Tiled amplicon sequencing of monkeypox virus from wastewater: a novel approach for clade and subclade level differentiation

preprint OA: closed
Full text JSON View at publisher
Full text 161,475 characters · extracted from preprint-html · click to expand
Tiled amplicon sequencing of monkeypox virus from wastewater: a novel approach for clade and subclade level differentiation | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Tiled amplicon sequencing of monkeypox virus from wastewater: a novel approach for clade and subclade level differentiation Mathew Fisher, Jennifer Ali, Shayna Giesbrecht, Raveena Roopra, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6347660/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 11 Aug, 2025 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract Wastewater-based surveillance (WBS) has modernized in recent years and emerged as an important tool for the monitoring of viral pathogens, including monkeypox virus (MPXV). Here we describe a novel targeted amplicon sequencing method developed for clade and subclade characterization of MPXV from municipal wastewater. This new method addresses the limitations of PCR-based methods and the challenges of sequencing a pathogen displaying low viral load in municipal wastewater samples. A tiled amplicon scheme composed of 11 primer pairs targeting a 4.2 kb portion of the inverted terminal repeat (ITR) region of the MPXV genome was designed and tested. In silico analysis demonstrated high accuracy for clade and subclade calls using the full target region, with specific amplicons also exhibiting strong performance individually. An MPXV consensus sequence representing the entire target region was successfully sequenced from a wastewater sample and differentiated from positive controls by a distinct deletion within a short homopolymeric region. Notably, clade-informing data was also achieved from partial sequences recovered from lower abundance samples. This study presents a new sequencing method targeting MPXV with enhanced genomic resolution compared to existing PCR-based approaches, providing critical genomic-level information informing MPXV surveillance and public health interventions. Biological sciences/Molecular biology Health sciences/Diseases/Infectious diseases Health sciences/Diseases/Infectious diseases/Viral infection Biological sciences/Biological techniques/Genomic analysis/Comparative genomics Tiled amplicon sequencing MPOX Wastewater Monkeypox virus Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction Monkeypox virus (MPXV) is an enveloped, double-stranded DNA virus with an approximate genome size of 197 kb and the causative agent of a zoonotic disease called mpox (formerly known as monkeypox). Along with the closely related variola virus, the etiological agent responsible for smallpox, it belongs to the Orthopoxvirus genus. It was first described in 1957 following an outbreak in a Danish monkey colony [ 1 ] with the first human cases detected in the Democratic Republic of the Congo (DRC) in 1970 during the smallpox eradication campaigns [ 2 ]. For the next 50 years it was considered a rare zoonotic disease, endemic to the Central and West African regions and human cases were typically attributed to contact with infected animals. Historically, MPXV has caused rare sporadic disease in African countries up until 2003 when it caused a significant outbreak in the United States due to direct contact with infected prairie dogs imported from Ghana [ 3 ]. This outbreak represented the first MPXV infections outside of the African continent until its re-emergence in 2022 resulting in a global epidemic. From July 2022 until May 2023, the World Health Organization (WHO) declared a public health emergency of international concern (PHEIC) [ 4 ] due to the rapid increase in mpox cases and spread of MPXV clade IIb from the DRC to non-endemic countries including the United Kingdom [ 5 ], Canada [ 6 ] and the USA [ 7 ]. By May 2023, over 88,060 laboratory-confirmed cases and 147 deaths were reported across 120 countries [ 8 ] with the most significantly impacted demographic of the epidemic being men who have sex with men. Although the PHEIC phase of this public health event was declared over in May 2023, clade IIb continued to transmit and cases were detected worldwide. In September 2023, a new outbreak event was detected, emerging from the South Kivu region of the DRC, eventually prompting the WHO declaration of a second PHEIC on August 14, 2024 [ 9 ]. A main contributing factor leading to the declaration of this second PHEIC was the emergence of a new clade I strain designated as clade Ib [ 9 ]. The global public health community, including Canada’s disease surveillance programs are exercising increased vigilance concerning clade Ib, as clade I is considered more virulent than clade II. However, a recent WHO study found only a slight difference at 0.19% and 0.7%, respectively, in the mortality rates of clade IIb and clade Ib lineages responsible for the 2022-23 and 2023-ongoing outbreaks [ 10 ]. Recently, travel associated cases of clade Ib have been reported in a number of countries outside of Africa including Canada [ 11 ], the United States [ 12 ], Germany [ 13 ], India [ 14 ], Sweden [ 15 ], Thailand [ 16 ] and the United Kingdom [ 17 ]. Wastewater-based surveillance (WBS) is an active surveillance strategy that was significantly advanced and deployed for community-level surveillance throughout the coronavirus disease 2019 (COVID-19) pandemic and during that time, demonstrated capacity as a leading indicator of disease incidence [ 18 ], [ 19 ]. Although complementary to traditional clinical surveillance, WBS functions as an unbiased and cost-effective disease monitoring approach that also captures signals shed by infected individuals, including from those displaying mild symptoms or asymptomatic cases. Furthermore, community-level studies have revealed a high correlation between the quantity of viral nucleic acid recovered from wastewater to reported clinical case numbers [ 20 ]. Beyond the COVID-19 pandemic, WBS has been expanded to understand the transmission dynamics of other viral pathogens circulating within a population including influenza virus [ 21 ], [ 22 ], [ 23 ], [ 24 ], [ 25 ], respiratory syncytial virus [ 24 ], [ 25 ], [ 26 ], MPXV [ 27 ], [ 28 ], [ 29 ], [ 30 ], [ 31 ] and dengue virus [ 32 ]. As communities across Canada and globally implement monitoring for the importation of MPXV, including clade Ib, PCR methods targeting a variety of genomic targets have been developed for wastewater testing. However, PCR methods are inherently limited in the amount of genomic information they produce, hindering their capacity for taxonomic classification or rapid detection of new or emerging clades, subclades, or genomic variants. As a result, genomic sequencing can bridge these surveillance gaps. Although several assays are now available for MPXV sequencing, these methods target the complete genome and were developed for and tested on purified clinical specimens. Wastewater presents a unique matrix and with it, unique challenges that may hamper the ease-of-adoption of assays designed for sequencing of clinical specimens. Unlike most clinical specimens, wastewater is a microbially mixed matrix potentially composed of multiple, diverse pathogens shed by a catchment population into an eventual wastewater treatment plant. The detection of a targeted pathogen by PCR or sequencing is further complicated if the pathogen is not abundantly shed, if it is not present in high copy numbers in the feces or urine of infected individuals or if there are low numbers of infected individuals within a wastewater treatment plant’s catchment area. Here, we describe a novel targeted sequencing method and its successful use to detect and differentiate MPXV signals from municipal wastewater samples to the clade and subclade level. Although alternative whole genome targeted sequencing approaches were initially tested, they did not yield MPXV sequences from the wastewater samples tested, likely due to the lower viral load compared to clinical samples. For that reason, we developed a novel set of tiled amplicon sequencing primers, targeting a portion of the genomically variable ITR region [ 33 ], [ 34 ] located at the terminal end of the MPXV genome. Similar tiled amplicon sequencing methods have been described in previous studies for a variety of targets including the widely used ARTIC scheme for targeted SARS-CoV-2 sequencing [ 35 ], [ 36 ]. The method presented in this study improves upon the data obtained by PCR-based methods by providing increased genomic resolution and enabling not only detection of MPXV but also clade and subclade level characterization. Materials and methods Wastewater sample collection Twenty-four hour composite influent wastewater from four different wastewater treatment plant sites in a large Canadian city with a combined catchment population nearing three million were used in this study (Fig. 1 ). Composite wastewater influent samples from each site were collected using an autosampler on a biweekly basis from September to October of 2024 as a total composite volume of 400–500 ml. Sterile polyethylene terephthalate bottles were used for collection and storage. Samples were shipped to the JC Wilt Infectious Diseases Research Centre in Winnipeg, Manitoba on ice and stored at 4°C upon receipt until processing. Capture of MPXV and DNA isolation Initial attempts to concentrate MPXV from wastewater samples were performed following a procedure using Ceres™ immunomagnetic beads currently in use within our laboratory for SARS-CoV-2 WBS using 10 to 40 mL of wastewater 24-hour composite influent. However, due to low recovery of MPXV nucleic acid, the starting volume of wastewater was increased to 120 mL. For method development and as a positive run control, 120 ml of municipal wastewater samples were spiked with commercially available MPXV clade IIb whole genome nucleic acid (AMPLIRUN Monkeypox Virus DNA Control, Vircell, reference # MBC146-R). Samples were centrifuged and nucleic acid extracted from the solid pellet as previously described [ 27 ] with modification of the final elution step to use Qiagen Buffer EB (Qiagen, 19086) instead of RNase-free water. A final purification step was carried out using AMPure XP beads (Beckman Coulter, Brea, California, USA) according to manufacturer's recommendations using an equal volume of sample and beads, 75% ethanol for washes, and 100 µl of nuclease-free water for the final elution step. All results described in this study were obtained using this method, designated as Method E and shown in Figure S1 . Real time quantitative polymerase chain reaction (RT-qPCR) To determine the presence of MPXV in wastewater, samples were screened prior to sequencing using previously published RT-qPCR assays (G2R_G [ 37 ], G2R_NML [ 27 ] and F3L [ 38 ]). PrimeTime Probes (Integrated DNA Technologies) were synthesized with a 5’ 6-FAM fluorophore and 3’ ZEN-Iowa Black FQ quencher. Primer and probe concentrations are as described in the literature [ 27 ], [ 28 ], [ 37 ]. Each PCR reaction was performed in triplicate in a total volume of 20 µL using the QuantiNova Multiplex PCR Kit (Qiagen, 208452) according to the manufacturer’s specifications. The QuantStudio 5 Real-Time PCR System (Applied Biosystems, A28138) was used with the following conditions: 95°C for 2 minutes, followed by 42 cycles of amplification at 95°C for 5 seconds and 60°C for 30 seconds. Samples with a cycle threshold value (C T ) of less than 38 for any one of the three assays were selected for sequencing. PCR assay positive controls consisted of both a high and low concentration of gBlocks® Gene Fragments (Integrated DNA Technologies) for each PCR target. Positive controls included in all runs consisted of gBlock® Gene Fragments (Integrated DNA Technologies) containing the fragment of interest (gBlock sequences and other information available in Table S1 ) at final concentrations of 10 cp/µL and 1000 cp/µL and diluted AMPLIRUN Monkeypox Virus DNA Control at a final concentration of 35 cp/ml (Vircell Molecular, MBC146-R). Quantification of DNA standards The initial concentration of each gBlocks® Gene Fragment (Integrated DNA Technologies) was quantified by digital PCR according to the manufacturer’s recommendations. Briefly, each gene fragment was diluted in nuclease-free water to a calculated concentration of 10,000 cp/ µL and tested in quadruplicate. A reaction mix volume of 9 µL was prepared using Absolute Q DNA Digital PCR MasterMix (5X) (Applied Biosystems, A52490), primer and probe concentrations of 100 µM, and 2 µL of each diluted gene fragment. Absolute quantification was performed using the QuantStudio Absolute Q Digital PCR System (Applied Biosystems, A52864) under the following conditions: activation for 10 minutes at 96°C followed by 40 cycles of 96°C for 5 seconds and 60°C for 15 seconds. Generation of standard curves and determination of PCR assay sensitivity A six-point standard curve from 5 to 500,000 copies per reaction was generated for each qPCR assay using quantified, serially diluted gBlock Gene Fragments (Integrated DNA Technologies) containing the target sequence of the G2R_G, G2R_NML and F3L RT-qPCR assays. Six replicates of each concentration were used per target. The sensitivity of each PCR assay was assessed using serially diluted gBlock Gene Fragments (Integrated DNA Technologies) containing 0.78 to 200 copies per reaction. Twenty replicates of each concentration were tested and a cycle threshold value of less than 40 was interpreted as a positive detection. To calculate the limit of quantification (LOQ), only concentrations in which all replicates were positive were used. The coefficient of variation (CV) was calculated for each concentration tested and fit to a linear regression model linking it to the template concentration [ 39 ]. The LOQ was defined as the concentration at which a CV equal to 35% was achieved as predicted by linear regression [ 39 ]. To determine the limit of detection (LOD), results were converted into binary values (ie. positive and negative detection only) and a probit model was generated to predict the relationship between template concentration and positive detection. The LOD was defined as the lowest concentration at which a positivity rate of 95% was maintained as predicted by the probit model. All modeling was performed in RStudio using the tidyverse set of packages [ 40 ]. Tiled MPXV amplicon scheme design Initial analysis was performed on a database of complete MPXV genomes downloaded from GISAID which were selected to represent the genetic diversity of the virus, including both recent outbreak and historical sequences In order to reduce the redundancy and overall size of the dataset for processing, CD-HIT [ 41 ] was used to cluster and remove sequences with more than 95% sequence identity, resulting in a database of 49 MPXV genome sequences. The sequences were aligned with MAFFT [ 42 ] and the resulting alignment was manually investigated for the presence of variable regions suitable for design of a tiled amplicon scheme allowing for clade and subclade differentiation. This process resulted in the identification of an approximately 4.2 kb portion of the ITR region that was extracted from the alignment for further analysis. CD-HIT [ 41 ] was used to remove redundant sequences with greater than 99% identity, resulting in a final database of nine sequences spanning the target region which was used for subsequent assay design. A tiled amplicon scheme was designed with PrimalScheme v.1.3.2 [ 43 ] using the final database of nine MPXV sequences. The resulting scheme consisted of 11 primer pairs generating PCR products ranging from 490 to 516 bp (Table 1 ). The primers were mapped to a whole genome database of representative MPXV sequences using Geneious Prime v2025.0.2 [ 44 ] to screen for mismatches that could impact primer binding efficiency. This database consisted of recent whole genome sequences representing MPXV subclades from all global regions with collection dates starting January 1, 2023, downloaded from GISAID [ 45 ] on November 20, 2024 with the “complete” and “low coverage excl” filters enabled. The only exception was clade IIa which had no sequences in the GISAID repository within the specified collection dates, so two historical sequences from the USA and Liberia isolated in 1962 and 1970 were used for analysis (GISAID accession EPI_ISL_13056556 and EPI_ISL_13058405, respectively). Table 1 MPXV 4.2kb ITR tiled amplicon sequencing primers and amplicons. For each primer, two primer binding location ranges (with position values relative to reference NC_063383.1) are shown since the MPXV genome contains two ITRs and therefore each primer has two separate binding locations. Amplicon Size (bp) Primer Name Primer Sequence (5' to 3') Primer Binding Coordinates 