenic differentiation or osteoclastogenesis, we found that genes involved in these processes were upregulated in growth plate injuries but not in cortical bone injuries (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB), suggesting a much more active bone turnover behavior governing the repair process in growth plate injuries. Moreover, genes associated with chondrogenesis are also upregulated (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG), making it clear that despite bone bridge formation occurring, cartilage function is not completely lost but may even be in an active state. This finding suggests that there is a distinctly different microenvironment conducive for bone bridge formation during the process of growth plate fracture repair. Identifying key factors involved in this microenvironment could help solve the problem of bone bridge growth.\u003c/p\u003e\u003cp\u003e\u003cb\u003eCCL9 shows potential to support cartilage repair\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo identify factors related to bone bridge formation, we conducted further analysis of differentially expressed genes encoding secretory proteins. The expression of the chemokine CCL9 was significantly reduced at day 7 after the fracture compared to day 3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). The reduced level of CCL9 during phases of growth plate injury was further confirmed using Q-PCR. CCL9 expression was increased in the initial phase of the fracture (day 1 to 3) and then gradually decreased from post-fracture day 3 to 14 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). These data indicate that the chemokine CCL9 may play a critical role in the subsequent cartilaginous or osteogenic events.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo investigate the role of CCL9 in the regulation of chondrocyte function, we obtained growth plate tissue explants from newborn mice and drilled in a middle of the epiphyseal plates to mimic a drilling-hole model \u003cem\u003ein vivo\u003c/em\u003e (Supplemental Fig.\u0026nbsp;2A). The explants were then cultured in a culture medium with or without homologous recombinant CCL9. Immunoblotting analysis showed that SOX9 and COL2 protein levels in drilling-hole cartilage explants significant decrease (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC), although the \u003cem\u003eex vivo\u003c/em\u003e chondrogenesis of limb chondrocytes was not impacted in the presence of recombinant CCL9 (Supplemental Fig.\u0026nbsp;2B). Consistently, immunohistochemistry staining data showed that drilling-hole fractures caused a significant decrease in the levels of the transcription factor SOX9, which regulates chondrogenesis (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD, \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE), and COL2, mainly synthesized by chondrocytes (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF, \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG) in growth plate proliferative chondrocytes. However, the expression of SOX9 and COL2 were retained in the basal levels in the CCL9-incubated groups. These data indicate that CCL9 serves as a potential protective factor for chondrogenesis to counteract cartilage loss.\u003c/p\u003e\u003cp\u003e\u003cb\u003eCCL9 suppresses BMSC osteogenic differentiation but promote non-inflammatory osteoclast formation\u003c/b\u003e\u003c/p\u003e\u003cp\u003ePublished studies have indicated that chemokines play a role in attracting stem cells to form a niche system that promotes fracture healing\u003csup\u003e14\u0026ndash;16\u003c/sup\u003e, In this study, we examined the potential roles of CCL9 in stem cells chemotaxis by performing an \u003cem\u003eex vivo\u003c/em\u003e scratch-wound assay to determine whether bone marrow mesenchymal stem cells (BMSCs) from murine or rat can generate a migratory response to CCL9. After incubation for 12h, 24h and 36h with recombinant CCL9, BMSCs migrated noticeably faster than those in the BSA-incubated control groups (Supplemental Fig.\u0026nbsp;3).\u003c/p\u003e\u003cp\u003eGiven that mesenchymal stem cells have been considered to differentiate into osteoblasts subsequently at the growth plate injured site following migration and chemotaxis\u003csup\u003e17,18\u003c/sup\u003e and a recent finding indicated that CCL9 inhibition is an effective way for accelerating bone healing \u003cem\u003ein vivo\u003c/em\u003e\u003csup\u003e19\u003c/sup\u003e, we aimed to determine if additional CCL9 would affect the osteogenic fate of BMSCs. To investigate this, we performed an \u003cem\u003eex vivo\u003c/em\u003e osteogenesis assay. CCL9 was shown to suppress osteogenic differentiation and osteogenic alkaline phosphatase activity in murine BMSCs (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB) but not in primary cranial osteoblastic progenitors (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC, \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD), indicating that CCL9 is more effective in cells with multipotent capacity in inhibiting osteogenesis. Consistent with these findings, expression levels of the bone-specific genes, including osterix (OSX)\u003csup\u003e20\u003c/sup\u003e, RUNX2\u003csup\u003e21\u003c/sup\u003e, and osteocalcin (OCN)\u003csup\u003e22,23\u003c/sup\u003e, were all significantly decreased in osteoblast-differentiating BMSCs incubated in osteogenic-conditioned medium containing recombinant CCL9, in comparison to the BSA controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). In addition, type 1 collagen\u003csup\u003e24\u003c/sup\u003e, which is synthesized for subsequent mineralization, was reduced upon CCL9 incubation during BMSC differentiating into osteoblasts, accompanied by a minor reduction in the level of OCN (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF, \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG). These results suggest that CCL9 can inhibit the osteogenic capacity of BMSCs and indicate a potential resistance mechanism of CCL9 against the osteogenesis process, which may be beneficial for damaged cartilage during growth plate injury.