Cfap300 regulates the transdifferentiation of Corpuscle of Stannius cells in zebrafish

preprint OA: closed
📄 Open PDF Full text JSON View at publisher
AI-generated deep summary by claude@2026-06, 2026-06-24 · read from full text

The paper investigates how cfap300, a DNAAF gene implicated in primary ciliary dyskinesia, controls formation of the zebrafish Corpuscle of Stannius (CS) gland, which normally arises by transdifferentiation of distal pronephric epithelial cells. Using TALEN-generated cfap300 mutant zebrafish, the authors report normal development and nephron segmentation but impaired CS gland development due to defective transdifferentiation, partially rescued by cfap300 mRNA injection; they further show that cfap300 mutants have increased cdh17 driven by upregulated hnf1ba, and that knocking down hnf1ba or cdh17 restores CS formation. A key limitation is that the study focuses on zebrafish endocrine organogenesis and does not establish whether the same pathway operates in human disease contexts beyond genetic association with PCD. This paper does not explicitly discuss endometriosis or adenomyosis; it was included in the corpus via a keyword match in the upstream search index.

Read from the paper's body, not the abstract. Not a substitute for reading the paper. No clinical advice. How this works

Full text 68,983 characters · extracted from preprint-html · click to expand
Cfap300 regulates the transdifferentiation of Corpuscle of Stannius cells in zebrafish | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Cfap300 regulates the transdifferentiation of Corpuscle of Stannius cells in zebrafish View ORCID Profile Usharani Nayak , View ORCID Profile Kalyani Sahoo , View ORCID Profile Praveen Barrodia , View ORCID Profile Rajeeb K. Swain doi: https://doi.org/10.1101/2025.10.06.680176 Usharani Nayak 1 Institute of Life Sciences , NALCO Square, Chandrasekharpur, Bhubaneswar, India 2 Regional Centre for Biotechnology , Faridabad, India Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Usharani Nayak Kalyani Sahoo 1 Institute of Life Sciences , NALCO Square, Chandrasekharpur, Bhubaneswar, India 2 Regional Centre for Biotechnology , Faridabad, India Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Kalyani Sahoo Praveen Barrodia 1 Institute of Life Sciences , NALCO Square, Chandrasekharpur, Bhubaneswar, India Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Praveen Barrodia Rajeeb K. Swain 1 Institute of Life Sciences , NALCO Square, Chandrasekharpur, Bhubaneswar, India 2 Regional Centre for Biotechnology , Faridabad, India Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Rajeeb K. Swain For correspondence: rkswain{at}ils.res.in Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract Stanniocalcin 1 (Stc1) is a hormone secreted by the Corpuscle of Stannius (CS) gland in teleost fish, including zebrafish, where it regulates calcium homeostasis. The CS gland forms by transdifferentiation of pronephric tubule epithelial cells at the distal early (DE) and distal late (DL) boundary. Although transdifferentiation is known in development and disease, the underlying mechanisms remain unclear. Here, we show that cfap300 , a DNAAF implicated in primary ciliary dyskinesia (PCD), is essential for CS gland formation. TALEN-generated cfap300 mutants develop normally and show no nephron segmentation defects, but exhibit impaired CS development, which could be partially rescued by cfap300 mRNA injection. Further, cfap300 mutants display increased expression of cdh17 driven by Hnf1ba, which blocks CS precursor transdifferentiation. Knockdown of cdh17 or hnf1ba restores CS formation. These results uncover a Cfap300–Hnf1ba–Cdh17 pathway that regulates epithelial-to-endocrine transdifferentiation, revealing a novel, lineage-specific role for a DNAAF protein in endocrine organogenesis. Introduction Primary non-motile cilia are present on most mammalian cells and serve as sensory organelles, whereas the motile cilia are expressed in multiple organs where they function to move fluids and particles ( 1 ). Dynein arm assembly factors (DNAAF) are cytoplasmic proteins that are essential for the assembly and transport of dynein motor complexes, crucial for the movement of cilia ( 2 ). Mutations in DNAAF genes lead to primary ciliary dyskinesia (PCD), a group of rare genetic diseases with a diverse phenotype ( 3 , 4 ). Zebrafish mutants of human DNAAF homologs have been shown to faithfully recapitulate the PCD phenotypes associated with human mutations, thus serving as genetic animal models of this group of diseases ( 5 – 7 ). Cilia and flagella-associated protein 300 (CFAP300, also known as DNAAF17) localises to the cytoplasm and cilia-associated compartment of motile ciliated cells ( 8 ). Biallelic loss-of-function mutations of CFAP300 have been linked to primary ciliary dyskinesia (PCD) in various populations, marked by situs inversus, respiratory cilia immotility, and loss of both the inner and outer dynein arms (IDA + ODA) ( 4 , 8 – 10 ). The organs containing motile cilia in zebrafish include, inter alia, the Kupffer’s vesicle, pronephros, olfactory organs and spinal central canal ( 11 ). Zebrafish pronephros consists of glomerulus, neck, proximal convoluted tubule (PCT), proximal straight tubule (PST), distal early (DE), distal late (DL) and pronephric duct (PD). The proximal segments are homologous to the PCT and PST in mammals, while the distal segments are homologous to the mammalian thick ascending limb (TAL) and distal convoluted tubule (DCT), respectively ( 12 ). The zebrafish pronephros is lined by both mono and multi-ciliated cells, which beat in a coordinated manner to generate fluid flow through the pronephric ducts. This ciliary-driven flow is essential for waste excretion, the prevention of fluid build-up. A pronephric cilia defect often leads to a pronephric cyst in zebrafish ( 5 , 6 ). The zebrafish pronephros also possesses the site of origin of an endocrine gland called the Corpuscle of Stannius (CS), which is unique to the teleost class and maintains calcium homeostasis through the secretion of stc1 hormone ( 13 ). CS gland-forming cells originate by transdifferentiation of the pronephric epithelium present between DE and DL segments and gradually extrude out to form a paired, independent gland ( 14 ). Transdifferentiation refers to the process by which a fully differentiated, mature somatic cell transforms into a different cell type. This process can occur through a direct conversion from one cell type to another or might involve a stage of dedifferentiation before the final cell fate is achieved ( 15 ). In zebrafish, several transcription factors (e.g. Hnf1b, Irx2a/3b, Tbx2a/b, Sim1a) and signalling pathways (e.g. Notch, RA and Fgf) are known to control CS gland development ( 12 , 14 , 16 – 19 ). Their specific functions during transdifferentiation and extrusion, however, remain to be elucidated. In this study, we report that zebrafish cfap300 is expressed in the pronephros and multiple other organs that possess motile cilia. We have studied the function of cfap300 by creating a mutant zebrafish using TALEN. These mutants show no obvious morphological abnormalities, grow like wild type (WT) and are fertile. They show normal nephron segmentation compared to WT, but the CS gland development is impaired in these mutants. We show that impaired CS gland formation is due to the lack of transdifferentiation of distal pronephric epithelia to CS gland-forming cells. cfap300 mRNA injection in cfap300 mutants restored CS development, confirming its role in CS gland development. As cell adhesion plays an important role in differentiation, the level of cadherins expressed in the pronephros was checked in WT and cfap300 mutants, and it was found that cdh17 is overexpressed in these mutants compared to WT. We further show that hnf1ba is significantly up-regulated in these mutants and could drive the expression of cdh17 . Knockdown of hnf1ba or cdh17 rescued the transdifferentiation and CS gland formation defect in cfap300 mutants. These data suggest that cfap300 , a gene implicated in PCD, regulates transdifferentiation of CS cells from pronephric epithelium through hnf1ba and cdh17 , thus unveiling a novel role for