516 hMpxV_J1-J3_1_LEFT TAACGCATTTATGGACGACGGT 4,530–4,551; 192,659 − 192,680 hMpxV_J1-J3_1_RIGHT TGGAACGCGGATATGTGTTTACA 4,036 − 4,058; 193,152–193,174 495 hMpxV_J1-J3_2_LEFT ACAAATTATTGACTAAAGGATCTGACCC 4,102–4,129; 193,081–193,108 hMpxV_J1-J3_2_RIGHT ACCGTAGTATATTGAGAGAGCGACT 3,635–3,659; 193,551 − 193,575 506 hMpxV_J1-J3_3_LEFT TGGCACGAACAAAAATACGGGA 3,725–3,746; 193,464 − 193,485 hMpxV_J1-J3_3_RIGHT ACACTTTTATAGTCCTCGTTTAAACAGA 3,241–3,268; 193,942 − 193,969 510 hMpxV_J1-J3_4_LEFT TCTCCCTACGACGATCACTACG 3,332–3,353; 193,857 − 193,878 hMpxV_J1-J3_4_RIGHT TGGATAATATTTGTAATGGTTCTTTCCGT 2,844–2,872; 194,338 − 194,366 492 hMpxV_J1-J3_5_LEFT GACTATCGTATTTGCCTCCGGA 2,929–2,950; 194,260 − 194,281 hMpxV_J1-J3_5_RIGHT CGCGTCTCTACCTGATTACTATCAC 2,459–2,483; 194,727 − 194,751 509 hMpxV_J1-J3_6_LEFT CGTGTGGTTCGGATACCTTTACA 2,530–2,552; 194,658 − 194,680 hMpxV_J1-J3_6_RIGHT TGCTACATTATTAAGGACAGAGAAGTATTC 2,044 − 2,073; 195,137–195,166 498 hMpxV_J1-J3_7_LEFT AACTATATCGATGTGGAAATTAACCTGT 2,193–2,220; 194,990 − 195,017 hMpxV_J1-J3_7_RIGHT GGAATTAGTGATCAGTTTATGTATATCGCA 1,723–1,752; 195,458 − 195,487 512 hMpxV_J1-J3_8_LEFT AGCGTCGACATCTACATACTATATAGT 1,840–1,866; 195,344 − 195,370 hMpxV_J1-J3_8_RIGHT TCGGATACCTCATCATCTTCGGT 1,355–1,377; 195,833 − 195,855 491 hMpxV_J1-J3_9_LEFT CACAAAGCAAGACCAAACACCG 1,420–1,441; 195,769 − 195,790 hMpxV_J1-J3_9_RIGHT CCTCACACATGTCTCCGATACG 951–972; 196,238 − 196,259 512 hMpxV_J1-J3_10_LEFT TAGATTGTCCAGCGTGTCACC 1,202–1,222; 195,988 − 196,008 hMpxV_J1-J3_10_RIGHT GTAGTTAAATATTTTTGTTTTGCAAACCGG 711–740; 196,470 − 196,499 490 hMpxV_J1-J3_11_LEFT TCATCTGAAAATGGATGAGTTGGGT 796–820; 196,390 − 196,414 hMpxV_J1-J3_11_RIGHT GAGCAGTGTCCCCTACATGGAT 331–352; 196,858 − 196,879 In silico tiled sequencing primer scheme evaluation The database of recent MPXV whole genome sequences described in the previous section for screening of primer binding efficiency was used for subsequent in silico analysis. The sequences were aligned using MAFFT [ 42 ] and the whole target region of the tiled amplicon scheme, excluding the terminal primer binding sites, was extracted from the alignments using Geneious Prime v2025.0.2 [ 44 ]. The resulting sequences were filtered using Cutadapt[ 46 ] in order to remove sequences with more than 10% ambiguous (N) bases. The filtered sequences were then analyzed using Nextclade (v3.10.0, Mpox virus (All clades) reference dataset) [ 47 ] and the resulting clade assignments were compared to those from GISAID metadata in order to assess the clade differentiation capability and accuracy of the tiled amplicon scheme. Similar analysis was also performed on each of the 11 individual amplicon regions to assess their capacity to differentiate clades with incomplete target region coverage. Using the MPXV alignments generated previously for whole target region in silico analysis, the primers targeting each amplicon were mapped and each amplicon region, excluding the primer binding sites (coordinates show in Table 1 ), was extracted using Geneious [ 44 ]. The resulting sequences were filtered to remove sequences with any ambiguous bases (N) using Cutadapt [ 46 ]. This ambiguous base filtering cut-off was selected because due to the nature of PCR amplification, any amplicons that amplified efficiently should have complete coverage across their entire length. Similar to the whole genome sequence analysis, filtered sequences were analyzed using Nextclade (v3.10.0, Mpox virus (All clades) reference dataset) [ 47 ] and clade assignments were compared to those from GISAID metadata. PCR amplification and next generation sequencing Amplicons were generated using the Q5 Hot Start High-Fidelity DNA Polymerase kit (NEB, Massachusetts, USA; M0493S). For each sample, two PCR reactions were prepared, using either primer pool 1 (containing primers for odd-numbered amplicons) or primer pool 2 (containing primers for even-numbered amplicons) and the products of each primer pool were combined post-amplification. PCR master mixes were prepared using 5 µL of extracted nucleic acid, 12.5 µL of 5X Q5 Reaction Buffer, 1.44 µM of either pool 1 or 2 (3.6µL of a 10 µM pooled primer stock) and nuclease-free water up to a total volume of 25 µL. PCR was carried out at 98°C for 3 minutes, followed by 35 cycles of 98°C for 15 seconds and 61°C for 5 minutes, with a final hold at 4°C using an Eppendorf Mastercycler Nexus Gradient GSX1 Thermal Cycler (Fisher Scientific, E6332000029). All runs included a MPXV clade IIb positive control sample consisting of diluted AMPLIRUN Monkeypox Virus DNA Control (Vircell Molecular, MBC146-R). Additionally, non-MPXV Orthopoxvirus positive control DNA (vaccina virus Western Reserve), was amplified and sequenced to confirm that sequencing results could be differentiated from MPXV. The PCR products were run on a 4200 Tapestation System (Aglient Technologies, G2991BA) with a D5000 ScreenTape System (Agilent Technologies, 5067–5588, 5067–5589, 5067–5590) for confirmation of successful amplification following the standard manufacturer’s protocol. Quantification of each sample was done with a Qubit dsDNA Quantification Assay Kit (ThermoFisher Scientific, Q32851) on a Qubit Flex Fluorometer (ThermoFisher Scientific, Q33327) and Picogreen dsDNA Reagent (Invitrogen, P7581) using a FilterMax F5 Multi-Mode Microplate Reader (Molecular Devices, F5). Sequencing library preparation was performed on prepared amplicons using the Nextera XT library preparation kit (Illumina) as per manufacturer’s instructions. Libraries were quantified, pooled and sequenced on an Illumina NextSeq 2000 using a P2 600 cycle kit (Illumina). Sequence assembly and analysis Quality and primer trimming, read mapping, consensus sequence generation and clade assignment were performed using the nf-core/viralrecon v2.6.0 pipeline [ 48 ] using MPXV isolate M5312_HM12_Rivers (NCBI accession NC_063383.1), trimmed to the target PCR region excluding external primer binding regions, as the reference sequence (reference FASTA used included in supplementary materials). The pipeline was run using the viralrecon amplicon protocol [ 48 ] and a custom primer BED file containing the positions of the primers relative to the reference in order to enable trimming of primer sequences (primer BED file used included as supplementary materials). Clade assignment using Nextclade was enabled using the hMPXV nextclade dataset included in the pipeline at the time of analysis (v2.12.0). Due to the version of Nextclade included in the pipeline not being the most current, assembled consensus sequences were also analyzed using the browser version of Nextclade (v3.10.0, Mpox virus (All clades) reference dataset) to verify clade and sub-clade assignment calls. To further confirm the presence or absence of MPXV, the resulting consensus sequences were queried against the NCBI core nucleotide database using blastn [ 49 ]. Additionally, raw sequencing reads were taxonomically classified using Kraken2 [ 50 ] and subsequently visualized using Pavian [ 51 ]. Phylogenetic analysis The MPXV genome database of extracted genome sequences corresponding to the 4.2 kb tiled amplicon target region used previously for in silico primer specificity testing, was used for phylogenetic analysis. To remove sequences with any ambiguous bases, the database was filtered with Cutadapt [ 46 ]. The resulting sequence database was further filtered with CD-HIT [ 41 ] using a sequence identity threshold of 0.9995 in order to remove redundant or highly similar sequences, resulting in a final database of 19 representative MPXV sequences. These sequences were aligned to wastewater and positive control derived consensus sequences generated by in-house sequencing using MAFFT [ 42 ]. A phylogenetic tree was generated using IQ-TREE [ 52 ] on the find best model setting with ModelFinder [ 53 ] (Best-fit model selected: K3Pu + F) with 1000 ultrafast bootstraps [ 54 ] and then visualized using iTOL [ 55 ] with a vaccinia Western Reserve virus consensus sequence (NML collection) chosen as the outgroup for rooting. Results Recovery of MPOX material from Wastewater samples The recovery of MPOX material from wastewater samples was complicated by the low abundance of this pathogen in the tested municipal wastewater samples. Within the study period, a total of 196 MPOX clinical MPOX cases were reported nationally in Canada which represents less than 0.0005% of the total population. In addition to the described here, a number of other processing methods were attempted for recovery of MPXV genomic DNA. However, due to limited available volumes of wastewater samples, a detailed side-by-side comparison of the methods processed with the same samples was not able to be performed. In total six methods were evaluated using positive control nucleic acid (AMPLIRUN Monkeypox Virus DNA Control, Vircell Molecular, MBC146-R). Four of these methods did not generate reads mapping to MPXV from any of the tested wastewater samples. A schematic describing all trialed methods is shown in the supplementary materials (Figure S1 ) with the metod used to generate the wastewater-derived sequences presented in this study (method E) indicated with a black box. qPCR sensitivity analysis The sensitivity of the qPCR assays targeting the ITR (G2R_G [ 37 ] and G2R_NML [ 27 ]) and F3L [ 38 ] genes were evaluated using gBlock® Gene Fragments (Integrated DNA Technologies) containing the relevant PCR target, which were quantified by digital PCR. Although the dilutions tested with digital PCR were initially estimated to be approximately 10,000 cp/uL based on manufacturer-provided information, the absolute concentrations were determined to be 8,044 cp/uL, 5,005 cp/uL, and 6,821 cp/uL for the gene fragments containing the PCR targets for G2R_G, G2R_NML, and F3L, respectively. Consequently, all calculations for generating the standard curves and assessing qPCR assay sensitivity were adjusted to reflect the absolute concentrations obtained via digital PCR. The PCR efficiencies for each of the assays were within the desired range of 90–110% [ 56 ] with values of 99.6%, 97.0%, and 94.1% for the G2R_G, G2R_NML, and F3L assays, respectively. The log-linear linear correlation and PCR efficiencies of the G2R_G, G2R_NML, F3L assays are shown in Figure S2. The qPCR assays had calculated LOQs ranging from 5.35 to 12.6 copies per reaction while LODs ranged from 1.91 to 4.13 copies per reaction for each assay (Figures S3, S4). Results from these three qPCR assays were used as an initial screening strategy to detect the presence of MPXV DNA in wastewater samples. Wastewater samples were selected for subsequent sequencing if they produced a qPCR Ct value ≤ 38 with any of the three assays. In silico tiled sequencing primer scheme specificity A total of 1,482 MPXV sequences were retained for in silico analysis following ambiguous base filtering. Using the entire 4.2 kb tiled amplicon target region, clade level calls were consistent with the clade listed on GISAID meta-data for all sequences analyzed. At the subclade level, the amplicon region-derived calls were 100% consistent with GISAID meta-data for all subclade Ib, IIa and IIb sequences. Two subclade Ia samples (of 80 total) were called only to the clade level (ie. called as clade I only), resulting in a subclade level accuracy of 97.5% (Table 2 ). Table 2 In silico clade and subclade level call percent accuracy for both the whole target region and individual amplicons. Raw numbers used to calculate percentages are also available in supplementary materials (Table S2). Clade Amplicon All 1 2 3 4 5 6 7 8 9 10 11 Clade level accuracy Ia 100% 0.0% 100% 97.2% 100% 100% 0.0% 1.2% 0.0% 0.0% 0.0% 0.0% Ib 100% 16.7% 100% 0.0% 100% 100% 0.0% 0.0% 0.0% 0.0% 0.0% 0.0% IIa 100% 50.0% 100% 0.0% 100% 100% 100% 100% 100% 0.0% 0.0% 0.0% IIb 100% 0.0% 96.3% 100% 100% 100% 100% 100% 100% 0.0% 0.0% 0.0% Subclade level Accuracy Ia 97.5% 0.0% 24.4% 97.2% 98.6% 0.0% 0.0% 1.2% 0.0% 0.0% 0.0% 0.0% Ib 100% 16.7% 0.0% 0.0% 100% 0.0% 0.0% 0.0% 0.0% 0.0% 0.0% 0.0% IIa 100% 50.0% 100% 0.0% 100% 0.0% 100% 0.0% 100% 0.0% 0.0% 0.0% IIb 100% 0.0% 96.3% 100% 100% 96.6% 1.7% 100% 100% 0.0% 0.0% 0.0% A similar in silico analysis was performed on each of the 11 individual amplicons (Table 2 ). At the clade level, amplicons 4 and 5 correctly identified all sequences analyzed while amplicon 2 correctly identified all clade Ia, Ib and IIa sequences and over 96% of clade IIb sequences analyzed (1,334 of 1,385 total). At the subclade level, amplicon 4 correctly identified all subclade Ib, IIa and IIb sequences and over 98% of subclade Ia sequences analyzed (69 of 70 total). The remaining amplicons not specifically mentioned had varying degrees of accuracy depending on the clade or subclade of the sample as shown in Table 2 . Wastewater-derived consensus sequence analysis A total of 23 wastewater samples were processed and sequenced using the method described in this study. Seven processed wastewater samples generated a minimum of 1,000 reads mapping to the MPXV reference sequence in at least one of three replicates sequenced (one sample did not have any replicates). Of these seven samples, three were positive in all three replicates, two were positive in two of three replicates, one was positive in one of three replicates and for one sample, only a single replicate was positive. Sample to sample variation included the breadth of target region coverage or total read depth per each amplicon, as shown in Fig. 2 . The 15 wastewater-derived MPXV consensus sequences were aligned using MAFFT [ 42 ] and found to be identical to each other in overlapping regions. Therefore, a representative high-quality consensus sequence with complete breadth of target region coverage was selected for a more detailed genomic analysis (assembled representative consensus sequence available in supplementary materials). A 4,169 bp consensus sequence covering the complete target region was assembled from wastewater-derived sequencing reads. To ensure that the assembled sequence was not the result of contamination from MPXV positive control material included on the same sequencing run, the sequences of the wastewater and positive control derived consensus sequences were aligned. The sequences showed a high degree of similarity, however were distinct based on a homopolymeric stretch within an intergenic region of amplicon 11. While the MPXV-derived positive control had a stretch of 17 consecutive thymidines, the wastewater-derived consensus had a deletion of 8 thymidines (Fig. 3 , panel C). This length of this deletion was consistent across all three replicates for this sample, which were PCR amplified, sequenced and analyzed separately. While all three replicates harboured this unique deletion, two of the replicates were missing a single amplicon (Fig. 2 ) and therefore did not include the entire target region but were otherwise identical in overlapping regions. Based on viralrecon-generated primer-trimmed alignments, the replicate with coverage across the entire target region had a minimum read-depth coverage of 74 and a mean of 8,282 reads (Fig. 3 , panel B). A query against the NCBI core nucleotide database (performed January 20, 2025) via blastn [ 49 ] showed that the wastewater-derived MPXV consensus sequence was identical to a number of recent MPXV sequence submissions collected from various locations including the USA, Australia and South Africa which also harbour this 8 nucleotide deletion (Fig. 3 , panel C). Phylogenetic Analysis In-house generated consensus sequences of the target region from MPXV clade Ib, MPXV clade IIb and vaccinia virus Western Reserve material as well the wastewater derived MPXV sequence were included in phylogenetic analysis with a subset of MPXV sequences downloaded from GISAID (Fig. 4 ). All samples included in the analysis clustered as expected, with the vaccinia virus and each individual MPXV subclade forming distinct clade-specific branches within the phylogenetic tree. The wastewater-derived consensus sequence clustered with the clade IIb sequences. This result is consistent both with the results of other sequence analysis presented in this study and the expected clade from the sampling site based on reported clinical cases in Canada [ 57 ], which with the exception of a single case reported in November 2024, have been uniquely typed as clade II. Discussion This study describes a start-to-finish laboratory workflow for the extraction and sequencing of low-abundance MPXV from complex wastewater samples. Previously published qPCR assays were employed as a rapid screen to determine whether MPXV could potentially be sequenced from wastewater samples. This screening approach advantageously reduces the risk of performing costly PCR and sequencing reactions on samples that do not contain MPXV. Coupled with a novel tiled amplicon sequencing approach targeting the genetically variable ITR region, this method was used to generate