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eInterestingly, we observed a signature of suppressed osteoclast formation during the early stage of bone bridge formation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eH), which is similar to the observations in the early stage of cortical bone fracture repair (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eI), despite the osteoclast number beginning to increase as inflammation fades (Supplemental Fig.\u0026nbsp;4A). Considering that in the initial phase of growth plate fracture, inflammatory responses and increased CCL9 are the major events, we next investigated whether CCL9 contributes to osteoclast formation. In bone marrow-derived monocyte/macrophage (BMDM) cultures, CCL9 significantly promotes multinuclear TRAP-positive cell formation but plays a suppressive role in the presence of IL-1β (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eJ, \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eK), suggesting a dual role of CCL9 in osteoclasts.\u003c/p\u003e\u003cp\u003e\u003cb\u003eCCL9 activates macrophage while inhibiting proinflammatory response\u003c/b\u003e\u003c/p\u003e\u003cp\u003eExperimental mouse bone fractures have demonstrated that the healing process depends on tissue repair-associated macrophages\u003csup\u003e25,26\u003c/sup\u003e. As CCL9 is a monokine with inflammatory and chemokinetic properties, we next determined whether CCL9 plays a role in regulating inflammatory response or macrophage polarization. Following an additional 24-hour incubation with CCL9, IL-1\u0026szlig; and TNF-ɑ levels in LPS-induced M1 macrophages decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA), while they remained constant in macrophages without LPS stimulation compared to BSA-incubated controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). This suggests an anti-inflammatory effect of exogenous CCL9. In the context of bone fractures, increased recruitment of M2-like macrophages has been identified as a response to support remodeling. In our study, we observed a significant increase in the markers for the M2 anti-inflammatory subset, arginase-1 (Arg-1), and CD206, in macrophages treated with recombinant CCL9 Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). CCL9 also induced higher levels of Arg-1 and CD206 in M2-type macrophages (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). Interestingly, recombinant CCL9 also induced inducible Nitric oxide synthase (iNOS) expression in macrophages under both inflammatory and non-inflammatory conditions (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE, \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). The positive effect of CCL9 on the expression of the arginine metabolism enzyme in macrophages may be beneficial for inhibiting bone bridge formation in injured growth plates.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eCCL9 administration during the initial phase of fractures can mitigate bone bridge formation\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo assess the \u003cem\u003ein vivo\u003c/em\u003e effect of CCL9, we employed continuous delivery to the injured site in drilling-hole mice. By day 5 post-injury, CCL9 treatment significantly induced osteoclastogenesis at the injured site compared to controls. Conversely, osteoclast formation was reduced when a CCL9 receptor CCR1 was co-administered with CCL9 (Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). In contrast to the detection of bone bridge formation in the non-treated groups, bony callus was significantly reduced by CCL9 administration (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). A previous study has indicated that CCL9 can counteract kidney fibrosis\u003csup\u003e27\u003c/sup\u003e, supporting a positive role of CCL9 in tissue repair. The effect of CCL9 in our current growth plate drilling-hole model suggests that it acts as a governor to slow down bone turnover. These results suggest that increasing the CCL9 level in the injured microenvironment may provide more space and time for cartilage regeneration. Consistent with our \u003cem\u003eex vivo\u003c/em\u003e observations, CCL9 administration to the injured growth plate induced SOX9 expression in chondrocytes to the basal level; however, in the presence of a CCR1 antagonist, the SOX9 level was decreased (Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD, \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). These findings demonstrate the essential role of CCL9 levels in the injured site for growth plate fracture repair. CCL9 benefits damaged cartilage, likely by reducing bone turnover and protecting against cartilage loss to resist bone bridge formation.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eGrowth plate damage that penetrates the subchondral bone typically results in extensive bony bridge formation, leading to angulation deformity. Therefore, clarifying the microenvironment involving cartilage function loss and enhanced osteogenesis will aid in developing improved therapeutic approaches for physeal fracture healing. In our current study, we compared growth plate fracture repair with bone cortex fracture. We observed that chemokine activity is a dominant phenotype during bony bridge formation, which differs from the cortical bone healing process at the same stage. We screened for differential expression of the chemokine CCL9 in the injured growth plate and presented evidence that recombinant CCL9 has the potential to suppress bone turnover, serving as a chondroprotective factor after growth plate injury.