a DNAAF family member. Results cfap300 is expressed in the pronephros and motile cilia-bearing tissues during zebrafish embryogenesis The CFAP300 is highly conserved among vertebrates and its orthologs are present in most species containing motile cilia, including invertebrates ( 8 , 20 ). Whole-mount in situ hybridization (WISH) was carried out to determine the expression of cfap300 mRNA during zebrafish embryogenesis. The expression of cfap300 was not detected from the 2-cell to the 6 hpf stage ( Figure 1a-d ). Expression of cfap300 was observed in the Kupffer’s vesicle at 10 hpf, a transient organ containing ciliated cells that is essential for determining left-right asymmetry ( Figure 1e ). cfap300 is expressed in the notochord (NC) and intermediate mesoderm (IM) at 14 hpf ( Figure 1f ). Its expression in pronephros (P), olfactory placodes (OP), notochord and tail bud (TB) was detected at 22 hpf ( Figure 1g ). In 24 hpf embryos, cfap300 is expressed in the pronephros, olfactory placodes, notochord, epiphysis (E), tegmentum (T), floor plate (FP) and tail bud ( Figure 1h ). cfap300 is not expressed in the glomerulus, but its expression starts at the neck segments of the pronephros. Strong expression of cfap300 can be seen in the whole pronephric tubule and duct ( Figure 1i ). Histological analysis confirmed its expression in the pronephros ( Figure 1j ). The expression of cfap300 in the above tissues remained up to 48 hpf ( Figure 1k-m ). Two-colour WISH of cfap300 along with pdzk1 confirmed its expression in the proximal and distal early parts of the tubule and slc12a3 confirmed its expression in the distal late segment ( Figure 1n-o ). The expression pattern of cfap300 is in agreement with its proposed role in cilia biogenesis and function because organs like Kupffer’s vesicle, pronephros, olfactory placode, tegmentum and epiphysis contain motile cilia ( 11 , 21 ). Its expression in the entire pronephros tubule and duct, and not just the motile cilia-containing region, suggests that it may regulate tissue-specific developmental programs in the kidney in addition to its proposed role in cilia. Download figure Open in new tab Figure 1: cfap300 is expressed in the pronephros and other motile cilia-bearing tissues during zebrafish development. WISH data show that cfap300 is not expressed until 10 hpf (a-d) . cfap300 is expressed in Kupffer’s vesicle (KV) at 10 hpf (e) and in notochord (NC) and intermediate mesoderm (IM) at 14 hpf ( f) . It is expressed in the pronephros (P) and the olfactory placodes (OP) at 22 hpf (g) ; in epiphysis (E), tegmentum (T), floor plate (FP) and tail bud (TB) in addition to NC and OP at 24 hpf (h) . Close observation shows that cfap300 is expressed in all segments of the pronephros tubule and duct except the glomerulus (i) , and histology confirms its expression in pronephros (j) . cfap300 expression persists in the above tissues at least until 48 hpf (k-m) . Two colour WISH of pdzk1 confirmed cfap300 expression in the pronephric tubule and slc12a3 confirmed its expression in the duct (n and o) . hpf: hours post fertilisation. Scale bar 150 μm, except 1j in which it is 25 μm. Corpuscle of Stannius gland formation is impaired in cfap300 mutants and morphants A TALEN-mediated cfap300 mutant zebrafish was generated by targeting exon 2. Zebrafish mutant fish with deletion of 26 nucleotides in the coding region (Δ26) were confirmed by Sanger sequencing and homozygous mutants (henceforth referred to as cfap300 −/− or mutants) were used in all experiments ( Figure 2A ). High-resolution melt curve (HRM) and heteroduplex analysis (HD) were used to identify the mutant allele of cfap300 ( Figure 2B and C ). Deletion of 26-nucleotides in cfap300 introduces a premature termination codon (PTC) after 55 amino acids of Cfap300 and a leucine in place of a phenylalanine. It is well known that PTC can lead to nonsense-mediated decay of the mRNA ( 22 ). Hence, we checked if the cfap300 mRNA undergoes NMD and is degraded in cfap300 −/− embryos. RT-qPCR and WISH were carried out on wild type (WT) and cfap300 −/− embryos, which showed that the cfap300 mRNA is degraded in the mutants, thus indicating that the mutants will have no functional Cfap300 protein ( Figure 2D and E ). Download figure Open in new tab Figure 2: Generation of the cfap300 loss-of-function mutant. (A) Sanger sequencing reveals a 26-nucleotide deletion in the Cfap300 coding region, resulting in a premature termination codon (PTC) after 55 amino acids of Cfap300 and a Leucine. (B and C) High-resolution melt curve and heteroduplex analysis to identify the mutant allele of cfap300 . ( D ) RT-qPCR analysis of RNA extracted from pooled 24 hpf WT or cfap300 −/− embryo shows NMD-mediated degradation of cfap300 . p<0.0001 from unpaired t-test. ( E) WISH shows decreased cfap300 transcripts in cfap300 −/− embryos, confirming that cfap300 mRNA is unstable. Scale bar 150 μm. The cfap300 mutants do not exhibit gross morphological abnormalities at 24 hpf or later (data not shown). Since cfap300 is strongly expressed in the pronephros, we checked if pronephros development is impaired in the cfap300 −/− embryos. Zebrafish pronephros segments can be distinguished by analysing the expression of marker genes that are expressed in a segment-specific manner ( 12 ). The somite marker xirp2a was used to measure the pronephros segment length with respect to the somite number. In wild-type embryos, sodium/inorganic phosphate symporter ( slc20a1a ) is expressed in part of the nephron adjacent to the 3 rd to 7 th somite in 48 hpf embryos, which demarcates the proximal convoluted tubule (PCT). Transient receptor potential cation channel , subfamily M, member 7 ( trpm7 ) is expressed in the proximal straight tubule (PST) aligned with the 8 th to 11 th somite. Sodium/potassium/chloride transporter slc12a1 is expressed in part of the nephron adjacent to the 12 th and 14 th somite at 48 hpf, demarcating the distal early (DE) segment of the nephron. Sodium/chloride transporter slc12a3 is expressed in part of the nephron adjacent to the 15 th and 17 th somite, demarcating the distal late (DL) segment of the nephron ( 23 ). The expression levels and domains of slc20a1a , trpm7 , slc12a1 and slc12a3 were identical in both WT and cfap300 −/− embryos at 48 hpf ( Figure 3A ), indicating that cfap300 may not regulate nephron segmentation. The expression domain of stc1 that demarcates the Corpuscle of Stannius was not changed. However, the stc1 mRNA level was greatly reduced in the cfap300 mutants, indicating that cfap300 may have a role in CS development or stc1 expression ( Figure 3A ). We also examined multiciliated cell (MCC) development in the pronephros by analysing the ciliogenesis markers odf3 and rfx2 . Their expression domains and intensity were indistinguishable between wild-type and mutant embryos ( Figure 3B and C ). Thus, cfap300 mutants do not display broad defects in MCC formation, reinforcing the idea that its role is specific to CS gland development. Download figure Open in new tab Figure 3: Pronephros segmentation and MCC formation are not affected in cfap300 mutants or morphants. ( A ) WISH with pronephros segment-specific markers slc20a1a (PCT), or trpm7 (PST), or slc12a1 (DE), or slc12a3 (DL) or stc1 (CS) with a somite marker xirp2a shows reduced stc1 expression, without any change in pronephros segmentation in cfap300 mutants. ( B and C) WISH for odf3 or rfx2 shows normal MCC formation in cfap300 mutants. ( D) WISH against pronephros segment-specific markers with a somite marker on the control mismatch ( cfap300 -MM) and translation blocking ( cfap300 -MO) antisense morpholino-injected embryos shows reduced stc1 expression without alteration in pronephros segmentation in cfap300 morphants. (E and F) Unaltered MCC formation in cfap300 morphants. Scale bar 150 μm. It has been reported that nonsense-mediated decay of mRNA can induce transcriptional compensation, whereas antisense morpholino oligo-mediated knockdown has no such effect ( 24 ). We hypothesised that the lack of any major defect in nephron segmentation and MCC formation may be a result of the upregulation of other genes in the cfap300 mutants that can compensate for its loss of function. Hence, we