epidemiologically informative sequences permitting clade and subclade level identification of wastewater-derived MPXV sequences. A 4.2kb portion of the ITR was selected as the target region for two major reasons; first, this region contains lineage-delineating mutations that allow for MPXV clade and subclade assignment, and second, there are two copies per genome, which effectively doubles the amount of viral starting material. This duplication was important due to the low quantity of MPXV in wastewater, resulting from the significantly reduced clinical incidence of MPXV compared to other viruses currently circulating in the Canadian population, such as SARS-CoV-2, which are also shed into the wastewater. In contrast to whole genome sequencing approaches, only a portion of the genome was targeted due to the low quantity of MPXV in wastewater samples, as well as the high propensity for primer dimer formation when using the large number of primer pairs required to tile across a genome of approximately 197 kb (estimated at 400 primer pairs with an amplicon length of 500 bp). Importantly, this assay was developed in response to a lack of recovered MPXV sequences from wastewater samples using published whole genome sequence assays designed for clinical sequencing [ 58 ]. The entire 4.2kb tiled amplicon target region, composed of 11 separate amplicons, was successfully used to characterize MPXV consensus sequences derived from municipal wastewater to both the clade and subclade level. Based on the results of in silico analysis, all sequences included were correctly called to the clade level. At the subclade level, all clade Ib, IIa and IIb sequences and over 97% of clade Ia sequences were correctly identified. Since wastewater samples typically contain only low concentrations of viral nucleic acid and contaminants which may inhibit amplification and sequencing, the clade and subclade differentiation capability with only partial target region coverage was also assessed. In silico analysis performed separately on each of the 11 amplicons showed that for clade level differentiation, amplicons 4 and 5 were the most accurate and identified all sequences included in the analysis. Amplicon 2 also showed high clade level accuracy, correctly identifying 100% of clade Ia, Ib and IIa sequences and over 96% of clade IIb sequences. For subclade level differentiation amplicon 4 was the most accurate, correctly calling the subclade of all Ib, IIa and IIb sequences and over 98% of clade Ia sequences. Despite the limited clade and subclade differentiation ability of the less specific amplicons, they still may provide valuable genomic information. For example, amplicon 11 contained a deletion in a homopolymeric region of the wastewater-derived consensus sequence which allowed for source attribution and differentiation from MPXV control material. The capability of the tiled amplicon sequencing method to identify and characterize MPXV in practice was demonstrated through the assembly of MPXV consensus sequences from wastewater samples. The presence of MPXV was verified by Kraken2 [ 50 ] taxonomic classification of raw sequencing reads as well as Nextclade [ 47 ] analysis and a blastn [ 49 ] query of the MPXV consensus sequence assembled via viralrecon [ 48 ] analysis. Although positive MPXV control material was included on the same run, differences in the length of a homopolymeric stretch between consensus sequences supported the wastewater-derived consensus sequence being from a distinct source. The wastewater-derived MPXV consensus sequence was identified as clade IIb based on results from Nextclade [ 47 ], phylogenetic analysis and blastn [ 49 ] query results. These result are also consistent with clinical data available from the collection area which are solely classified as clade IIb. To date Canada has only reported a single clinical clade Ib case which was from a region not included in this analysis. In summary, we have described the development, validation and deployment of a new tiled amplicon sequencing approach following the concentration and extraction of MPXV nucleic acid from wastewater samples. While this manuscript was in preparation, the authors became aware of approaches under development for tiled amplicon sequencing of MPXV from wastewater [ 59 ], [ 60 ]. However, to the best of our knowledge, this is the first description of a tiled amplicon sequencing method that enables clade and subclade determination of MPXV from municipal wastewater samples. Although tiled amplicon strategies have been developed for several pathogenic RNA viruses, including SARS-CoV-2, [ 35 ], [ 36 ] Zika, [ 43 ] Dengue, [ 61 ] and Ebolaviruses, [ 62 ] our study contributes to the literature by describing a low-cost, low-complexity protocol for concentrating a large DNA virus from wastewater, followed by tiled amplicon sequencing of an epidemiologically informative genomic region of a low abundance pathogen. Declarations Acknowledgements We would like to thank all participating municipalities included in this study, including the wastewater treatment plant operators who collected the samples. We would also like to acknowledge the support from Statistics Canada National Wastewater Survey program for assistance collect the wastewater samples used in this study. Further acknowledgments are extended to the PHAC-NML Genomics and RSL core groups for their assistance with this project. Author contributions Conceptualization – C.L.; Methodology – M.F., J.A., S.G. and C.L.; Bioinformatic analysis and support – M.F. and N.D.; Laboratory processing – J.A., S.G., R.R. and V.C.; Writing of original draft – M.F., J.A., S.G. and C.L.; Design of tiled primer scheme – C.B.; All authors reviewed and corrected the manuscript for submission. Data availability All raw wastewater sequencing data are available via the NCBI Sequence Read Archive under the BioProject ID PRJNA1241250 available at: https://www.ncbi.nlm.nih.gov/bioproject/PRJNA1241250. Competing interests The authors declare no competing interests. References S. Parker and R. M. Buller, “A review of experimental and natural infections of animals with monkeypox virus between 1958 and 2012,” Future Virol. , vol. 8, no. 2, pp. 129–157, Feb. 2013, doi: 10.2217/fvl.12.130. J. P. S. Begum, L. Ngangom, P. Semwal, S. Painuli, R. Sharma, and A. Gupta, “Emergence of monkeypox: a worldwide public health crisis,” Hum. Cell , vol. 36, no. 3, pp. 877–893, 2023, doi: 10.1007/s13577-023-00870-1. J. Guarner et al. , “Monkeypox Transmission and Pathogenesis in Prairie Dogs,” Emerg. Infect. Dis. , vol. 10, no. 3, pp. 426–431, Mar. 2004, doi: 10.3201/eid1003.030878. “WHO Director-General declares the ongoing monkeypox outbreak a Public Health Emergency of International Concern.” Accessed: Nov. 26, 2024. [Online]. Available: https://www.who.int/europe/news/item/23-07-2022-who-director-general-declares-the-ongoing-monkeypox-outbreak-a-public-health-event-of-international-concern “Monkeypox cases confirmed in England – latest updates,” GOV.UK. Accessed: Jan. 07, 2025. [Online]. Available: https://www.gov.uk/government/news/monkeypox-cases-confirmed-in-england-latest-updates Public Health Agency of Canada, “Epidemiological summary report: 2022-2023 mpox outbreak in Canada.” Accessed: Jan. 06, 2025. [Online]. Available: https://www.canada.ca/en/public-health/services/publications/diseases-conditions/epidemiological-summary-report-2022-23-mpox-outbreak-canada.html J. H. McQuiston et al. , “The CDC Domestic Mpox Response — United States, 2022–2023,” MMWR Morb. Mortal. Wkly. Rep. , vol. 72, no. 20, pp. 547–552, May 2023, doi: 10.15585/mmwr.mm7220a2. “WHO Health Emergency Dashboard.” Accessed: Mar. 24, 2025. [Online]. Available: https://extranet.who.int/publicemergency/# “WHO Director-General declares mpox outbreak a public health emergency of international concern.” Accessed: Nov. 23, 2024. [Online]. Available: https://www.who.int/news/item/14-08-2024-who-director-general-declares-mpox-outbreak-a-public-health-emergency-of-international-concern L. Subissi, “Overview of clinical characteristics of various MPXV clades.” Accessed: Feb. 06, 2025. [Online]. Available: https://cdn.who.int/media/docs/default-source/consultation-rdb/overview-of-clinical-characteristics-of-various-clades.pdf?sfvrsn=78263ab0_3 Public Health Agency of Canada, “Public Health Agency of Canada confirms the first case of clade I mpox in Canada.” Accessed: Nov. 28, 2024. [Online]. Available: https://www.canada.ca/en/public-health/news/2024/11/public-health-agency-of-canada-confirms-the-first-case-of-clade-i-mpox-in-canada.html CDC, “California confirms first clade I mpox case,” CDC Newsroom. Accessed: Nov. 28, 2024. [Online]. Available: https://www.cdc.gov/media/releases/s1116-california-first-clade.html “Confirmed mpox clade Ib case in Germany, risk remains low for EU/EEA.” Accessed: Nov. 28, 2024. [Online]. Available: https://www.ecdc.europa.eu/en/news-events/confirmed-mpox-clade-ib-case-germany-risk-remains-low-eueea National Centre for Disease Control, and Directorate General of Health Services, Government of India, “CD Alert - October, 2024.” [Online]. Available: https://ncdc.mohfw.gov.in/wp-content/uploads/2024/10/Revised-CD-Alert-Mpox-1.pdf “One case of mpox clade 1 reported in Sweden - The Public Health Agency of Sweden.” Accessed: Nov. 28, 2024. [Online]. Available: https://www.folkhalsomyndigheten.se/the-public-health-agency-of-sweden/communicable-disease-control/disease-information-about-mpox/one-case-of-mpox-clade-i-reported-in-sweden/ “DDC reports the first suspected case of Mpox Clade I in Thailand; the patient traveled from Africa and tests are ongoing to confirm the strain.” Accessed: Nov. 28, 2024. [Online]. Available: https://ddc.moph.go.th/oic/news.php?news=45683&deptcode=oic “Latest update on cases of Clade Ib mpox,” GOV.UK. Accessed: Nov. 28, 2024. [Online]. Available: https://www.gov.uk/government/news/ukhsa-detects-first-case-of-clade-ib-mpox H. Schenk, W. Rauch, A. Zulli, and A. B. Boehm, “SARS-CoV-2 surveillance in US wastewater: Leading indicators and data variability analysis in 2023–2024,” PLOS ONE , vol. 19, no. 11, p. e0313927, Nov. 2024, doi: 10.1371/journal.pone.0313927. A. K. Overton et al. , “Genomic surveillance of Canadian airport wastewater samples allows early detection of emerging SARS-CoV-2 lineages,” Sci. Rep. , vol. 14, p. 26534, Nov. 2024, doi: 10.1038/s41598-024-76925-6. S. Nourbakhsh et al. , “A wastewater-based epidemic model for SARS-CoV-2 with application to three Canadian cities,” Epidemics , vol. 39, p. 100560, Jun. 2022, doi: 10.1016/j.epidem.2022.100560. E. Mercier et al. , “Municipal and neighbourhood level wastewater surveillance and subtyping of an influenza virus outbreak,” Sci. Rep. , vol. 12, p. 15777, Sep. 2022, doi: 10.1038/s41598-022-20076-z. R. Markt et al. , “Expanding the Pathogen Panel in Wastewater Epidemiology to Influenza and Norovirus,” Viruses , vol. 15, no. 2, p. 263, Jan. 2023, doi: 10.3390/v15020263. V. Vo et al. , “Identification and genome sequencing of an influenza H3N2 variant in wastewater from elementary schools during a surge of influenza A cases in Las Vegas, Nevada,” Sci. Total Environ. , vol. 872, p. 162058, May 2023, doi: 10.1016/j.scitotenv.2023.162058. H. Ando, W. Ahmed, R. Iwamoto, Y. Ando, S. Okabe, and M. Kitajima, “Impact of the COVID-19 pandemic on the prevalence of influenza A and respiratory syncytial viruses elucidated by wastewater-based epidemiology,” Sci. Total Environ. , vol. 880, p. 162694, Jul. 2023, doi: 10.1016/j.scitotenv.2023.162694. D. Toribio-Avedillo et al. , “Monitoring influenza and respiratory syncytial virus in wastewater. Beyond COVID-19,” Sci. Total Environ. , vol. 892, p. 164495, Sep. 2023, doi: 10.1016/j.scitotenv.2023.164495. B. Hughes et al. , “Respiratory Syncytial Virus (RSV) RNA in Wastewater Settled Solids Reflects RSV Clinical Positivity Rates,” Environ. Sci. Technol. Lett. , vol. 9, no. 2, pp. 173–178, Feb. 2022, doi: 10.1021/acs.estlett.1c00963. E. M. Mejia et al. , “Detection of mpox virus in wastewater provides forewarning of clinical cases in Canadian cities,” Sci. Total Environ. , vol. 933, p. 173108, Jul. 2024, doi: 10.1016/j.scitotenv.2024.173108. J. Oghuan et al. , “Wastewater analysis of Mpox virus in a city with low prevalence of Mpox disease: an environmental surveillance study,” Lancet Reg. Health - Am. , vol. 28, p. 100639, Nov. 2023, doi: 10.1016/j.lana.2023.100639. I. Girón-Guzmán et al. , “Spanish wastewater reveals the current spread of Monkeypox virus,” Water Res. , vol. 231, p. 119621, Mar. 2023, doi: 10.1016/j.watres.2023.119621. D. A. Bowes et al. , “Enhanced detection of mpox virus in wastewater using a pre-amplification approach: A pilot study informing population-level monitoring of low-titer pathogens,” Sci. Total Environ. , vol. 903, p. 166230, Dec. 2023, doi: 10.1016/j.scitotenv.2023.166230. K. Brighton, S. Fisch, H. Wu, K. Vigil, and T. G. Aw, “Targeted community wastewater surveillance for SARS-CoV-2 and Mpox virus during a festival mass-gathering event,” Sci. Total Environ. , vol. 906, p. 167443, Jan. 2024, doi: 10.1016/j.scitotenv.2023.167443. M. K. Wolfe et al. , “Wastewater Detection of Emerging Arbovirus Infections: Case Study of Dengue in the United States,” Environ. Sci. Technol. Lett. , vol. 11, no. 1, pp. 9–15, Jan. 2024, doi: 10.1021/acs.estlett.3c00769. A. Karagoz et al. , “Monkeypox (mpox) virus: Classification, origin, transmission, genome organization, antiviral drugs, and molecular diagnosis,” J. Infect. Public Health , vol. 16, no. 4, pp. 531–541, Apr. 2023, doi: 10.1016/j.jiph.2023.02.003. “Genus: Orthopoxvirus | ICTV.” Accessed: Nov. 25, 2024. [Online]. Available: https://ictv.global/report/chapter/poxviridae/poxviridae/orthopoxvirus J. Quick, “nCoV-2019 sequencing protocol,” Jan. 2020, Accessed: Feb. 06, 2025. [Online]. Available: https://www.protocols.io/view/ncov-2019-sequencing-protocol-bbmuik6w J. R. Tyson et al. , “Improvements to the ARTIC multiplex PCR method for SARS-CoV-2 genome sequencing using nanopore,” BioRxiv Prepr. Serv. Biol. , p. 2020.09.04.283077, Sep. 2020, doi: 10.1101/2020.09.04.283077. Y. Li, H. Zhao, K. Wilkins, C. Hughes, and I. K. Damon, “Real-time PCR assays for the specific detection of monkeypox virus West African and Congo Basin strain DNA,” J. Virol. Methods , vol. 169, no. 1, pp. 223–227, Oct. 2010, doi: 10.1016/j.jviromet.2010.07.012. R. A. Maksyutov, E. V. Gavrilova, and S. N. Shchelkunov, “Species-specific differentiation of variola, monkeypox, and varicella-zoster viruses by multiplex real-time PCR assay,” J. Virol. Methods , vol. 236, pp. 215–220, Oct. 2016, doi: 10.1016/j.jviromet.2016.07.024. A. Forootan, R. Sjöback, J. Björkman, B. Sjögreen, L. Linz, and M. Kubista, “Methods to determine limit of detection and limit of quantification in quantitative real-time PCR (qPCR),” Biomol. Detect. Quantif. , vol. 12, pp. 1–6, Apr. 2017, doi: 10.1016/j.bdq.2017.04.001. H. Wickham et al. , “Welcome to the Tidyverse,” J. Open Source Softw. , vol. 4, no. 43, p. 1686, Nov. 2019, doi: 10.21105/joss.01686. W. Li and A. Godzik, “Cd-hit: a fast program for clustering and comparing large sets of protein or nucleotide sequences,” Bioinformatics , vol. 22, no. 13, pp. 1658–1659, Jul. 2006, doi: 10.1093/bioinformatics/btl158. K. Katoh and D. M. Standley, “MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability,” Mol. Biol. Evol. , vol. 30, no. 4, pp. 772–780, Apr. 2013, doi: 10.1093/molbev/mst010. J. Quick et al. , “Multiplex PCR method for MinION and Illumina sequencing of Zika and other virus genomes directly from clinical samples,” Nat. Protoc. , vol. 12, no. 6, pp. 1261–1276, Jun. 2017, doi: 10.1038/nprot.2017.066. M. Kearse et al. , “Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data,” Bioinformatics , vol. 28, no. 12, pp. 1647–1649, Jun. 2012, doi: 10.1093/bioinformatics/bts199. S. Khare et al. , “GISAID’s Role in Pandemic Response,” China CDC Wkly. , vol. 3, no. 49, pp. 1049–1051, Dec. 2021, doi: 10.46234/ccdcw2021.255. M. Martin, “Cutadapt removes adapter sequences from high-throughput sequencing reads,” EMBnet.journal , vol. 17, no. 1, Art. no. 1, May 2011, doi: 10.14806/ej.17.1.200. I. Aksamentov, C. Roemer, E. B. Hodcroft, and R. A. Neher, “Nextclade: clade assignment, mutation calling and quality control for viral genomes,” J. Open Source Softw. , vol. 6, no. 67, p. 3773, Nov. 2021, doi: 10.21105/joss.03773. H. Patel et al. , nf-core/viralrecon: nf-core/viralrecon v2.6.0 - Rhodium Raccoon . (Mar. 23, 2023). Zenodo. doi: 10.5281/zenodo.7764938. S. F. Altschul, W. Gish, W. Miller, E. W. Myers, and D. J. Lipman, “Basic local alignment search tool,” J. Mol. Biol. , vol. 215, no. 3, pp. 403–410, Oct. 1990, doi: 10.1016/S0022-2836(05)80360-2. D. E. Wood, J. Lu, and B. Langmead, “Improved metagenomic analysis with Kraken 2,” Genome Biol. , vol. 20, no. 1, p. 257, Nov. 2019, doi: 10.1186/s13059-019-1891-0. F. P. Breitwieser and S. L. Salzberg, “Pavian: interactive analysis of metagenomics data for microbiome studies and pathogen identification,” Bioinforma. Oxf. Engl. , vol. 36, no. 4, pp. 1303–1304, Feb. 2020, doi: 10.1093/bioinformatics/btz715. B. Q. Minh et al. , “IQ-TREE 2: New Models and Efficient Methods for Phylogenetic Inference in the Genomic Era,” Mol. Biol. Evol. , vol. 37, no. 5, pp. 1530–1534, May 2020, doi: 10.1093/molbev/msaa015. S. Kalyaanamoorthy, B. Q. Minh, T. K. F. Wong, A. von Haeseler, and L. S. Jermiin, “ModelFinder: fast model selection for accurate phylogenetic estimates,” Nat. Methods , vol. 14, no. 6, pp. 587–589, Jun. 2017, doi: 10.1038/nmeth.4285. D. T. Hoang, O. Chernomor, A. von Haeseler, B. Q. Minh, and L. S. Vinh, “UFBoot2: Improving the Ultrafast Bootstrap Approximation,” Mol. Biol. Evol. , vol. 35, no. 2, pp. 518–522, Feb. 2018, doi: 10.1093/molbev/msx281. I. Letunic and P. Bork, “Interactive Tree of Life (iTOL) v6: recent updates to the phylogenetic tree display and annotation tool,” Nucleic Acids Res. , vol. 52, no. W1, pp. W78–W82, Jul. 2024, doi: 10.1093/nar/gkae268. S. A. Bustin et al. , “The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments,” Clin. Chem. , vol. 55, no. 4, pp. 611–622, Apr. 2009, doi: 10.1373/clinchem.2008.112797. Public Health Agency of Canada, “Mpox epidemiology update — Canada.ca.” Accessed: Mar. 26, 2025. [Online]. Available: https://health-infobase.canada.ca/mpox/ S. Isabel et al. , “Targeted amplification-based whole genome sequencing of Monkeypox virus in clinical specimens,” Microbiol. Spectr. , vol. 12, no. 1, pp. e02979-23, doi: 10.1128/spectrum.02979-23. A. Steedman and M. Zeller, “MPXV Sequencing from Wastewater (Illumina) V1.0.” Accessed: Mar. 26, 2025. [Online]. Available: https://www.protocols.io/view/mpxv-sequencing-from-wastewater-illumina-v1-0-dyzv7x66 “ARTIC/INRB MPXV Wastewater Sequencing Primer Scheme.” Accessed: Mar. 26, 2025. [Online]. Available: https://labs.primalscheme.com/detail/artic-inrb-mpox/400/v1.0.0/?q= T. T. Vi et al. , “A serotype-specific and tiled amplicon multiplex PCR method for whole genome sequencing of dengue virus,” J. Virol. Methods , vol. 328, p. 114968, Jul. 2024, doi: 10.1016/j.jviromet.2024.114968. J. Quick et al. , “Real-time, portable genome sequencing for Ebola surveillance,” Nature , vol. 530, no. 7589, pp. 228–232, Feb. 2016, doi: 10.1038/nature16996. Additional Declarations No competing interests reported. Supplementary Files Fisheretal.2025SupplementaryMaterials.zip Cite Share Download PDF Status: Published Journal Publication published 11 Aug, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 02 Jun, 2025 Reviews received at journal 12 May, 2025 Reviewers agreed at journal 02 May, 2025 Reviews received at journal 01 May, 2025 Reviewers agreed at journal 01 May, 2025 Reviewers invited by journal 29 Apr, 2025 Editor assigned by journal 22 Apr, 2025 Editor invited by journal 22 Apr, 2025 Submission checks completed at journal 21 Apr, 2025 First submitted to journal 31 Mar, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6347660","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":451094993,"identity":"aae7b7ce-7555-4f68-9041-35c25ecc2ca6","order_by":0,"name":"Mathew Fisher","email":"","orcid":"","institution":"Public Health Agency of Canada","correspondingAuthor":false,"prefix":"","firstName":"Mathew","middleName":"","lastName":"Fisher","suffix":""},{"id":451094994,"identity":"49d83848-9343-4164-91d3-19046b5656a0","order_by":1,"name":"Jennifer Ali","email":"","orcid":"","institution":"Public Health Agency of Canada","correspondingAuthor":false,"prefix":"","firstName":"Jennifer","middleName":"","lastName":"Ali","suffix":""},{"id":451094995,"identity":"d2850c9a-db78-43bc-ac0b-64e6c92bef3d","order_by":2,"name":"Shayna Giesbrecht","email":"","orcid":"","institution":"Public Health Agency of Canada","correspondingAuthor":false,"prefix":"","firstName":"Shayna","middleName":"","lastName":"Giesbrecht","suffix":""},{"id":451094996,"identity":"9ad6f021-dbf9-47eb-b495-d57636ee619e","order_by":3,"name":"Raveena Roopra","email":"","orcid":"","institution":"Public Health Agency of Canada","correspondingAuthor":false,"prefix":"","firstName":"Raveena","middleName":"","lastName":"Roopra","suffix":""},{"id":451094997,"identity":"c2f00470-8ff1-4054-92a6-e6a993ce1b53","order_by":4,"name":"Veronica Carroll","email":"","orcid":"","institution":"Public Health Agency of Canada","correspondingAuthor":false,"prefix":"","firstName":"Veronica","middleName":"","lastName":"Carroll","suffix":""},{"id":451094998,"identity":"d213d9d5-3f84-4b48-b1c0-793d07e047be","order_by":5,"name":"Cody Buchanan","email":"","orcid":"","institution":"Public Health Agency of Canada","correspondingAuthor":false,"prefix":"","firstName":"Cody","middleName":"","lastName":"Buchanan","suffix":""},{"id":451094999,"identity":"7ece64e4-68d1-40b5-8be7-46bdddc2fa98","order_by":6,"name":"Nicholas Duan","email":"","orcid":"","institution":"Public Health Agency of Canada","correspondingAuthor":false,"prefix":"","firstName":"Nicholas","middleName":"","lastName":"Duan","suffix":""},{"id":451095000,"identity":"e2a2efce-4935-49cc-8540-3e2df744e15c","order_by":7,"name":"Chrystal Landgraff","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABU0lEQVRIie2RMWvCQBTHX7hyWV7IepKiX0ER4tA2/SongUxShEKXFhQKukRdheLXsGNTBF0srimUIgiZHDJJKlL6oqFtLLR0KzQ/uLs/x/14d/cAMjL+ImK3HIJKM9JQr0ce+1mRdJglCo4d+WulVvxW0W86Qe4lskhhwXy5fi4gx9WifmWB3nu4D2FNoe2lijxNTAOlTQqvlAbd85LLtdtyf2yD8M9soXQpTOVnpSgcboBk8cVMQ3OlclfoDA3kXqPpowmK60ERvii5SDZIUVexcupyDAx89aAwmyaKPt9XBMoRKUg3jGSVFG5oLTrp1UyAiIJIVRG+w47QmSBneJEbNKXtcl4pa/SEUvyWatNG4aeq6H1HeYyOL/O62h6K5UaeuJwFC1xZkJ/Rj4UbK6/3UlWIg21reDwpLXjPuzZVW9tm7cHCj7zZV5KdjIyMjH/NG+yBaIp0UwyrAAAAAElFTkSuQmCC","orcid":"","institution":"Public Health Agency of Canada","correspondingAuthor":true,"prefix":"","firstName":"Chrystal","middleName":"","lastName":"Landgraff","suffix":""}],"badges":[],"createdAt":"2025-03-31 20:38:08","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6347660/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6347660/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-13927-y","type":"published","date":"2025-08-11T15:56:50+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":81990319,"identity":"17910ca8-86e0-4de3-bc3c-5ec98987d21e","added_by":"auto","created_at":"2025-05-05 16:29:22","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":286537,"visible":true,"origin":"","legend":"\u003cp\u003eOverview of the wastewater collection, sample processing and analysis workflow used in this study.\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-6347660/v1/c5f59c356f00507542741568.png"},{"id":81990628,"identity":"86a871a2-231e-4c5f-8389-c070c2e44ef3","added_by":"auto","created_at":"2025-05-05 16:37:22","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":79626,"visible":true,"origin":"","legend":"\u003cp\u003eSummary of all MPXV positive samples sequenced in this study.\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-6347660/v1/b4a901db9f2c218328e17d69.png"},{"id":81990323,"identity":"801c852b-65b0-4322-a543-dcba0b224f98","added_by":"auto","created_at":"2025-05-05 16:29:22","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":571322,"visible":true,"origin":"","legend":"\u003cp\u003eSummary of 4.2kb ITR tiled amplicon sequencing scheme genomic and coverage information. (A) Whole genome schematic of a MPXV clade IIb reference sequence (GenBank accession: NC_063383.1) showing the positions of the ITR regions as well as the PCR target regions. (B) Enlarged image of the target region from the 5’ ITR region of the MPXV genome, showing the coding sequences (CDS) in yellow arrows as well as the positions of all 11 amplicons in gray boxes. A coverage plot with the depth of coverage from a representative wastewater sample, which generated a complete sequence across the entire target region is shown. The x-axis represents the genomic position within the target region excluding the terminal primer binding sites and also corresponds to the positions of the CDS and amplicons above the plot. The region highlighted by the red vertical line indicates the location of the homopolymeric region containing the unique deletion relative to MPXV clade IIb control material. (C) Further enlarged image showing an alignment of the homopolymeric region with the unique deletion compared to reference sequence NC_063383.1 and MPXV clade IIb control material. The wastewater-derived sequence is highlighted in gray, while other MPXV sequences containing the same deletion are shown with their respective GenBank accession numbers.\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-6347660/v1/d478c5c76191a68c1524bed7.png"},{"id":81990630,"identity":"5db0fcfd-a598-4839-8482-d53f0216b08e","added_by":"auto","created_at":"2025-05-05 16:37:22","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":258473,"visible":true,"origin":"","legend":"\u003cp\u003eOutgroup rooted phylogenetic tree of the wastewater-derived MPXV consensus sequence and other reference sequences. In-house generated sequences from MPXV clade Ib and IIb as well as a vaccinia virus control material are also shown along with a selection of reference sequences from GISAID. SH-aLRT and ultrafast bootstrap (UFBoot) support percentage values, as calculated by IQ-TREE, are shown on each branch in that order (ie. SH-aLRT/ UFBoot). All in-house generated consensus sequences are bolded with the wastewater-derived sequence indicated with an asterix.\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-6347660/v1/96894de658333d987505a5e7.png"},{"id":89310460,"identity":"de96d9a3-30d3-4338-8d21-00a2ddc79df0","added_by":"auto","created_at":"2025-08-18 15:59:22","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1985429,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6347660/v1/d492f56c-a4fa-46d5-9772-38110e0c16a1.pdf"},{"id":81990314,"identity":"3a5eb213-cbfb-4fcf-944e-8f66f9756228","added_by":"auto","created_at":"2025-05-05 16:29:22","extension":"zip","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":720262,"visible":true,"origin":"","legend":"","description":"","filename":"Fisheretal.2025SupplementaryMaterials.zip","url":"https://assets-eu.researchsquare.com/files/rs-6347660/v1/dd83a189b7d0cf67c982296b.zip"}],"financialInterests":"No competing interests reported.","formattedTitle":"Tiled amplicon sequencing of monkeypox virus from wastewater: a novel approach for clade and subclade level differentiation","fulltext":[{"header":"Introduction","content":"\u003cp\u003eMonkeypox virus (MPXV) is an enveloped, double-stranded DNA virus with an approximate genome size of 197 kb and the causative agent of a zoonotic disease called mpox (formerly known as monkeypox). Along with the closely related variola virus, the etiological agent responsible for smallpox, it belongs to the \u003cem\u003eOrthopoxvirus\u003c/em\u003e genus. It was first described in 1957 following an outbreak in a Danish monkey colony [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e] with the first human cases detected in the Democratic Republic of the Congo (DRC) in 1970 during the smallpox eradication campaigns [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. For the next 50 years it was considered a rare zoonotic disease, endemic to the Central and West African regions and human cases were typically attributed to contact with infected animals. Historically, MPXV has caused rare sporadic disease in African countries up until 2003 when it caused a significant outbreak in the United States due to direct contact with infected prairie dogs imported from Ghana [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. This outbreak represented the first MPXV infections outside of the African continent until its re-emergence in 2022 resulting in a global epidemic.\u003c/p\u003e \u003cp\u003eFrom July 2022 until May 2023, the World Health Organization (WHO) declared a public health emergency of international concern (PHEIC) [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e] due to the rapid increase in mpox cases and spread of MPXV clade IIb from the DRC to non-endemic countries including the United Kingdom [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], Canada [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e] and the USA [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. By May 2023, over 88,060 laboratory-confirmed cases and 147 deaths were reported across 120 countries [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e] with the most significantly impacted demographic of the epidemic being men who have sex with men. Although the PHEIC phase of this public health event was declared over in May 2023, clade IIb continued to transmit and cases were detected worldwide. In September 2023, a new outbreak event was detected, emerging from the South Kivu region of the DRC, eventually prompting the WHO declaration of a second PHEIC on August 14, 2024 [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. A main contributing factor leading to the declaration of this second PHEIC was the emergence of a new clade I strain designated as clade Ib [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. The global public health community, including Canada\u0026rsquo;s disease surveillance programs are exercising increased vigilance concerning clade Ib, as clade I is considered more virulent than clade II. However, a recent WHO study found only a slight difference at 0.19% and 0.7%, respectively, in the mortality rates of clade IIb and clade Ib lineages responsible for the 2022-23 and 2023-ongoing outbreaks [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Recently, travel associated cases of clade Ib have been reported in a number of countries outside of Africa including Canada [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], the United States [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], Germany [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], India [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], Sweden [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], Thailand [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e] and the United Kingdom [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eWastewater-based surveillance (WBS) is an active surveillance strategy that was significantly advanced and deployed for community-level surveillance throughout the coronavirus disease 2019 (COVID-19) pandemic and during that time, demonstrated capacity as a leading indicator of disease incidence [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e], [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Although complementary to traditional clinical surveillance, WBS functions as an unbiased and cost-effective disease monitoring approach that also captures signals shed by infected individuals, including from those displaying mild symptoms or asymptomatic cases. Furthermore, community-level studies have revealed a high correlation between the quantity of viral nucleic acid recovered from wastewater to reported clinical case numbers [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Beyond the COVID-19 pandemic, WBS has been expanded to understand the transmission dynamics of other viral pathogens circulating within a population including influenza virus [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], respiratory syncytial virus [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], MPXV [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e], [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e] and dengue virus [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAs communities across Canada and globally implement monitoring for the importation of MPXV, including clade Ib, PCR methods targeting a variety of genomic targets have been developed for wastewater testing. However, PCR methods are inherently limited in the amount of genomic information they produce, hindering their capacity for taxonomic classification or rapid detection of new or emerging clades, subclades, or genomic variants. As a result, genomic sequencing can bridge these surveillance gaps. Although several assays are now available for MPXV sequencing, these methods target the complete genome and were developed for and tested on purified clinical specimens. Wastewater presents a unique matrix and with it, unique challenges that may hamper the ease-of-adoption of assays designed for sequencing of clinical specimens. Unlike most clinical specimens, wastewater is a microbially mixed matrix potentially composed of multiple, diverse pathogens shed by a catchment population into an eventual wastewater treatment plant. The detection of a targeted pathogen by PCR or sequencing is further complicated if the pathogen is not abundantly shed, if it is not present in high copy numbers in the feces or urine of infected individuals or if there are low numbers of infected individuals within a wastewater treatment plant\u0026rsquo;s catchment area.