NOL10 is required for NUP98-DDX10 leukemia

NOL10 is required for NUP98-DDX10 leukemia | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article NOL10 is required for NUP98-DDX10 leukemia Issay Kitabayashi, Yutaka Shima, Kazutsune Yamagata, Kazuki Sasaki This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3896248/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 22 Apr, 2025 Read the published version in Leukemia → Version 1 posted 9 You are reading this latest preprint version Abstract NUP98 rearrangements associated with acute myeloid leukemia and myelodysplastic syndromes generate NUP98-fusion proteins. One such fusion protein, NUP98-DDX10, contains the putative RNA helicase DDX10. The molecular mechanism by which NUP98-DDX10 induces leukemia is not well understood. Here, we show that 24 amino acids within the DDX10 moiety of NUP98-DDX10 are crucial for cell immortalization and leukemogenesis. NOL10, nucleolar protein 10, interacts with the 24 amino acids, and NOL10 is a critical dependency of NUP98-DDX10 leukemia development. Studies in a mouse model of NUP98-DDX10 leukemia showed that loss of Nol10 impaired disease progression and improved survival. We also identified a novel function of NOL10 in that it acts cooperatively with NUP98-DDX10 to regulate serine biosynthesis pathways and stabilize ATF4 mRNA. Collectively, these findings suggest that NOL10 is a critical regulator of NUP98-DDX10 leukemia, and that targeting NOL10 (or the serine synthesis pathway regulated by NOL10) may be an effective therapeutic approach. Biological sciences/Cell biology Health sciences/Diseases/Haematological diseases/Haematological cancer/Leukaemia/Acute myeloid leukaemia Biological sciences/Cancer/Cancer metabolism Biological sciences/Cancer/Cancer therapy/Targeted therapies Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction NUP98, a component of the nuclear pore complex (NPC), plays an important role in molecular trafficking between the cytoplasm and the nucleus. NUP98 has two Phe-Gly (FG) repeat domains, which are characteristic of NPC proteins [ 1 ]. In acute myeloid leukemia and myelodysplastic syndromes, the NUP98 gene can be rearranged and fused to several partner genes, including HOXA9, NSD1, and DDX10 [ 2 – 4 ]. In all NUP98 fusion proteins reported to date, the NUP98 moiety comprises the N-terminus, with the C-terminal region comprising the fusion partner moiety [ 5 ]. NUP98 rearrangements are associated with a poor prognosis in leukemia. During developing of leukemia, the FG repeat domains in the NUP98 moiety of the NUP98 fusion protein are important for forming liquid-liquid phase separation (LLPS) structures in the nucleus [ 6 ] and for interactions with MLL1 [ 7 , 8 ]. NUP98 fusion partners such as HOXA9 and NSD1 act as transcription factors or transcriptional activators. These transcriptional regulators are also required to activate expression of genes encoding HOXA7 and HOXA9, which play a role in inducing leukemia [ 8 , 9 ]. In the context of leukemia, most of the partners of NUP98 are transcription factors or coactivators [ 5 ]. DDX10, a putative RNA helicase, can also be fused to NUP98; however, the molecular mechanism by which NUP98-DDX10 induces leukemia, particularly the role of the DDX10 moiety in leukemogenesis and cell immortalization, is poorly understood. Nucleolar protein 10 (NOL10) is a protein localized in the nucleolus. Studies suggest that NOL10 plays a role in biosynthesis of the 40S ribosomal subunit [ 10 ]. In addition, a recent study reported that NOL10 is essential for nucleolus formation [ 11 ]. However, the biological functions of NOL10, especially those related to disease, are not well understood. Here, we examined the role of the DDX10 moiety of NUP98-DDX10 in cell immortalization and leukemogenesis. We identified a short amino acid sequence within the DDX10 moiety that is important for these processes. NUP98-DDX10 interacted with NOL10 via the amino acid sequence. NUP98-DDX10 and NOL10 co-localized in NUP98-DDX10-generated LLPS structures and acted cooperatively to stabilize ATF4 mRNA and activate the serine synthesis pathway. Collectively, these data suggest that NOL10 is indispensable for induction of NUP98-DDX10 leukemia, and that NOL10 is a novel regulator of the serine biosynthesis pathway. Thus, targeting NOL10 (or the serine biosynthesis pathway it regulates) could be therapeutic option for NUP98-DDX10 leukemia. Materials/Subjects and Methods Mice C57BL6/J mice were used as transplant recipients. All mice were aged 6–16 weeks, and were bred and maintained in the animal care facilities at the National Cancer Center. All animal experiments were performed in accordance with protocols approved by the National Cancer Center Animal Ethics Committee. Cell culture KLS cells and mouse leukemia cells were cultured in StemPro-34 SFM medium (Gibco, Grand Island, NY, USA) supplemented with 10 ng/ml IL3, 50 ng/ml SCF, 10 ng/ml Oncostatin M, 2.5% nutrients, 0.1% tylosin, and 1% L-glutamine-penicillin-streptomycin. 293FT cells, U2OS cells and Plat-E cells were cultured as described previously [ 12 ]. Home-made medium without serine and glycine was comprised as shown in Table 1. Cell isolation Bone marrow cells were suspended in PBS. Red blood cells were lysed using RBC lysis buffer (eBioscience, Carlsbad, CA, USA) before staining. C-kit-positive cells were enriched by staining whole bone marrow with anti-CD117/c-kit microbeads and isolating positively-labeled cells on a MACS column (Miltenyi Biotec, Bergisch Gladbach, Germany). Antibodies specific for the following were used to identify c-kit-positive, Lineage-negative, and Sca-1-positive cells as KLS cells: CD3ε, Gr1, CD11b/Mac1, Ter119, and B220 (all for Lineage), CD117/c-kit, and Sca1. All antibodies were purchased from BD Pharmingen or eBioscience. Cell sorting and analysis were done on a JSAN cytometer, and the data were analyzed using FlowJo software. Murine NUP98-DDX10 leukemia cells were sorted from whole bone marrow using an anti-CD2 antibody (eBioscience). Retroviral constructs and production Deletion mutants of NUP98-DDX10 were generated by PCR and inserted into the MSCVneo plasmid. pMYs-ires-CD2 was generated from pMYs-ires-GFP. NUP98-DDX10 or NUP98-DDX10 ID, cut from the MSCVneo backbone plasmid, was inserted into pMYs-ires-CD2. shRNAs targeting Aatf , Ngdn , Nol10 , and Phgdh , as well as the shCtrl control, were designed and cloned into pMKO.1-GFP (a gift from William Hahn; Addgene plasmid # 10676) using the DNA oligomers as shown in Table 2. Plat-E cells were transfected with the viral constructs, and supernatants containing the retrovirus were collected 48 h later. shRNA specific for human NOL10 was designed and cloned into the pLV-hU6-EF1a-green backbone (Biosettia, San Diego, CA, USA) using the following DNA oligomer; AAAAGGTGTTCCTTCTTAGACAATTGGATCCAATTGTCTAAGAAGGAACACC, according to the manufacturer’s protocol. shCtrl was cloned using the following DNA oligomer; AAAAAAATCGCTGATTTGTGTAGTCTTGGATCCAAGACTACACAAATCAGCGATTT. Serial replating assay C-kit + cells were transduced with retroviruses using RetroNectin (Takara, Shiga, Japan), as described previously [ 8 ]. The cells were cultured and replated every 4 days in methylcellulose medium containing G418 (for the first and second rounds of selection). Colony numbers were counted for the second to fifth rounds. Transplantation KLS cells were retrovirally transduced with NUP98-DDX10-ires-CD2 or NUP98-DDX10 ID-ires-CD2. CD2-positive cells were sorted 48 h after infection. The sorted cells were transplanted into sub-lethally irradiated (6 Gy) C57BL/6 mice. Primary mouse NUP98-DDX10 leukemia cells were retrovirally infected with shCtrl or shNol10. GFP-positive and CD2-positive cells were sorted 24 h after infection. Sorted cells were transplanted into sub-lethally irradiated (6 Gy) C57BL/6 mice. LC/MS/MS 293FT cells were transfected with MSCV-FLAG-NUP98-DDX10, or MSCV-FLAG-NUP98-DDX10 ID, each in duplicate, and lysed as described previously [ 12 ]. Immunoprecipitates were trypsinized. Tryptic peptides were labeled with TMT isobaric mass tags (Thermo Fisher Scientific, Rockford, IL, USA) according to the manufacturer’s instructions. Peptides from NUP98-DDX10 transfectants were labeled with TMT-126 and − 129, and those from NUP98-DDX10 ID with TMT-127 and − 130, followed by tandem mass spectrometry identification. Tandem mass spectrometry (MS/MS) analysis was performed on an Orbitrap Fusion mass spectrometry (Thermo Fisher Scientific). To identify differentially binding proteins, we used the reporter ion signal intensity of peptide sequence. First, the reporter ion signal intensity value of each DDX10 peptide from each preparation was divided by the corresponding value from the TMT-126 preparation, followed by calculating the average of quotients. Then, intensity values of all the identified peptides were divided by the mean value calculated above to normalize sample-to-sample valuations. A protein was selected as the potential partner of NUP98-DDX10 which interacts with NUP98-DDX10 via the ID region if the average normalized value of peptide derived from the protein in two NUP98-DDX10 ID preparations was less than half of that in two NUP98-DDX10 preparation. Immunoprecipitation and Western blot analysis Immunoprecipitation and Western blot analysis were performed as described previously [ 12 ]. Anti-FLAG antibody (SIGMA, St. Louis, MO, USA), anti-HA antibody (Roche, Mannheim, Germany), anti-NGDN antibody (Proteintech, Rosemont, IL, USA), or anti-NOL10 (Bethyl, Montgomery, TX, USA) was used as the primary antibody. Immunofluorescence analysis Transfected U2OS cells were fixed in 4% formaldehyde/PBS, and incubated for 1 h in blocking buffer (10% FCS, 5% BSA, and 0.1% Triton X-100 in PBS). Cells were then incubated for 12 h at 4°C with an anti-FLAG antibody (SIGMA) and an anti-NOL10 antibody (Invitrogen, Rockford, IL, USA), followed by appropriate secondary antibodies. The slides were mounted using ProLong Gold antifade reagent containing DAPI (Invitrogen) and images were captured under a BZ-9000 microscope (KEYENCE, Osaka, Japan). RNA-seq analysis Primary mouse NUP98-DDX10 leukemia cells were retrovirally infected with shCtrl or shNol10, and GFP-positive and CD2-positive cells were sorted 48 h later. RNA was purified from the sorted cells using a RNeasy Plus Micro Kit (Qiagen, Hilden, Germany). Library preparation and sequencing was conducted by Azenta (Burlington, MA, USA). RNA-seq data were analyzed by DEseq2 using Galaxy. Metascape and STRING were used for network analysis of genes regulated by NOL10. RT-PCR Isolated RNA was reverse transcribed to cDNA using Superscript IV VILO (Invitrogen). Quantitative real-time PCR was performed using TaqMan Gene Expression Assays or FastStart Universal SYBR Green Master Mix (Roche), along with gene-specific primers (see Table 3). All real-time expression data were normalized to expression of Tbp or B2m. RIP assay Transfected 293FT cells were harvested and suspended in PBS. One volume of nuclear isolation buffer (40 mM Tris-HCl (pH 7.5), 1.28 M sucrose, 20 mM MgCl 2 , and 4% Triton X-100), and three volumes of water, were added to the cell suspension to make a nuclear extract. The extract was resuspended in RIP buffer (25 mM Tris-HCl (pH 7.5), 150 mM KCl, 5 mM EDTA, 0.5 mM DTT, 0.5% NP40, 100 U/ml SUPERase In RNase inhibitor (Invitrogen), and protease inhibitor cocktail (cOmplete, Roche)) and sheared using an S220 apparatus (Covaris, Woburn, MA, USA). The NUP98-DDX10 complex or NUP98-DDX10 ID complex was immunoprecipitated using anti-FLAG antibody. RNA was purified from the immunoprecipitates using Isogen (Nippon gene, Tokyo, Japan) and the RNA Clean & Concentrator-5 with DNase kit (Zymo Research, Irvine, CA, USA). Finally, purified RNA was reverse transcribed to cDNA as described above. Statistical analysis Statistical analyses were carried out using GraphPad Prism software version 9 (GraphPad Software Inc., Boston, MA, USA) or Microsoft Excel for Mac version 16 (Microsoft, Redmond, WA, USA). Data are shown as the mean ± SEM. Two-tailed unpaired Student’s t tests were used to statistical significance (*p < 0.05, **p < 0.01, ***p < 0.001). Results A 24 amino acid sequence in the DDX10 moiety of NUP98-DDX10 is important for immortalization To clarify the role of the DDX10 moiety of NUP98-DDX10 during leukemogenesis, we generated several deletion mutants of NUP98-DDX10 (Fig. 1 A). We then examined the ability of these mutant proteins to immortalize murine cells. To do this, we transduced mutant proteins into normal murine hematopoietic progenitor cells and subjected to a serial replating assay (Fig. 1 B). Whereas NUP98-DDX10 immortalized the cells (Fig. 1 C), the deletion mutants such as 1–698 and 1–1078, which retain the DEAD box that is important for RNA helicase activity, did not. By contrast, mutants 1–1102 and 1–1111 did immortalize the cells. Next, we generated an internal deletion mutant of NUP98-DDX10 (ID), which lacks amino acids 1079–1102. ID did not immortalize the cells (Fig. 1 C). Taken together, these results indicate that the 24 amino acid sequence in the C-terminal domain of NUP98-DDX10 is important for immortalization of the cells. The 24 amino acid sequence within the DDX10 moiety of NUP98-DDX10 is required for leukemogenesis The FG repeat sequence in the NUP98 moiety of NUP98-DDX10 is important for the LLPS structure, which is itself important for immortalization and triggering of leukemogenesis by the NUP98 fusion protein [ 6 , 8 ]. Therefore, we performed an immunofluorescence assay to check whether deleting 24 amino acids from NUP98-DDX10 disrupts the LLPS structure. Intact NUP98-DDX10 formed LLPS structures in the nucleus (Fig. 2 A). The ID mutant, which retains the FG repeat sequence, also formed LLPS structures (to the same extent as full-length NUP98-DDX10) (Fig. 2 A) despite the finding that ID did not immortalize murine progenitor cells (Fig. 1 C). These results indicate that the 24 amino acid deletion prevents immortalization, but does not disrupt formation of LLPS structures. Therefore, we next investigated the effect of NUP98-DDX10 and the ID mutant on leukemogenesis by performing an in vivo transplantation assay (Fig. 2 B). A previous study reported a murine leukemia model designed to examine the effects of NUP98-DDX10 [ 13 ]. The authors transduced NUP98-DDX10 into fetal liver cells harboring a KRAS mutation. Here, to exclude the effects of the KRAS mutation, we established a novel murine leukemia model in which only NUP98-DDX10 was transduced into KLS cells purified from bone marrow; these cells were transplanted into recipient mice irradiated sub-lethally. All recipient mice developed leukemia and died (Fig. 2 C, D); however, mice receiving cells harboring NUP98-DDX10 ID did not develop leukemia for at least 300 days post-transplantation, even though NUP98-DDX10 ID formed LLPS structures. These results indicate that the 24 amino acid region within the DDX10 moiety is important for leukemogenesis induced by NUP98-DDX10. NOL10 interacts with NUP98-DDX10 Next, we hypothesized that the 24 amino acid sequence within NUP98-DDX10 interacts with other proteins to regulate leukemogenesis. To identify the proteins that interact with NUP98-DDX10, we performed LC-MS/MS analysis. Those proteins whose expression levels were considered lower in NUP98-DDX10 ID transfectants than in the full-length transfectants were listed (Fig. 3 A and Table 4). Likewise, there were lower amounts of AATF, NGDN, and NOL10 in NUP98-DDX10 ID immunoprecipitates (Fig. 3 A). We excluded the proteins like NU188 from further analysis because only one or two peptides showed a decrease in the ID sample. These results suggest that AATF, NGDN, and NOL10 interact with NUP98-DDX10 via the 24 amino acid region. IP-Western blot analysis confirmed the interaction between NUP98-DDX10 and these proteins (Fig. 3 B). To investigate whether these proteins play a role in immortalization induced by NUP98-DDX10, we generated two different shRNAs targeting each gene. We found that the shRNAs suppressed expression all of these genes (Fig. 3 C, D). Knockdown of Aatf , Ngdn , or Nol10 inhibited colony formation by NUP98-DDX10-expressing leukemia cells (Fig. 3 E). Next, to examine the effect of the gene knockdown on normal hematopoietic cells, KLS cells were transduced with the shRNAs and then cultured in methylcellulose medium. Knockdown of Aatf or Ngdn inhibited colony formation by normal hematopoietic stem cells, as well as leukemia cells. Surprisingly, knockdown of Nol10 did not inhibit colony formation by normal hematopoietic cells (Fig. 3 F), but did inhibit colony formation by leukemia cells. Therefore, we focused on the role of NOL10 in NUP98-DDX10-induced leukemia. Knocking down NOL10 inhibits the serine synthesis pathway NOL10 is localized in the nucleolus, but its function is not well understood. Therefore, we first checked the localization of NOL10 in cells. An immunofluorescence assay revealed that NOL10 was indeed localized to the nucleolus (Fig. 4 A). Some of the NOL10 protein was recruited from the nucleolus to the LLPS structures in cells harboring NUP98-DDX10, but not to the LLPS structures in cells harboring NUP98-DDX10 ID (Fig. 4 A). To examine the impact of NOL10 on survival of mice transplanted with NUP98-DDX10 leukemia cells, the cells were transduced with control shRNA (shCtrl) or shNol10 and then transplanted into recipient mice. As shown in Fig. 4 B, all mice transplanted with control NUP98-DDX10 leukemia died within 51 days post-transplantation. By contrast, mice transplanted with NUP98-DDX10 leukemia cells, in which Nol10 expression was disrupted, survived for longer (Fig. 4 B). Thus, loss of Nol10 from established NUP98-DDX10 leukemia cells prolonged the survival of mice significantly, indicating that NOL10 is critical for continued growth of NUP98-DDX10 leukemia cells. To better understand the molecular basis underlying the effects of NOL10 loss on NUP98-DDX10 leukemia, we performed RNA-seq analysis using NUP98-DDX10 leukemia cells transduced with shCtrl or shNol10. Loss of Nol10 led to global changes in gene expression: 910 genes were downregulated by shNol10 #1, 380 genes were downregulated by shNol10 #2, and 255 genes were downregulated by both (Fig. 4 C). We then analyzed these data using several algorithms to better understand how NOL10 regulates growth of NUP98-DDX10 leukemia cells. For example, GO pathway analysis of common downregulated genes revealed enrichment of amino acid metabolic processes, tRNA aminoacylation of proteins, and ncRNA metabolic processes (Fig. 4 D). The top amino acid metabolic pathway in GO analysis contained 33 genes. In particular, Phgdh , Psat1 , Psph , and Shmt2 are related to the serine biosynthesis pathway. In addition, Atf4 (the transcription factor for all four of these genes) [ 14 – 16 ], was downregulated after Nol10 knockdown. STRING network analysis revealed that all five proteins were closely related (Fig. 4 E). To confirm the results of RNA-seq, we performed qPCR analysis. Atf4 , Phgdh , Psat1 , Psph , and Shmt2 were downregulated by shNol10 (Fig. 4 F). Taken together these results suggest that loss of Nol10 decreases expression of genes related to the serine biosynthesis pathway. The molecular mechanism by which NOL10 and NUP98-DDX10 regulate expression of ATF4 Because loss of NOL10 reduces expression of ATF4 (Fig. 4 F), we checked whether NUP98-DDX10 or NUP98-DDX10 ID increases expression of ATF4 and genes relate to the serine synthesis pathway. Compared with an empty vector or NUP98-DDX10 ID, NUP98-DDX10 increased expression of Atf4 and genes related to the serine biosynthesis pathway in murine hematopoietic progenitor cells (Fig. 5 A). These results indicate that NUP98-DDX10 and NOL10 act cooperatively to activate ATF4. Next, we tried to address the mechanism by which NOL10 and NUP98-DDX10 regulate ATF4 expression. First, we hypothesized that, like another NUP98 fusion protein (NUP98-HOXA9) [ 8 ], NUP98-DDX10 binds directly to the ATF4 gene locus to activate its transcription factor activity. Therefore, we performed ChIP-qPCR analysis to prove this; however, the ChIP-qPCR assay provided no evidence that NUP98-DDX10 or NOL10 binds to the ATF4 gene locus (data not shown). Next, we explored the possibility that NUP98-DDX10 binds to ATF4 mRNA to stabilize it together with NOL10; this is because DDX10 has a DEAD box domain specific for the RNA helicase, and NOL10 may regulate maturation of ribosomal RNA. The RIP assay showed that NUP98-DDX10 bound to ATF4 mRNA (Fig. 5 B). However, the interaction between NUP98-DDX10 ID and ATF4 mRNA was weaker than that between NUP98-DDX10 and ATF4 mRNA (Fig. 5 B). Knockdown of NOL10 decreased the interaction between NUP98-DDX10 and ATF4 mRNA (Fig. 5 C). Next, to examine whether the interaction stabilizes ATF4 mRNA, we treated cells with actinomycin D. ATF4 mRNA in NUP98-DDX10-expressing cells was more stable than that in cells transduced with empty vector or NUP98-DDX10 ID (Fig. 5 D). Furthermore, knockdown of NOL10 destabilized ATF4 mRNA in NUP98-DDX10-expressing cells (Fig. 5 E). These results indicate that NUP98-DDX10 and NOL10 act cooperatively to stabilize ATF4 mRNA to activate expression of ATF4, resulting in activation of the serine biosynthesis pathway. The serine synthesis pathway is important for NUP98-DDX10-induced leukemia To investigate whether the serine biosynthesis pathway is indispensable for NUP98-DDX10 leukemia cells, we generated shRNAs targeting Phgdh . PHGDH is the enzyme that catalyzes oxidation of 3-phosphogylcerate to 3-phosphohydroxypyruvate during the first step of serine synthesis (Fig. 6 A). Knockdown of Phgdh inhibited colony formation by NUP98-DDX10 leukemia cells (Fig. 6 B), suggesting that the serine biosynthesis pathway is indispensable in these cells. The serine biosynthesis pathway generates serine and glycine. Therefore, to investigate whether serine or/and glycine are required for growth of NUP98-DDX10 leukemia cells, we cultured them in a home-made liquid medium without serine and glycine. We also used a complete version of this medium, to which serine and glycine were added (referred to as complete medium). Glycine depletion inhibited the growth of NUP98-DDX10 leukemia cells (Fig. 6 C) slightly; however, serine depletion inhibited growth strongly (Fig. 6 C). We also asked whether the supplement of serine/glycine rescues colony formation inhibited by Nol10 knockdown. Although the addition did not affect the colony formation of NUP98-DDX10 leukemia cells transduced with shCtrl, it partially rescued the colony formation inhibited by Nol10 knockdown (Fig. 6 D). These results indicate that the serine synthesis pathway is important for NOL10-regulated growth of NUP98-DDX10 leukemia cells, and that inhibiting this pathway has potential as a treatment for NUP98-DDX10 leukemia. Discussion NOL10 is a novel factor that regulates development of leukemia NOL10 is required for nucleolus formation [ 11 ]; indeed, NOL10 localizes to the nucleolus, which is the site of ribosome biogenesis. Knockdown of NOL10 results in a defect of ribosomal RNA maturation [ 10 ]. Here, we show that NOL10 stabilizes ATF4 mRNA, thereby activating the serine synthesis pathway, making it indispensable for NUP98-DDX10-mediated induction of leukemia (Figs. 3 , 4 , and 5 ). We also show that NOL10 is