checked if morpholino-mediated knockdown of cfap300 results in defects not seen in the cfap300 −/− embryos. A translation blocking cfap300 morpholino ( cfap300 -MO) and a negative control mismatch morpholino ( cfap300 -MM) were injected into 1-cell-stage zebrafish embryos and the effect of these morpholinos on morphology, nephron segmentation and MCC formation was analysed. The gross morphology or nephron segmentation or MCC formation was normal in the morphants ( Figure 3D-F ). The stc1 expression, however, was decreased in the morphants, recapitulating the phenotype seen in the mutants ( Figure 3D ). These data indicate that cfap300 specifically regulates CS development without broadly impacting nephron segmentation or ciliogenesis. To confirm that cfap300 regulates CS gland formation and not just stc1 expression, we analysed the CS gland development using multiple markers that recognise this gland ( 12 , 25 ). fgf23 and gata3 expression were greatly reduced in the cfap300 −/− embryos, indicating that indeed CS gland formation is impaired in the mutants ( Figure 4A ). Interestingly, gata3 expression in other anatomical structures, such as spinal cord neurons and pronephric duct was unaffected, further strengthening the idea that the cfap300 effect is limited to CS gland formation ( Figure 4A ). Download figure Open in new tab Figure 4: CS gland formation is impaired in cfap300 mutants. (A) WISH showed decreased CS gland marker gene expression of stc1 , gata3 and fgf23 (black circles) in cfap300 mutants. Notably, gata3 expression outside the CS gland, including spinal cord (black arrows) and pronephric duct (black box), remains unaffected. (B) RT-digital PCR analysis identified decreased fgf23 expression (p<0.0001, 2-way ANOVA analysis) during the CS gland morphogenesis (30, 50, and 72 hpf). (C) cfap300 mRNA injection restores stc1 expression in cfap300 mutants. (D) Quantification showed cfap300 mRNA injection resulting in normal stc1 expression in ∼55% cfap300 −/− embryos, while only ∼10% of control-uninjected (UI) cfap300 −/− embryos show normal stc1 expression (p<0.001, Cochran–Mantel–Haenszel (CMH) test). (E) Fluorescent WISH showed reduced stc1 -positive CS cells in cfap300 mutants during 27-72 hpf. The cdh17 expression (green) marks the entire pronephric tubule and duct, whereas stc1 (red) marks the CS gland. Scale bar 150 μm. fgf23 expression was analysed by digital PCR on cDNA prepared from different stages of CS gland formation to confirm the WISH data. We found that fgf23 mRNA level was greatly reduced in the cfap300 mutants compared to the WT embryos during different stages of CS gland formation ( Figure 4B ). Moreover, microinjection of cfap300 mRNA into the cfap300 mutants resulted in 55% embryos having normal stc1 expression comparable to WT embryos. These data establish that loss of cfap300 leads to impaired CS gland development that can be rescued by expression of cfap300 mRNA ( Figure 4C and D ; Supplementary Figure 1). These findings provide the first evidence that a conserved ciliary gene such as cfap300 , previously associated only with motile cilia function and ciliopathies, has a lineage-specific role in regulating endocrine organ formation. cfap300 is necessary for CS gland cell transdifferentiation A defined number of cells from the pronephros tubule bordering the DE and DL segments transdifferentiate (completed by 30 hpf) to form the CS cells, undergo apical constriction and extrude from the tubule and form the CS gland by 72 hpf. To check how cfap300 might take part in this gland formation, a two-colour fluorescent WISH was carried out using cdh17 as a marker for the pronephric tubule and stc1 as a marker for CS cells. The number of CS cells at 27 hpf in cfap300 mutants was greatly reduced compared to the wild-type embryos ( Figure 4E ). The fluorescent WISH carried out at 32 and 72 hpf indicated that the transdifferentiation is impaired and not delayed in the mutants ( Figure 4E ). We also observed that a low number of CS cells that form in the cfap300 −/− embryos exhibit incomplete extrusion out of the nephron epithelium ( Figure 4E ). These results demonstrate that cfap300 is required for epithelial to endocrine transdifferentiation underlying CS gland formation, a previously unrecognized mechanism in vertebrate kidney and endocrine development. The impaired CS gland formation in cfap300 mutants is due to upregulation of cdh17 It is reported that cdh17 , which is expressed in the tubule and duct of zebrafish pronephros, is downregulated in the border between the DE and DL ( 14 ). We reasoned that cdh17 and other cadherins may be involved in the process of transdifferentiation. Hence, we checked the status of cadherins expressed in the pronephros of zebrafish ( cdh1 , cdh6 and cdh17 ) by RT-qPCR at 48 hpf. All cadherins except cdh17 showed non-significant change of expression, whereas cdh17 expression was significantly upregulated in cfap300 −/− embryos ( Figure 5A ). Then the cdh17 mRNA levels in the pronephros during different stages of CS gland development, such as end of transdifferentiation (30 hpf), extrusion (50 hpf) and expansion of CS cells (72 hpf) were checked using RT – digital PCR and WISH. The cdh17 was significantly upregulated in all three stages and the WISH results showed the overexpression is throughout the tubule ( Figure 5B and C ). This indicates that the upregulation of cdh17 in the pronephros of zebrafish may be the reason behind impaired transdifferentiation of CS cells from the tubule of the pronephros, leading to CS gland formation defect in cfap300 mutants. If cdh17 upregulation leads to impaired CS gland formation, we reasoned that the knockdown of cdh17 in cfap300 mutants would restore the CS gland formation. We took advantage of the F0 crispant method to test this hypothesis. Two guide RNAs (gRNA) were designed targeting the exon-4 and exon-8 of zebrafish cdh17 and were tested for their efficacy (Supplementary Figure 2). The microinjection of cdh17 gRNA led to the NMD-mediated degradation of cdh17 mRNA in these crispants, suggesting that the cdh17 crispants will lack Cdh17 protein ( Figure 6A ). We then checked CS gland formation in cdh17 crispants at 30, 50 and 72 hpf by analyzing stc1 expression. The CS gland formation was largely restored in the cdh17 crispants created in the cfap300 −/− background ( Figure 6B ). Only 10% of cfap300 −/− embryos had normal stc1 expression at 30 hpf, whereas 60% embryos showed normal CS development in cdh17 crispants created in these mutants ( Figure 6C ). Similar results were obtained when cdh17 crispants created in the cfap300 −/− background were analyzed at 50 and 72 hpf ( Figure 6C ). These experimental observations support the hypothesis that upregulation of cdh17 in cfap300 mutants leads to impaired transdifferentiation and reduced CS gland formation, which can be restored by downregulating cdh17 . These data identify a mechanism whereby persistent cdh17 expression acts as a barrier to CS cell transdifferentiation, linking cfap300 function to an adhesion molecule regulation. Download figure Open in new tab Figure 5: cdh17 expression is upregulated in cfap300 mutants. ( A ) RT-qPCR analysis of cdh1 , cdh6 and cdh17 at 48 hpf. Only cdh17 expression was significantly increased in cfap300 mutants (** / p=0.0057, 2-way ANOVA). (B) RT – digital PCR confirms increased cdh17 expression at different stages of CS development in cfap300 mutants (*/p<0.03, **/p<0.007 and ***/p=0.0001, 2-way ANOVA). (C) WISH showed increased cdh17 expression in ∼53%, 60% and 75% embryos at 30, 50, and 72 hpf cfap300 −/− embryos, respectively. Scale bar 150 μm. Download figure Open in new tab Figure 6: cdh17 knockdown restores CS gland formation in cfap300 mutants. ( A ) WISH showed decreased cdh17 expression in cdh17 crispants, indicating NMD-mediated cdh17 mRNA degradation. (B) WISH against stc1 showed restored CS gland development in cdh17 crispants in cfap300 mutants. (C) Quantification showed ∼60% cfap300 −/− /cdh17 crispants embryos had normal stc1 expression compared to ∼10% in cfap300 −/− at 30, 50 and 72 hpf. The statistical significance of recovery in the mutant was determined using the Cochran–Mantel– Haenszel (CMH) test (p<0.001). Scale