\u003c/p\u003e \u003cp\u003eHere, we describe a novel targeted sequencing method and its successful use to detect and differentiate MPXV signals from municipal wastewater samples to the clade and subclade level. Although alternative whole genome targeted sequencing approaches were initially tested, they did not yield MPXV sequences from the wastewater samples tested, likely due to the lower viral load compared to clinical samples. For that reason, we developed a novel set of tiled amplicon sequencing primers, targeting a portion of the genomically variable ITR region [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e], [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e] located at the terminal end of the MPXV genome. Similar tiled amplicon sequencing methods have been described in previous studies for a variety of targets including the widely used ARTIC scheme for targeted SARS-CoV-2 sequencing [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e], [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. The method presented in this study improves upon the data obtained by PCR-based methods by providing increased genomic resolution and enabling not only detection of MPXV but also clade and subclade level characterization.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eWastewater sample collection\u003c/h2\u003e \u003cp\u003eTwenty-four hour composite influent wastewater from four different wastewater treatment plant sites in a large Canadian city with a combined catchment population nearing three million were used in this study (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Composite wastewater influent samples from each site were collected using an autosampler on a biweekly basis from September to October of 2024 as a total composite volume of 400\u0026ndash;500 ml. Sterile polyethylene terephthalate bottles were used for collection and storage. Samples were shipped to the JC Wilt Infectious Diseases Research Centre in Winnipeg, Manitoba on ice and stored at 4\u0026deg;C upon receipt until processing.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eCapture of MPXV and DNA isolation\u003c/h3\u003e\n\u003cp\u003eInitial attempts to concentrate MPXV from wastewater samples were performed following a procedure using Ceres\u0026trade; immunomagnetic beads currently in use within our laboratory for SARS-CoV-2 WBS using 10 to 40 mL of wastewater 24-hour composite influent. However, due to low recovery of MPXV nucleic acid, the starting volume of wastewater was increased to 120 mL. For method development and as a positive run control, 120 ml of municipal wastewater samples were spiked with commercially available MPXV clade IIb whole genome nucleic acid (AMPLIRUN Monkeypox Virus DNA Control, Vircell, reference # MBC146-R). Samples were centrifuged and nucleic acid extracted from the solid pellet as previously described [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e] with modification of the final elution step to use Qiagen Buffer EB (Qiagen, 19086) instead of RNase-free water. A final purification step was carried out using AMPure XP beads (Beckman Coulter, Brea, California, USA) according to manufacturer's recommendations using an equal volume of sample and beads, 75% ethanol for washes, and 100 \u0026micro;l of nuclease-free water for the final elution step. All results described in this study were obtained using this method, designated as Method E and shown in Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e.\u003c/p\u003e\n\u003ch3\u003eReal time quantitative polymerase chain reaction (RT-qPCR)\u003c/h3\u003e\n\u003cp\u003eTo determine the presence of MPXV in wastewater, samples were screened prior to sequencing using previously published RT-qPCR assays (G2R_G [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e], G2R_NML [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e] and F3L [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]). PrimeTime Probes (Integrated DNA Technologies) were synthesized with a 5\u0026rsquo; 6-FAM fluorophore and 3\u0026rsquo; ZEN-Iowa Black FQ quencher. Primer and probe concentrations are as described in the literature [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Each PCR reaction was performed in triplicate in a total volume of 20 \u0026micro;L using the QuantiNova Multiplex PCR Kit (Qiagen, 208452) according to the manufacturer\u0026rsquo;s specifications. The QuantStudio 5 Real-Time PCR System (Applied Biosystems, A28138) was used with the following conditions: 95\u0026deg;C for 2 minutes, followed by 42 cycles of amplification at 95\u0026deg;C for 5 seconds and 60\u0026deg;C for 30 seconds. Samples with a cycle threshold value (C\u003csub\u003eT\u003c/sub\u003e) of less than 38 for any one of the three assays were selected for sequencing. PCR assay positive controls consisted of both a high and low concentration of gBlocks\u0026reg; Gene Fragments (Integrated DNA Technologies) for each PCR target. Positive controls included in all runs consisted of gBlock\u0026reg; Gene Fragments (Integrated DNA Technologies) containing the fragment of interest (gBlock sequences and other information available in Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e) at final concentrations of 10 cp/\u0026micro;L and 1000 cp/\u0026micro;L and diluted AMPLIRUN Monkeypox Virus DNA Control at a final concentration of 35 cp/ml (Vircell Molecular, MBC146-R).\u003c/p\u003e\n\u003ch3\u003eQuantification of DNA standards\u003c/h3\u003e\n\u003cp\u003eThe initial concentration of each gBlocks\u0026reg; Gene Fragment (Integrated DNA Technologies) was quantified by digital PCR according to the manufacturer\u0026rsquo;s recommendations. Briefly, each gene fragment was diluted in nuclease-free water to a calculated concentration of 10,000 cp/ \u0026micro;L and tested in quadruplicate. A reaction mix volume of 9 \u0026micro;L was prepared using Absolute Q DNA Digital PCR MasterMix (5X) (Applied Biosystems, A52490), primer and probe concentrations of 100 \u0026micro;M, and 2 \u0026micro;L of each diluted gene fragment. Absolute quantification was performed using the QuantStudio Absolute Q Digital PCR System (Applied Biosystems, A52864) under the following conditions: activation for 10 minutes at 96\u0026deg;C followed by 40 cycles of 96\u0026deg;C for 5 seconds and 60\u0026deg;C for 15 seconds.\u003c/p\u003e\n\u003ch3\u003eGeneration of standard curves and determination of PCR assay sensitivity\u003c/h3\u003e\n\u003cp\u003eA six-point standard curve from 5 to 500,000 copies per reaction was generated for each qPCR assay using quantified, serially diluted gBlock Gene Fragments (Integrated DNA Technologies) containing the target sequence of the G2R_G, G2R_NML and F3L RT-qPCR assays. Six replicates of each concentration were used per target. The sensitivity of each PCR assay was assessed using serially diluted gBlock Gene Fragments (Integrated DNA Technologies) containing 0.78 to 200 copies per reaction. Twenty replicates of each concentration were tested and a cycle threshold value of less than 40 was interpreted as a positive detection. To calculate the limit of quantification (LOQ), only concentrations in which all replicates were positive were used. The coefficient of variation (CV) was calculated for each concentration tested and fit to a linear regression model linking it to the template concentration [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. The LOQ was defined as the concentration at which a CV equal to 35% was achieved as predicted by linear regression [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. To determine the limit of detection (LOD), results were converted into binary values (ie. positive and negative detection only) and a probit model was generated to predict the relationship between template concentration and positive detection. The LOD was defined as the lowest concentration at which a positivity rate of 95% was maintained as predicted by the probit model. All modeling was performed in RStudio using the tidyverse set of packages [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e].\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eTiled MPXV amplicon scheme design\u003c/h2\u003e \u003cp\u003eInitial analysis was performed on a database of complete MPXV genomes downloaded from GISAID which were selected to represent the genetic diversity of the virus, including both recent outbreak and historical sequences In order to reduce the redundancy and overall size of the dataset for processing, CD-HIT [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e] was used to cluster and remove sequences with more than 95% sequence identity, resulting in a database of 49 MPXV genome sequences. The sequences were aligned with MAFFT [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e] and the resulting alignment was manually investigated for the presence of variable regions suitable for design of a tiled amplicon scheme allowing for clade and subclade differentiation. This process resulted in the identification of an approximately 4.2 kb portion of the ITR region that was extracted from the alignment for further analysis. CD-HIT [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e] was used to remove redundant sequences with greater than 99% identity, resulting in a final database of nine sequences spanning the target region which was used for subsequent assay design. A tiled amplicon scheme was designed with PrimalScheme v.1.3.2 [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e] using the final database of nine MPXV sequences. The resulting scheme consisted of 11 primer pairs generating PCR products ranging from 490 to 516 bp (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The primers were mapped to a whole genome database of representative MPXV sequences using Geneious Prime v2025.0.2 [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e] to screen for mismatches that could impact primer binding efficiency. This database consisted of recent whole genome sequences representing MPXV subclades from all global regions with collection dates starting January 1, 2023, downloaded from GISAID [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e] on November 20, 2024 with the \u0026ldquo;complete\u0026rdquo; and \u0026ldquo;low coverage excl\u0026rdquo; filters enabled. The only exception was clade IIa which had no sequences in the GISAID repository within the specified collection dates, so two historical sequences from the USA and Liberia isolated in 1962 and 1970 were used for analysis (GISAID accession EPI_ISL_13056556 and EPI_ISL_13058405, respectively).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eMPXV 4.2kb ITR tiled amplicon sequencing primers and amplicons. For each primer, two primer binding location ranges (with position values relative to reference NC_063383.1) are shown since the MPXV genome contains two ITRs and therefore each primer has two separate binding locations.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAmplicon Size (bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer Name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePrimer Sequence (5' to 3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePrimer Binding Coordinates\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e516\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ehMpxV_J1-J3_1_LEFT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTAACGCATTTATGGACGACGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4,530\u0026ndash;4,551; 192,659\u0026thinsp;\u0026minus;\u0026thinsp;192,680\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ehMpxV_J1-J3_1_RIGHT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGAACGCGGATATGTGTTTACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4,036\u0026thinsp;\u0026minus;\u0026thinsp;4,058; 193,152\u0026ndash;193,174\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e495\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ehMpxV_J1-J3_2_LEFT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACAAATTATTGACTAAAGGATCTGACCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4,102\u0026ndash;4,129; 193,081\u0026ndash;193,108\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ehMpxV_J1-J3_2_RIGHT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACCGTAGTATATTGAGAGAGCGACT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3,635\u0026ndash;3,659; 193,551\u0026thinsp;\u0026minus;\u0026thinsp;193,575\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e506\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ehMpxV_J1-J3_3_LEFT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGCACGAACAAAAATACGGGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3,725\u0026ndash;3,746; 193,464\u0026thinsp;\u0026minus;\u0026thinsp;193,485\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ehMpxV_J1-J3_3_RIGHT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACACTTTTATAGTCCTCGTTTAAACAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3,241\u0026ndash;3,268; 193,942\u0026thinsp;\u0026minus;\u0026thinsp;193,969\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e510\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ehMpxV_J1-J3_4_LEFT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCTCCCTACGACGATCACTACG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3,332\u0026ndash;3,353; 193,857\u0026thinsp;\u0026minus;\u0026thinsp;193,878\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ehMpxV_J1-J3_4_RIGHT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGGATAATATTTGTAATGGTTCTTTCCGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2,844\u0026ndash;2,872; 194,338\u0026thinsp;\u0026minus;\u0026thinsp;194,366\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e492\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ehMpxV_J1-J3_5_LEFT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGACTATCGTATTTGCCTCCGGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2,929\u0026ndash;2,950; 194,260\u0026thinsp;\u0026minus;\u0026thinsp;194,281\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ehMpxV_J1-J3_5_RIGHT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGCGTCTCTACCTGATTACTATCAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2,459\u0026ndash;2,483; 194,727\u0026thinsp;\u0026minus;\u0026thinsp;194,751\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e509\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ehMpxV_J1-J3_6_LEFT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGTGTGGTTCGGATACCTTTACA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2,530\u0026ndash;2,552; 194,658\u0026thinsp;\u0026minus;\u0026thinsp;194,680\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ehMpxV_J1-J3_6_RIGHT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGCTACATTATTAAGGACAGAGAAGTATTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2,044\u0026thinsp;\u0026minus;\u0026thinsp;2,073; 195,137\u0026ndash;195,166\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e498\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ehMpxV_J1-J3_7_LEFT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAACTATATCGATGTGGAAATTAACCTGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e2,193\u0026ndash;2,220; 194,990\u0026thinsp;\u0026minus;\u0026thinsp;195,017\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ehMpxV_J1-J3_7_RIGHT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGAATTAGTGATCAGTTTATGTATATCGCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1,723\u0026ndash;1,752; 195,458\u0026thinsp;\u0026minus;\u0026thinsp;195,487\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e512\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ehMpxV_J1-J3_8_LEFT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGCGTCGACATCTACATACTATATAGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1,840\u0026ndash;1,866; 195,344\u0026thinsp;\u0026minus;\u0026thinsp;195,370\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ehMpxV_J1-J3_8_RIGHT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCGGATACCTCATCATCTTCGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1,355\u0026ndash;1,377; 195,833\u0026thinsp;\u0026minus;\u0026thinsp;195,855\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e491\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ehMpxV_J1-J3_9_LEFT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCACAAAGCAAGACCAAACACCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1,420\u0026ndash;1,441; 195,769\u0026thinsp;\u0026minus;\u0026thinsp;195,790\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ehMpxV_J1-J3_9_RIGHT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCTCACACATGTCTCCGATACG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e951\u0026ndash;972; 196,238\u0026thinsp;\u0026minus;\u0026thinsp;196,259\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e512\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ehMpxV_J1-J3_10_LEFT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTAGATTGTCCAGCGTGTCACC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1,202\u0026ndash;1,222; 195,988\u0026thinsp;\u0026minus;\u0026thinsp;196,008\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ehMpxV_J1-J3_10_RIGHT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTAGTTAAATATTTTTGTTTTGCAAACCGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e711\u0026ndash;740; 196,470\u0026thinsp;\u0026minus;\u0026thinsp;196,499\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e490\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ehMpxV_J1-J3_11_LEFT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCATCTGAAAATGGATGAGTTGGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e796\u0026ndash;820; 196,390\u0026thinsp;\u0026minus;\u0026thinsp;196,414\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ehMpxV_J1-J3_11_RIGHT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAGCAGTGTCCCCTACATGGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e331\u0026ndash;352; 196,858\u0026thinsp;\u0026minus;\u0026thinsp;196,879\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eIn silico\u003c/b\u003e \u003cb\u003etiled sequencing primer scheme evaluation\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe database of recent MPXV whole genome sequences described in the previous section for screening of primer binding efficiency was used for subsequent \u003cem\u003ein silico\u003c/em\u003e analysis. The sequences were aligned using MAFFT [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e] and the whole target region of the tiled amplicon scheme, excluding the terminal primer binding sites, was extracted from the alignments using Geneious Prime v2025.0.2 [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. The resulting sequences were filtered using Cutadapt[\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e] in order to remove sequences with more than 10% ambiguous (N) bases. The filtered sequences were then analyzed using Nextclade (v3.10.0, Mpox virus (All clades) reference dataset) [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e] and the resulting clade assignments were compared to those from GISAID metadata in order to assess the clade differentiation capability and accuracy of the tiled amplicon scheme.