recruited to the speckles formed by NUP98-DDX10 in the nucleus (Fig. 4 A). NOL10 in NUP98-DDX10 leukemia cells may stabilize mRNA since it exits the nucleolus. Taken together, these results suggest that NOL10 plays a role in regulating both rRNA and mRNA, and that stabilization of mRNA drives development of leukemia. NOL10 is recruited to the LLPS structures formed by NUP98-DDX10 Unlike most organelles such as the endoplasmic reticulum, LLPS structures are membrane-less [ 17 ]. This lack of membrane allows transfer of DNA, RNA, and proteins between LLPS structures. For example, the transcription factors OCT4 and GCN4 can form LLPS structures with Mediator to activate genes [ 18 ]. NUP98-HOXA9 is another NUP98-fusion protein that also forms an LLPS structure. The FG repeat domain within the NUP98 moiety of NUP98-HOXA9 plays a central role in LLPS formation [ 6 ]. Deletion of the FG repeat domain disrupts the LLPS and inactivates HOXA genes [ 6 , 8 ]. These data indicate that the LLPS structure is an important site of transcription. Therefore, we hypothesized that NUP98-DDX10 also regulates transcription of ATF4 . However, we could not demonstrate binding of NUP98-DDX10 and NOL10 to the ATF4 gene locus directly. Instead, we showed that NUP98-DDX10 and NOL10 stabilize ATF4 mRNA to increase expression of ATF4 . Several LLPS structures, including the nucleolus, the structure formed by NUP98-fusion proteins, and the PML body were observed in the nucleus. These results suggest that each LLPS structure has a different physiological role. As mentioned above, the nucleolus is the site of ribosome biogenesis. PML recruits several transcription factors and transcripitional co-activators to activate transcription [ 19 – 21 ]. Here, we showed that one of the functions of the LLPS structure formed by NUP98-DDX10 is to stabilize RNA. The LLPS structure formed by NUP98-DDX10 is not a nucleolus (Fig. 2 A). NOL10 is recruited to the LLPS structure formed by NUP98-DDX10 from the nucleolus (Fig. 4 A). However, the data suggest that NUP98-DDX10 is not localized, or recruited to, the nucleolus. NUP98-DDX10 ID also formed speckles in the nucleus (Figs. 2 A and 4 A), but NOL10 was not recruited to these speckles. These results indicate two things: first, that the 24 amino acids region of NUP98-DDX10 (required for the interaction with NOL10) is not necessary for formation of the LLPS structure; and second, NOL10 must be recruited to the LLPS structure formed by NUP98-DDX10 to stabilize ATF4 mRNA. Knocking down Nol10 inhibits the colony formation by NUP98-DDX10 leukemia cells, but not that by normal hematopoietic cells (Fig. 3 E, F), suggesting that NOL10 inhibition would be effective against NUP98-DDX10 leukemia specifically. The serine biosynthesis pathway is required for growth of NUP98-DDX10 leukemia cells Serine biosynthesis is dysregulated in cancers [ 15 ]. Increased production of serine by cells is one of the metabolic changes associated with carcinogenesis [ 22 , 23 ]. Copy number gain of the PHGDH gene is more common in triple-negative breast cancer than in other breast cancer subtypes. In addition, expression of PHGDH and PSAT1 proteins is elevated in metastatic variants of estrogen receptor-negative breast cancer cells [ 24 ]. PHGDH is also overexpressed in gliomas, with its expression level being associated with tumor grade and overall survival [ 25 ]. Here, we showed that NUP98-DDX10 activates expression of ATF4 and genes that regulate the serine biosynthesis pathway. The NUP98-DDX10 ID mutant, which does not interact with NOL10, did not activate these genes (Fig. 5 A). NOL10 knockdown also reduced expression of these genes in NUP98-DDX10 leukemia cells (Fig. 4 F). These results indicate that NUP98-DDX10 and NOL10 act cooperatively to activate expression of genes related to the serine biosynthesis pathway, and that serine biosynthesis in NUP98-DDX10 leukemia cells is dysregulated, as it is in other cancers. Furthermore, Phgdh knockdown reduced the number of colonies formed by NUP98-DDX10 leukemia cells (Fig. 6 B). Serine depletion also inhibited the cell growth (Fig. 6 C). Addition of serine and glycine partially rescued the effect of Nol10 knockdown (Fig. 6 D); other studies show that inhibition of PHGDH plus depletion of serine/glycine impedes tumor growth [ 26 ]. Serine is a non-essential amino acid, so combined treatment would be needed to inhibit tumor growth. However, in the case of NUP98-DDX10 leukemia, PHGDH inhibition or serine depletion may be sufficient. NUP98-DDX10 leukemia cells seems to be highly dependent on serine synthesis. Serine is required for synthesis of other amino acids such as glycine and cysteine, and for production of phospholipids. It is also required for the folate cycle via one carbon metabolism, resulting in generation of NADPH, NADH and ATP [ 15 , 27 – 29 ]. The finding that NUP98-DDX10 activates the expression of genes related to serine synthesis suggests that NUP98-DDX10 leukemia cells depend on the serine synthesis pathway to generate energy (Fig. 5 A). Therefore, further studies should examine cellular energy metabolism in NUP98-DDX10 leukemia cells. The data presented in the present study suggest that inhibiting the serine synthesis pathway would be a good therapeutic option for patients with NUP98-DDX10 leukemia, particularly if inhibiting the function of NOL10 proves too difficult. Declarations Acknowledgements This study was supported by Project for Promotion of Cancer Research and Therapeutic Evolution (P-PROMOTE) from AMED. Author contributions YS and IK conceived and designed the experiments. YS and KS performed the experiments. YS and KY performed the bioinformatic analysis. YS, KY, KS, and IK analyzed the data. YS, KS, and IK wrote the manuscript. All authors edited the manuscript. Competing interests All authors have nothing to disclose. Data Availability Statements The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request. References Strambio-De-Castillia C, Niepel M, Rout MP. The nuclear pore complex: bridging nuclear transport and gene regulation. Nat. Rev. Mol. Cell Biol. 2010;11:490–501. Nakamura T, Largaespada D, Lee M, Johnson L, Ohyashiki K, Toyama K, et al . Fusion of the nucleoporin gene NUP98 to HOXA9 by the chromosome translocation t(7;11)(p15;p15) in human myeloid leukaemia. Nat. Genet. 1996;12:154–8. Brown J, Jawad M, Twigg SRF, Saracoglu K, Sauerbrey A, Thomas AE, et al. A cryptic t(5;11)(q35;p15.5) in 2 children with acute myeloid leukemia with apparently normal karyotypes, identified by a multiplex fluorescence in situ hybridization telomere assay. Blood 2002;99:2526–31. Arai Y, Hosoda F, Kobayashi H, Arai K, Hayashi Y, Kamada N, et al . The inv(11)(p15q22) chromosome translocation of de novo and therapy- related myeloid malignancies results in fusion of the nucleoporin gene, NUP98, with the putative RNA helicase gene, DDX10. Blood 1997;89:3936–44. Gough SM, Slape CI, Aplan PD. NUP98 gene fusions and hematopoietic malignancies: Common themes and new biologic insights. Blood 2011;118:6247–57. Ahn JH, Davis ES, Daugird TA, Zhao S, Quiroga IY, Uryu H, et al. Phase separation drives aberrant chromatin looping and cancer development. Nature 2021;595:591–5. Xu H, Valerio DG, Eisold ME, Sinha A, Koche RP, Hu W, et al . NUP98 Fusion Proteins Interact with the NSL and MLL1 Complexes to Drive Leukemogenesis. Cancer Cell 2016;30:863–78. Shima Y, Yumoto M, Katsumoto T, Kitabayashi I. MLL is essential for NUP98-HOXA9-induced leukemia. Leukemia 2017;31:2200–10. Wang GG, Cai L, Pasillas MP, Kamps MP. NUP98-NSD1 links H3K36 methylation to Hox-A gene activation and leukaemogenesis. Nat. Cell Biol. 2007;9:804–12. Bammert L, Jonas S, Ungricht R, Kutay U. Human AATF/Che-1 forms a nucleolar protein complex with NGDN and NOL10 required for 40S ribosomal subunit synthesis. Nucleic Acids Res. 2016;44:9803–20. Jin X, Tanaka H, Jin M, Fujita K, Homma H, Inotsume M, et al . PQBP5/NOL10 maintains and anchors the nucleolus under physiological and osmotic stress conditions. Nat. Commun. 2023;14:1–5. Shima Y, Honma Y, Kitabayashi I. PML-RARα and its phosphorylation regulate PML oligomerization and HIPK2 stability. Cancer Res. 2013;73:4278–88. Schmoellerl J, Barbosa IAM, Eder T, Brandstoetter T, Schmidt L, Maurer B, et al . CDK6 is an essential direct target of NUP98 fusion proteins in acute myeloid leukemia. Blood 2020;136:387–400. DeNicola GM, Chen PH, Mullarky E, Sudderth JA, Hu Z, Wu D, et al . NRF2 regulates serine biosynthesis in non-small cell lung cancer. Nat. Genet. 2015;47:1475–81. Yang M, Vousden KH. Serine and one-carbon metabolism in cancer. Nat. Rev. Cancer 2016;16:650–62. Mattaini KR, Sullivan MR, Vander Heiden MG. The importance of serine metabolism in cancer. J. Cell Biol . 2016;214:249–57. Wang B, Zhang L, Dai T, Qin Z, Lu H, Zhang L, et al . Liquid–liquid phase separation in human health and diseases. Signal Transduct. Target. Ther. 2021;6:290. Boija A, Klein IA, Sabari BR, Dall'Agnese A, Coffey EL, Zamudio AV, et al . Transcription Factors Activate Genes through the Phase-Separation Capacity of Their Activation Domains. Cell 2018;175:1842-55. Jensen K, Shiels C, Freemont PS. PML protein isoforms and the RBCC/TRIM motif. Oncogene 2001;20:7223–33. Takahashi Y, Lallemand-Breitenbach V, Zhu J, de Thé H. PML nuclear bodies and apoptosis. Oncogene 2004;23: 2819–24. Nguyen LA, Pandolfi PP, Aikawa Y, Tagata Y, Ohki M, Kitabayashi I. Physical and functional link of the leukemia-associated factors AML1 and PML. Blood 2005;105:292–300. Davis JL, Fallon HJ, Morris HP. Two enzymes of serine metabolism in rat liver and hepatomas. Cancer Res. 1970;30:2917–20. Snell K. Enzymes of serine metabolism in normal, developing and neoplastic rat tissues. Adv. Enzyme Regul. 1984;22:325–400. Pollari S, Käkönen SM, Edgren H, Wolf M, Kohonen P, Sara H, et al . Enhanced serine production by bone metastatic breast cancer cells stimulates osteoclastogenesis. Breast Cancer Res. Treat. 2011;125:421–30. Liu J, Guo S, Li Q, Yang L, Xia Z, Zhang L, et al. Phosphoglycerate dehydrogenase induces glioma cells proliferation and invasion by stabilizing forkhead box M1. J. Neurooncol. 2013;111:245–55. Tajan M, Hennequart M, Cheung EC, Zani F, Hock AK, Legrave N, et al . Serine synthesis pathway inhibition cooperates with dietary serine and glycine limitation for cancer therapy. Nat. Commun. 2021;12:1–16. Allen RW, Moskowitz M. Arrest of cell growth in the G1 phase of the cell cycle by serine deprivation. Exp. Cell Res. 1978;116:127–37. Rowe PB, Sauer D, Fahey D, Craig G, McCairns E. One-carbon metabolism in lectin-activated human lymphocytes. Arch. Biochem. Biophys. 1985;236:277–88. Davis SR, Stacpoole PW, Williamson J, Kick LS, Quinlivan EP, Coats BS, et al . Tracer-derived total and folate-dependent homocysteine remethylation and synthesis rates in humans indicate that serine is the main one-carbon donor. Am. J. Physiol. - Endocrinol. Metab. 