\u003c/p\u003e\u003cp\u003eCCL9 belongs to the MIP-1 CC chemokine subfamily and possesses chemotactic and inflammatory properties\u003csup\u003e9,28,29\u003c/sup\u003e. Although the roles of CCL9 in diseases or fracture repair have been observed in previous studies, how CCL9 is involved in cartilage injury has not been determined. It is known that timely recruitment of progenitors to the injured site is required for tissue regeneration\u003csup\u003e30\u0026ndash;34\u003c/sup\u003e. However, the dominant chemotactic factor that actually drives cellular events underlying the healing process in the injured growth plate remains unknown. Osteogenesis induction of pluripotent progenitors during cortical bone fracture healing is beneficial for subsequent bone formation\u003csup\u003e35\u0026ndash;37\u003c/sup\u003e. However, in growth plate injuries, progenitor cells eventually differentiating into the osteoblastic lineage may not be conducive to cartilage regeneration. In our experiments, recombinant CCL9 significantly promoted BMSCs migration but suppressed their capacity to differentiate into the osteogenic lineage. This observation is consistent with a recent finding that identified a pro-osteogenic function of anti-CCL9 antibody for bone fracture repair\u003csup\u003e19\u003c/sup\u003e. Notably, these data suggest a potential application of CCL9 in mesenchymal stem cell therapy for physeal repair, recruiting possible cell sources for the regeneration of cartilage.\u003c/p\u003e\u003cp\u003eHighly progressive of osteogenesis in growth plate fractures leads to accumulation of excess calcified extracellular matrix components, causing misshapen bones and cartilage malfunctions. Considering the cellular composition of bone, osteoclast is a significant cell population which located adjacent to chondrocytes, osteoblasts and their progenitors, play a crucial role in absorbing and removing calcified extracellular matrix components. However, few studies have addressed the involvement of osteoclasts in growth plate injury. Our study indicated that CCL9 promotes osteoclast differentiation under non-inflammatory conditions, suggesting a potential therapeutic capacity of CCL9 that target bone turnover rate. The suppressive effects of CCL9 on osteoclasts in the context of pro-inflammation response supports our observations of a near absence of osteoclasts in the initial phase of the fracture. We hypothesize that this inhibitory effect on osteoclasts in the initial phase may facilitate the initiation of osteogenesis.\u003c/p\u003e\u003cp\u003eNotable differences between physeal fracture and bone cortex fracture are chemokine and cytokine activities, and function by binding to their receptors. Chemokines and cytokines are functional secreted proteins that regulate or determine cell trafficking and immune responses\u003csup\u003e38\u003c/sup\u003e. However, each factor may have a completely different function, depending on the specific phase of the immune response or location where it is presented. Transcription profiling of the injured growth plate at post-injury days 3 and 7 revealed that several chemokines are decreased, suggesting the possibility that the natural recruitment of cell sources for regeneration is insufficient, and the local microenvironment is hostile after injury. Although numerous studies have reported on the mechanisms of M2-polarized macrophage accumulation being beneficial for bone regeneration\u003csup\u003e39\u0026ndash;43\u003c/sup\u003e, we determined that exogenous CCL9 impacts macrophages without affecting pro-inflammatory responses but can elevate the inflammatory mediator, inducible nitric oxide synthase (iNOS) level. Xian et al. has been indicated that iNOS may play a role in promoting MSC differentiation to cartilaginous cells\u003csup\u003e44\u003c/sup\u003e. The effects of CCL9 on macrophages and protective effects of CCL9 shown in experiments on explant tissue culture suggest an applicable strategy to injuries involving growth plates, however, future investigations are necessary to validate \u003cem\u003ein vivo\u003c/em\u003e. Moreover, in humans, there is no highly homologous gene to CCL9; only CCL15 and CCL23 are moderately similar to rodent CCL9\u003csup\u003e45\u003c/sup\u003e. Therefore, it is important to elucidate the functional receptor with high affinity to CCL9 on stem cells during physeal injury, providing more information to improve strategies in stem cell therapy.\u003c/p\u003e\u003cp\u003e\u003cb\u003eLimitations of the study\u003c/b\u003e\u003c/p\u003e\u003cp\u003eAlthough this study has uncovered that CCL9 suppressed \u003cem\u003eex vivo\u003c/em\u003e cartilaginous degeneration and are reinforced chondrocyte anabolism, while the underlying mechanism remains to be fully elucidated. Therefore, future studies are needed to include a more detailed and in-depth analysis the potential mechanism. Another limitation is that all in \u003cem\u003evivo\u003c/em\u003e data were obtained in mice. Testing in clinical specimens or other species particularly nonhuman primates is required to assess the potential protective role of CCL9 for growth plate injuries.\u003c/p\u003e"},{"header":"Experimental Model and Study Participant Detailss","content":"\u003cp\u003e\u003cstrong\u003eAnimal model\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eThe growth plate injury model of distal femoral was established in 4-week-old wild-type (WT) C57BL/6J mice (Laboratory Animal Centre of Southern Medical University, Guangzhou, China). Before surgery, the mice were anaesthetized by intraperitoneal injection of 2.5% avertin. A 0.5-cm incision was performed on the anterior aspect of left knee and the distal femoral trochlear groove were exposed. And then, a defect (0.6-mm diameter) was made across the physis of the distal femur using a microdrill. Subsequently, the patella was relocated to its original position, the incision was closed with 5-0 vicryl suture. Similarly, a bone defect was constructed in the metaphysis of the left femur in the laterale direction. Mice were died of cervical dislocation afer anesthesia with 2.5% avertin at day 1, 3, 7, 14 and 28 post-surgeries (n = 6 per group).\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eEthics statement\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eAll animal experiments were submitted for review to the Animal Ethics Management Center of Southern Medical University and were subsequently approved by the Animal Ethics Committee of Southern Medical University. All procedures involving animals adhered to the Guidelines for the Care and Use of Laboratory Animals established by the U.S. National Institutes of Health.