bar 150 μm. hnf1b a transcription factor is upregulated in the cfap300 mutants and regulates cdh17 expression We next investigated how cdh17 becomes misregulated in cfap300 mutants. The 5kb upstream sequence of cdh17 that is reported to drive its expression in the zebrafish pronephros was analysed for transcription factors that can bind to this region using Alggen software ( http://www.lsi.upc.es/~alggen ) ( 26 , 27 ). Two hundred and thirty-four transcription factors were identified that can potentially bind to this region. Spatial expression of these TFs during zebrafish development was checked at the Zfin.org database to identify TFs that are expressed in a spatially overlapping manner with the cdh17 in the zebrafish pronephros. Zebrafish cjun , ppargc1a , hnf1ba , hnf1bb and c-myc were found to be expressed in a complete or partially overlapped fashion with cdh17 . The expression of these TF was analyzed in the cfap300 mutant embryos at 48 hpf by RT-qPCR. c-myc expression was downregulated and hnfb1a expression was upregulated in the cfap300 mutants, whereas the expression of other genes was not altered ( Figure 7A ). Next, we checked the ability of c-myc and hnf1ba to regulate cdh17 transcription by creating crispants ( c-myc ) or morphants ( hnf1ba ). Since hnf1bb is a paralog of hnf1ba , it was also taken, although its expression was not altered in the mutants. Our analysis showed that hnf1bb crispants had normal, c-myc crispants showed enhanced and hnf1ba morphants showed reduced cdh17 expression compared to WT embryos at 48 hpf ( Figure 7B ). Since hnf1ba expression is upregulated in cfap300 mutants and could enhance cdh17 transcription, we checked its level of expression at different stages of CS development. The RT – digital PCR and WISH on WT and cfap300 mutant embryos between 30 and 72 hpf show that hnf1ba transcription is upregulated in the mutant embryos during the CS gland formation ( Figure 7C and D ). These data support the hypothesis that hnf1ba and its transcriptional target cdh17 are upregulated in the cfap300 mutants, which results in impaired CS gland formation. Download figure Open in new tab Figure 7: Cfap300 negatively regulates hnf1ba but not hnf1bb expression in developing pronephros. (A) Quantification of the transcripts of transcription factors that are predicted to bind to the regulatory sequence of cdh17 and are known to be expressed in the pronephros. Decreased c-myc and increased hnf1ba transcripts in cfap300 mutants compared to wild-type embryos (***/p<.001, 2-way ANOVA). (B) Quantification of cdh17 transcripts in c- myc or hnf1bb crispants or hnf1ba morphants at 48 hpf (*/p=0.02, **/p=0.002, unpaired t-test). (C) Comparative analysis of hnf1ba transcripts in embryos during different stages of CS gland formation (30 – 72 hpf). (D) Lateral views of WISH embryos against hnf1ba . hnf1ba is increased in cfap300 mutants during CS gland development. Statistical significance determined by Student’s t-test (**) p<0.01. Scale bar 150 μm. Knockdown of hnf1ba partially restores CS development in cfap300 mutants We have provided evidence that hnf1ba is upregulated in the pronephros of cfap300 mutants, leading to upregulation of cdh17 , impaired transdifferentiation of CS cells and defective CS gland formation. If this is true, then downregulation of hnf1ba in cfap300 −/− embryos should lead to restoration of CS gland formation. To test this pathway directly, we knocked down hnf1ba in cfap300 −/− embryos using a translation-blocking antisense morpholino. Hnf1ba downregulation led to reduced cdh17 expression and partial restoration of CS formation, with over 80% of cfap300 mutant embryos at 30, 50, and 72 hpf showing normal or elevated stc1 expression ( Figure 8A and B ; Supplementary Figure 3). This functional rescue confirms that hnf1ba acts upstream of cdh17 and positions cfap300 as a key regulator of CS gland development. Download figure Open in new tab Figure 8: Knockdown of hnf1ba restores the CS development in cfap300 mutants. (A) Lateral views of whole mount in situ hybridised wild-type or cfap300 −/− embryos, either control or a translation-blocking morpholino against hnfba injected. hnf1ba knockdown largely restored the stc1 -expressing CS gland cells in the cfap300 mutants. ( B) Bar graph quantifies the percentage of embryos with stc1 expression categorised as normal, ectopic or reduced in uninjected (UI) or hnf1ba morpholino-injected cfap300 mutant or WT. hnf1ba knockdown in cfap300 mutants restored stc1 expressing CS cells in ∼50-60% embryos. The statistical significance of recovery in the mutant was determined using the Cochran-Mantel-Haenszel test (p<0.001). Scale bar 150 μm. Discussion The Dynein axonemal assembly factors (DNAAFs) are well-known essential proteins involved in the assembly of axonemal dynein arms and cilia biogenesis ( 4 ). Apart from these canonical functions, DNAAF also contributes to cell division and cell fate determination ( 28 – 31 ). In this study, we report that Cfap300, a protein classified as a DNAAF, regulates CS gland morphogenesis by suppressing hnf1ba and its target cdh17 expression in zebrafish. Several outcomes of this study support the claim. cfap300 is predominantly expressed in the pronephric tubule during CS gland morphogenesis and cfap300 mutants showed reduced CS glands. These mutants show increased hnf1ba and cdh17 expression and the CS gland is restored by downregulation of hnf1ba or cdh17 in the mutants. Cadherins, including cdh1 , cdh6, cdh16, and cdh17, are known to be expressed in the developing zebrafish pronephros. Interestingly, our study found pronephric expression of cdh17 is regulated by Cfap300, while cdh1 , cdh6 expression remain unaltered in cfap300 mutants. The function of CDH17 in cell adhesion and cell signalling, including the Wnt/β-catenin, NF-κB, α2β1 integrin, FAK, and Ras pathways, has been well documented ( 32 – 36 ). Since our study identified reduced CS gland along with increased cdh17 expression in cfap300 mutants, we speculate that downregulation of Cdh17 is necessary for the transdifferentiation of the pronephric epithelial cells to CS cells. A recent report showed that cdh16 is expressed in most segments of the pronephros but primarily localises to the CS gland at 48 hpf. The cdh16 mutants show impaired acoustic sensory gating in zebrafish as a result of a defect in calcium homeostasis ( 37 ). Thus, it will be interesting to explore the role of Cdh16 in Cfap300-mediated CS development in future. Hnf1ba and Hnf1bb are two zebrafish paralogues of human HNF1B, expressed in many organs, including pronephros, liver, pancreas and gut ( 38 – 40 ). In the pronephros, hnf1ba is expressed broadly, whereas hnf1bb expression is restricted to proximal and distal early segments ( 38 ). Despite the differences in their expression domains, they have been proposed to carry out similar functions in zebrafish pronephros segmentation. We show here that hnf1ba and not hnf1bb is upregulated in the cfap300 mutants, and suppression of hnf1ba in cfap300 mutants resulted in normal CS development without alteration in pronephros morphogenesis, indicating that Hnf1ba is essential for CS gland development, and dispensable in nephron segmentation. Conversely, Hnf1bb, which has been shown to regulate nephron segmentation, may not regulate CS development ( 26 , 27 ). It has been reported that Hnf1b is translocated from the nucleus to the cytoplasm in the cells between the DE and DL boundary cells of the zebrafish ( 14 ). As this study shows that suppression of hnf1ba or cdh17 in cfap300 mutants rescued CS gland morphogenesis phenotype, and cdh17 is a transcriptional target of Hnf1ba, one could reason that the downregulation of Hnf1ba target genes is necessary for the transdifferentiation of CS forming cells from the nephric epithelium. In the future, it will be important to know whether other targets of Hnf1ba are also involved in this process ( Figure 9 ). Download figure Open in new tab Figure 9: A model depicting the function of cfap300 during Corpuscle of Stannius (CS) gland formation. The normal function of Cfap300 is to downregulate hnf1ba . In the cfap300 loss-of-function mutant, hnf1ba transcription is upregulated, thus upregulating