2004;286:272–9. Tables Tables 1 to 4 are available in the Supplementary Files section. Additional Declarations There is NO conflict of interest to disclose. Supplementary Files Table1.xlsx Table2.xlsx Table3.xlsx Table4.xlsx Cite Share Download PDF Status: Published Journal Publication published 22 Apr, 2025 Read the published version in Leukemia → Version 1 posted Editorial decision: revise 04 Mar, 2024 Review # 2 received at journal 01 Mar, 2024 Review # 1 received at journal 28 Feb, 2024 Reviewer # 2 agreed at journal 09 Feb, 2024 Reviewer # 1 agreed at journal 09 Feb, 2024 Reviewers invited by journal 05 Feb, 2024 Editor assigned by journal 25 Jan, 2024 Submission checks completed at journal 25 Jan, 2024 First submitted to journal 25 Jan, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3896248","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":271184504,"identity":"dd5bfeb9-a449-4f20-9997-39837bda4619","order_by":0,"name":"Issay Kitabayashi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3ElEQVRIiWNgGAWjYBACNh7GBgYgYuCHiYA4hLQ0NoBUScJUEtTCwANUA1JlcIBYh/HxHG5/8HOHXeLm280PPzD8smFgnk3AGjbexsbG3jPJidvuHDOWYOxLY2CcQ8A+Nn6gX3jbmBO33chhY2DsOczAOCOBsJbGv231iZtnEK0F6LBm3rbDiRskgFoYfhCjhedg42zZM8eNZ9xIM5ZIbEjjIegX+Z70Bx/f7qiW7Z+R/PDDhz82coaEQgwGHMHqEtsYeAxnEKeDwR5C/QHaK0GkllEwCkbBKBgxAAD/v0d4jD62yAAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0002-8409-0407","institution":"National Cancer Center Research Institute","correspondingAuthor":true,"prefix":"","firstName":"Issay","middleName":"","lastName":"Kitabayashi","suffix":""},{"id":271184505,"identity":"f027aec3-9952-4d26-ab5e-497a1d9f6962","order_by":1,"name":"Yutaka Shima","email":"","orcid":"","institution":"National Cancer Center Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Yutaka","middleName":"","lastName":"Shima","suffix":""},{"id":271184506,"identity":"c9266d57-f49d-4354-aa6b-6fd18acedf4b","order_by":2,"name":"Kazutsune Yamagata","email":"","orcid":"","institution":"National Cancer Center Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Kazutsune","middleName":"","lastName":"Yamagata","suffix":""},{"id":271184507,"identity":"29225cdb-efb8-48b0-bbfe-119bb95649c0","order_by":3,"name":"Kazuki Sasaki","email":"","orcid":"","institution":"Sasaki Institute","correspondingAuthor":false,"prefix":"","firstName":"Kazuki","middleName":"","lastName":"Sasaki","suffix":""}],"badges":[],"createdAt":"2024-01-25 06:40:22","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3896248/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3896248/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41375-025-02607-5","type":"published","date":"2025-04-22T04:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":50785885,"identity":"fa3b7c23-f3b9-4347-8093-6cb0c9d628ae","added_by":"auto","created_at":"2024-02-07 09:27:57","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":483079,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA 24 amino acid sequence within the C-terminal region of NUP98-DDX10 is required for immortalization of the cells.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e Diagram of NUP98-DDX10 and its mutant variants. The phenylalanine-glycine repeat domain (FG) and the DEAD box (DEAD) are indicated. \u003cstrong\u003eB\u003c/strong\u003e Schematic showing the strategy used to determine the effect of NUP98-DDX10 mutants on colony formation. \u003cstrong\u003eC\u003c/strong\u003e C-kit+ cells were infected with the desired vector and plated in methylcellulose medium. The colony numbers from the second to the fifth rounds are indicated. Error bars represent ± SEM from three independent experiments.\u003c/p\u003e","description":"","filename":"FigurePage1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3896248/v1/263020d1b0c72a3255b17d97.jpg"},{"id":50785882,"identity":"72ba05b8-cfa0-4b79-adc9-11e19226a1fe","added_by":"auto","created_at":"2024-02-07 09:27:57","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1593098,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe 24 amino acid sequence within the C-terminal region of NUP98-DDX10 is essential for development of leukemia.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e FLAG-tagged NUP98-DDX10 or FLAG-tagged NUP98-DDX10 ID was expressed in U2OS cells, and localization within the cells was detected by an anti-FLAG antibody. Scale bar represents 10 mm. \u003cstrong\u003eB\u003c/strong\u003e Schematic showing the strategy used to transplant transduced KLS cells into recipient mice. \u003cstrong\u003eC\u003c/strong\u003e Survival curves of mice transplanted with NUP98-DDX10-(n=10) or NUP98-DDX10 ID-(n=7) expressing cells (3,000 cells per recipient). ***p \u0026lt; 0.001, Student’s t test. \u003cstrong\u003eD\u003c/strong\u003e May-Grünwald Giemsa staining of whole bone marrow cells from recipient mice that developed NUP98-DDX10 leukemia (upper panel). Representative FACS plots showing the percentage of NUP98-DDX10 leukemia cells (PI-negative and CD2-positive cells) in the bone marrow of recipient mice transplanted with NUP98-DDX10-expressing KLS cells, and the percentage of Gr1- and Mac1-positive cells in the NUP98-DDX10 leukemia cell population (lower panel).\u003c/p\u003e","description":"","filename":"FigurePage2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3896248/v1/05146239273062e87e0f2498.jpg"},{"id":50785888,"identity":"c28be1dc-2437-4387-99e0-24d76be6493d","added_by":"auto","created_at":"2024-02-07 09:27:57","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":653762,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNOL10 interacts with NUP98-DDX10.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e Proteins whose expression levels were considered downregulated in NUP98-DDX10 ID samples. \u003cstrong\u003eB\u003c/strong\u003e293FT cells were transfected with MSCV-HA-AATF and MSCV (empty), MSCV-FLAG-NUP98-DDX10, or MSCF-FLAG-NUP98-DDX10 ID (left panel); or with MSCV (empty), MSCV-FLAG-NUP98-DDX10 or MSCF-FLAG-NUP98-DDX10 ID (right panel). Expression of AATF, NGDN, or NOL10 in the lysates of transfectants was detected by immunoblotting with anti-HA, anti-NGDN, or anti-NOL10 antibodies, respectively (Input). The lysates were also incubated with an anti-FLAG antibody. Immunoprecipitates were analyzed by immunoblotting with anti-HA, anti-NGDN, anti-NOL10, and anti-FLAG antibodies (IP). \u003cstrong\u003eC\u003c/strong\u003e Schematic showing the strategy used to determine the effect of gene knockdown on established NUP98-DDX10 leukemia cells and normal hematopoietic stem cells. \u003cstrong\u003eD\u003c/strong\u003eInhibition of \u003cem\u003eAatf\u003c/em\u003e, \u003cem\u003eNgdn\u003c/em\u003e, or \u003cem\u003eNol10\u003c/em\u003e expression in NUP98-DDX10 leukemia cells by shRNA. Data are normalized to shCtrl and are representative of three biological replicates. \u003cstrong\u003eE\u003c/strong\u003e Impact of shRNA-mediated knockdown of \u003cem\u003eAatf\u003c/em\u003e, \u003cem\u003eNgdn\u003c/em\u003e, or \u003cem\u003eNol10\u003c/em\u003e on the colony forming ability of NUP98-DDX10 leukemia cells. Error bars represent ± SEM. **p \u0026lt; 0.01, ***p \u0026lt; 0.001, Student’s t test. \u003cstrong\u003eF\u003c/strong\u003e Effect of shRNA-mediated knockdown of \u003cem\u003eAatf\u003c/em\u003e, \u003cem\u003eNgdn\u003c/em\u003e, or \u003cem\u003eNol10\u003c/em\u003e on the colony forming ability of normal hematopoietic stem cells. Error bars represent ± SEM. **p \u0026lt; 0.01, Student’s t test.\u003c/p\u003e","description":"","filename":"FigurePage3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3896248/v1/74380f8c246d92faea97dc8a.jpg"},{"id":50785890,"identity":"2f0c06b9-66bf-4282-9be3-78aa15f6027f","added_by":"auto","created_at":"2024-02-07 09:27:57","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":4922518,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNOL10 controls expression of genes related to serine biosynthesis in NUP98-DDX10 leukemia cells.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e Empty vector, FLAG-tagged NUP98-DDX10, or FLAG-tagged NUP98-DDX10 ID was expressed in U2OS cells, and localization of NOL10, NUP98-DDX10, and NUP98-DDX10 ID was detected by anti-NOL10 and anti-FLAG antibodies. Scale bar represents 10 mm. \u003cstrong\u003eB\u003c/strong\u003e Survival curves of mice transplanted with shCtrl- or shNol10-positive NUP98-DDX10 leukemia cells (3,000 cells per recipient). n=4 for shCtrl and n=4 for shNol10. **p \u0026lt; 0.01, Student’s t test. \u003cstrong\u003eC\u003c/strong\u003e Venn diagram showing genes downregulated by shNol10 #1 or shNol10 #2. Overall, 255 genes were downregulated by both shNol10 #1 and shNol10 #2. \u003cstrong\u003eD\u003c/strong\u003e Common downregulated genes were analyzed using Metascape. \u003cstrong\u003eE\u003c/strong\u003e Common downregulated genes were analyzed using STRING. \u003cstrong\u003eF\u003c/strong\u003e Effect of shRNA-mediated knockdown of Nol10 on expression of genes related to the serine synthesis pathway; data are representative of three biological replicates. Error bars represent ± SEM.\u003c/p\u003e","description":"","filename":"FigurePage4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3896248/v1/918954495d00f4506270776b.jpg"},{"id":50785889,"identity":"a83f4590-9a37-4fd4-b3f8-1d7fbd480351","added_by":"auto","created_at":"2024-02-07 09:27:57","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":519289,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNUP98-DDX10 and NOL10 stabilize ATF4 mRNA.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e Effect of NUP98-DDX10 on expression of genes related to serine synthesis; data are representative of three biological replicates. Error bars represent ± SEM. \u003cstrong\u003eB\u003c/strong\u003e \u003cem\u003eATF4\u003c/em\u003e mRNA interacts with NUP98-DDX10. \u003cem\u003eB2M\u003c/em\u003e mRNA was used as a control. \u003cstrong\u003eC\u003c/strong\u003e NOL10 was needed for the interaction between NUP98-DDX10 and \u003cem\u003eATF4\u003c/em\u003e mRNA. \u003cstrong\u003eD\u003c/strong\u003e Empty vector, FLAG-tagged NUP98-DDX10, or FLAG-tagged NUP98-DDX10 ID was expressed in 293FT cells. RNA was purified from cells treated with 5 mg/ml actinomycin D for 0, 3, or 6 h and the amount of \u003cem\u003eATF4\u003c/em\u003e mRNA was detected by qPCR. \u003cstrong\u003eE\u003c/strong\u003eFLAG-tagged NUP98-DDX10 was transduced into 293FT cells together with shCtrl or shNOL10. RNA was purified from the cells treated with 5 mg/ml actinomycin D for 0, 3, or 6 h and the amount of \u003cem\u003eATF4\u003c/em\u003e mRNA was detected by qPCR.\u003c/p\u003e","description":"","filename":"FigurePage5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3896248/v1/9c4c10001e4054897c6ff47c.jpg"},{"id":50785891,"identity":"8a004e8c-049d-484a-993a-d7aff0204a11","added_by":"auto","created_at":"2024-02-07 09:27:57","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":328901,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNUP98-DDX10 leukemia cells are dependent on the serine biosynthesis pathway.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e Schematic showing the serine synthesis pathway. \u003cstrong\u003eB\u003c/strong\u003e Effect of shRNA-mediated knockdown of \u003cem\u003ePhgdh\u003c/em\u003e(left panel) and the colony forming ability of NUP98-DDX10 leukemia cells (right panel). ***p \u0026lt; 0.001, Student’s t test. \u003cstrong\u003eC\u003c/strong\u003e Cells immortalized by NUP98-DDX10 were cultured in serine- and glycine-depleted medium, or in depleted medium re-supplemented with serine or/and glycine. Cell numbers were counted daily. \u003cstrong\u003eD\u003c/strong\u003e NUP98-DDX10 leukemia cells were cultured in methylcellulose medium supplemented with 5 mM serine or/and glycine. Error bars represent ± SEM. *p \u0026lt; 0.05, **p \u0026lt; 0.01, compared with each control, Student’s t test.\u003c/p\u003e","description":"","filename":"FigurePage6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-3896248/v1/8bc189b52afe23cda0a19953.jpg"},{"id":81179291,"identity":"c3603799-9ef4-4f1e-92ae-5074ee7af605","added_by":"auto","created_at":"2025-04-23 07:07:12","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":9465408,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3896248/v1/2b1d9ddf-f843-41b4-b14a-c1dd5cdf379c.pdf"},{"id":50785884,"identity":"e50f6474-3321-4ced-9ae7-77d369a6ac40","added_by":"auto","created_at":"2024-02-07 09:27:57","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":10684,"visible":true,"origin":"","legend":"","description":"","filename":"Table1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3896248/v1/101a42d20f24ea866358fbe8.xlsx"},{"id":50785883,"identity":"d365e713-617f-44ae-8b34-e81f9ca6123b","added_by":"auto","created_at":"2024-02-07 09:27:57","extension":"xlsx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":9441,"visible":true,"origin":"","legend":"","description":"","filename":"Table2.