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eRNA-sequencing analysis\u003c/strong\u003e\u003c/p\u003e\u003cp\u003ePost-injury tissues collected from mice and total RNA from each sample was isolated and extracted. Libraries were constructed and cDNA of ~200bp in size were pair-end sequenced using an Illumina Novaseq platform. Genes for which the expression differed in the day 7 post-injury groups compared with day 3 post-injury groups were identified. Fold changes (\u0026gt;2 or \u0026lt; 2) are set as the threshold for up- or down-regulated transcripts. Adjusted P values were calculated using the Benjamini-Hochberg method. A q-value \u0026lt; 0.05 was considered significant.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eHistology\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eFemur tissues were fixed in 4% paraformaldehyde for 24 h and decalcified for 21 days. The decalcification solution was replaced every 3 days. Specimens then dehydrated and embedded in paraffin (4 μm thick sections) or cryosection (10 μm thick sections). For cryosections, specimens were dehydrated in 30% sucrose overnight at 4 °C and processed for SAKURA Tissue-Tek® O.C.T. Compound (4583, Sakura Finetek, Torrance, CA, USA). The tissue sections were stained with Safranin O, and fast green (Solarbio, Beijing, China), hematoxylin, and eosin (H\u0026amp;E) (Solarbio, Beijing, China), toluidine blue (Solarbio, Beijing, China) for morphological observation. The Immunostaining was performed on the serial tissue sections. Paraffin sections were deparaffinized and rehydrated at first. All slides were washed three times in PBS for 5 minutes each time. Antigen retrieval was performed by citric buffer (Sigma) in a 60 °C water bath for 14h. Subsequently, the endogenous peroxidase activity of tissue slices were reduced by 3% hydrogen peroxide (Sigma) at room temperature for 10 min. After washing three times in PBS, the tissue sections were blocked with goat serum (Solarbio, Beijing, China) for 60 min and then incubated with the indicated antibodies at 4 °C overnight. The primary antibodies used for IHC staining were: rabbit anti-COL2 (1:100, ab34712, Abcam), rabbit anti-SOX9 (1:100, A19170, Abclonal). On the second day, the tissue sections were washed with PBS and incubated with the horseradish peroxidase for 1 h at room temperature, then sections were stained with DAB and hematoxylin. Images were obtained using Zeiss LSM 780 confocal microscope (Carl Zeiss Microscopy, LLC,White Plains, NY, USA).\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eBMSCs isolation and culture\u003c/strong\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\u003cp\u003eBone marrow mesenchymal stem cells (BMSCs) were isolated from femurs and tibiae of 8-week-old C57BL/6J mouse. After the mice were euthanized, the femurs, tibias were separated under sterile condition and the attached soft tissue was stripped carefully. Then, the both ends of femur and tibia were cut off, and the bone marrow was flushed out by Minimum Essential Medium Alpha (α-MEM) using a 5 ml syringe. Subsequently, the bone marrow was centrifuged for 5 min at 1000 r/min, and the cells was re-suspended after the supernatants was remove. Whole bone marrow cells were cultured in α-MEM containing 10% Fetal Bovine Serum (FBS, corning) and 100μg/ml penicillin-streptomycin (Gibco, Carlsbad, CA, USA) at 37 °C in a 5% CO2 incubator. After 24 h, non-adherent cells were removed by washed with PBS. RAW264.7 monocytes (ATCC, Mana ssas, VA, USA) were cultured in RPMI 1640 (Gibco) with 10% FBS and 1% penicillin-streptomycin.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eCalvarial osteoblasts ex vivo culture\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eCalvarial osteoblasts were isolated from C57BL/6J mouse embryos at postnatal day 2. The parietal bone was separated and the surface soft tissue were removed under sterile condition. Then, the cranium was minced, and digested with 0.25% trypsin (Gibco) in a 37℃ shaker, set at 80rpm for 30min. Discarding the trypsin, the rest of tissues were washed with 1×PBS, and digested with 0.2% collagenase type II (C6885, Sigma-Aldrich, Germany) in the 37℃ shaker for 60min. Subsequently, the collagenase solution was collected and centrifuged. After the supernatant was removed, the cells were re-suspended in complete α-MEM and seeded in a 6-cm2 Petri dish.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eScratching experiment\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eTo verify the effect of migration of BMSCs, a scratch wound healing assay was performed. BMSCs were seeded in 6-well plates and cultured to 80% confluence. A scratch wound was made with 1ml pipette tips. The wound was rinsed with PBS and then cultured in complete α-MEM. The process of cell migration was observed and recorded at 0 h, 6h, 12 h, 24 h and 36 h using an inverted microscope (BX53, Olympus). The gap closure rate was analyzed and quantified using Image J.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eEx vivo osteoblast differentiation assay\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eBMSCs/calvarial osteoblasts were seeded at 1 × 106/well density on 6-well plate and cultured in complete α-MEM. Subsequently, the complete medium was changed with osteogenic medium (MUBMX-90021, Cyagen, China) after the cells cultured to 70% confluence. The medium was changed every 3 days. On days 21, cells were fixed in 4% paraformaldehyde and stained with Alkaline Phosphatase (ALP) to detect their osteogenic abilities.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eEx vivo osteoclast differentiation assay\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eBone marrow derived monocyte/macrophages (BMDMs) were seeded onto the plates and cultured in the α-MEM supplemented with 10% fetal bovine serum, 20ng/mL M-CSF and 40ng/mL RANKL. After incubation at 37 °C for 3 days, cells were fixed for TRAP staining assay or lysed for Q-PCR detection. Image were quantified using Image J.\u003c/p\u003e\u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003cstrong\u003eGrowth plate explants ex vivo culture model\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eThe 2-day-old C57 mice were euthanized to isolate femur explants. And then, the growth plate injury of distal femur was performed using a 1ml syringe. Explants were cultured for 5 days in complete DMEM/F12.