\u003c/p\u003e \u003cp\u003eSimilar analysis was also performed on each of the 11 individual amplicon regions to assess their capacity to differentiate clades with incomplete target region coverage. Using the MPXV alignments generated previously for whole target region \u003cem\u003ein silico\u003c/em\u003e analysis, the primers targeting each amplicon were mapped and each amplicon region, excluding the primer binding sites (coordinates show in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), was extracted using Geneious [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. The resulting sequences were filtered to remove sequences with any ambiguous bases (N) using Cutadapt [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. This ambiguous base filtering cut-off was selected because due to the nature of PCR amplification, any amplicons that amplified efficiently should have complete coverage across their entire length. Similar to the whole genome sequence analysis, filtered sequences were analyzed using Nextclade (v3.10.0, Mpox virus (All clades) reference dataset) [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e] and clade assignments were compared to those from GISAID metadata.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003ePCR amplification and next generation sequencing\u003c/h3\u003e\n\u003cp\u003eAmplicons were generated using the Q5 Hot Start High-Fidelity DNA Polymerase kit (NEB, Massachusetts, USA; M0493S). For each sample, two PCR reactions were prepared, using either primer pool 1 (containing primers for odd-numbered amplicons) or primer pool 2 (containing primers for even-numbered amplicons) and the products of each primer pool were combined post-amplification. PCR master mixes were prepared using 5 \u0026micro;L of extracted nucleic acid, 12.5 \u0026micro;L of 5X Q5 Reaction Buffer, 1.44 \u0026micro;M of either pool 1 or 2 (3.6\u0026micro;L of a 10 \u0026micro;M pooled primer stock) and nuclease-free water up to a total volume of 25 \u0026micro;L. PCR was carried out at 98\u0026deg;C for 3 minutes, followed by 35 cycles of 98\u0026deg;C for 15 seconds and 61\u0026deg;C for 5 minutes, with a final hold at 4\u0026deg;C using an Eppendorf Mastercycler Nexus Gradient GSX1 Thermal Cycler (Fisher Scientific, E6332000029). All runs included a MPXV clade IIb positive control sample consisting of diluted AMPLIRUN Monkeypox Virus DNA Control (Vircell Molecular, MBC146-R). Additionally, non-MPXV \u003cem\u003eOrthopoxvirus\u003c/em\u003e positive control DNA (vaccina virus Western Reserve), was amplified and sequenced to confirm that sequencing results could be differentiated from MPXV.\u003c/p\u003e \u003cp\u003eThe PCR products were run on a 4200 Tapestation System (Aglient Technologies, G2991BA) with a D5000 ScreenTape System (Agilent Technologies, 5067\u0026ndash;5588, 5067\u0026ndash;5589, 5067\u0026ndash;5590) for confirmation of successful amplification following the standard manufacturer\u0026rsquo;s protocol. Quantification of each sample was done with a Qubit dsDNA Quantification Assay Kit (ThermoFisher Scientific, Q32851) on a Qubit Flex Fluorometer (ThermoFisher Scientific, Q33327) and Picogreen dsDNA Reagent (Invitrogen, P7581) using a FilterMax F5 Multi-Mode Microplate Reader (Molecular Devices, F5). Sequencing library preparation was performed on prepared amplicons using the Nextera XT library preparation kit (Illumina) as per manufacturer\u0026rsquo;s instructions. Libraries were quantified, pooled and sequenced on an Illumina NextSeq 2000 using a P2 600 cycle kit (Illumina).\u003c/p\u003e\n\u003ch3\u003eSequence assembly and analysis\u003c/h3\u003e\n\u003cp\u003eQuality and primer trimming, read mapping, consensus sequence generation and clade assignment were performed using the nf-core/viralrecon v2.6.0 pipeline [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e] using MPXV isolate M5312_HM12_Rivers (NCBI accession NC_063383.1), trimmed to the target PCR region excluding external primer binding regions, as the reference sequence (reference FASTA used included in supplementary materials). The pipeline was run using the viralrecon amplicon protocol [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e] and a custom primer BED file containing the positions of the primers relative to the reference in order to enable trimming of primer sequences (primer BED file used included as supplementary materials). Clade assignment using Nextclade was enabled using the hMPXV nextclade dataset included in the pipeline at the time of analysis (v2.12.0). Due to the version of Nextclade included in the pipeline not being the most current, assembled consensus sequences were also analyzed using the browser version of Nextclade (v3.10.0, Mpox virus (All clades) reference dataset) to verify clade and sub-clade assignment calls. To further confirm the presence or absence of MPXV, the resulting consensus sequences were queried against the NCBI core nucleotide database using blastn [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Additionally, raw sequencing reads were taxonomically classified using Kraken2 [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e] and subsequently visualized using Pavian [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e].\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003ePhylogenetic analysis\u003c/h2\u003e \u003cp\u003eThe MPXV genome database of extracted genome sequences corresponding to the 4.2 kb tiled amplicon target region used previously for \u003cem\u003ein silico\u003c/em\u003e primer specificity testing, was used for phylogenetic analysis. To remove sequences with any ambiguous bases, the database was filtered with Cutadapt [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. The resulting sequence database was further filtered with CD-HIT [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e] using a sequence identity threshold of 0.9995 in order to remove redundant or highly similar sequences, resulting in a final database of 19 representative MPXV sequences. These sequences were aligned to wastewater and positive control derived consensus sequences generated by in-house sequencing using MAFFT [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. A phylogenetic tree was generated using IQ-TREE [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e] on the find best model setting with ModelFinder [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e] (Best-fit model selected: K3Pu\u0026thinsp;+\u0026thinsp;F) with 1000 ultrafast bootstraps [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e] and then visualized using iTOL [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e] with a vaccinia Western Reserve virus consensus sequence (NML collection) chosen as the outgroup for rooting.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eRecovery of MPOX material from Wastewater samples\u003c/h2\u003e \u003cp\u003eThe recovery of MPOX material from wastewater samples was complicated by the low abundance of this pathogen in the tested municipal wastewater samples. Within the study period, a total of 196 MPOX clinical MPOX cases were reported nationally in Canada which represents less than 0.0005% of the total population. In addition to the described here, a number of other processing methods were attempted for recovery of MPXV genomic DNA. However, due to limited available volumes of wastewater samples, a detailed side-by-side comparison of the methods processed with the same samples was not able to be performed. In total six methods were evaluated using positive control nucleic acid (AMPLIRUN Monkeypox Virus DNA Control, Vircell Molecular, MBC146-R). Four of these methods did not generate reads mapping to MPXV from any of the tested wastewater samples. A schematic describing all trialed methods is shown in the supplementary materials (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e) with the metod used to generate the wastewater-derived sequences presented in this study (method E) indicated with a black box.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eqPCR sensitivity analysis\u003c/h2\u003e \u003cp\u003eThe sensitivity of the qPCR assays targeting the ITR (G2R_G [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e] and G2R_NML [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]) and F3L [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e] genes were evaluated using gBlock\u0026reg; Gene Fragments (Integrated DNA Technologies) containing the relevant PCR target, which were quantified by digital PCR. Although the dilutions tested with digital PCR were initially estimated to be approximately 10,000 cp/uL based on manufacturer-provided information, the absolute concentrations were determined to be 8,044 cp/uL, 5,005 cp/uL, and 6,821 cp/uL for the gene fragments containing the PCR targets for G2R_G, G2R_NML, and F3L, respectively. Consequently, all calculations for generating the standard curves and assessing qPCR assay sensitivity were adjusted to reflect the absolute concentrations obtained via digital PCR.\u003c/p\u003e \u003cp\u003eThe PCR efficiencies for each of the assays were within the desired range of 90\u0026ndash;110% [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e] with values of 99.6%, 97.0%, and 94.1% for the G2R_G, G2R_NML, and F3L assays, respectively. The log-linear linear correlation and PCR efficiencies of the G2R_G, G2R_NML, F3L assays are shown in Figure S2. The qPCR assays had calculated LOQs ranging from 5.35 to 12.6 copies per reaction while LODs ranged from 1.91 to 4.13 copies per reaction for each assay (Figures S3, S4). Results from these three qPCR assays were used as an initial screening strategy to detect the presence of MPXV DNA in wastewater samples. Wastewater samples were selected for subsequent sequencing if they produced a qPCR Ct value\u0026thinsp;\u0026le;\u0026thinsp;38 with any of the three assays.\u003c/p\u003e \u003cp\u003e \u003cb\u003eIn silico\u003c/b\u003e \u003cb\u003etiled sequencing primer scheme specificity\u003c/b\u003e\u003c/p\u003e \u003cp\u003eA total of 1,482 MPXV sequences were retained for \u003cem\u003ein silico\u003c/em\u003e analysis following ambiguous base filtering. Using the entire 4.2 kb tiled amplicon target region, clade level calls were consistent with the clade listed on GISAID meta-data for all sequences analyzed. At the subclade level, the amplicon region-derived calls were 100% consistent with GISAID meta-data for all subclade Ib, IIa and IIb sequences. Two subclade Ia samples (of 80 total) were called only to the clade level (ie. called as clade I only), resulting in a subclade level accuracy of 97.5% (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003e \u003cem\u003eIn silico\u003c/em\u003e clade and subclade level call percent accuracy for both the whole target region and individual amplicons. Raw numbers used to calculate percentages are also available in supplementary materials (Table S2).\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"14\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c11\" colnum=\"11\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c12\" colnum=\"12\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c13\" colnum=\"13\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c14\" colnum=\"14\"\u003e\u003c/div\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eClade\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"12\" nameend=\"c14\" namest=\"c3\"\u003e \u003cp\u003eAmplicon\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAll\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003e\u003cb\u003eClade level accuracy\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eIa\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e97.2%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e1.2%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eIb\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e16.7%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eIIa\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e50.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eIIb\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e96.3%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"3\" rowspan=\"4\"\u003e \u003cp\u003e\u003cb\u003eSubclade level Accuracy\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eIa\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e97.5%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e24.4%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e97.2%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e98.6%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e1.2%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eIb\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e16.7%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eIIa\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e50.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eIIb\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e96.3%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e96.6%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c9\"\u003e \u003cp\u003e1.7%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c10\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c11\"\u003e \u003cp\u003e100%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c12\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c13\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c14\"\u003e \u003cp\u003e0.0%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eA similar \u003cem\u003ein silico\u003c/em\u003e analysis was performed on each of the 11 individual amplicons (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). At the clade level, amplicons 4 and 5 correctly identified all sequences analyzed while amplicon 2 correctly identified all clade Ia, Ib and IIa sequences and over 96% of clade IIb sequences analyzed (1,334 of 1,385 total). At the subclade level, amplicon 4 correctly identified all subclade Ib, IIa and IIb sequences and over 98% of subclade Ia sequences analyzed (69 of 70 total). The remaining amplicons not specifically mentioned had varying degrees of accuracy depending on the clade or subclade of the sample as shown in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eWastewater-derived consensus sequence analysis\u003c/h2\u003e \u003cp\u003eA total of 23 wastewater samples were processed and sequenced using the method described in this study. Seven processed wastewater samples generated a minimum of 1,000 reads mapping to the MPXV reference sequence in at least one of three replicates sequenced (one sample did not have any replicates). Of these seven samples, three were positive in all three replicates, two were positive in two of three replicates, one was positive in one of three replicates and for one sample, only a single replicate was positive. Sample to sample variation included the breadth of target region coverage or total read depth per each amplicon, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e. The 15 wastewater-derived MPXV consensus sequences were aligned using MAFFT [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e] and found to be identical to each other in overlapping regions. Therefore, a representative high-quality consensus sequence with complete breadth of target region coverage was selected for a more detailed genomic analysis (assembled representative consensus sequence available in supplementary materials).