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3896248/v1/96fec0a774f2217ecb11d85e.xlsx"},{"id":50785886,"identity":"ce2a38b8-d5aa-4c3e-953e-96f35a1331d1","added_by":"auto","created_at":"2024-02-07 09:27:57","extension":"xlsx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":9841,"visible":true,"origin":"","legend":"","description":"","filename":"Table3.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3896248/v1/eb5018cb72c67e4ab903372e.xlsx"},{"id":50785892,"identity":"d5269c87-5430-4ac9-b9f2-42949769cc67","added_by":"auto","created_at":"2024-02-07 09:27:57","extension":"xlsx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":2187505,"visible":true,"origin":"","legend":"","description":"","filename":"Table4.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3896248/v1/622e6011aa490b1002e7b13e.xlsx"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e conflict of interest to disclose.","formattedTitle":"NOL10 is required for NUP98-DDX10 leukemia","fulltext":[{"header":"Introduction","content":"\u003cp\u003eNUP98, a component of the nuclear pore complex (NPC), plays an important role in molecular trafficking between the cytoplasm and the nucleus. NUP98 has two Phe-Gly (FG) repeat domains, which are characteristic of NPC proteins [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. In acute myeloid leukemia and myelodysplastic syndromes, the NUP98 gene can be rearranged and fused to several partner genes, including HOXA9, NSD1, and DDX10 [\u003cspan additionalcitationids=\"CR3\" citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. In all NUP98 fusion proteins reported to date, the NUP98 moiety comprises the N-terminus, with the C-terminal region comprising the fusion partner moiety [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. NUP98 rearrangements are associated with a poor prognosis in leukemia.\u003c/p\u003e \u003cp\u003eDuring developing of leukemia, the FG repeat domains in the NUP98 moiety of the NUP98 fusion protein are important for forming liquid-liquid phase separation (LLPS) structures in the nucleus [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e] and for interactions with MLL1 [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. NUP98 fusion partners such as HOXA9 and NSD1 act as transcription factors or transcriptional activators. These transcriptional regulators are also required to activate expression of genes encoding HOXA7 and HOXA9, which play a role in inducing leukemia [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. In the context of leukemia, most of the partners of NUP98 are transcription factors or coactivators [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. DDX10, a putative RNA helicase, can also be fused to NUP98; however, the molecular mechanism by which NUP98-DDX10 induces leukemia, particularly the role of the DDX10 moiety in leukemogenesis and cell immortalization, is poorly understood.\u003c/p\u003e \u003cp\u003eNucleolar protein 10 (NOL10) is a protein localized in the nucleolus. Studies suggest that NOL10 plays a role in biosynthesis of the 40S ribosomal subunit [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. In addition, a recent study reported that NOL10 is essential for nucleolus formation [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. However, the biological functions of NOL10, especially those related to disease, are not well understood.\u003c/p\u003e \u003cp\u003eHere, we examined the role of the DDX10 moiety of NUP98-DDX10 in cell immortalization and leukemogenesis. We identified a short amino acid sequence within the DDX10 moiety that is important for these processes. NUP98-DDX10 interacted with NOL10 via the amino acid sequence. NUP98-DDX10 and NOL10 co-localized in NUP98-DDX10-generated LLPS structures and acted cooperatively to stabilize \u003cem\u003eATF4\u003c/em\u003e mRNA and activate the serine synthesis pathway. Collectively, these data suggest that NOL10 is indispensable for induction of NUP98-DDX10 leukemia, and that NOL10 is a novel regulator of the serine biosynthesis pathway. Thus, targeting NOL10 (or the serine biosynthesis pathway it regulates) could be therapeutic option for NUP98-DDX10 leukemia.\u003c/p\u003e"},{"header":"Materials/Subjects and Methods","content":"\u003cp\u003eMice\u003c/p\u003e \u003cp\u003eC57BL6/J mice were used as transplant recipients. All mice were aged 6\u0026ndash;16 weeks, and were bred and maintained in the animal care facilities at the National Cancer Center. All animal experiments were performed in accordance with protocols approved by the National Cancer Center Animal Ethics Committee.\u003c/p\u003e \u003cp\u003eCell culture\u003c/p\u003e \u003cp\u003eKLS cells and mouse leukemia cells were cultured in StemPro-34 SFM medium (Gibco, Grand Island, NY, USA) supplemented with 10 ng/ml IL3, 50 ng/ml SCF, 10 ng/ml Oncostatin M, 2.5% nutrients, 0.1% tylosin, and 1% L-glutamine-penicillin-streptomycin. 293FT cells, U2OS cells and Plat-E cells were cultured as described previously [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Home-made medium without serine and glycine was comprised as shown in Table\u0026nbsp;1.\u003c/p\u003e \u003cp\u003eCell isolation\u003c/p\u003e \u003cp\u003eBone marrow cells were suspended in PBS. Red blood cells were lysed using RBC lysis buffer (eBioscience, Carlsbad, CA, USA) before staining. C-kit-positive cells were enriched by staining whole bone marrow with anti-CD117/c-kit microbeads and isolating positively-labeled cells on a MACS column (Miltenyi Biotec, Bergisch Gladbach, Germany). Antibodies specific for the following were used to identify c-kit-positive, Lineage-negative, and Sca-1-positive cells as KLS cells: CD3ε, Gr1, CD11b/Mac1, Ter119, and B220 (all for Lineage), CD117/c-kit, and Sca1. All antibodies were purchased from BD Pharmingen or eBioscience. Cell sorting and analysis were done on a JSAN cytometer, and the data were analyzed using FlowJo software. Murine NUP98-DDX10 leukemia cells were sorted from whole bone marrow using an anti-CD2 antibody (eBioscience).\u003c/p\u003e \u003cp\u003eRetroviral constructs and production\u003c/p\u003e \u003cp\u003eDeletion mutants of NUP98-DDX10 were generated by PCR and inserted into the MSCVneo plasmid. pMYs-ires-CD2 was generated from pMYs-ires-GFP. NUP98-DDX10 or NUP98-DDX10 ID, cut from the MSCVneo backbone plasmid, was inserted into pMYs-ires-CD2. shRNAs targeting \u003cem\u003eAatf\u003c/em\u003e, \u003cem\u003eNgdn\u003c/em\u003e, \u003cem\u003eNol10\u003c/em\u003e, and \u003cem\u003ePhgdh\u003c/em\u003e, as well as the shCtrl control, were designed and cloned into pMKO.1-GFP (a gift from William Hahn; Addgene plasmid # 10676) using the DNA oligomers as shown in Table\u0026nbsp;2. Plat-E cells were transfected with the viral constructs, and supernatants containing the retrovirus were collected 48 h later. shRNA specific for human \u003cem\u003eNOL10\u003c/em\u003e was designed and cloned into the pLV-hU6-EF1a-green backbone (Biosettia, San Diego, CA, USA) using the following DNA oligomer; AAAAGGTGTTCCTTCTTAGACAATTGGATCCAATTGTCTAAGAAGGAACACC, according to the manufacturer\u0026rsquo;s protocol. shCtrl was cloned using the following DNA oligomer; AAAAAAATCGCTGATTTGTGTAGTCTTGGATCCAAGACTACACAAATCAGCGATTT.\u003c/p\u003e \u003cp\u003eSerial replating assay\u003c/p\u003e \u003cp\u003eC-kit\u0026thinsp;+\u0026thinsp;cells were transduced with retroviruses using RetroNectin (Takara, Shiga, Japan), as described previously [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. The cells were cultured and replated every 4 days in methylcellulose medium containing G418 (for the first and second rounds of selection). Colony numbers were counted for the second to fifth rounds.\u003c/p\u003e \u003cp\u003eTransplantation\u003c/p\u003e \u003cp\u003eKLS cells were retrovirally transduced with NUP98-DDX10-ires-CD2 or NUP98-DDX10 ID-ires-CD2. CD2-positive cells were sorted 48 h after infection. The sorted cells were transplanted into sub-lethally irradiated (6 Gy) C57BL/6 mice. Primary mouse NUP98-DDX10 leukemia cells were retrovirally infected with shCtrl or shNol10. GFP-positive and CD2-positive cells were sorted 24 h after infection. Sorted cells were transplanted into sub-lethally irradiated (6 Gy) C57BL/6 mice.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eLC/MS/MS\u003c/h2\u003e \u003cp\u003e293FT cells were transfected with MSCV-FLAG-NUP98-DDX10, or MSCV-FLAG-NUP98-DDX10 ID, each in duplicate, and lysed as described previously [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Immunoprecipitates were trypsinized. Tryptic peptides were labeled with TMT isobaric mass tags (Thermo Fisher Scientific, Rockford, IL, USA) according to the manufacturer\u0026rsquo;s instructions. Peptides from NUP98-DDX10 transfectants were labeled with TMT-126 and \u0026minus;\u0026thinsp;129, and those from NUP98-DDX10 ID with TMT-127 and \u0026minus;\u0026thinsp;130, followed by tandem mass spectrometry identification. Tandem mass spectrometry (MS/MS) analysis was performed on an Orbitrap Fusion mass spectrometry (Thermo Fisher Scientific). To identify differentially binding proteins, we used the reporter ion signal intensity of peptide sequence. First, the reporter ion signal intensity value of each DDX10 peptide from each preparation was divided by the corresponding value from the TMT-126 preparation, followed by calculating the average of quotients. Then, intensity values of all the identified peptides were divided by the mean value calculated above to normalize sample-to-sample valuations. A protein was selected as the potential partner of NUP98-DDX10 which interacts with NUP98-DDX10 via the ID region if the average normalized value of peptide derived from the protein in two NUP98-DDX10 ID preparations was less than half of that in two NUP98-DDX10 preparation.\u003c/p\u003e \u003cp\u003eImmunoprecipitation and Western blot analysis\u003c/p\u003e \u003cp\u003eImmunoprecipitation and Western blot analysis were performed as described previously [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Anti-FLAG antibody (SIGMA, St. Louis, MO, USA), anti-HA antibody (Roche, Mannheim, Germany), anti-NGDN antibody (Proteintech, Rosemont, IL, USA), or anti-NOL10 (Bethyl, Montgomery, TX, USA) was used as the primary antibody.\u003c/p\u003e \u003cp\u003eImmunofluorescence analysis\u003c/p\u003e \u003cp\u003eTransfected U2OS cells were fixed in 4% formaldehyde/PBS, and incubated for 1 h in blocking buffer (10% FCS, 5% BSA, and 0.1% Triton X-100 in PBS). Cells were then incubated for 12 h at 4\u0026deg;C with an anti-FLAG antibody (SIGMA) and an anti-NOL10 antibody (Invitrogen, Rockford, IL, USA), followed by appropriate secondary antibodies. The slides were mounted using ProLong Gold antifade reagent containing DAPI (Invitrogen) and images were captured under a BZ-9000 microscope (KEYENCE, Osaka, Japan).\u003c/p\u003e \u003cp\u003eRNA-seq analysis\u003c/p\u003e \u003cp\u003ePrimary mouse NUP98-DDX10 leukemia cells were retrovirally infected with shCtrl or shNol10, and GFP-positive and CD2-positive cells were sorted 48 h later. RNA was purified from the sorted cells using a RNeasy Plus Micro Kit (Qiagen, Hilden, Germany). Library preparation and sequencing was conducted by Azenta (Burlington, MA, USA). RNA-seq data were analyzed by DEseq2 using Galaxy. Metascape and STRING were used for network analysis of genes regulated by NOL10.