its target cdh17 , which leads to inhibition of CS gland formation. Hnf1ba may regulate the transcription of genes other than cdh17 , which may also contribute to CS gland formation. This study revealed that cfap300 zebrafish mutants have no major cilia-related phenotypes. In contrast, human CFAP300 mutations lead to PCD. One of the major impacts of PCD is infertility due to reduced sperm motility. The cfap300 mutants grow to adulthood and produce progeny at par with their WT counterparts, although the sperm of the cfap300 mutant adults show slow motility with low genetic penetrance (Supplementary Videos 1 and 2). cfap300 has a strong expression in the pronephros, but the mutants and the morphants have no impact on the pronephros segmentation, MCC formation or pronephros function (Supplementary Figure 4). This indicates that the lack of cfap300 function in zebrafish mutants may be partly compensated for by other DNAAF, which needs further investigation. It is also tempting to postulate that the role of Cfap300 in the transdifferentiation and CS gland formation may reflect a cilia-independent function, and future work will clarify this. DNAAFs are essentially chaperons that are responsible for assembling protein complexes and it is plausible that Cfap300 may act as a chaperon in signalling networks that control CS development. RA, Notch and FGF signalling pathways are known regulators of pronephros segmentation and contribute to CS gland formation ( 12 , 18 , 19 ). Wnt/Beta-catenin signalling is known to regulate different aspects of pronephros development and patterning ( 41 ). The role of Cfap300 in these signalling pathways in the context of CS development and transdifferentiation requires further investigation. CS gland formation also involves the extrusion of the transdifferentiated cells out of the nephric epithelium. We have observed that the small number of cells that transdifferentiate from the tubule epithelium are not efficiently extruded in the cfap300 mutants. Cell extrusion is a property of the epithelium that maintains cell homeostasis, where undesired cells are squeezed out from the epithelium without creating a gap, thus preserving the intact barrier property. Being the first line of defence barrier, epithelial cell encounters the highest stress of cell turnover. This turnover stress is an inclusion of a high rate of cell death, overcrowding, replicative stress, pathogen infection, oncogenic mutation, epithelial cell transition or transdifferentiation ( 42 – 45 ). To maintain a constant cell number, epithelium extrudes above mentioned cells by apical cell extrusion (ACE) or basal cell extrusion (BCE) by the coordination of both extruding and neighbouring cells. The mechanisms employed by CS cells for extrusion are not well studied, but are likely to employ some of the known mechanisms of extrusion seen in other biological contexts. At later stages of development (6 dpf and later), a small CS gland can be seen in the cfap300 mutants (data not shown), further strengthening the idea that transdifferentiation and extrusion processes are tightly regulated processes. In conclusion, we have uncovered a novel role for a DNAAF in transdifferentiation and organogenesis of an endocrine gland. Our data indicates that Cfap300 may not regulate this process through a classical ciliary function, but through a transcriptional adhesion pathway involving hnf1ba and cdh17 . Materials and Methods Zebrafish husbandry and ethics statement Zebrafish were maintained in a circulating system with a 14-hours light and 10-hours dark cycle at 28⁰C ± 0.5. The zebrafish strains, Albino and Tübingen (Tü) were used in all experiments. Embryos were grown in E3 medium at 28.5°C and staged according to the standard protocol ( 46 ). All the experiments were approved by the Institutional Animal Ethics Committee (ILS/IAEC-250-AH/FEB-22). Total RNA extraction and cDNA synthesis The total RNA from zebrafish embryos/larvae was extracted using MagSure all RNA isolation kit (RNA Biotech, India) or Direct-zol RNA miniprep kit (Zymo Research, USA) according to the manufactures protocol. Subsequently, equal amount of RNA was taken and the cDNA was synthesised using SuperScript IV First-Strand Synthesis System with oligo (dT)18 (Thermo Fisher Scientific). Finally, the quantitative measurements were taken using in Qubit 4 fluorometer (Qubit™ ssDNA Assay Kit, Thermo Fisher Scientific). Probe synthesis for whole-mount in situ hybridization (WISH) The DNA templates required for the probe synthesis ( cfap300 , cdh17 , xirp2a , gata3 , fgf23 and hnf1ba ) were amplified with gene-specific primers (Supplementary Table 1) and Phusion polymerase using cDNA obtained from wild-type (WT) zebrafish embryos. The PCR products were cloned into the PCR-Blunt II-TOPO vector (Thermo Fisher Scientific) and the sequences were verified by Sanger sequencing. The plasmids were linearized and DIG or Fluorescein labelled probes were synthesised using SP6 or T7 RNA polymerases (Supplementary Table 1) ( 47 ). WISH The WISH was carried out following the protocol modified from Thisse and Thisse, 2008 ( 47 ). In brief, the embryos were fixed in 4% paraformaldehyde (PFA), washed in PBS, transferred to 100% methanol and stored at –20°C a minimum for 2 hours. The embryos were rehydrated in PBST, permeabilised with proteinase-K and refixed in 4% PFA. The embryos were incubated in hybridisation buffer for 4 hours (without the probe), then the probe was added and kept at 65°C for overnight. The next day, the embryos were washed with formamide/SSC buffer at 65°C to remove unbound probes and transferred to MABT (0.1% Tween-20 in 1X MAB) at RT. Then the embryos were transferred to blocking buffer (10% fetal bovine serum (FBS) and 2% blocking reagent (Roche 1109617600) in MABT, 2-3 hours at RT). Then it was incubated overnight with alkaline phosphatase (AP) conjugated anti-digoxygenin (DIG) or anti-fluorescein antibodies at 4°C. On the third day, gene transcripts were detected by developing with BM purple (Roche 11442074001). The reaction was stopped by adding PBS and fixed with 4% PFA kept at 4°C for overnight. To check the expression of two genes in the same embryo, double in situ hybridisation was carried out by incubating in both DIG and fluorescein labelled probes targeting two different gene transcripts during the hybridisation step. After detection of the first transcript with BM purple, AP activity was deactivated with methanol, re blocked, and incubated with the second antibody respective to the second probe. The next day, the second RNA probe was visualized using INT-BCIP (Roche 11681460001) and then the reaction was stopped as described above. Fluorescent in situ hybridization (FISH) For two colour FISH, the embryos were hybridized with Fluorescein or DIG labelled riboprobes and incubated with horseradish Peroxidase (POD) conjugated antibodies. The probe was detected using fluorescence substrate from the TSA Plus Fluorescein Kit (NEL741001KT). Then, the first POD antibody was inactivated by the addition of 1% H202 (prepared in methanol). Then the embryos were incubated with POD conjugated antibody against the second probe. The second probe was visualized by adding TSA Plus TMR Solution (NEL763001KT) followed by PBST wash, cleared with 75% glycerol and kept at 4°C for overnight ( 48 ). Histology WISH-stained embryos were fixed in 4% PFA for 1-2 hours at room temperature followed by PBS wash and then transferred to 30% sucrose solution (prepared in PBS) for overnight at 4°C. The next day, the embryos were incubated in a 1:1 mixture of OCT medium and 30% sucrose solution for 30 minutes at RT and stored at –80°C. Then 10μm-sized cryo-sections were taken and mounted on a glass slide using a cryotome (Thermo Fisher Scientific). TALEN The TALEN target site for cfap300 was designed using TALEN-T software selecting two 18 bp sequences in exon 2 as the left (5’ ACAGCACAAGCCTTCAAC 3’) and right (5’ CCAGCCTTATAGAAGCAA 3’) binding sites ( https://tale-nt.cac.cornell.edu/ ) ( 49 ). TALEN binding domains were assembled using the Golden Gate cloning method, where RVD repeats 1–10 in pFUS_A and11–17 in pFUS_B1 were cloned using BsaI and T4 ligase. The positive clones were confirmed with universal