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eA 4,169 bp consensus sequence covering the complete target region was assembled from wastewater-derived sequencing reads. To ensure that the assembled sequence was not the result of contamination from MPXV positive control material included on the same sequencing run, the sequences of the wastewater and positive control derived consensus sequences were aligned. The sequences showed a high degree of similarity, however were distinct based on a homopolymeric stretch within an intergenic region of amplicon 11. While the MPXV-derived positive control had a stretch of 17 consecutive thymidines, the wastewater-derived consensus had a deletion of 8 thymidines (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, panel C). This length of this deletion was consistent across all three replicates for this sample, which were PCR amplified, sequenced and analyzed separately. While all three replicates harboured this unique deletion, two of the replicates were missing a single amplicon (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) and therefore did not include the entire target region but were otherwise identical in overlapping regions. Based on viralrecon-generated primer-trimmed alignments, the replicate with coverage across the entire target region had a minimum read-depth coverage of 74 and a mean of 8,282 reads (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, panel B). A query against the NCBI core nucleotide database (performed January 20, 2025) via blastn [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e] showed that the wastewater-derived MPXV consensus sequence was identical to a number of recent MPXV sequence submissions collected from various locations including the USA, Australia and South Africa which also harbour this 8 nucleotide deletion (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, panel C).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003ePhylogenetic Analysis\u003c/h2\u003e \u003cp\u003eIn-house generated consensus sequences of the target region from MPXV clade Ib, MPXV clade IIb and vaccinia virus Western Reserve material as well the wastewater derived MPXV sequence were included in phylogenetic analysis with a subset of MPXV sequences downloaded from GISAID (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). All samples included in the analysis clustered as expected, with the vaccinia virus and each individual MPXV subclade forming distinct clade-specific branches within the phylogenetic tree. The wastewater-derived consensus sequence clustered with the clade IIb sequences. This result is consistent both with the results of other sequence analysis presented in this study and the expected clade from the sampling site based on reported clinical cases in Canada [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e], which with the exception of a single case reported in November 2024, have been uniquely typed as clade II.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eThis study describes a start-to-finish laboratory workflow for the extraction and sequencing of low-abundance MPXV from complex wastewater samples. Previously published qPCR assays were employed as a rapid screen to determine whether MPXV could potentially be sequenced from wastewater samples. This screening approach advantageously reduces the risk of performing costly PCR and sequencing reactions on samples that do not contain MPXV. Coupled with a novel tiled amplicon sequencing approach targeting the genetically variable ITR region, this method was used to generate epidemiologically informative sequences permitting clade and subclade level identification of wastewater-derived MPXV sequences. A 4.2kb portion of the ITR was selected as the target region for two major reasons; first, this region contains lineage-delineating mutations that allow for MPXV clade and subclade assignment, and second, there are two copies per genome, which effectively doubles the amount of viral starting material. This duplication was important due to the low quantity of MPXV in wastewater, resulting from the significantly reduced clinical incidence of MPXV compared to other viruses currently circulating in the Canadian population, such as SARS-CoV-2, which are also shed into the wastewater. In contrast to whole genome sequencing approaches, only a portion of the genome was targeted due to the low quantity of MPXV in wastewater samples, as well as the high propensity for primer dimer formation when using the large number of primer pairs required to tile across a genome of approximately 197 kb (estimated at 400 primer pairs with an amplicon length of 500 bp). Importantly, this assay was developed in response to a lack of recovered MPXV sequences from wastewater samples using published whole genome sequence assays designed for clinical sequencing [\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe entire 4.2kb tiled amplicon target region, composed of 11 separate amplicons, was successfully used to characterize MPXV consensus sequences derived from municipal wastewater to both the clade and subclade level. Based on the results of \u003cem\u003ein silico\u003c/em\u003e analysis, all sequences included were correctly called to the clade level. At the subclade level, all clade Ib, IIa and IIb sequences and over 97% of clade Ia sequences were correctly identified. Since wastewater samples typically contain only low concentrations of viral nucleic acid and contaminants which may inhibit amplification and sequencing, the clade and subclade differentiation capability with only partial target region coverage was also assessed. \u003cem\u003eIn silico\u003c/em\u003e analysis performed separately on each of the 11 amplicons showed that for clade level differentiation, amplicons 4 and 5 were the most accurate and identified all sequences included in the analysis. Amplicon 2 also showed high clade level accuracy, correctly identifying 100% of clade Ia, Ib and IIa sequences and over 96% of clade IIb sequences. For subclade level differentiation amplicon 4 was the most accurate, correctly calling the subclade of all Ib, IIa and IIb sequences and over 98% of clade Ia sequences. Despite the limited clade and subclade differentiation ability of the less specific amplicons, they still may provide valuable genomic information. For example, amplicon 11 contained a deletion in a homopolymeric region of the wastewater-derived consensus sequence which allowed for source attribution and differentiation from MPXV control material.\u003c/p\u003e \u003cp\u003eThe capability of the tiled amplicon sequencing method to identify and characterize MPXV in practice was demonstrated through the assembly of MPXV consensus sequences from wastewater samples. The presence of MPXV was verified by Kraken2 [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e] taxonomic classification of raw sequencing reads as well as Nextclade [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e] analysis and a blastn [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e] query of the MPXV consensus sequence assembled via viralrecon [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e] analysis. Although positive MPXV control material was included on the same run, differences in the length of a homopolymeric stretch between consensus sequences supported the wastewater-derived consensus sequence being from a distinct source. The wastewater-derived MPXV consensus sequence was identified as clade IIb based on results from Nextclade [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e], phylogenetic analysis and blastn [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e] query results. These result are also consistent with clinical data available from the collection area which are solely classified as clade IIb. To date Canada has only reported a single clinical clade Ib case which was from a region not included in this analysis.\u003c/p\u003e \u003cp\u003eIn summary, we have described the development, validation and deployment of a new tiled amplicon sequencing approach following the concentration and extraction of MPXV nucleic acid from wastewater samples. While this manuscript was in preparation, the authors became aware of approaches under development for tiled amplicon sequencing of MPXV from wastewater [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e], [\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]. However, to the best of our knowledge, this is the first description of a tiled amplicon sequencing method that enables clade and subclade determination of MPXV from municipal wastewater samples. Although tiled amplicon strategies have been developed for several pathogenic RNA viruses, including SARS-CoV-2, [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e], [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e] Zika, [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e] Dengue, [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e] and Ebolaviruses, [\u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e] our study contributes to the literature by describing a low-cost, low-complexity protocol for concentrating a large DNA virus from wastewater, followed by tiled amplicon sequencing of an epidemiologically informative genomic region of a low abundance pathogen.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to thank all participating municipalities included in this study, including the wastewater treatment plant operators who collected the samples. We would also like to acknowledge the support from Statistics Canada National Wastewater Survey program for assistance collect the wastewater samples used in this study. Further acknowledgments are extended to the PHAC-NML Genomics and RSL core groups for their assistance with this project.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConceptualization – C.L.; Methodology – M.F., J.A., S.G. and C.L.; Bioinformatic analysis and support – M.F. and N.D.; Laboratory processing – J.A., S.G., R.R. and V.C.; Writing of original draft – M.F., J.A., S.G. and C.L.; Design of tiled primer scheme – C.B.; All authors reviewed and corrected the manuscript for submission.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll raw wastewater sequencing data are available via the NCBI Sequence Read Archive under the BioProject ID PRJNA1241250 available at: https://www.ncbi.nlm.nih.gov/bioproject/PRJNA1241250.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eS. Parker and R. M. Buller, \u0026ldquo;A review of experimental and natural infections of animals with monkeypox virus between 1958 and 2012,\u0026rdquo; \u003cem\u003eFuture Virol.\u003c/em\u003e, vol. 8, no. 2, pp. 129\u0026ndash;157, Feb. 2013, doi: 10.2217/fvl.12.130.\u003c/li\u003e\n\u003cli\u003eJ. P. S. Begum, L. Ngangom, P. Semwal, S. Painuli, R. Sharma, and A. Gupta, \u0026ldquo;Emergence of monkeypox: a worldwide public health crisis,\u0026rdquo; \u003cem\u003eHum. Cell\u003c/em\u003e, vol. 36, no. 3, pp. 877\u0026ndash;893, 2023, doi: 10.1007/s13577-023-00870-1.\u003c/li\u003e\n\u003cli\u003eJ. Guarner \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Monkeypox Transmission and Pathogenesis in Prairie Dogs,\u0026rdquo; \u003cem\u003eEmerg. Infect. Dis.\u003c/em\u003e, vol. 10, no. 3, pp. 426\u0026ndash;431, Mar. 2004, doi: 10.3201/eid1003.030878.\u003c/li\u003e\n\u003cli\u003e\u0026ldquo;WHO Director-General declares the ongoing monkeypox outbreak a Public Health Emergency of International Concern.\u0026rdquo; Accessed: Nov. 26, 2024. [Online]. Available: https://www.who.int/europe/news/item/23-07-2022-who-director-general-declares-the-ongoing-monkeypox-outbreak-a-public-health-event-of-international-concern\u003c/li\u003e\n\u003cli\u003e\u0026ldquo;Monkeypox cases confirmed in England \u0026ndash; latest updates,\u0026rdquo; GOV.UK. Accessed: Jan. 07, 2025. [Online]. Available: https://www.gov.uk/government/news/monkeypox-cases-confirmed-in-england-latest-updates\u003c/li\u003e\n\u003cli\u003ePublic Health Agency of Canada, \u0026ldquo;Epidemiological summary report: 2022-2023 mpox outbreak in Canada.\u0026rdquo; Accessed: Jan. 06, 2025. [Online]. Available: https://www.canada.ca/en/public-health/services/publications/diseases-conditions/epidemiological-summary-report-2022-23-mpox-outbreak-canada.html\u003c/li\u003e\n\u003cli\u003eJ. H. McQuiston \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;The CDC Domestic Mpox Response \u0026mdash; United States, 2022\u0026ndash;2023,\u0026rdquo; \u003cem\u003eMMWR Morb. Mortal. Wkly. Rep.\u003c/em\u003e, vol. 72, no. 20, pp. 547\u0026ndash;552, May 2023, doi: 10.15585/mmwr.mm7220a2.\u003c/li\u003e\n\u003cli\u003e\u0026ldquo;WHO Health Emergency Dashboard.\u0026rdquo; Accessed: Mar. 24, 2025. [Online]. Available: https://extranet.who.int/publicemergency/#\u003c/li\u003e\n\u003cli\u003e\u0026ldquo;WHO Director-General declares mpox outbreak a public health emergency of international concern.\u0026rdquo; Accessed: Nov. 23, 2024. [Online]. Available: https://www.who.int/news/item/14-08-2024-who-director-general-declares-mpox-outbreak-a-public-health-emergency-of-international-concern\u003c/li\u003e\n\u003cli\u003eL. Subissi, \u0026ldquo;Overview of clinical characteristics of various MPXV clades.\u0026rdquo; Accessed: Feb. 06, 2025. [Online]. Available: https://cdn.who.int/media/docs/default-source/consultation-rdb/overview-of-clinical-characteristics-of-various-clades.pdf?sfvrsn=78263ab0_3\u003c/li\u003e\n\u003cli\u003ePublic Health Agency of Canada, \u0026ldquo;Public Health Agency of Canada confirms the first case of clade I mpox in Canada.\u0026rdquo; Accessed: Nov. 28, 2024. [Online]. Available: https://www.canada.ca/en/public-health/news/2024/11/public-health-agency-of-canada-confirms-the-first-case-of-clade-i-mpox-in-canada.html\u003c/li\u003e\n\u003cli\u003eCDC, \u0026ldquo;California confirms first clade I mpox case,\u0026rdquo; CDC Newsroom. Accessed: Nov. 28, 2024. [Online]. Available: https://www.cdc.gov/media/releases/s1116-california-first-clade.html\u003c/li\u003e\n\u003cli\u003e\u0026ldquo;Confirmed mpox clade Ib case in Germany, risk remains low for EU/EEA.\u0026rdquo; Accessed: Nov. 28, 2024. [Online]. Available: https://www.ecdc.europa.eu/en/news-events/confirmed-mpox-clade-ib-case-germany-risk-remains-low-eueea\u003c/li\u003e\n\u003cli\u003eNational Centre for Disease Control, and Directorate General of Health Services, Government of India, \u0026ldquo;CD Alert - October, 2024.\u0026rdquo; [Online]. Available: https://ncdc.mohfw.gov.in/wp-content/uploads/2024/10/Revised-CD-Alert-Mpox-1.pdf\u003c/li\u003e\n\u003cli\u003e\u0026ldquo;One case of mpox clade 1 reported in Sweden - The Public Health Agency of Sweden.\u0026rdquo; Accessed: Nov. 28, 2024. [Online]. Available: https://www.folkhalsomyndigheten.se/the-public-health-agency-of-sweden/communicable-disease-control/disease-information-about-mpox/one-case-of-mpox-clade-i-reported-in-sweden/\u003c/li\u003e\n\u003cli\u003e\u0026ldquo;DDC reports the first suspected case of Mpox Clade I in Thailand; the patient traveled from Africa and tests are ongoing to confirm the strain.\u0026rdquo; Accessed: Nov. 28, 2024. [Online]. Available: https://ddc.moph.go.th/oic/news.php?news=45683\u0026amp;deptcode=oic\u003c/li\u003e\n\u003cli\u003e\u0026ldquo;Latest update on cases of Clade Ib mpox,\u0026rdquo; GOV.UK. Accessed: Nov. 28, 2024. [Online]. Available: https://www.gov.uk/government/news/ukhsa-detects-first-case-of-clade-ib-mpox\u003c/li\u003e\n\u003cli\u003eH. Schenk, W. Rauch, A. Zulli, and A. B. Boehm, \u0026ldquo;SARS-CoV-2 surveillance in US wastewater: Leading indicators and data variability analysis in 2023\u0026ndash;2024,\u0026rdquo; \u003cem\u003ePLOS ONE\u003c/em\u003e, vol. 19, no. 11, p. e0313927, Nov. 2024, doi: 10.1371/journal.pone.0313927.\u003c/li\u003e\n\u003cli\u003eA. K. Overton \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Genomic surveillance of Canadian airport wastewater samples allows early detection of emerging SARS-CoV-2 lineages,\u0026rdquo; \u003cem\u003eSci. Rep.\u003c/em\u003e, vol. 14, p. 26534, Nov. 2024, doi: 10.1038/s41598-024-76925-6.