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eReal-time (RT)-PCR\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eTotal RNA was isolated using TRIzol reagent (Accurate Biology,Hunan, China), followed 1 mg total RNA was reverse-transcripted into cDNA using the cDNA Reverse Transcription Kit (Vazyme Biotech, Nanjing, China). The qPCR reaction was performed with SYBR Green Master Mix (Vazyme). All reactionss were performed in triplicate. The primer sequences in this study are summarized in Table 1.\u003c/p\u003e\u003cp\u003e\u003cstrong\u003eWestern blot analysis\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eCells were lysed on ice with RIPA (Fude Biological) buffer supplemented with 1% protease inhibitors (Biosharp) and 1% phosphatase inhibitors (Biosharp). The mixture was then centrifuged at 12000r/min, 4℃ for 15 min, and collected the supernatant. Proteins were quantified using the BCA kit (Fude Biological), and mixed with loading buffer (Fude Biological). Equal volume of protein (10μg) was supplemented and separated on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and then transferred to polyvinylidene difluoride (PVDF, Beyotime) membranes. The PVDF membrane was incubated with primary antibodies overnight at 4 °C after blocked with QuickBlock Blocking Buffer (P0231, Beyotime) for 15 min. After washing with Tris-buffered saline containing 0.1% Tween-20 (TBST), the membranes were incubated with secondary antibodies (1:1000 dilution, Beyotime) for 1 h at RT. Images were obtained with the FDbio-Dura ECL (FDbio science, Hangzhou, China). The primary antibodies used in WB were rabbit anti-Col I (1:1000 dilution, Abcam, ab270933), rabbit anti-osteocalcin (1:100 dilution, Abcam, ab93876), mouse anti-actin (1:5000 dilution, Beijing Ray Antibody Biotech, RM2001).\u003c/p\u003e\u003cp\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eThe experimental data were presented as the mean ± SD. For comparisons of two groups, unpaired Student’s t-test was performed. For data involving multiple groups analyses were performed with one-way analysis of variance (ANOVA) followed by Turkey’s post-hoc test. P \u0026lt; 0.05 was accepted as statistically significant.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization, Ruolian Ye. and Dehong Yang.; Methodology, Zhaobo Zhu. and Yuelun Ji.; Investigation, Yuelun Ji. and Zhen Kong.; Validation, Yuanjing Liao., Zhaobo Zhu.and Zhen Kong.; Data Curation, Zhaobo Zhu., Yuelun Ji. and Zhen Kong.; Writing-Original Draft, Zhaobo Zhu. and Yuelun Ji.; Funding Acquisition, Ruolian Ye.; Supervision, Ruolian Ye. and Dehong Yang.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding Declaration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Natural Science Foundation of Guangdong Province, China (grant numbers 2023A1515010372).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data included in this study are available from the Corresponding author.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interests\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflicts of interest.\u003c/p\u003e\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eKao, S.C., and Smith, W.L. (1997). Skeletal injuries in the pediatric patient. Radiol. Clin. N. Am. \u003cem\u003e35\u003c/em\u003e, 727-746.\u003c/li\u003e\n\u003cli\u003eJones, I.E., and Williams, S.M., and Dow, N., and Goulding, A. (2002). How many children remain fracture-free during growth? A longitudinal study of children and adolescents participating in the dunedin multidisciplinary health and development study. Osteoporos. Int. \u003cem\u003e13\u003c/em\u003e, 990-995. 10.1007/s001980200137.\u003c/li\u003e\n\u003cli\u003eLee, M.A., and Nissen, T.P., and Otsuka, N.Y. (2000). Utilization of a murine model to investigate the molecular process of transphyseal bone formation. J. Pediatr. Orthop. \u003cem\u003e20\u003c/em\u003e, 802-806. 10.1097/00004694-200011000-00021.\u003c/li\u003e\n\u003cli\u003eWattenbarger, J.M., and Gruber, H.E., and Phieffer, L.S. (2002). Physeal fractures, part i: histologic features of bone, cartilage, and bar formation in a small animal model. J. Pediatr. Orthop. \u003cem\u003e22\u003c/em\u003e, 703-709.\u003c/li\u003e\n\u003cli\u003eMacsai, C.E., and Hopwood, B., and Chung, R., and Foster, B.K., and Xian, C.J. (2011). Structural and molecular analyses of bone bridge formation within the growth plate injury site and cartilage degeneration at the adjacent uninjured area. Bone \u003cem\u003e49\u003c/em\u003e, 904-912. 10.1016/j.bone.2011.07.024.\u003c/li\u003e\n\u003cli\u003eMacsai, C.E., and Georgiou, K.R., and Foster, B.K., and Zannettino, A.C., and Xian, C.J. (2012). Microarray expression analysis of genes and pathways involved in growth plate cartilage injury responses and bony repair. Bone \u003cem\u003e50\u003c/em\u003e, 1081-1091. 10.1016/j.bone.2012.02.013.\u003c/li\u003e\n\u003cli\u003eXian, C.J., and Zhou, F.H., and Mccarty, R.C., and Foster, B.K. (2004). Intramembranous ossification mechanism for bone bridge formation at the growth plate cartilage injury site. J. Orthop. Res. \u003cem\u003e22\u003c/em\u003e, 417-426. 10.1016/j.orthres.2003.08.003.\u003c/li\u003e\n\u003cli\u003eSalhotra, A., and Shah, H.N., and Levi, B., and Longaker, M.T. (2020). Mechanisms of bone development and repair. Nat. Rev. Mol. Cell Biol. \u003cem\u003e21\u003c/em\u003e, 696-711. 10.1038/s41580-020-00279-w.\u003c/li\u003e\n\u003cli\u003eYang, M., and Odgren, P.R. (2005). Molecular cloning and characterization of rat ccl9 (mip-1gamma), the ortholog of mouse ccl9. Cytokine \u003cem\u003e31\u003c/em\u003e, 94-102. 10.1016/j.cyto.2005.04.001.\u003c/li\u003e\n\u003cli\u003eLi, B., and Zhang, S., and Huang, N., and Chen, H., and Wang, P., and Yang, J., and Li, Z. (2019). Ccl9/ccr1 induces myeloid‑derived suppressor cell recruitment to the spleen in a murine h22 orthotopic hepatoma model. Oncol. Rep. \u003cem\u003e41\u003c/em\u003e, 608-618. 10.3892/or.2018.6809.\u003c/li\u003e\n\u003cli\u003eKortlever, R.M., and Sodir, N.M., and Wilson, C.H., and Burkhart, D.L., and Pellegrinet, L., and Brown, S.L., and Littlewood, T.D., and Evan, G.I. (2017). Myc cooperates with ras by programming inflammation and immune suppression. Cell \u003cem\u003e171\u003c/em\u003e, 1301-1315. 