primers and they were combined with the 18th RVD plasmid (pLR-HD for left, pLR-NI for right) and destination vectors (pCS2+Tal3-DDD and pCS2+Tal3-RRR) using BsmBI ( 50 , 51 ). Finally, the constructs were confirmed by PCR and subsequently used for in vitro mRNA synthesis. The TALEN left arm containing pCS2+-Tal3-DDD and right arm containing pCS2+-Tal3-RRR were linearized with Not I and the mRNA was synthesised using SP6 mMessage mMachine kit. Both left and right TALENs were co-injected into single-cell zebrafish embryos and the injected embryos were checked for mutation efficiency by high-resolution melt (HRM) analysis and heteroduplex (HD) assay at 48hpf. These fish were grown up to adulthood, and the F0 founders were identified and crossed with wild-type fish to generate F1 heterozygous mutants. The DNA sequencing of F1 heterozygous adults showed the presence of four different kinds of mutations in the cfap300 gene. These mutations include the deletion of 7, 8, 10 and 26 nucleotides. To generate homozygous mutants, heterozygous fish with deletion of 26 nucleotides from 340-365 of NM_001077345.3 (del26) were crossed with each other, grown to adulthood and homozygous fish were identified by HRM and HD. Design and synthesis of guide RNA (gRNA) The target sites for the gRNA synthesis were identified for the following genes cdh17 , c- myc and hnf1bb using CRISPR RGEN tools ( http://www.rgenome.net/cas-designer/ ). For cdh17 , the targets sites were designed against exon-4 5’GGAGATCCTGACCTTATCTT3’ and exon-8 5’GATTGTTCGGGCTGAGGATT3’. For c- myc the targets sites were designed at exon 1-5’ GAGACAGTCGCTCTCCACCG 3’ and exon 2-5’ GGTCATGCCGCGTTGACGGA 3’. For hnf1bb , two target sites were chosen at exon 3-5’ GAGCAGCGGTAGGAGATGAG 3’ and exon 9-5’ GAAGATTTCATCCCCTCAGTT 3’. The target sites and the universal oligo were synthesised from IDT. The DNA template was prepared and gRNA synthesized using in vitro transcription ( 52 ). High-resolution melt curve analysis (HRM) and heteroduplex mobility assay (HMA) The genomic DNA was isolated from the zebrafish embryo/adult fin by incubating the single embryo/adult ( 52 ).The target sites were amplified using the site-specific primers (Supplementary Table 1) using 2X SYBR® Green JumpStartTM Taq ReadyMix. During melt curve reaction was performed from 60-95°C with increment of 0.2°C and fluorescence was recorded at every 0.2 sec. Then, PCR amplicons were denatured at 95°C and reannealed at RT. Then, the samples were resolved in 12% polyacrylamide gel at120V for 90 minutes and gel images were taken using ChemiDoc (Biorad). Molecular cloning For the mutation identification in target genes after gene knockout experiments using TALEN and CRISPR, the target sites were amplified and cloned into pGEM®-T Easy Vector Systems. To make zebrafish cfap300 (818 bp) expression construct, the target region was amplified from cDNA using a forward primer containing NCoI and the reverse primer containing XhoI restriction enzyme sites with an HA tag at the C-terminus. Then it was subjected to restriction digestion and ligated into the pCS2 + vector. After that the transformation was carried out using DH5α cells and cultured in LB media. Finally, the plasmid DNA was isolated by using QIAprep Spin Miniprep Kit (27106) and stored at –20°C. In vitro transcription pCS2+- cfap300 vectors were linearized with Not I and the mRNA was synthesised using SP6 mMessage mMachine kit. pT3TS-nlsCas9nls vector was linearized with XbaI and mRNA was synthesized using T3 mMessage mMachine kit (Invitrogen). For the gRNA synthesis, annealed gRNA oligos were used as templates and gRNA was synthesised using Invitrogen TM MEGAScript TM T7/SP6 kit and purified using the phenol and chloroform extraction method. Morpholino design The antisense morpholino oligonucleotide was designed and purchased from Gene Tools. cfap300 -ATG morpholino ( cfap300 -MO, 5′ TGCCTATTGTTGTTGTTACCATGAC-3′) was designed to block translation of cfap300 mRNA and a mismatch morpholino ( cfap300 -MM) 5′ TGCaTATTaTTaTTaTTACCATaAC-3′ with five base mismatches (small letters) was used as a negative control. For hnf1ba a previously reported morpholino (5’ CTAGAGAGGGAAATGCGGTATTGTG 3’) was used in our study ( 53 ). Morpholinos were dissolved in nuclease-free water to make a 1 mM stock, diluted to 0.25mM and 1nl was injected into each embryo at the 1-2 cell stage. Microinjection Microinjection was performed at single cell stage of zebrafish embryos for all following experiments using a Femtojet microinjector (Eppendorf). 100 pg/nl of right and left arm mRNA was used for the microinjection for the TALEN-mediated mutagenesis. The gene knockout by CRISPR mutagenesis was achieved by injecting 1nl of gRNA and nCAS9n mRNA mixture in the concentrations of 25 ng/μl, 100 ng/μl, respectively. cfap300 mRNA was injected at 150 pg per embryo for rescue experiments. Quantitative Reverse Transcription PCR (RT-qPCR) Comparative gene expression analysis of cdh1 , cdh6 , cdh17 and cfap300 and transcription factors cjun , ppargc1a , c-myc, hnf1ba and hnf1bb were carried out using RT-qPCR. The experiment was performed in QuantStudio™ 5 Real-Time PCR System (Tm 60°C, 40 cycles) using GoTaq® qPCR Master Mix (Promega). Relative gene expression levels were calculated using the ΔΔCt method, normalising to housekeeping gene ef1α . Digital PCR (D-PCR) The expression levels of fgf23 , cdh17 and hnf1ba mRNA were quantified by QIAcuity One D-PCR system. The reaction mixture was prepared by adding cDNA, target specific primers and EvaGreen master mix from the QIAcuity TM EG PCR Kit (Qiagen). The PCR reaction was carried out with the following cycles: Initial denaturation 95⁰C-2 min, then 40 cycles of denaturation at 95⁰C for15 seconds, annealing at 62⁰C for 30 seconds and extension at 72⁰C for 25 seconds and final extension at 40⁰C for 5 min. Images were acquired at an exposure of 300 milliseconds and a gain of 6 in the green channel. The result was analysed using QIAcuity Software Suite (Qiagen). Relative gene expression levels were normalized to the housekeeping gene ef1α and b2m . Transcription Factor Identification To identify the transcription factors binding to the cdh17 promoter, an in-silico promoter analysis was carried out using ALGGEN PROMO software ( http://www.lsi.upc.es/~alggen ). After the analysis it was found that 234 transcription factors can bind to cdh17 promoter. Spatial expression of these TFs during zebrafish development was checked at the Zfin.org database to identify the TFs that are expressed in a spatially overlapping manner with the cdh17 in the zebrafish pronephros. The TFs cjun , ppargc1a , hnf1ba , hnf1bb and c-myc were found to be expressed in a complete or partially overlapped fashion with cdh17 and were taken for further analysis. Microscopy The zebrafish embryos were mounted in 75% glycerol and the bright-field and fluorescence images were taken using Leica M205 FA stereo microscope with identical magnification and exposure settings for the all the samples. Pronephros function assay For pronephros function assessment, 70 KDa dextran was injected into the common cardinal vein of 54 hpf zebrafish embryos. Accumulation of dextran was measured by measuring the fluorescent intensity at the heart, using ImageJ software at 0, 5 and 24 hours post-injection. Then the percentage of fluorescent intensity was calculated to measure the clearance by the pronephros( 54 ). Sperm motility assay Sperm collection and motility test were carried out following Kikkawa and Yamaguchi, 2019 (bio-protocol.org /prep21). Spermatozoa were collected in ice-cold Hank’s buffer, then diluted in 0.2X Hank’s buffer and used for video microscopy. Sperm motilities were observed under bright-field conditions using Celldiscoverer 7 (Zeiss). The video was obtained at 20X magnification and played at 12fps. Statistical analysis The statistical analysis of relative gene expression was performed using an unpaired t-test and a 2-way ANOVA method in GraphPad Prism 8.0.1. and the data were presented as mean ± standard deviation (SD). The graphs representing the statistical significance p<0.05 (*), p<0.01 (**) and p<0.001(***) or as mentioned in the figure legends. For rescue experiments, the significance