\u003c/li\u003e\n\u003cli\u003eS. Nourbakhsh \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;A wastewater-based epidemic model for SARS-CoV-2 with application to three Canadian cities,\u0026rdquo; \u003cem\u003eEpidemics\u003c/em\u003e, vol. 39, p. 100560, Jun. 2022, doi: 10.1016/j.epidem.2022.100560.\u003c/li\u003e\n\u003cli\u003eE. Mercier \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Municipal and neighbourhood level wastewater surveillance and subtyping of an influenza virus outbreak,\u0026rdquo; \u003cem\u003eSci. Rep.\u003c/em\u003e, vol. 12, p. 15777, Sep. 2022, doi: 10.1038/s41598-022-20076-z.\u003c/li\u003e\n\u003cli\u003eR. Markt \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Expanding the Pathogen Panel in Wastewater Epidemiology to Influenza and Norovirus,\u0026rdquo; \u003cem\u003eViruses\u003c/em\u003e, vol. 15, no. 2, p. 263, Jan. 2023, doi: 10.3390/v15020263.\u003c/li\u003e\n\u003cli\u003eV. Vo \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Identification and genome sequencing of an influenza H3N2 variant in wastewater from elementary schools during a surge of influenza A cases in Las Vegas, Nevada,\u0026rdquo; \u003cem\u003eSci. Total Environ.\u003c/em\u003e, vol. 872, p. 162058, May 2023, doi: 10.1016/j.scitotenv.2023.162058.\u003c/li\u003e\n\u003cli\u003eH. Ando, W. Ahmed, R. Iwamoto, Y. Ando, S. Okabe, and M. Kitajima, \u0026ldquo;Impact of the COVID-19 pandemic on the prevalence of influenza A and respiratory syncytial viruses elucidated by wastewater-based epidemiology,\u0026rdquo; \u003cem\u003eSci. Total Environ.\u003c/em\u003e, vol. 880, p. 162694, Jul. 2023, doi: 10.1016/j.scitotenv.2023.162694.\u003c/li\u003e\n\u003cli\u003eD. Toribio-Avedillo \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Monitoring influenza and respiratory syncytial virus in wastewater. Beyond COVID-19,\u0026rdquo; \u003cem\u003eSci. Total Environ.\u003c/em\u003e, vol. 892, p. 164495, Sep. 2023, doi: 10.1016/j.scitotenv.2023.164495.\u003c/li\u003e\n\u003cli\u003eB. Hughes \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Respiratory Syncytial Virus (RSV) RNA in Wastewater Settled Solids Reflects RSV Clinical Positivity Rates,\u0026rdquo; \u003cem\u003eEnviron. Sci. Technol. Lett.\u003c/em\u003e, vol. 9, no. 2, pp. 173\u0026ndash;178, Feb. 2022, doi: 10.1021/acs.estlett.1c00963.\u003c/li\u003e\n\u003cli\u003eE. M. Mejia \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Detection of mpox virus in wastewater provides forewarning of clinical cases in Canadian cities,\u0026rdquo; \u003cem\u003eSci. Total Environ.\u003c/em\u003e, vol. 933, p. 173108, Jul. 2024, doi: 10.1016/j.scitotenv.2024.173108.\u003c/li\u003e\n\u003cli\u003eJ. Oghuan \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Wastewater analysis of Mpox virus in a city with low prevalence of Mpox disease: an environmental surveillance study,\u0026rdquo; \u003cem\u003eLancet Reg. Health - Am.\u003c/em\u003e, vol. 28, p. 100639, Nov. 2023, doi: 10.1016/j.lana.2023.100639.\u003c/li\u003e\n\u003cli\u003eI. Gir\u0026oacute;n-Guzm\u0026aacute;n \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Spanish wastewater reveals the current spread of Monkeypox virus,\u0026rdquo; \u003cem\u003eWater Res.\u003c/em\u003e, vol. 231, p. 119621, Mar. 2023, doi: 10.1016/j.watres.2023.119621.\u003c/li\u003e\n\u003cli\u003eD. A. Bowes \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Enhanced detection of mpox virus in wastewater using a pre-amplification approach: A pilot study informing population-level monitoring of low-titer pathogens,\u0026rdquo; \u003cem\u003eSci. Total Environ.\u003c/em\u003e, vol. 903, p. 166230, Dec. 2023, doi: 10.1016/j.scitotenv.2023.166230.\u003c/li\u003e\n\u003cli\u003eK. Brighton, S. Fisch, H. Wu, K. Vigil, and T. G. Aw, \u0026ldquo;Targeted community wastewater surveillance for SARS-CoV-2 and Mpox virus during a festival mass-gathering event,\u0026rdquo; \u003cem\u003eSci. Total Environ.\u003c/em\u003e, vol. 906, p. 167443, Jan. 2024, doi: 10.1016/j.scitotenv.2023.167443.\u003c/li\u003e\n\u003cli\u003eM. K. Wolfe \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Wastewater Detection of Emerging Arbovirus Infections: Case Study of Dengue in the United States,\u0026rdquo; \u003cem\u003eEnviron. Sci. Technol. Lett.\u003c/em\u003e, vol. 11, no. 1, pp. 9\u0026ndash;15, Jan. 2024, doi: 10.1021/acs.estlett.3c00769.\u003c/li\u003e\n\u003cli\u003eA. Karagoz \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Monkeypox (mpox) virus: Classification, origin, transmission, genome organization, antiviral drugs, and molecular diagnosis,\u0026rdquo; \u003cem\u003eJ. Infect. Public Health\u003c/em\u003e, vol. 16, no. 4, pp. 531\u0026ndash;541, Apr. 2023, doi: 10.1016/j.jiph.2023.02.003.\u003c/li\u003e\n\u003cli\u003e\u0026ldquo;Genus: Orthopoxvirus | ICTV.\u0026rdquo; Accessed: Nov. 25, 2024. [Online]. Available: https://ictv.global/report/chapter/poxviridae/poxviridae/orthopoxvirus\u003c/li\u003e\n\u003cli\u003eJ. Quick, \u0026ldquo;nCoV-2019 sequencing protocol,\u0026rdquo; Jan. 2020, Accessed: Feb. 06, 2025. [Online]. Available: https://www.protocols.io/view/ncov-2019-sequencing-protocol-bbmuik6w\u003c/li\u003e\n\u003cli\u003eJ. R. Tyson \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Improvements to the ARTIC multiplex PCR method for SARS-CoV-2 genome sequencing using nanopore,\u0026rdquo; \u003cem\u003eBioRxiv Prepr. Serv. Biol.\u003c/em\u003e, p. 2020.09.04.283077, Sep. 2020, doi: 10.1101/2020.09.04.283077.\u003c/li\u003e\n\u003cli\u003eY. Li, H. Zhao, K. Wilkins, C. Hughes, and I. K. Damon, \u0026ldquo;Real-time PCR assays for the specific detection of monkeypox virus West African and Congo Basin strain DNA,\u0026rdquo; \u003cem\u003eJ. Virol. Methods\u003c/em\u003e, vol. 169, no. 1, pp. 223\u0026ndash;227, Oct. 2010, doi: 10.1016/j.jviromet.2010.07.012.\u003c/li\u003e\n\u003cli\u003eR. A. Maksyutov, E. V. Gavrilova, and S. N. Shchelkunov, \u0026ldquo;Species-specific differentiation of variola, monkeypox, and varicella-zoster viruses by multiplex real-time PCR assay,\u0026rdquo; \u003cem\u003eJ. Virol. Methods\u003c/em\u003e, vol. 236, pp. 215\u0026ndash;220, Oct. 2016, doi: 10.1016/j.jviromet.2016.07.024.\u003c/li\u003e\n\u003cli\u003eA. Forootan, R. Sj\u0026ouml;back, J. Bj\u0026ouml;rkman, B. Sj\u0026ouml;green, L. Linz, and M. Kubista, \u0026ldquo;Methods to determine limit of detection and limit of quantification in quantitative real-time PCR (qPCR),\u0026rdquo; \u003cem\u003eBiomol. Detect. Quantif.\u003c/em\u003e, vol. 12, pp. 1\u0026ndash;6, Apr. 2017, doi: 10.1016/j.bdq.2017.04.001.\u003c/li\u003e\n\u003cli\u003eH. Wickham \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Welcome to the Tidyverse,\u0026rdquo; \u003cem\u003eJ. Open Source Softw.\u003c/em\u003e, vol. 4, no. 43, p. 1686, Nov. 2019, doi: 10.21105/joss.01686.\u003c/li\u003e\n\u003cli\u003eW. Li and A. Godzik, \u0026ldquo;Cd-hit: a fast program for clustering and comparing large sets of protein or nucleotide sequences,\u0026rdquo; \u003cem\u003eBioinformatics\u003c/em\u003e, vol. 22, no. 13, pp. 1658\u0026ndash;1659, Jul. 2006, doi: 10.1093/bioinformatics/btl158.\u003c/li\u003e\n\u003cli\u003eK. Katoh and D. M. Standley, \u0026ldquo;MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability,\u0026rdquo; \u003cem\u003eMol. Biol. Evol.\u003c/em\u003e, vol. 30, no. 4, pp. 772\u0026ndash;780, Apr. 2013, doi: 10.1093/molbev/mst010.\u003c/li\u003e\n\u003cli\u003eJ. Quick \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Multiplex PCR method for MinION and Illumina sequencing of Zika and other virus genomes directly from clinical samples,\u0026rdquo; \u003cem\u003eNat. Protoc.\u003c/em\u003e, vol. 12, no. 6, pp. 1261\u0026ndash;1276, Jun. 2017, doi: 10.1038/nprot.2017.066.\u003c/li\u003e\n\u003cli\u003eM. Kearse \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data,\u0026rdquo; \u003cem\u003eBioinformatics\u003c/em\u003e, vol. 28, no. 12, pp. 1647\u0026ndash;1649, Jun. 2012, doi: 10.1093/bioinformatics/bts199.\u003c/li\u003e\n\u003cli\u003eS. Khare \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;GISAID\u0026rsquo;s Role in Pandemic Response,\u0026rdquo; \u003cem\u003eChina CDC Wkly.\u003c/em\u003e, vol. 3, no. 49, pp. 1049\u0026ndash;1051, Dec. 2021, doi: 10.46234/ccdcw2021.255.\u003c/li\u003e\n\u003cli\u003eM. Martin, \u0026ldquo;Cutadapt removes adapter sequences from high-throughput sequencing reads,\u0026rdquo; \u003cem\u003eEMBnet.journal\u003c/em\u003e, vol. 17, no. 1, Art. no. 1, May 2011, doi: 10.14806/ej.17.1.200.\u003c/li\u003e\n\u003cli\u003eI. Aksamentov, C. Roemer, E. B. Hodcroft, and R. A. Neher, \u0026ldquo;Nextclade: clade assignment, mutation calling and quality control for viral genomes,\u0026rdquo; \u003cem\u003eJ. Open Source Softw.\u003c/em\u003e, vol. 6, no. 67, p. 3773, Nov. 2021, doi: 10.21105/joss.03773.\u003c/li\u003e\n\u003cli\u003eH. Patel \u003cem\u003eet al.\u003c/em\u003e, \u003cem\u003enf-core/viralrecon: nf-core/viralrecon v2.6.0 - Rhodium Raccoon\u003c/em\u003e. (Mar. 23, 2023). Zenodo. doi: 10.5281/zenodo.7764938.\u003c/li\u003e\n\u003cli\u003eS. F. Altschul, W. Gish, W. Miller, E. W. Myers, and D. J. Lipman, \u0026ldquo;Basic local alignment search tool,\u0026rdquo; \u003cem\u003eJ. Mol. Biol.\u003c/em\u003e, vol. 215, no. 3, pp. 403\u0026ndash;410, Oct. 1990, doi: 10.1016/S0022-2836(05)80360-2.\u003c/li\u003e\n\u003cli\u003eD. E. Wood, J. Lu, and B. Langmead, \u0026ldquo;Improved metagenomic analysis with Kraken 2,\u0026rdquo; \u003cem\u003eGenome Biol.\u003c/em\u003e, vol. 20, no. 1, p. 257, Nov. 2019, doi: 10.1186/s13059-019-1891-0.\u003c/li\u003e\n\u003cli\u003eF. P. Breitwieser and S. L. Salzberg, \u0026ldquo;Pavian: interactive analysis of metagenomics data for microbiome studies and pathogen identification,\u0026rdquo; \u003cem\u003eBioinforma. Oxf. Engl.\u003c/em\u003e, vol. 36, no. 4, pp. 1303\u0026ndash;1304, Feb. 2020, doi: 10.1093/bioinformatics/btz715.\u003c/li\u003e\n\u003cli\u003eB. Q. Minh \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;IQ-TREE 2: New Models and Efficient Methods for Phylogenetic Inference in the Genomic Era,\u0026rdquo; \u003cem\u003eMol. Biol. Evol.\u003c/em\u003e, vol. 37, no. 5, pp. 1530\u0026ndash;1534, May 2020, doi: 10.1093/molbev/msaa015.\u003c/li\u003e\n\u003cli\u003eS. Kalyaanamoorthy, B. Q. Minh, T. K. F. Wong, A. von Haeseler, and L. S. Jermiin, \u0026ldquo;ModelFinder: fast model selection for accurate phylogenetic estimates,\u0026rdquo; \u003cem\u003eNat. Methods\u003c/em\u003e, vol. 14, no. 6, pp. 587\u0026ndash;589, Jun. 2017, doi: 10.1038/nmeth.4285.\u003c/li\u003e\n\u003cli\u003eD. T. Hoang, O. Chernomor, A. von Haeseler, B. Q. Minh, and L. S. Vinh, \u0026ldquo;UFBoot2: Improving the Ultrafast Bootstrap Approximation,\u0026rdquo; \u003cem\u003eMol. Biol. Evol.\u003c/em\u003e, vol. 35, no. 2, pp. 518\u0026ndash;522, Feb. 2018, doi: 10.1093/molbev/msx281.\u003c/li\u003e\n\u003cli\u003eI. Letunic and P. Bork, \u0026ldquo;Interactive Tree of Life (iTOL) v6: recent updates to the phylogenetic tree display and annotation tool,\u0026rdquo; \u003cem\u003eNucleic Acids Res.\u003c/em\u003e, vol. 52, no. W1, pp. W78\u0026ndash;W82, Jul. 2024, doi: 10.1093/nar/gkae268.\u003c/li\u003e\n\u003cli\u003eS. A. Bustin \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments,\u0026rdquo; \u003cem\u003eClin. Chem.\u003c/em\u003e, vol. 55, no. 4, pp. 611\u0026ndash;622, Apr. 2009, doi: 10.1373/clinchem.2008.112797.\u003c/li\u003e\n\u003cli\u003ePublic Health Agency of Canada, \u0026ldquo;Mpox epidemiology update \u0026mdash; Canada.ca.\u0026rdquo; Accessed: Mar. 26, 2025. [Online]. Available: https://health-infobase.canada.ca/mpox/\u003c/li\u003e\n\u003cli\u003eS. Isabel \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Targeted amplification-based whole genome sequencing of Monkeypox virus in clinical specimens,\u0026rdquo; \u003cem\u003eMicrobiol. Spectr.\u003c/em\u003e, vol. 12, no. 1, pp. e02979-23, doi: 10.1128/spectrum.02979-23.\u003c/li\u003e\n\u003cli\u003eA. Steedman and M. Zeller, \u0026ldquo;MPXV Sequencing from Wastewater (Illumina) V1.0.\u0026rdquo; Accessed: Mar. 26, 2025. [Online]. Available: https://www.protocols.io/view/mpxv-sequencing-from-wastewater-illumina-v1-0-dyzv7x66\u003c/li\u003e\n\u003cli\u003e\u0026ldquo;ARTIC/INRB MPXV Wastewater Sequencing Primer Scheme.\u0026rdquo; Accessed: Mar. 26, 2025. [Online]. Available: https://labs.primalscheme.com/detail/artic-inrb-mpox/400/v1.0.0/?q=\u003c/li\u003e\n\u003cli\u003eT. T. Vi \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;A serotype-specific and tiled amplicon multiplex PCR method for whole genome sequencing of dengue virus,\u0026rdquo; \u003cem\u003eJ. Virol. Methods\u003c/em\u003e, vol. 328, p. 114968, Jul. 2024, doi: 10.1016/j.jviromet.2024.114968.\u003c/li\u003e\n\u003cli\u003eJ. Quick \u003cem\u003eet al.\u003c/em\u003e, \u0026ldquo;Real-time, portable genome sequencing for Ebola surveillance,\u0026rdquo; \u003cem\u003eNature\u003c/em\u003e, vol. 530, no. 7589, pp. 228\u0026ndash;232, Feb. 2016, doi: 10.1038/nature16996.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Tiled amplicon sequencing, MPOX, Wastewater, Monkeypox virus","lastPublishedDoi":"10.21203/rs.3.rs-6347660/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6347660/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eWastewater-based surveillance (WBS) has modernized in recent years and emerged as an important tool for the monitoring of viral pathogens, including monkeypox virus (MPXV). Here we describe a novel targeted amplicon sequencing method developed for clade and subclade characterization of MPXV from municipal wastewater. This new method addresses the limitations of PCR-based methods and the challenges of sequencing a pathogen displaying low viral load in municipal wastewater samples. A tiled amplicon scheme composed of 11 primer pairs targeting a 4.2 kb portion of the inverted terminal repeat (ITR) region of the MPXV genome was designed and tested. \u003cem\u003eIn silico\u003c/em\u003e analysis demonstrated high accuracy for clade and subclade calls using the full target region, with specific amplicons also exhibiting strong performance individually. An MPXV consensus sequence representing the entire target region was successfully sequenced from a wastewater sample and differentiated from positive controls by a distinct deletion within a short homopolymeric region. Notably, clade-informing data was also achieved from partial sequences recovered from lower abundance samples. This study presents a new sequencing method targeting MPXV with enhanced genomic resolution compared to existing PCR-based approaches, providing critical genomic-level information informing MPXV surveillance and public health interventions.\u003c/p\u003e","manuscriptTitle":"Tiled amplicon sequencing of monkeypox virus from wastewater: a novel approach for clade and subclade level differentiation","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-05-05 16:29:17","doi":"10.21203/rs.3.rs-6347660/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-06-02T05:18:39+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-05-12T23:40:43+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"17135565351853128265021734020394442501","date":"2025-05-02T12:28:15+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-05-01T17:30:09+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"33890570975742314449168179896944471101","date":"2025-05-01T07:37:51+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-04-30T00:54:57+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-04-22T13:16:50+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-04-22T12:06:09+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-04-22T03:47:56+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-03-31T20:25:21+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e75f0dbe-1808-436d-bb92-9c8f78e87db3","owner":[],"postedDate":"May 5th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":47994010,"name":"Biological sciences/Molecular biology"},{"id":47994011,"name":"Health sciences/Diseases/Infectious diseases"},{"id":47994012,"name":"Health sciences/Diseases/Infectious diseases/Viral infection"},{"id":47994013,"name":"Biological sciences/Biological techniques/Genomic analysis/Comparative genomics"}],"tags":[],"updatedAt":"2025-08-18T15:58:20+00:00","versionOfRecord":{"articleIdentity":"rs-6347660","link":"https://doi.org/10.1038/s41598-025-13927-y","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-08-11 15:56:50","publishedOnDateReadable":"August 11th, 2025"},"versionCreatedAt":"2025-05-05 16:29:17","video":"","vorDoi":"10.1038/s41598-025-13927-y","vorDoiUrl":"https://doi.org/10.1038/s41598-025-13927-y","workflowStages":[]},"version":"v1","identity":"rs-6347660","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6347660","identity":"rs-6347660","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00