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eRT-PCR\u003c/h2\u003e \u003cp\u003eIsolated RNA was reverse transcribed to cDNA using Superscript IV VILO (Invitrogen). Quantitative real-time PCR was performed using TaqMan Gene Expression Assays or FastStart Universal SYBR Green Master Mix (Roche), along with gene-specific primers (see Table\u0026nbsp;3). All real-time expression data were normalized to expression of Tbp or B2m.\u003c/p\u003e \u003cp\u003eRIP assay\u003c/p\u003e \u003cp\u003eTransfected 293FT cells were harvested and suspended in PBS. One volume of nuclear isolation buffer (40 mM Tris-HCl (pH 7.5), 1.28 M sucrose, 20 mM MgCl\u003csub\u003e2\u003c/sub\u003e, and 4% Triton X-100), and three volumes of water, were added to the cell suspension to make a nuclear extract. The extract was resuspended in RIP buffer (25 mM Tris-HCl (pH 7.5), 150 mM KCl, 5 mM EDTA, 0.5 mM DTT, 0.5% NP40, 100 U/ml SUPERase In RNase inhibitor (Invitrogen), and protease inhibitor cocktail (cOmplete, Roche)) and sheared using an S220 apparatus (Covaris, Woburn, MA, USA). The NUP98-DDX10 complex or NUP98-DDX10 ID complex was immunoprecipitated using anti-FLAG antibody. RNA was purified from the immunoprecipitates using Isogen (Nippon gene, Tokyo, Japan) and the RNA Clean \u0026amp; Concentrator-5 with DNase kit (Zymo Research, Irvine, CA, USA). Finally, purified RNA was reverse transcribed to cDNA as described above.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eStatistical analyses were carried out using GraphPad Prism software version 9 (GraphPad Software Inc., Boston, MA, USA) or Microsoft Excel for Mac version 16 (Microsoft, Redmond, WA, USA). Data are shown as the mean \u0026plusmn; SEM. Two-tailed unpaired Student\u0026rsquo;s t tests were used to statistical significance (*p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, **p\u0026thinsp;\u0026lt;\u0026thinsp;0.01, ***p\u0026thinsp;\u0026lt;\u0026thinsp;0.001).\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eA 24 amino acid sequence in the DDX10 moiety of NUP98-DDX10 is important for immortalization\u003c/h2\u003e \u003cp\u003eTo clarify the role of the DDX10 moiety of NUP98-DDX10 during leukemogenesis, we generated several deletion mutants of NUP98-DDX10 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). We then examined the ability of these mutant proteins to immortalize murine cells. To do this, we transduced mutant proteins into normal murine hematopoietic progenitor cells and subjected to a serial replating assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Whereas NUP98-DDX10 immortalized the cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC), the deletion mutants such as 1\u0026ndash;698 and 1\u0026ndash;1078, which retain the DEAD box that is important for RNA helicase activity, did not. By contrast, mutants 1\u0026ndash;1102 and 1\u0026ndash;1111 did immortalize the cells. Next, we generated an internal deletion mutant of NUP98-DDX10 (ID), which lacks amino acids 1079\u0026ndash;1102. ID did not immortalize the cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Taken together, these results indicate that the 24 amino acid sequence in the C-terminal domain of NUP98-DDX10 is important for immortalization of the cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eThe 24 amino acid sequence within the DDX10 moiety of NUP98-DDX10 is required for leukemogenesis\u003c/h2\u003e \u003cp\u003eThe FG repeat sequence in the NUP98 moiety of NUP98-DDX10 is important for the LLPS structure, which is itself important for immortalization and triggering of leukemogenesis by the NUP98 fusion protein [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Therefore, we performed an immunofluorescence assay to check whether deleting 24 amino acids from NUP98-DDX10 disrupts the LLPS structure. Intact NUP98-DDX10 formed LLPS structures in the nucleus (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). The ID mutant, which retains the FG repeat sequence, also formed LLPS structures (to the same extent as full-length NUP98-DDX10) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA) despite the finding that ID did not immortalize murine progenitor cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). These results indicate that the 24 amino acid deletion prevents immortalization, but does not disrupt formation of LLPS structures. Therefore, we next investigated the effect of NUP98-DDX10 and the ID mutant on leukemogenesis by performing an \u003cem\u003ein vivo\u003c/em\u003e transplantation assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). A previous study reported a murine leukemia model designed to examine the effects of NUP98-DDX10 [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. The authors transduced NUP98-DDX10 into fetal liver cells harboring a KRAS mutation. Here, to exclude the effects of the KRAS mutation, we established a novel murine leukemia model in which only NUP98-DDX10 was transduced into KLS cells purified from bone marrow; these cells were transplanted into recipient mice irradiated sub-lethally. All recipient mice developed leukemia and died (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC, D); however, mice receiving cells harboring NUP98-DDX10 ID did not develop leukemia for at least 300 days post-transplantation, even though NUP98-DDX10 ID formed LLPS structures. These results indicate that the 24 amino acid region within the DDX10 moiety is important for leukemogenesis induced by NUP98-DDX10.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eNOL10 interacts with NUP98-DDX10\u003c/h2\u003e \u003cp\u003eNext, we hypothesized that the 24 amino acid sequence within NUP98-DDX10 interacts with other proteins to regulate leukemogenesis. To identify the proteins that interact with NUP98-DDX10, we performed LC-MS/MS analysis. Those proteins whose expression levels were considered lower in NUP98-DDX10 ID transfectants than in the full-length transfectants were listed (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and Table\u0026nbsp;4). Likewise, there were lower amounts of AATF, NGDN, and NOL10 in NUP98-DDX10 ID immunoprecipitates (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). We excluded the proteins like NU188 from further analysis because only one or two peptides showed a decrease in the ID sample. These results suggest that AATF, NGDN, and NOL10 interact with NUP98-DDX10 via the 24 amino acid region. IP-Western blot analysis confirmed the interaction between NUP98-DDX10 and these proteins (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). To investigate whether these proteins play a role in immortalization induced by NUP98-DDX10, we generated two different shRNAs targeting each gene. We found that the shRNAs suppressed expression all of these genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC, D). Knockdown of \u003cem\u003eAatf\u003c/em\u003e, \u003cem\u003eNgdn\u003c/em\u003e, or \u003cem\u003eNol10\u003c/em\u003e inhibited colony formation by NUP98-DDX10-expressing leukemia cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). Next, to examine the effect of the gene knockdown on normal hematopoietic cells, KLS cells were transduced with the shRNAs and then cultured in methylcellulose medium. Knockdown of \u003cem\u003eAatf\u003c/em\u003e or \u003cem\u003eNgdn\u003c/em\u003e inhibited colony formation by normal hematopoietic stem cells, as well as leukemia cells. Surprisingly, knockdown of \u003cem\u003eNol10\u003c/em\u003e did not inhibit colony formation by normal hematopoietic cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF), but did inhibit colony formation by leukemia cells. Therefore, we focused on the role of NOL10 in NUP98-DDX10-induced leukemia.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eKnocking down\u003c/b\u003e \u003cb\u003eNOL10\u003c/b\u003e \u003cb\u003einhibits the serine synthesis pathway\u003c/b\u003e\u003c/p\u003e \u003cp\u003eNOL10 is localized in the nucleolus, but its function is not well understood. Therefore, we first checked the localization of NOL10 in cells. An immunofluorescence assay revealed that NOL10 was indeed localized to the nucleolus (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Some of the NOL10 protein was recruited from the nucleolus to the LLPS structures in cells harboring NUP98-DDX10, but not to the LLPS structures in cells harboring NUP98-DDX10 ID (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). To examine the impact of NOL10 on survival of mice transplanted with NUP98-DDX10 leukemia cells, the cells were transduced with control shRNA (shCtrl) or shNol10 and then transplanted into recipient mice. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB, all mice transplanted with control NUP98-DDX10 leukemia died within 51 days post-transplantation. By contrast, mice transplanted with NUP98-DDX10 leukemia cells, in which Nol10 expression was disrupted, survived for longer (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Thus, loss of \u003cem\u003eNol10\u003c/em\u003e from established NUP98-DDX10 leukemia cells prolonged the survival of mice significantly, indicating that NOL10 is critical for continued growth of NUP98-DDX10 leukemia cells. To better understand the molecular basis underlying the effects of \u003cem\u003eNOL10\u003c/em\u003e loss on NUP98-DDX10 leukemia, we performed RNA-seq analysis using NUP98-DDX10 leukemia cells transduced with shCtrl or shNol10. Loss of \u003cem\u003eNol10\u003c/em\u003e led to global changes in gene expression: 910 genes were downregulated by shNol10 #1, 380 genes were downregulated by shNol10 #2, and 255 genes were downregulated by both (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). We then analyzed these data using several algorithms to better understand how NOL10 regulates growth of NUP98-DDX10 leukemia cells. For example, GO pathway analysis of common downregulated genes revealed enrichment of amino acid metabolic processes, tRNA aminoacylation of proteins, and ncRNA metabolic processes (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). The top amino acid metabolic pathway in GO analysis contained 33 genes. In particular, \u003cem\u003ePhgdh\u003c/em\u003e, \u003cem\u003ePsat1\u003c/em\u003e, \u003cem\u003ePsph\u003c/em\u003e, and \u003cem\u003eShmt2\u003c/em\u003e are related to the serine biosynthesis pathway. In addition, \u003cem\u003eAtf4\u003c/em\u003e (the transcription factor for all four of these genes) [\u003cspan additionalcitationids=\"CR15\" citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], was downregulated after \u003cem\u003eNol10\u003c/em\u003e knockdown. STRING network analysis revealed that all five proteins were closely related (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). To confirm the results of RNA-seq, we performed qPCR analysis. \u003cem\u003eAtf4\u003c/em\u003e, \u003cem\u003ePhgdh\u003c/em\u003e, \u003cem\u003ePsat1\u003c/em\u003e, \u003cem\u003ePsph\u003c/em\u003e, and \u003cem\u003eShmt2\u003c/em\u003e were downregulated by shNol10 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). Taken together these results suggest that loss of \u003cem\u003eNol10\u003c/em\u003e decreases expression of genes related to the serine biosynthesis pathway.