was measured by implementing the Cochran–Mantel–Haenszel (CMH) test. The analysis was performed using IBM/SPSS software and a p<0.001 was considered significant. Author Contributions RKS conceptualised the project. PB and UN generated the mutants and reagents. WISH and fluorescent WISH were carried out by UN, KS and PB. UN and KS performed RT-qPCR and RT-digital PCR experiments. UN, KS and PB analysed the data and all authors prepared the manuscript. Conflict of interest The authors declare no conflict of interest. Figure Legends Download figure Open in new tab Supplementary Figure 1: Expression of the cfap300 - HA mRNA. (A) Western blotting showing the expression of Cfap300-HA. (B) Microinjection of cfap300-HA mRNA in WT and cfap300 mutants shows high and ubiquitous expression. Download figure Open in new tab Supplementary Figure 2: Efficiency of cdh17 gRNA. (A) gRNA was designed against exon-4 and –8, and these gRNA and Cas9 mRNA were microinjected into one-cell stage zebrafish embryos. (B – C) Both gRNAs can induce high efficiency mutagenesis as seen by HD. Download figure Open in new tab Supplementary Figure 3: Effect of hnf1ba knockdown on cdh17 and stc1 expression. WISH shows knockdown of hnf1ba reduces cdh17 expression and enhances stc1 expression. Download figure Open in new tab Supplementary Figure 4: Pronephros function is not affected in cfap300 −/− embryos. (A-B) Clearance of 70 kDa dextran injected into the common cardinal vein of 54 hpf WT and cfap300 −/− embryos. (A) Representative picture of dextran-injected WT and cfap300 −/− embryos. The fluorescence intensity of a defined area (Red circle) was measured in each embryo at 0, 5 and 24 hours post-injection (hpi) (B). The percentage change in fluorescent intensity was plotted on a graph. Supplementary Video 1 and 2: Movies of free-swimming spermatozoa of WT and cfap300 mutant, filmed by a high-speed camera and played at 12 fps. Scale bar: 50 μm View this table: View inline View popup Supplementary Table: Oligonucleotides used in PCR Primers used to clone WISH probes Acknowledgements We thank Suryasikha Mohanty for her help with the experiments, Satyajit Behera and Subhangi Mohanty for maintaining the zebrafish facility. We thank Dr Chinmoy Patra, ARI, Pune for discussions and critical reading of the manuscript and Dr Vinoth S. for help with manuscript preparation. This work was partially supported by a SERB-EMR grant (EMR/2016/003/780) and a DBT grant (BT/PR45460/MED/12/952/2022) to RKS, and intramural funds from ILS, which is an institute of BRIC, DBT, Government of India. UN is a recipient of the DST-Inspire fellowship (IF180156) and KS is a UGC-SRF (221610148651). Figure 9 was created with BioRender (Agreement number-BA28TETTCD). Funder Information Declared Science and Engineering Research Board, https://ror.org/03ffdsr55 , EMR/2016/003/780 Department of Biotechnology, https://ror.org/03tjsyq23 , BT/PR45460/MED/12/952/2022 Footnotes Emails of other authors: usharani.n{at}ils.res.in , kalyani{at}ils.res.in and pbarrodia{at}mdanderson.org References 1. ↵ Amack JD . Structures and functions of cilia during vertebrate embryo development . Mol Reprod Dev . 2022 ; 89 ( 12 ): 579 – 96 . OpenUrl PubMed 2. ↵ Braschi B , Omran H , Witman GB , Pazour GJ , Pfister KK , Bruford EA , et al. Consensus nomenclature for dyneins and associated assembly factors . J Cell Biol . 2022 ; 221 ( 2 ). 3. ↵ Jat KR , Faruq M , Jindal S , Bari S , Soni A , Sharma P , et al. Genetics of 67 patients of suspected primary ciliary dyskinesia from India . Clin Genet . 2024 ; 106 ( 5 ): 650 – 8 . OpenUrl PubMed 4. ↵ Aprea I , Raidt J , Hoben IM , Loges NT , Nothe-Menchen T , Pennekamp P , et al. Defects in the cytoplasmic assembly of axonemal dynein arms cause morphological abnormalities and dysmotility in sperm cells leading to male infertility . PLoS Genet . 2021 ; 17 ( 2 ): e1009306 . OpenUrl CrossRef PubMed 5. ↵ Mitchison HM , Schmidts M , Loges NT , Freshour J , Dritsoula A , Hirst RA , et al. Mutations in axonemal dynein assembly factor DNAAF3 cause primary ciliary dyskinesia . Nat Genet . 2012 ; 44 ( 4 ): 381 – 9 , S1-2. OpenUrl CrossRef PubMed 6. ↵ Kishimoto N , Cao Y , Park A , Sun Z . Cystic kidney gene seahorse regulates cilia-mediated processes and Wnt pathways . Dev Cell . 2008 ; 14 ( 6 ): 954 – 61 . OpenUrl CrossRef PubMed Web of Science 7. ↵ Marie-Hardy L , Cantaut-Belarif Y , Pietton R , Slimani L , Pascal-Moussellard H . The orthopedic characterization of cfap298(tm304) mutants validate zebrafish to faithfully model human AIS . Sci Rep . 2021 ; 11 ( 1 ): 7392 . OpenUrl PubMed 8. ↵ Fassad MR , Shoemark A , le Borgne P , Koll F , Patel M , Dixon M , et al. C11orf70 Mutations Disrupting the Intraflagellar Transport-Dependent Assembly of Multiple Axonemal Dyneins Cause Primary Ciliary Dyskinesia . Am J Hum Genet . 2018 ; 102 ( 5 ): 956 – 72 . OpenUrl CrossRef PubMed 9. Schultz R , Elenius V , Fassad MR , Freke G , Rogers A , Shoemark A , et al. CFAP300 mutation causing primary ciliary dyskinesia in Finland . Front Genet . 2022 ; 13 : 985227 . OpenUrl CrossRef PubMed 10. ↵ Zhou Z , Qi Q , Wang WH , Dong J , Xu JJ , Feng YM , et al. A novel homozygous mutation of CFAP300 identified in a Chinese patient with primary ciliary dyskinesia and infertility . Asian J Androl . 2025 ; 27 ( 1 ): 113 – 9 . OpenUrl PubMed 11. ↵ Liu J , Xie H , Wu M , Hu Y , Kang Y . The role of cilia during organogenesis in zebrafish . Open Biol . 2023 ; 13 ( 12 ): 230228 . OpenUrl PubMed 12. ↵ Wingert RA , Selleck R , Yu J , Song HD , Chen Z , Song A , et al. The cdx genes and retinoic acid control the positioning and segmentation of the zebrafish pronephros . PLoS Genet . 2007 ; 3 ( 10 ): 1922 – 38 . OpenUrl CrossRef PubMed Web of Science 13. ↵ Tseng DY , Chou MY , Tseng YC , Hsiao CD , Huang CJ , Kaneko T , et al. Effects of stanniocalcin 1 on calcium uptake in zebrafish (Danio rerio) embryo . Am J Physiol Regul Integr Comp Physiol . 2009 ; 296 ( 3 ): R549 – 57 . OpenUrl CrossRef PubMed Web of Science 14. ↵ Naylor RW , Chang HG , Qubisi S , Davidson AJ . A novel mechanism of gland formation in zebrafish involving transdifferentiation of renal epithelial cells and live cell extrusion . Elife . 2018 ; 7 . 15. ↵ Tosh D , Slack JM . How cells change their phenotype . Nat Rev Mol Cell Biol . 2002 ; 3 ( 3 ): 187 – 94 . OpenUrl CrossRef PubMed Web of Science 16. ↵ Marra AN , Cheng CN , Adeeb B , Addiego A , Wesselman HM , Chambers BE , et al. Iroquois transcription factor irx2a is required for multiciliated and transporter cell fate decisions during zebrafish pronephros development . Sci Rep . 2019 ; 9 ( 1 ): 6454 . OpenUrl CrossRef PubMed 17. Drummond BE , Li Y , Marra AN , Cheng CN , Wingert RA . The tbx2a/b transcription factors direct pronephros segmentation and corpuscle of Stannius formation in zebrafish . Dev Biol . 2017 ; 421 ( 1 ): 52 – 66 . OpenUrl PubMed 18. ↵ Cheng CN , Wingert RA . Nephron proximal tubule patterning and corpuscles of Stannius formation are regulated by the sim1a transcription factor and retinoic acid in zebrafish . Dev Biol . 2015 ; 399 ( 1 ): 100 – 16 . OpenUrl CrossRef PubMed 19. ↵ Klingbeil K , Nguyen TQ , Fahrner A , Guthmann C , Wang H , Schoels M , et al. Corpuscles of Stannius development requires FGF signaling . Dev Biol . 2022 ; 481 : 160 – 71 . OpenUrl CrossRef PubMed 20. ↵ Zietkiewicz E , Bukowy-Bieryllo Z , Rabiasz A , Daca-Roszak P , Wojda A , Voelkel K , et al. CFAP300: Mutations in Slavic Patients with Primary Ciliary Dyskinesia and a Role in Ciliary Dynein Arms Trafficking . Am J Respir Cell Mol Biol . 2019 ; 61 ( 4 ): 440 – 9 . OpenUrl CrossRef PubMed 21. ↵ D’Gama PP , Jeong I , Nygard AM , Jamali A , Yaksi E , Jurisch-Yaksi N . Motile cilia modulate neuronal and astroglial activity in the zebrafish larval brain . Cell Rep . 2025 ; 44 ( 1 ): 115195 . OpenUrl CrossRef PubMed 22. ↵ Ma Z , Zhu P , Shi H , Guo L , Zhang Q , Chen Y , et al. PTC-bearing mRNA elicits a genetic compensation response via Upf3a and COMPASS components . Nature . 2019 ; 568 (7751): 259 – 63 . OpenUrl CrossRef PubMed 23. ↵ Barrodia P , Patra C , Swain RK . EF-hand domain containing 2 (Efhc2) is crucial for distal segmentation of pronephros in zebrafish . Cell Biosci . 