10.1016/j.cell.2017.11.013.\u003c/li\u003e\n\u003cli\u003eXiong, Y., and Mi, B.B., and Lin, Z., and Hu, Y.Q., and Yu, L., and Zha, K.K., and Panayi, A.C., and Yu, T., and Chen, L., and Liu, Z.P., et al (2022). The role of the immune microenvironment in bone, cartilage, and soft tissue regeneration: from mechanism to therapeutic opportunity. Mil. Med. Res. \u003cem\u003e9\u003c/em\u003e, 65. 10.1186/s40779-022-00426-8.\u003c/li\u003e\n\u003cli\u003eWang, Y., and Chen, X., and Cao, W., and Shi, Y. (2014). Plasticity of mesenchymal stem cells in immunomodulation: pathological and therapeutic implications. Nat. Immunol. \u003cem\u003e15\u003c/em\u003e, 1009-1016. 10.1038/ni.3002.\u003c/li\u003e\n\u003cli\u003eOrtinau, L., and Lei, K., and Jeong, Y., and Park, D. (2020). Real-time imaging of ccl5-induced migration of periosteal skeletal stem cells in mice. J. Vis. Exp. 10.3791/61162.\u003c/li\u003e\n\u003cli\u003eMyers, T.J., and Longobardi, L., and Willcockson, H., and Temple, J.D., and Tagliafierro, L., and Ye, P., and Li, T., and Esposito, A., and Moats-Staats, B.M., and Spagnoli, A. (2015). Bmp2 regulation of cxcl12 cellular, temporal, and spatial expression is essential during fracture repair. J. Bone. Miner. Res. \u003cem\u003e30\u003c/em\u003e, 2014-2027. 10.1002/jbmr.2548.\u003c/li\u003e\n\u003cli\u003eGranero-Molto, F., and Weis, J.A., and Miga, M.I., and Landis, B., and Myers, T.J., and O\u0026apos;Rear, L., and Longobardi, L., and Jansen, E.D., and Mortlock, D.P., and Spagnoli, A. (2009). Regenerative effects of transplanted mesenchymal stem cells in fracture healing. Stem. Cells. \u003cem\u003e27\u003c/em\u003e, 1887-1898. 10.1002/stem.103.\u003c/li\u003e\n\u003cli\u003eGarg, P., and Mazur, M.M., and Buck, A.C., and Wandtke, M.E., and Liu, J., and Ebraheim, N.A. (2017). Prospective review of mesenchymal stem cells differentiation into osteoblasts. Orthop. Surg. \u003cem\u003e9\u003c/em\u003e, 13-19. 10.1111/os.12304.\u003c/li\u003e\n\u003cli\u003eHeino, T.J., and Hentunen, T.A. (2008). Differentiation of osteoblasts and osteocytes from mesenchymal stem cells. Curr. Stem Cell Res. Ther. \u003cem\u003e3\u003c/em\u003e, 131-145. 10.2174/157488808784223032.\u003c/li\u003e\n\u003cli\u003eNakayama, M., and Okada, H., and Seki, M., and Suzuki, Y., and Chung, U.I., and Ohba, S., and Hojo, H. (2022). Single-cell rna sequencing unravels heterogeneity of skeletal progenitors and cell-cell interactions underlying the bone repair process. Regen. Ther. \u003cem\u003e21\u003c/em\u003e, 9-18. 10.1016/j.reth.2022.05.001.\u003c/li\u003e\n\u003cli\u003eNakashima, K., and Zhou, X., and Kunkel, G., and Zhang, Z., and Deng, J.M., and Behringer, R.R., and de Crombrugghe, B. (2002). The novel zinc finger-containing transcription factor osterix is required for osteoblast differentiation and bone formation. Cell \u003cem\u003e108\u003c/em\u003e, 17-29. 10.1016/s0092-8674(01)00622-5.\u003c/li\u003e\n\u003cli\u003eKomori, T. (2010). Regulation of osteoblast differentiation by runx2. Adv. Exp. Med. Biol. \u003cem\u003e658\u003c/em\u003e, 43-49. 10.1007/978-1-4419-1050-9_5.\u003c/li\u003e\n\u003cli\u003eHauschka, P.V., and Lian, J.B., and Gallop, P.M. (1975). Direct identification of the calcium-binding amino acid, gamma-carboxyglutamate, in mineralized tissue. Proc. Natl. Acad. Sci. U. S. A. \u003cem\u003e72\u003c/em\u003e, 3925-3929. 10.1073/pnas.72.10.3925.\u003c/li\u003e\n\u003cli\u003eKomori, T. (2020). What is the function of osteocalcin? J. Oral Biosci. \u003cem\u003e62\u003c/em\u003e, 223-227. 10.1016/j.job.2020.05.004.\u003c/li\u003e\n\u003cli\u003eShi, S., and Kirk, M., and Kahn, A.J. (1996). The role of type i collagen in the regulation of the osteoblast phenotype. J. Bone. Miner. Res. \u003cem\u003e11\u003c/em\u003e, 1139-1145. 10.1002/jbmr.5650110813.\u003c/li\u003e\n\u003cli\u003eShin, R.L., and Lee, C.W., and Shen, O.Y., and Xu, H., and Lee, O.K. (2021). The crosstalk between mesenchymal stem cells and macrophages in bone regeneration: a systematic review. Stem Cells Int. \u003cem\u003e2021\u003c/em\u003e, 8835156. 10.1155/2021/8835156.\u003c/li\u003e\n\u003cli\u003eSchlundt, C., and El, K.T., and Serra, A., and Dienelt, A., and Wendler, S., and Schell, H., and van Rooijen, N., and Radbruch, A., and Lucius, R., and Hartmann, S., et al (2018). Macrophages in bone fracture healing: their essential role in endochondral ossification. Bone \u003cem\u003e106\u003c/em\u003e, 78-89. 10.1016/j.bone.2015.10.019.\u003c/li\u003e\n\u003cli\u003eHemmers, C., and Schulte, C., and Wollenhaupt, J., and Wong, D., and Harlacher, E., and Orth-Alampour, S., and Klinkhammer, B.M., and Schirmer, S.H., and Bohm, M., and Marx, N., et al (2022). Chemokine ccl9 is upregulated early in chronic kidney disease and counteracts kidney inflammation and fibrosis. Biomedicines \u003cem\u003e10\u003c/em\u003e. 10.3390/biomedicines10020420.\u003c/li\u003e\n\u003cli\u003eLagergren, A., and Mansson, R., and Zetterblad, J., and Smith, E., and Basta, B., and Bryder, D., and Akerblad, P., and Sigvardsson, M. (2007). The cxcl12, periostin, and ccl9 genes are direct targets for early b-cell factor in op-9 stroma cells. J. Biol. Chem. \u003cem\u003e282\u003c/em\u003e, 14454-14462. 10.1074/jbc.M610263200.\u003c/li\u003e\n\u003cli\u003eDawes, J.M., and Kiesewetter, H., and Perkins, J.R., and Bennett, D.L., and Mcmahon, S.B. (2013). Chemokine expression in peripheral tissues from the monosodium iodoacetate model of chronic joint pain. Mol. Pain \u003cem\u003e9\u003c/em\u003e, 57. 10.1186/1744-8069-9-57.\u003c/li\u003e\n\u003cli\u003eKo, I.K., and Lee, S.J., and Atala, A., and Yoo, J.J. (2013). In situ tissue regeneration through host stem cell recruitment. Exp. Mol. Med. \u003cem\u003e45\u003c/em\u003e, e57. 10.1038/emm.2013.118.\u003c/li\u003e\n\u003cli\u003eBaht, G.S., and Vi, L., and Alman, B.A. (2018). The role of the immune cells in fracture healing. Curr. Osteoporos. Rep. \u003cem\u003e16\u003c/em\u003e, 138-145. 10.1007/s11914-018-0423-2.\u003c/li\u003e\n\u003cli\u003eHerrmann, M., and Stanic, B., and Hildebrand, M., and Alini, M., and Verrier, S. (2019). In vitro simulation of the early proinflammatory phase in fracture healing reveals strong immunomodulatory effects of cd146-positive mesenchymal stromal cells. J. Tissue Eng. Regen. Med. \u003cem\u003e13\u003c/em\u003e, 1466-1481. 