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eThe molecular mechanism by which NOL10 and NUP98-DDX10 regulate expression of ATF4\u003c/h2\u003e \u003cp\u003eBecause loss of NOL10 reduces expression of ATF4 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF), we checked whether NUP98-DDX10 or NUP98-DDX10 ID increases expression of ATF4 and genes relate to the serine synthesis pathway. Compared with an empty vector or NUP98-DDX10 ID, NUP98-DDX10 increased expression of \u003cem\u003eAtf4\u003c/em\u003e and genes related to the serine biosynthesis pathway in murine hematopoietic progenitor cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). These results indicate that NUP98-DDX10 and NOL10 act cooperatively to activate ATF4. Next, we tried to address the mechanism by which NOL10 and NUP98-DDX10 regulate ATF4 expression. First, we hypothesized that, like another NUP98 fusion protein (NUP98-HOXA9) [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], NUP98-DDX10 binds directly to the \u003cem\u003eATF4\u003c/em\u003e gene locus to activate its transcription factor activity. Therefore, we performed ChIP-qPCR analysis to prove this; however, the ChIP-qPCR assay provided no evidence that NUP98-DDX10 or NOL10 binds to the \u003cem\u003eATF4\u003c/em\u003e gene locus (data not shown). Next, we explored the possibility that NUP98-DDX10 binds to \u003cem\u003eATF4\u003c/em\u003e mRNA to stabilize it together with NOL10; this is because DDX10 has a DEAD box domain specific for the RNA helicase, and NOL10 may regulate maturation of ribosomal RNA. The RIP assay showed that NUP98-DDX10 bound to \u003cem\u003eATF4\u003c/em\u003e mRNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). However, the interaction between NUP98-DDX10 ID and \u003cem\u003eATF4\u003c/em\u003e mRNA was weaker than that between NUP98-DDX10 and \u003cem\u003eATF4\u003c/em\u003e mRNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Knockdown of \u003cem\u003eNOL10\u003c/em\u003e decreased the interaction between NUP98-DDX10 and \u003cem\u003eATF4\u003c/em\u003e mRNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). Next, to examine whether the interaction stabilizes \u003cem\u003eATF4\u003c/em\u003e mRNA, we treated cells with actinomycin D. \u003cem\u003eATF4\u003c/em\u003e mRNA in NUP98-DDX10-expressing cells was more stable than that in cells transduced with empty vector or NUP98-DDX10 ID (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). Furthermore, knockdown of \u003cem\u003eNOL10\u003c/em\u003e destabilized \u003cem\u003eATF4\u003c/em\u003e mRNA in NUP98-DDX10-expressing cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). These results indicate that NUP98-DDX10 and NOL10 act cooperatively to stabilize \u003cem\u003eATF4\u003c/em\u003e mRNA to activate expression of ATF4, resulting in activation of the serine biosynthesis pathway.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eThe serine synthesis pathway is important for NUP98-DDX10-induced leukemia\u003c/h2\u003e \u003cp\u003eTo investigate whether the serine biosynthesis pathway is indispensable for NUP98-DDX10 leukemia cells, we generated shRNAs targeting \u003cem\u003ePhgdh\u003c/em\u003e. PHGDH is the enzyme that catalyzes oxidation of 3-phosphogylcerate to 3-phosphohydroxypyruvate during the first step of serine synthesis (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). Knockdown of \u003cem\u003ePhgdh\u003c/em\u003e inhibited colony formation by NUP98-DDX10 leukemia cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB), suggesting that the serine biosynthesis pathway is indispensable in these cells. The serine biosynthesis pathway generates serine and glycine. Therefore, to investigate whether serine or/and glycine are required for growth of NUP98-DDX10 leukemia cells, we cultured them in a home-made liquid medium without serine and glycine. We also used a complete version of this medium, to which serine and glycine were added (referred to as complete medium). Glycine depletion inhibited the growth of NUP98-DDX10 leukemia cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC) slightly; however, serine depletion inhibited growth strongly (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). We also asked whether the supplement of serine/glycine rescues colony formation inhibited by \u003cem\u003eNol10\u003c/em\u003e knockdown. Although the addition did not affect the colony formation of NUP98-DDX10 leukemia cells transduced with shCtrl, it partially rescued the colony formation inhibited by \u003cem\u003eNol10\u003c/em\u003e knockdown (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD). These results indicate that the serine synthesis pathway is important for NOL10-regulated growth of NUP98-DDX10 leukemia cells, and that inhibiting this pathway has potential as a treatment for NUP98-DDX10 leukemia.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eNOL10 is a novel factor that regulates development of leukemia\u003c/h2\u003e \u003cp\u003eNOL10 is required for nucleolus formation [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]; indeed, NOL10 localizes to the nucleolus, which is the site of ribosome biogenesis. Knockdown of \u003cem\u003eNOL10\u003c/em\u003e results in a defect of ribosomal RNA maturation [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Here, we show that NOL10 stabilizes \u003cem\u003eATF4\u003c/em\u003e mRNA, thereby activating the serine synthesis pathway, making it indispensable for NUP98-DDX10-mediated induction of leukemia (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, and \u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). We also show that NOL10 is recruited to the speckles formed by NUP98-DDX10 in the nucleus (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). NOL10 in NUP98-DDX10 leukemia cells may stabilize mRNA since it exits the nucleolus. Taken together, these results suggest that NOL10 plays a role in regulating both rRNA and mRNA, and that stabilization of mRNA drives development of leukemia.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eNOL10 is recruited to the LLPS structures formed by NUP98-DDX10\u003c/h2\u003e \u003cp\u003eUnlike most organelles such as the endoplasmic reticulum, LLPS structures are membrane-less [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. This lack of membrane allows transfer of DNA, RNA, and proteins between LLPS structures. For example, the transcription factors OCT4 and GCN4 can form LLPS structures with Mediator to activate genes [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. NUP98-HOXA9 is another NUP98-fusion protein that also forms an LLPS structure. The FG repeat domain within the NUP98 moiety of NUP98-HOXA9 plays a central role in LLPS formation [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Deletion of the FG repeat domain disrupts the LLPS and inactivates HOXA genes [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. These data indicate that the LLPS structure is an important site of transcription. Therefore, we hypothesized that NUP98-DDX10 also regulates transcription of \u003cem\u003eATF4\u003c/em\u003e. However, we could not demonstrate binding of NUP98-DDX10 and NOL10 to the \u003cem\u003eATF4\u003c/em\u003e gene locus directly. Instead, we showed that NUP98-DDX10 and NOL10 stabilize \u003cem\u003eATF4\u003c/em\u003e mRNA to increase expression of \u003cem\u003eATF4\u003c/em\u003e. Several LLPS structures, including the nucleolus, the structure formed by NUP98-fusion proteins, and the PML body were observed in the nucleus. These results suggest that each LLPS structure has a different physiological role. As mentioned above, the nucleolus is the site of ribosome biogenesis. PML recruits several transcription factors and transcripitional co-activators to activate transcription [\u003cspan additionalcitationids=\"CR20\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Here, we showed that one of the functions of the LLPS structure formed by NUP98-DDX10 is to stabilize RNA. The LLPS structure formed by NUP98-DDX10 is not a nucleolus (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). NOL10 is recruited to the LLPS structure formed by NUP98-DDX10 from the nucleolus (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). However, the data suggest that NUP98-DDX10 is not localized, or recruited to, the nucleolus. NUP98-DDX10 ID also formed speckles in the nucleus (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA), but NOL10 was not recruited to these speckles. These results indicate two things: first, that the 24 amino acids region of NUP98-DDX10 (required for the interaction with NOL10) is not necessary for formation of the LLPS structure; and second, NOL10 must be recruited to the LLPS structure formed by NUP98-DDX10 to stabilize \u003cem\u003eATF4\u003c/em\u003e mRNA. Knocking down \u003cem\u003eNol10\u003c/em\u003e inhibits the colony formation by NUP98-DDX10 leukemia cells, but not that by normal hematopoietic cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE, F), suggesting that NOL10 inhibition would be effective against NUP98-DDX10 leukemia specifically.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eThe serine biosynthesis pathway is required for growth of NUP98-DDX10 leukemia cells\u003c/h2\u003e \u003cp\u003eSerine biosynthesis is dysregulated in cancers [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Increased production of serine by cells is one of the metabolic changes associated with carcinogenesis [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Copy number gain of the \u003cem\u003ePHGDH\u003c/em\u003e gene is more common in triple-negative breast cancer than in other breast cancer subtypes. In addition, expression of PHGDH and PSAT1 proteins is elevated in metastatic variants of estrogen receptor-negative breast cancer cells [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. PHGDH is also overexpressed in gliomas, with its expression level being associated with tumor grade and overall survival [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Here, we showed that NUP98-DDX10 activates expression of ATF4 and genes that regulate the serine biosynthesis pathway. The NUP98-DDX10 ID mutant, which does not interact with NOL10, did not activate these genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). \u003cem\u003eNOL10\u003c/em\u003e knockdown also reduced expression of these genes in NUP98-DDX10 leukemia cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). These results indicate that NUP98-DDX10 and NOL10 act cooperatively to activate expression of genes related to the serine biosynthesis pathway, and that serine biosynthesis in NUP98-DDX10 leukemia cells is dysregulated, as it is in other cancers. Furthermore, \u003cem\u003ePhgdh\u003c/em\u003e knockdown reduced the number of colonies formed by NUP98-DDX10 leukemia cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). Serine depletion also inhibited the cell growth (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). Addition of serine and glycine partially rescued the effect of \u003cem\u003eNol10\u003c/em\u003e knockdown (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD); other studies show that inhibition of PHGDH plus depletion of serine/glycine impedes tumor growth [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Serine is a non-essential amino acid, so combined treatment would be needed to inhibit tumor growth. However, in the case of NUP98-DDX10 leukemia, PHGDH inhibition or serine depletion may be sufficient. NUP98-DDX10 leukemia cells seems to be highly dependent on serine synthesis. Serine is required for synthesis of other amino acids such as glycine and cysteine, and for production of phospholipids. It is also required for the folate cycle via one carbon metabolism, resulting in generation of NADPH, NADH and ATP [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan additionalcitationids=\"CR28\" citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. The finding that NUP98-DDX10 activates the expression of genes related to serine synthesis suggests that NUP98-DDX10 leukemia cells depend on the serine synthesis pathway to generate energy (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Therefore, further studies should examine cellular energy metabolism in NUP98-DDX10 leukemia cells. The data presented in the present study suggest that inhibiting the serine synthesis pathway would be a good therapeutic option for patients with NUP98-DDX10 leukemia, particularly if inhibiting the function of NOL10 proves too difficult.