2018 ; 8 : 53 . OpenUrl PubMed 24. ↵ Rossi A , Kontarakis Z , Gerri C , Nolte H , Holper S , Kruger M , et al. Genetic compensation induced by deleterious mutations but not gene knockdowns . Nature . 2015 ; 524 (7564): 230 – 3 . OpenUrl CrossRef PubMed 25. ↵ Lin CH , Hu HJ , Hwang PP . Molecular Physiology of the Hypocalcemic Action of Fibroblast Growth Factor 23 in Zebrafish (Danio rerio) . Endocrinology . 2017 ; 158 ( 5 ): 1347 – 58 . OpenUrl PubMed 26. ↵ Farre D , Roset R , Huerta M , Adsuara JE , Rosello L , Alba MM , et al. Identification of patterns in biological sequences at the ALGGEN server: PROMO and MALGEN . Nucleic Acids Res . 2003 ; 31 ( 13 ): 3651 – 3 . OpenUrl CrossRef PubMed Web of Science 27. ↵ Naylor RW , Przepiorski A , Ren Q , Yu J , Davidson AJ . HNF1beta is essential for nephron segmentation during nephrogenesis . J Am Soc Nephrol . 2013 ; 24 ( 1 ): 77 – 87 . OpenUrl Abstract / FREE Full Text 28. ↵ Falkenberg LG , Beckman SA , Ravisankar P , Dohn TE , Waxman JS . Ccdc103 promotes myeloid cell proliferation and migration independent of motile cilia . Dis Model Mech . 2021 ; 14 ( 5 ). 29. Xu Z , Xu H , Chen X , Huang X , Tian J , Zhao J , et al. CCDC103 as a Prognostic Biomarker Correlated with Tumor Progression and Immune Infiltration in Glioma . Onco Targets Ther . 2023 ; 16 : 819 – 37 . OpenUrl PubMed 30. Liu Y , Wu Q , Sun T , Huang J , Han G , Han H . DNAAF5 promotes hepatocellular carcinoma malignant progression by recruiting USP39 to improve PFKL protein stability . Front Oncol . 2022 ; 12 : 1032579 . OpenUrl PubMed 31. ↵ Kamano Y , Saeki M , Egusa H , Kakihara Y , Houry WA , Yatani H , et al. PIH1D1 interacts with mTOR complex 1 and enhances ribosome RNA transcription . FEBS Lett . 2013 ; 587 ( 20 ): 3303 – 8 . OpenUrl CrossRef PubMed 32. ↵ Qiu HB , Zhang LY , Ren C , Zeng ZL , Wu WJ , Luo HY , et al. Targeting CDH17 suppresses tumor progression in gastric cancer by downregulating Wnt/beta-catenin signaling . PLoS One . 2013 ; 8 ( 3 ): e56959 . OpenUrl CrossRef PubMed 33. Liu LX , Lee NP , Chan VW , Xue W , Zender L , Zhang C , et al. Targeting cadherin-17 inactivates Wnt signaling and inhibits tumor growth in liver carcinoma . Hepatology . 2009 ; 50 ( 5 ): 1453 – 63 . OpenUrl CrossRef PubMed Web of Science 34. Bartolome RA , Barderas R , Torres S , Fernandez-Acenero MJ , Mendes M , Garcia-Foncillas J , et al. Cadherin-17 interacts with alpha2beta1 integrin to regulate cell proliferation and adhesion in colorectal cancer cells causing liver metastasis . Oncogene . 2014 ; 33 ( 13 ): 1658 – 69 . OpenUrl CrossRef PubMed 35. Jiang XJ , Lin J , Cai QH , Zhao JF , Zhang HJ . CDH17 alters MMP-2 expression via canonical NF-kappaB signalling in human gastric cancer . Gene . 2019 ; 682 : 92 – 100 . OpenUrl PubMed 36. ↵ Lin Z , Zhang C , Zhang M , Xu D , Fang Y , Zhou Z , et al. Targeting cadherin-17 inactivates Ras/Raf/MEK/ERK signaling and inhibits cell proliferation in gastric cancer . PLoS One . 2014 ; 9 ( 1 ): e85296 . OpenUrl PubMed 37. ↵ Schloss SS , Marshall ZQ , Santistevan NJ , Gjorcheska S , Stenzel A , Barske L , et al. Cadherin-16 regulates acoustic sensory gating in zebrafish through endocrine signaling . PLoS Biol . 2025 ; 23 ( 5 ): e3003164 . OpenUrl PubMed 38. ↵ Wingert RA , Davidson AJ . Zebrafish nephrogenesis involves dynamic spatiotemporal expression changes in renal progenitors and essential signals from retinoic acid and irx3b . Dev Dyn . 2011 ; 240 ( 8 ): 2011 – 27 . OpenUrl CrossRef PubMed 39. Matthews RP , Lorent K , Russo P , Pack M . The zebrafish onecut gene hnf-6 functions in an evolutionarily conserved genetic pathway that regulates vertebrate biliary development . Dev Biol . 2004 ; 274 ( 2 ): 245 – 59 . OpenUrl CrossRef PubMed 40. ↵ Lancman JJ , Zvenigorodsky N , Gates KP , Zhang D , Solomon K , Humphrey RK , et al. Specification of hepatopancreas progenitors in zebrafish by hnf1ba and wnt2bb . Development . 2013 ; 140 ( 13 ): 2669 – 79 . OpenUrl Abstract / FREE Full Text 41. ↵ Lyons JP , Miller RK , Zhou X , Weidinger G , Deroo T , Denayer T , et al. Requirement of Wnt/beta-catenin signaling in pronephric kidney development . Mech Dev . 2009 ; 126 ( 3-4 ): 142 – 59 . OpenUrl CrossRef PubMed 42. ↵ Ohsawa S , Vaughen J , Igaki T . Cell Extrusion: A Stress-Responsive Force for Good or Evil in Epithelial Homeostasis . Dev Cell . 2018 ; 44 ( 3 ): 284 – 96 . OpenUrl CrossRef PubMed 43. Eisenhoffer GT , Loftus PD , Yoshigi M , Otsuna H , Chien CB , Morcos PA , et al. Crowding induces live cell extrusion to maintain homeostatic cell numbers in epithelia . Nature . 2012 ; 484 (7395): 546 -9. OpenUrl CrossRef PubMed Web of Science 44. Villars A , Levayer R . Cell Extrusion: Crowd Pushing and Sticky Neighbours . Curr Biol . 2020 ; 30 ( 4 ): R168 – R71 . OpenUrl PubMed 45. ↵ Nanavati BN , Yap AS , Teo JL . Symmetry Breaking and Epithelial Cell Extrusion . Cells . 2020 ; 9 ( 6 ). 46. ↵ Kimmel CB , Ballard WW , Kimmel SR , Ullmann B , Schilling TF . Stages of embryonic development of the zebrafish . Dev Dyn . 1995 ; 203 ( 3 ): 253 – 310 . OpenUrl CrossRef PubMed Web of Science 47. ↵ Thisse C , Thisse B . High-resolution in situ hybridization to whole-mount zebrafish embryos . Nat Protoc . 2008 ; 3 ( 1 ): 59 – 69 . OpenUrl CrossRef PubMed Web of Science 48. ↵ Brend T , Holley SA . Zebrafish whole mount high-resolution double fluorescent in situ hybridization . J Vis Exp . 2009 ( 25 ). 49. ↵ Doyle EL , Booher NJ , Standage DS , Voytas DF , Brendel VP , Vandyk JK , et al. TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: tools for TAL effector design and target prediction . Nucleic Acids Res . 2012 ; 40 ( Web Server issue ): W117 – 22 . OpenUrl CrossRef PubMed Web of Science 50. ↵ Cermak T , Doyle EL , Christian M , Wang L , Zhang Y , Schmidt C , et al. Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting . Nucleic Acids Res . 2011 ; 39 ( 12 ): e82 . OpenUrl CrossRef PubMed 51. ↵ Liu Y , Zhao H , Cheng CH . Mutagenesis in Xenopus and Zebrafish using TALENs . Methods Mol Biol . 2016 ; 1338 : 207 – 27 . OpenUrl PubMed 52. ↵ Gagnon JA , Valen E , Thyme SB , Huang P , Akhmetova L , Pauli A , et al. Efficient mutagenesis by Cas9 protein-mediated oligonucleotide insertion and large-scale assessment of single-guide RNAs . PLoS One . 2014 ; 9 ( 5 ): e98186 . OpenUrl CrossRef PubMed 53. ↵ Sander V , Salleh L , Naylor RW , Schierding W , Sontam D , O’Sullivan JM , et al. Transcriptional profiling of the zebrafish proximal tubule . Am J Physiol Renal Physiol . 2019 ; 317 ( 2 ): F478 – F88 . OpenUrl CrossRef PubMed 54. ↵ Fatma S , Nayak U , Swain RK . Methods to generate and evaluate zebrafish models of human kidney diseases . Int J Dev Biol . 2021 ; 65 ( 7-8-9 ): 475 – 85 . OpenUrl PubMed View the discussion thread. Back to top Previous Next Posted October 06, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Cfap300 regulates the transdifferentiation of Corpuscle of Stannius cells in zebrafish Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Cfap300 regulates the transdifferentiation of Corpuscle of Stannius cells in zebrafish Usharani Nayak , Kalyani Sahoo , Praveen Barrodia , Rajeeb K. Swain bioRxiv 2025.10.06.680176; doi: https://doi.org/10.1101/2025.10.06.680176 Share This Article: Copy Citation Tools Cfap300 regulates the transdifferentiation of Corpuscle of Stannius cells in zebrafish Usharani Nayak , Kalyani Sahoo , Praveen Barrodia , Rajeeb K. Swain bioRxiv 2025.10.06.680176; doi: https://doi.org/10.1101/2025.10.06.680176 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Developmental Biology Subject Areas All Articles Animal Behavior and Cognition (7622) Biochemistry (17645) Bioengineering (13867) Bioinformatics (41873) Biophysics (21420) Cancer Biology (18550) Cell Biology (25447) Clinical Trials (138) Developmental Biology (13361) Ecology (19866) Epidemiology (2067) Evolutionary Biology (24289) Genetics (15587) Genomics (22473) Immunology (17707) Microbiology (40322) Molecular Biology (17144) Neuroscience (88457) Paleontology (666) Pathology (2826) Pharmacology and Toxicology (4815) Physiology (7634) Plant Biology (15111) Scientific Communication and Education (2042) Synthetic Biology (4285) Systems Biology (9813) Zoology (2268)

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00