10.1002/term.2902.\u003c/li\u003e\n\u003cli\u003eEhnert, S., and Relja, B., and Schmidt-Bleek, K., and Fischer, V., and Ignatius, A., and Linnemann, C., and Rinderknecht, H., and Huber-Lang, M., and Kalbitz, M., and Histing, T., and Nussler, A.K. (2021). Effects of immune cells on mesenchymal stem cells during fracture healing. World J. Stem Cells \u003cem\u003e13\u003c/em\u003e, 1667-1695. 10.4252/wjsc.v13.i11.1667.\u003c/li\u003e\n\u003cli\u003eZhang, E., and Miramini, S., and Patel, M., and Richardson, M., and Ebeling, P., and Zhang, L. (2022). Role of tnf-alpha in early-stage fracture healing under normal and diabetic conditions. Comput. Methods. Programs. Biomed. \u003cem\u003e213\u003c/em\u003e, 106536. 10.1016/j.cmpb.2021.106536.\u003c/li\u003e\n\u003cli\u003eWang, T., and Zhang, X., and Bikle, D.D. (2017). Osteogenic differentiation of periosteal cells during fracture healing. J. Cell. Physiol. \u003cem\u003e232\u003c/em\u003e, 913-921. 10.1002/jcp.25641.\u003c/li\u003e\n\u003cli\u003eJohnson, P.C., and Mikos, A.G., and Fisher, J.P., and Jansen, J.A. (2007). Strategic directions in tissue engineering. Tissue Eng \u003cem\u003e13\u003c/em\u003e, 2827-2837. 10.1089/ten.2007.0335.\u003c/li\u003e\n\u003cli\u003eArvidson, K., and Abdallah, B.M., and Applegate, L.A., and Baldini, N., and Cenni, E., and Gomez-Barrena, E., and Granchi, D., and Kassem, M., and Konttinen, Y.T., and Mustafa, K., et al (2011). Bone regeneration and stem cells. J. Cell. Mol. Med. \u003cem\u003e15\u003c/em\u003e, 718-746. 10.1111/j.1582-4934.2010.01224.x.\u003c/li\u003e\n\u003cli\u003eBorish, L.C., and Steinke, J.W. (2003). Cytokines and chemokines. J. Allergy. Clin. Immunol. \u003cem\u003e111\u003c/em\u003e, S460-S475. 10.1067/mai.2003.108.\u003c/li\u003e\n\u003cli\u003eMartin, K.E., and Garcia, A.J. (2021). Macrophage phenotypes in tissue repair and the foreign body response: implications for biomaterial-based regenerative medicine strategies. Acta Biomater. \u003cem\u003e133\u003c/em\u003e, 4-16. 10.1016/j.actbio.2021.03.038.\u003c/li\u003e\n\u003cli\u003eToita, R., and Kang, J.H., and Tsuchiya, A. (2022). Phosphatidylserine liposome multilayers mediate the m1-to-m2 macrophage polarization to enhance bone tissue regeneration. Acta Biomater. \u003cem\u003e154\u003c/em\u003e, 583-596. 10.1016/j.actbio.2022.10.024.\u003c/li\u003e\n\u003cli\u003eLi, Z., and Li, Q., and Tong, K., and Zhu, J., and Wang, H., and Chen, B., and Chen, L. (2022). Bmsc-derived exosomes promote tendon-bone healing after anterior cruciate ligament reconstruction by regulating m1/m2 macrophage polarization in rats. Stem Cell Res. Ther. \u003cem\u003e13\u003c/em\u003e, 295. 10.1186/s13287-022-02975-0.\u003c/li\u003e\n\u003cli\u003eMahon, O.R., and Browe, D.C., and Gonzalez-Fernandez, T., and Pitacco, P., and Whelan, I.T., and Von Euw, S., and Hobbs, C., and Nicolosi, V., and Cunningham, K.T., and Mills, K., et al (2020). Nano-particle mediated m2 macrophage polarization enhances bone formation and msc osteogenesis in an il-10 dependent manner. Biomaterials \u003cem\u003e239\u003c/em\u003e, 119833. 10.1016/j.biomaterials.2020.119833.\u003c/li\u003e\n\u003cli\u003eGibon, E., and Loi, F., and Cordova, L.A., and Pajarinen, J., and Lin, T., and Lu, L., and Nabeshima, A., and Yao, Z., and Goodman, S.B. (2016). Aging affects bone marrow macrophage polarization: relevance to bone healing. Regen. Eng. Transl. Med. \u003cem\u003e2\u003c/em\u003e, 98-104. 10.1007/s40883-016-0016-5.\u003c/li\u003e\n\u003cli\u003eArasapam, G., and Scherer, M., and Cool, J.C., and Foster, B.K., and Xian, C.J. (2006). Roles of cox-2 and inos in the bony repair of the injured growth plate cartilage. J. Cell. Biochem. \u003cem\u003e99\u003c/em\u003e, 450-461. 10.1002/jcb.20905.\u003c/li\u003e\n\u003cli\u003eYang, M., and Mailhot, G., and Mackay, C.A., and Mason-Savas, A., and Aubin, J., and Odgren, P.R. (2006). Chemokine and chemokine receptor expression during colony stimulating factor-1-induced osteoclast differentiation in the toothless osteopetrotic rat: a key role for ccl9 (mip-1gamma) in osteoclastogenesis in vivo and in vitro. Blood \u003cem\u003e107\u003c/em\u003e, 2262-2270. 10.1182/blood-2005-08-3365.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Table 1","content":"\u003cp\u003e\u003cstrong\u003eTable 1.\u0026nbsp;\u003c/strong\u003ePrimer Sequences of genes\u003c/p\u003e\n\u003cdiv\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eName\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eSpecies\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eSequence 5\u0026apos; to 3\u0026apos;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eCCL9（F）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003emouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eTACTGCCCTCTCCTTCCTCA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eCCL9（R）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003emouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eTTGAAAGCCCATGTGAAACA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eRUNX2（F）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003emouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eTTTAGGGCGCATTCCTCATC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eRUNX2（R）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003emouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eTGTCCTTGTGGATTAAAAGGACTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eOSX（F）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003emouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eCTTGTGCCTGATACCTGCACT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eOSX（R）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003emouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eTCACTCTACCTGACCCGTCATC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eOCN（F）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003emouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eGACTGTGACGAGTTGGCTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eOCN（R）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003emouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eCTGGAGAGGAGAAGAACTGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eIL-1\u0026beta;（F）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003emouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eCACCTTCTTTTCCTTCATCTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eIL-1\u0026beta;（R）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003emouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eTCACACACCAGCAGGTTATCATC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eTNF-\u0026alpha;（F）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003emouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eCACAGAAAGCATGATCCGCGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eTNF-\u0026alpha;（R）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003emouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eTGCCACAAGCAGGAATGAGAAGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eiNOS（F）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003emouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eTCCTCACTGCGACAGCACAGAATG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eiNOS（R）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003emouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eGTGTCATGCAAAATCTCTCCACTGCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eArg-1（F）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003emouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eGGAATCTGCATGGGCAACCTGTGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eArg-1（R）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003emouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eTCCTGGTGGGCCAGTACTAATTGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eCD206（F）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003emouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eCAGGTGTGGGCTCAGGTAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eCD206（R）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003emouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eTGTGGTGAGCTGAAAGGTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eGAPDH（F）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003emouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eCATCACTGCCACCCAGAAGACTG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eGAPDH（R）\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003emouse\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 184px;\"\u003e\n \u003cp\u003eATGCCAGTGAGCTTCCCGTTCAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"genes-and-immunity","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"genes","sideBox":"Learn more about [Genes \u0026 Immunity](http://www.nature.com/gene/)","snPcode":"41435","submissionUrl":"https://mts-gene.nature.com/cgi-bin/main.plex","title":"Genes \u0026 Immunity","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Growth plate, CCL9, Fracture microenvironment, Chondrocyte, Bone bridge formation","lastPublishedDoi":"10.21203/rs.3.rs-7127377/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7127377/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eGrowth plate fractures present a significant challenge to the healing process due to the formation of bone bridges. However, the microenvironment and the regulatory mechanisms underlying growth plate fracture healing remain poorly understood. In this study, we analyzed growth plate and cortical bone tissues from mice at various stages, before and after bone callus formation, using RNA sequencing to compare gene expression profiles. A distinct chemokine activity signature was observed in growth plate injuries, with CCL9 emerging as a dynamically regulated chemokine. Recombinant CCL9 was found to inhibit osteogenesis, promote osteoclast formation under non-inflammatory conditions, and induce macrophage activation ex vivo. Notably, treatment with CCL9 in growth plate injuries preserved chondrocyte activity and significantly reduced the accumulation of bony matrix. These findings collectively suggest a potential protective role for CCL9 in growth plate injuries, likely through the suppression of bone turnover and the enhancement of cartilage anabolism. Elevating CCL9 levels during the appropriate remodeling phase may offer novel opportunities for promoting cartilage regeneration.\u003c/p\u003e","manuscriptTitle":"Chemokine treatment in growth plate fracture: a pivotal role of CCL9","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-01 15:35:56","doi":"10.21203/rs.3.rs-7127377/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"This content is not available.","date":"2025-11-02T08:31:36+00:00","index":2,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2025-10-05T18:12:45+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2025-09-13T15:24:53+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2025-08-24T13:21:21+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-07-21T12:46:37+00:00","index":"","fulltext":""},{"type":"submitted","content":"Genes \u0026 Immunity","date":"2025-07-18T16:45:11+00:00","index":"","fulltext":""},{"type":"checksFailed","content":"","date":"2025-07-16T11:12:36+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-07-15T07:08:11+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"genes-and-immunity","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"genes","sideBox":"Learn more about [Genes \u0026 Immunity](http://www.nature.com/gene/)","snPcode":"41435","submissionUrl":"https://mts-gene.nature.com/cgi-bin/main.plex","title":"Genes \u0026 Immunity","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"d110899d-d655-40d9-a0a0-18be4b140061","owner":[],"postedDate":"September 1st, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":53624690,"name":"Biological sciences/Genetics/Gene regulation"},{"id":53624691,"name":"Biological sciences/Genetics/Gene expression"}],"tags":[],"updatedAt":"2025-09-01T15:35:57+00:00","versionOfRecord":[],"versionCreatedAt":"2025-09-01 15:35:56","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7127377","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7127377","identity":"rs-7127377","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}