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by Project for Promotion of Cancer Research and Therapeutic Evolution (P-PROMOTE) from AMED.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYS and IK conceived and designed the experiments. YS and KS performed the experiments. YS and KY performed the bioinformatic analysis. YS, KY, KS, and IK analyzed the data. YS, KS, and IK wrote the manuscript. All authors edited the manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors have nothing to disclose.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eStrambio-De-Castillia C, Niepel M, Rout MP. The nuclear pore complex: bridging nuclear transport and gene regulation. Nat. Rev. Mol. Cell Biol. 2010;11:490\u0026ndash;501.\u003c/li\u003e\n\u003cli\u003eNakamura T, Largaespada D, Lee M, Johnson L, Ohyashiki K, Toyama K, et al\u003cem\u003e.\u003c/em\u003e Fusion of the nucleoporin gene NUP98 to HOXA9 by the chromosome translocation t(7;11)(p15;p15) in human myeloid leukaemia. Nat. Genet. 1996;12:154\u0026ndash;8.\u003c/li\u003e\n\u003cli\u003eBrown J, Jawad M, Twigg SRF, Saracoglu K, Sauerbrey A, Thomas AE, et al. A cryptic t(5;11)(q35;p15.5) in 2 children with acute myeloid leukemia with apparently normal karyotypes, identified by a multiplex fluorescence in situ hybridization telomere assay. Blood 2002;99:2526\u0026ndash;31.\u003c/li\u003e\n\u003cli\u003eArai Y, Hosoda F, Kobayashi H, Arai K, Hayashi Y, Kamada N, et al\u003cem\u003e.\u003c/em\u003e The inv(11)(p15q22) chromosome translocation of de novo and therapy- related myeloid malignancies results in fusion of the nucleoporin gene, NUP98, with the putative RNA helicase gene, DDX10. Blood 1997;89:3936\u0026ndash;44.\u003c/li\u003e\n\u003cli\u003eGough SM, Slape CI, Aplan PD. NUP98 gene fusions and hematopoietic malignancies: Common themes and new biologic insights. Blood 2011;118:6247\u0026ndash;57.\u003c/li\u003e\n\u003cli\u003eAhn JH, Davis ES, Daugird TA, Zhao S, Quiroga IY, Uryu H, et al. Phase separation drives aberrant chromatin looping and cancer development. Nature 2021;595:591\u0026ndash;5.\u003c/li\u003e\n\u003cli\u003eXu H, Valerio DG, Eisold ME, Sinha A, Koche RP, Hu W, et al\u003cem\u003e.\u003c/em\u003e NUP98 Fusion Proteins Interact with the NSL and MLL1 Complexes to Drive Leukemogenesis. Cancer Cell 2016;30:863\u0026ndash;78.\u003c/li\u003e\n\u003cli\u003eShima Y, Yumoto M, Katsumoto T, Kitabayashi I. MLL is essential for NUP98-HOXA9-induced leukemia. Leukemia 2017;31:2200\u0026ndash;10.\u003c/li\u003e\n\u003cli\u003eWang GG, Cai L, Pasillas MP, Kamps MP. NUP98-NSD1 links H3K36 methylation to Hox-A gene activation and leukaemogenesis. Nat. Cell Biol. 2007;9:804\u0026ndash;12.\u003c/li\u003e\n\u003cli\u003eBammert L, Jonas S, Ungricht R, Kutay U. Human AATF/Che-1 forms a nucleolar protein complex with NGDN and NOL10 required for 40S ribosomal subunit synthesis. Nucleic Acids Res. 2016;44:9803\u0026ndash;20.\u003c/li\u003e\n\u003cli\u003eJin X, Tanaka H, Jin M, Fujita K, Homma H, Inotsume M, et al\u003cem\u003e.\u003c/em\u003e PQBP5/NOL10 maintains and anchors the nucleolus under physiological and osmotic stress conditions. Nat. Commun. 2023;14:1\u0026ndash;5.\u003c/li\u003e\n\u003cli\u003eShima Y, Honma Y, Kitabayashi I. PML-RAR\u0026alpha; and its phosphorylation regulate PML oligomerization and HIPK2 stability. Cancer Res. 2013;73:4278\u0026ndash;88.\u003c/li\u003e\n\u003cli\u003eSchmoellerl J, Barbosa IAM, Eder T, Brandstoetter T, Schmidt L, Maurer B, et al\u003cem\u003e.\u003c/em\u003e CDK6 is an essential direct target of NUP98 fusion proteins in acute myeloid leukemia. Blood 2020;136:387\u0026ndash;400.\u003c/li\u003e\n\u003cli\u003eDeNicola GM, Chen PH, Mullarky E, Sudderth JA, Hu Z, Wu D, et al\u003cem\u003e.\u003c/em\u003e NRF2 regulates serine biosynthesis in non-small cell lung cancer. Nat. Genet. 2015;47:1475\u0026ndash;81.\u003c/li\u003e\n\u003cli\u003eYang M, Vousden KH. Serine and one-carbon metabolism in cancer. Nat. Rev. Cancer 2016;16:650\u0026ndash;62.\u003c/li\u003e\n\u003cli\u003eMattaini KR, Sullivan MR, Vander Heiden MG. The importance of serine metabolism in cancer. J. Cell Biol\u003cem\u003e.\u003c/em\u003e 2016;214:249\u0026ndash;57.\u003c/li\u003e\n\u003cli\u003eWang B, Zhang L, Dai T, Qin Z, Lu H, Zhang L, et al\u003cem\u003e.\u003c/em\u003e Liquid\u0026ndash;liquid phase separation in human health and diseases. Signal Transduct. Target. Ther. 2021;6:290.\u003c/li\u003e\n\u003cli\u003eBoija A, Klein IA, Sabari BR, Dall\u0026apos;Agnese A, Coffey EL, Zamudio AV, et al\u003cem\u003e.\u003c/em\u003e Transcription Factors Activate Genes through the Phase-Separation Capacity of Their Activation Domains. Cell 2018;175:1842-55.\u003c/li\u003e\n\u003cli\u003eJensen K, Shiels C, Freemont PS. PML protein isoforms and the RBCC/TRIM motif. Oncogene 2001;20:7223\u0026ndash;33.\u003c/li\u003e\n\u003cli\u003eTakahashi Y, Lallemand-Breitenbach V, Zhu J, de Th\u0026eacute; H. PML nuclear bodies and apoptosis. Oncogene 2004;23: 2819\u0026ndash;24.\u003c/li\u003e\n\u003cli\u003eNguyen LA, Pandolfi PP, Aikawa Y, Tagata Y, Ohki M, Kitabayashi I. Physical and functional link of the leukemia-associated factors AML1 and PML. Blood 2005;105:292\u0026ndash;300.\u003c/li\u003e\n\u003cli\u003eDavis JL, Fallon HJ, Morris HP. Two enzymes of serine metabolism in rat liver and hepatomas. Cancer Res. 1970;30:2917\u0026ndash;20.\u003c/li\u003e\n\u003cli\u003eSnell K. Enzymes of serine metabolism in normal, developing and neoplastic rat tissues. Adv. Enzyme Regul. 1984;22:325\u0026ndash;400.\u003c/li\u003e\n\u003cli\u003ePollari S, K\u0026auml;k\u0026ouml;nen SM, Edgren H, Wolf M, Kohonen P, Sara H, et al\u003cem\u003e.\u003c/em\u003e Enhanced serine production by bone metastatic breast cancer cells stimulates osteoclastogenesis. Breast Cancer Res. Treat. 2011;125:421\u0026ndash;30.\u003c/li\u003e\n\u003cli\u003eLiu J, Guo S, Li Q, Yang L, Xia Z, Zhang L, et al. Phosphoglycerate dehydrogenase induces glioma cells proliferation and invasion by stabilizing forkhead box M1. J. Neurooncol. 2013;111:245\u0026ndash;55.\u003c/li\u003e\n\u003cli\u003eTajan M, Hennequart M, Cheung EC, Zani F, Hock AK, Legrave N, et al\u003cem\u003e.\u003c/em\u003e Serine synthesis pathway inhibition cooperates with dietary serine and glycine limitation for cancer therapy. Nat. Commun. 2021;12:1\u0026ndash;16.\u003c/li\u003e\n\u003cli\u003eAllen RW, Moskowitz M. Arrest of cell growth in the G1 phase of the cell cycle by serine deprivation. Exp. Cell Res. 1978;116:127\u0026ndash;37.\u003c/li\u003e\n\u003cli\u003eRowe PB, Sauer D, Fahey D, Craig G, McCairns E. One-carbon metabolism in lectin-activated human lymphocytes. Arch. Biochem. Biophys. 1985;236:277\u0026ndash;88.\u003c/li\u003e\n\u003cli\u003eDavis SR, Stacpoole PW, Williamson J, Kick LS, Quinlivan EP, Coats BS, et al\u003cem\u003e.\u003c/em\u003e Tracer-derived total and folate-dependent homocysteine remethylation and synthesis rates in humans indicate that serine is the main one-carbon donor. Am. J. Physiol. - Endocrinol. Metab. 2004;286:272\u0026ndash;9.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTables 1 to 4 are available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"leukemia","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"leu","sideBox":"Learn more about [Leukemia](http://www.nature.com/leu/)","snPcode":"41375","submissionUrl":"https://mts-leu.nature.com/cgi-bin/main.plex","title":"Leukemia","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-3896248/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3896248/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eNUP98 rearrangements associated with acute myeloid leukemia and myelodysplastic syndromes generate NUP98-fusion proteins. One such fusion protein, NUP98-DDX10, contains the putative RNA helicase DDX10. The molecular mechanism by which NUP98-DDX10 induces leukemia is not well understood. Here, we show that 24 amino acids within the DDX10 moiety of NUP98-DDX10 are crucial for cell immortalization and leukemogenesis. NOL10, nucleolar protein 10, interacts with the 24 amino acids, and NOL10 is a critical dependency of NUP98-DDX10 leukemia development. Studies in a mouse model of NUP98-DDX10 leukemia showed that loss of \u003cem\u003eNol10\u003c/em\u003eimpaired disease progression and improved survival. We also identified a novel function of NOL10 in that it acts cooperatively with NUP98-DDX10 to regulate serine biosynthesis pathways and stabilize \u003cem\u003eATF4\u003c/em\u003e mRNA. Collectively, these findings suggest that NOL10 is a critical regulator of NUP98-DDX10 leukemia, and that targeting NOL10 (or the serine synthesis pathway regulated by NOL10) may be an effective therapeutic approach.\u003c/p\u003e","manuscriptTitle":"NOL10 is required for NUP98-DDX10 leukemia","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-02-07 09:27:52","doi":"10.21203/rs.3.rs-3896248/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2024-03-04T14:38:43+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2024-03-01T11:50:41+00:00","index":2,"fulltext":"This content is not available."},{"type":"editorInvitedReview","content":"This content is not available.","date":"2024-02-28T20:35:25+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2024-02-09T16:17:23+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2024-02-09T13:32:52+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2024-02-05T17:01:58+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-01-25T11:22:54+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-01-25T11:22:19+00:00","index":"","fulltext":""},{"type":"submitted","content":"Leukemia","date":"2024-01-25T06:37:51+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"leukemia","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"leu","sideBox":"Learn more about [Leukemia](http://www.nature.com/leu/)","snPcode":"41375","submissionUrl":"https://mts-leu.nature.com/cgi-bin/main.plex","title":"Leukemia","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"a6dfee5c-a908-417b-a138-5d9fa5557c57","owner":[],"postedDate":"February 7th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":28583648,"name":"Biological sciences/Cell biology"},{"id":28583649,"name":"Health sciences/Diseases/Haematological diseases/Haematological cancer/Leukaemia/Acute myeloid leukaemia"},{"id":28583650,"name":"Biological sciences/Cancer/Cancer metabolism"},{"id":28583651,"name":"Biological sciences/Cancer/Cancer therapy/Targeted therapies"}],"tags":[],"updatedAt":"2025-04-23T07:07:05+00:00","versionOfRecord":{"articleIdentity":"rs-3896248","link":"https://doi.org/10.1038/s41375-025-02607-5","journal":{"identity":"leukemia","isVorOnly":false,"title":"Leukemia"},"publishedOn":"2025-04-22 04:00:00","publishedOnDateReadable":"April 22nd, 2025"},"versionCreatedAt":"2024-02-07 09:27:52","video":"","vorDoi":"10.1038/s41375-025-02607-5","vorDoiUrl":"https://doi.org/10.1038/s41375-025-02607-5","workflowStages":[]},"version":"v1","identity":"rs-3896248","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3896248","identity":"rs-3896248","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}